02 la informació genètica

Download 02   la informació genètica

Post on 20-Jul-2015




4 download

Embed Size (px)


<ul><li><p>LA INFORMACI GENTICATEMA 2</p></li><li><p>ELS CIDS NUCLEICSEls cids nucleics emmagatzemen i transmeten la informaci gentica. Sn macromolcules formades per la uni dunes unitats ms senzilles anomenades nucletids.</p></li><li><p>Un nucletid est format per tres subunitats: </p><p> un grup fosfat fsfor i oxigen. (cid ortofosfric)</p><p> un glcid - un monosacrid (ribosa o desoxiribosa) 5 toms de carboni (pentosa)</p><p> una base nitrogenada: Adenina (A), Guanina (G), Citosina (C), Timina (T) i Uracil (U) </p></li><li><p>TIPUS DE BASES NITROGENADES</p><p>Priques - 2 anells - Adenina i Guanina)</p><p>Pirimidniques - 1 anell - Citosina, Timina i lUracil)</p></li><li><p>Els polinucletidsFormen llargues cadenesLcid fosfric dun nucletid est unit a la pentosa del segent per mitj dun enllaEn cada polinucletid el grup fosfat i la pentosa sn sempre iguals, per varia la seqncia de bases nitrogenades.</p><p>La gran longitud de les cadenes de polinucletids i les mltiples combinacions segons les quals es poden ordenar les bases nitrogenades fan que el nombre de molcules diferents d'cids nucleics sigui gaireb infinit.</p></li><li><p>per la T noms a lADN </p><p>i lU noms a lARN</p><p>CIDS NUCLEICS: </p><p>ADN i ARN, que sn polmers formats per la uni de unes unitats bsiques anomenades nucletids.A, G i C es troben tant a lARN com a lADN,</p></li><li><p>LADNLADN va ser allat per primera vegada el 1869 per Friederich Miescher, contemporani als estudis de Mendel i Darwin.</p><p>Lany 1914, Feulgen, va veure que lADN es trobava a totes les cllules i en els cromosomes.</p><p>Lany 1943, Avery et al, va descobrir que lADN duna soca virulenta dun bacteri es podria transmetre a una soca no virulenta i canviar el seu comportament patolgic.</p><p>Ms tard es va veure la importncia dels cromosomes en les cllules somtiques (diploides) i les cllules sexuals (haploides)</p><p>Conclusions: LADN varia entre espcies les cllules dun teixit tenen el mateix ADN lADN no varia ni amb ledat, nutrici ... PER EL LLENGUATGE GENTIC S IDNTIC PER A TOTS ELS SSERS VIUS!!!!!!!!!!!!!!</p></li><li><p>LADN cont tota la informaci necessria perqu un sser viu funcioni i es desenvolupi.Watson i Crick proposaren un model que estigus dacord amb els coneixements sobre el comportament i propietats de lADN.Caractersitques: </p><p> LADN s un molcula molt llarga i prima formada per dues cadenes de polinucletids.</p><p> lADN forma una doble hlix, on les pentoses i els grups fosfat formen lesquelet extern de lespiral i les bases nitrogenades es disposen a linterior.</p><p> les dues cadenes de lADN no sn idntiques, tenen sentits oposats (antiparalleles)</p><p> les bases nitrogenades enfrontades estableixen ponts dhidrogen (dos ponts entre A i T i 3 ponts entre G i C) </p></li><li><p>ADN: </p><p>n bases purines = n bases pirimidines </p><p>i el n A = n T i el n C = n GLa seqncia de bases nitrogenades duna de les cadenes determina la seqncia de laltrahttp://recursos.cnice.mec.es/biosfera/alumno/2bachillerato/biomol/actividades/videoadn/adn.htm </p></li><li><p>LARNLARN s una macromolcula formada per la uni de nucletids (ribosa + ac fosfric + bases nitrogenades (A,U,C,G)</p><p>LARN participa en lexpressi de la informaci que cont lADN per mitj de la sntesi de protenes, que sn les que regulen la majoria de processos vitals dun organisme.</p><p>La majoria de molcules que formen lARN sn monocatenries, tot i que aquesta nica cadena pot formar una doble hlix doblegant-se sobre si mateixa.</p><p>Alguns virus tenen lARN com a nica molcula de magatzem de la seva informaci gentica (virus de la sida)</p></li><li><p> ARNm (missatger) que s una fotocpia dun tros dADN i on sexplica la construcci duna protena</p><p> ARNt (transferncia) interv en la traducci de lARNm i en la uni dels aminocids</p><p>ARNr (ribosmic) forma part dels ribosomes, orgnuls de la sntesi protecaExisteixen tres tipus bsics dARN:</p></li><li><p>LADN T LA CAPACITAT DE REPLICAR-SE, S A DIR, POT FER CPIES IDNTIQUES DE SI MATEIX.Abans que una cllula comenci a dividir-se ha de duplicar el seu ADN (REPLICACI) i sintetitzar una gran quantitat dhistones, per tal de formar els cromosomes fills</p><p>La rplica s un procs que t lloc una sola vegada en cada generaci cellular i es produeix al final de la interfase a una velocitat de 50 nucletids per segon (mamfers)</p><p>Existeixen 3 mecanismes possibles de replica:</p><p> hiptesi conservativa</p><p> hiptesi semiconservativa (+ acceptada)</p><p> hiptesi dispersiva</p></li><li><p> la replicaci comena amb el trencament del ponts dhidrogen que uneixen les bases nitrogenades. Aix provoca la separaci dels dos filaments dADN. cada cadena parental es transforma en un motlle per a la sntesi duna nova cadena complementria. Uns enzims sencarreguen de llegir la cadena parental i de la uni dels nucletids complementaris. a mesura que es van formant les noves cadenes, sestableixen novament els ponts dhidrogen i els filaments es van enrotllant. El resultat sn dues molcules dADN iguals entre si i a la molcula original.</p></li><li><p>REPLICACI: fotocpia dell mateix</p></li><li><p>CCATCGCTAAAGCGTGGAFORQUETA DE REPLICACIADN polimerasa en direcci 5 3TCCACGCTTTAGCGATGGADN lligasa</p></li><li><p>La reacci fonamental per a laddici dels nucletids, s la funci que fa lenzim ADN polimerasa 5- 3, unint les pentoses a lextrem 3 duna cadena de DNA.forquilla de replicaci 5 3 FILAMENT CONDUCTORFILAMENT RETARDAT fragments de Okazaki - ADN lligasa</p></li><li><p>Replicacions successives dADNTOTES TENEN LA MATEIXA INFORMACIENZIMS REPARADORS (en cas derror daparellament de nucletids)Les dues cadenes dADN formaran cada una, la cromtida germana dun cromosoma.</p></li><li><p>LADN, PORTADOR DE LA INFORMACI GENTICA</p><p>A finals del S XIX era ja conegut que la informaci gentica residia en el nucli de la cllula, per es creia que les protenes, per la seva complexitat, eren les responsables del seu emmagatzematge. </p></li><li><p>LEXPERIMENT DE GRIFFITHUn factor transformant present en la soca S virulenta morta es transmetia a la soca R viva inofensiva i la convertia en soca S virulenta</p></li><li><p>LEXPLICACI DAVERYLa substncia encarregada de transformar els bacteris inofensius en virulents era lADN, que determinava la producci o no de la cpsula bacteriana.De tots els ssers vius!!!</p></li><li><p>EL CONCEPTE DE GEN</p><p>Cada sser viu presenta uns trets caracterstics, trets que anomenem CARCTER.</p><p>Els carcters sn heretats dels progenitors, per poden tenir una clara INFLUNCIA AMBIENTAL.</p><p>Sanomena gen la unitat funcional dels cromosomes que correspon a un segment determinat dADN, el qual cont una informaci concreta i determinada (carcter). </p></li><li><p>EXPERIMENT DE BEADLE I TATUMUN GEN UN ENZIM ( UN GEN ---- UNA PROTENA )Actualment, des del punt de vista de la funci que porta a terme, un gen es defineix com un fragment de lADN que duu la informaci per sintetitzar una protena, necessria perqu sexpressi un carcter determinat en un individu.The Nobel Prize in Physiology or Medicine 1958Els rajos X provoquen mutacions en els enzims de les diferents rutes metabliques de Neurospora crassa</p></li><li><p>LESTRUCTURA DEL GENOMANo tots el GENS codifiquen per a protenes, ja que molts gens sencarreguen de regular lactivitat daltres gens.A ms, lADN posseeix fragments dels quals sen desconeix la seva funci.El conjunt del material gentic dun individu sanomena GENOMA.</p></li><li><p>CURIOSITATS DEL NOSTRE ADNCada cllula del nostre cos disposa dun nucli que en el seu interior t dues molcules dADN, o sigui som individus diploides, on una informaci ve del pare i laltre de la mare. Aquesta molcula dADN tindria una llargria de 2,5 metres, per la trobem 25000 vegades replegada dins del nucli de la nostra cllula eucariota. Si escrivssim totes les bases amb les seves lletres respectives aconseguirem una lnia de 5000 Km, o sigui la distncia entre Catalunya i Nova York. Si fabriqussim llibres arribarem a omplir ms de 3000 guies telefniques.</p></li><li><p>CURIOSITATS DEL NOSTRE ADN (II)LADN que ens informa sobre les protenes noms representa un 3% de tota la molcula, o sigui noms un 3% sestima que sn gens. Normalment es parla que en lADN hi ha entre 50000 i 100000 gens, tot i que actualment no hi ha mecanismes informtics eficaos per llegir la seqenciaci que sha obtingut amb el projecte del genoma hum. Shan trobat gens que estan formats per menys de 100 nucletids, per tant cercar-los en mig de tanta quantitat de bases s molt dificults. A ms a ms els gens comencen de formes molt peculiars, fins i tot es sobreposen els uns amb els altres, o sincorporen en introns daltres gens. </p></li><li><p>EL GENOMA EN ELS DIFERENTS TIPUS DE CLLULES en els organismes procariotes, el genoma est format per un sol cromosoma circular. Alguns bacteris, a ms, disposen de plasmidis, que sn molcules dADN circulars que es repliquen de manera independent al cromosoma bacteri.</p></li><li><p> en els organismes eucariotes, la major part del genoma constitueix la cromatina, localitzada al nucli de la cllula. Una latra part de lADN es troba als cloroplasts i als mitocondris, i t una estructura semblant al cromosoma bacteri.</p></li><li><p>LES MUTACIONS El material gentic es transmet sense modificacions de generaci en generaciLes mutacions sn canvis aleatoris que tenen lloc en lADN dun organisme. Constitueixen una font de variabilitat gentica i un motor per a levoluci de les espcies.Mutacions espontnies (causes naturals error en la duplicaci ADN, mal repartiment dels cromosomes en la divisi cellular)Mutacions indudes (agents fsics o qumics, radiacions Agents mutagnics)</p></li><li><p>Mutaci en la Drosophila melanogasterUna mutaci dun gen provocada per una mala seqenciaci de lADN, pot conduir a la inactivaci de la protena que especificava el gen en qesti, i depenent de la seva importncia, pot conduir a la mort de la cllula, seguida de la desaparici de la mutaci en el futur (MUTACI PERJUDICIAL MUTACI LETAL)</p><p>En canvi, si la mutaci s en una regi no-essencial, persistir en el temps, anomenant-se (MUTACI SILENCIOSA). </p><p>En casos excepcionals la mutaci de la protena pot ser beneficiosa, fent que els organismes portadors de la mutaci tinguin un avantatge respecte als que no la tenen, i per tant ms probabilitats de sobreviure (MUTACI BENEFICIOSA). </p><p>SEGONS LEFECTE SOBRE LINDIVIDU</p></li><li><p>Les conseqncies daquests errors poden ser dobles: </p><p>o lerror en un cllula somtica i a la prpia descendncia de la cllula en qesti (MUTACI SOMTICA). Poden originar lesions o malalties greus com el cncer.</p><p>lerror es troba en els gmetes. Lindividu no la pateix per pot passar a la descendncia (MUTACI GAMTICA O GERMINAL), </p><p>.SEGONS EL TIPUS DE CLLULES AFECTADES</p></li><li><p>SEGONS LEXTENSI DEL MATERIAL GENTIC AFECTAT gniques: canvis en la seqncia de nucletids dun gen (m. hereditries) genmiques: variaci en el nombre total de cromosomes del cariotip (m. numrica) cromosmiques: canvis en lestrutura interna dels cromosomes (m. estructural)duplicacions o prdues de fragments dun determinat cromosoma. Daltres vegades el cromosoma pot trencar-se en trossos. </p><p>Exemple: delacci dun cromosomaExemple: sndrome de Down o trisomia del cromosoma 21</p><p>Exemples: fibrosi qustica, anmia falciforme, polidactlia...</p></li><li><p>La PROGRIASndrome de Hutchinson-Gilford Pgina web: www.progeriaresearch.org Ashley quan tenia 7 anys; per el seu cos s com si en tingus 70.</p></li><li><p>Es considera una malaltia gentica estranya, que pateix un infant de cada 8 milions de bebs. Els nens pateixen un deficient creixement, amb un cos petit acompanyat dun cap gran, pell arrugada i calvcie. Molts dells presenten aterosclerosi.Aquests nens i nenes acaben tenint totes les patologies tpiques de la gent gran, com ara artrosis, problemes respiratoris, emblies...A ledat de ladolescncia solen morir, tot i que alguns arriben als 30 anys La PROGRIA o Sndrome de Hutchinson-Gilford</p><p>Malaltia provocada per la mutaci dun gen que en condicions normals hauria de fabricar una protena </p><p>s una malaltia que sinicia a la infantesa i que provoca un envelliment rpid del nen o nena. </p></li><li><p>La molcula dADN cont un codi amb instruccions per a lestructura i funci biolgiques. Aquestes instruccions sn executades per les protenes, amb el seu propi llenguatge a partir dels aa, seqncia que determina la seva estructura i la seva funci.</p><p>Falta doncs determinar qui s el responsable de traduir lADN a la seqncia daa que determinar una protena concreta. </p><p>Aqu entre ej joc lARN, una molcula present en els orgnuls anomenats ribosomes, localitzats en el citoplasma cellular, lloc on es produeix la major part de la sntesi proteca. Lintermediari entre ADN i ribosomes ser lARN missatger.</p></li><li><p>LA INFORMACI GENTICAEls cids nucleics i les protenes es basen en dos llenguatges diferents.LADN est escrit en un llenguatge de quatre lletres (A;T;G;C), on cadascuna de les quals correspon a un nucletid.Les protenes utilitzen els vint aminocids com a unitats elementals</p></li><li><p>ELS TRIPLETS O CODONSLa informaci que cont lADN est organitzada en forma de triplets. Cada triplet constitueix una de les possibles combinacions de tres nucletids.Un gen no sintetitza de forma directa un polipptid, cal doncs una descodificaci prvia dels triplets o codons i la formaci dun ARNm</p></li><li><p>La transcripciLa transcripci s el procs a partir del qual se sintetitza una cadena dARNm, que s la cpia duna de les dues cadenes dADN. </p><p>ARN polimerasa separa la doble hlix dADN i transcriu segons el principi de complementarietat de bases.</p><p>LARNm t una llargada de 500 a 10.000 nuceltids i s monocatenria. En lARNm la Timina s substituda per lUracil. </p><p>Seqncies especfiques de nucletids dADN sn senyals diniciaci per a la sntesi dARNm, sn els anomenats promotors. Altres seqncies indiquen el senyal de finalitzaci.</p><p>LARNm uneix els nous nucletids a lextrem 3 de la cadena en creixement. Lenzim es mou en direcci 3 5 de lADN que fa de motlle i fabrica una nova cadena dARN antiparallela 5 --- 3. </p></li><li><p>TRANSCRIPCI: conversi a ARN</p></li><li><p>CCAUCGCUAAAGCGUGGAUCCACGCUUUAGCGAUGGFORQUETA DE TRANSCRIPCIARN missatger: les oracions del genoma ARN polimerasa 5 --- 3</p></li><li><p>La traducciLa traducci consisteix en la sntesi de la protena, amb la qual cosa els aa es disposen en lordre que ve definit per la seqncia de codons de lARNm</p><p>Aquest procs requereix altres tipus dARN: </p><p> ARN ribosmic: els ribosomes estan formats per dues subunitats, una de gran i una de petita. La subunitat petita t un lloc duni per lARNm</p><p> ARN de transferncia: aquestes molcules sn com el diccionari a partir del qual es tradueix el llenguatge dels cids nucleics al llenguatge de les protenes. Hi ha ms de 20 tipus de ARNt.</p></li><li><p>El codi gentic s UNIVERSALAra ja noms queda per resoldre la correspondncia entre els aa i la seqncia de bases de lARN.</p><p>Les protenes contenen 20 aa diferents, per lADN i lARN noms tenen 4 nucletids diferents. Calen doncs combinacions de com a mnim tres nucletids per definir els diferents aa (4x4x4=64), els anomenats triplets o codons</p><p>En lARNt trobem: </p><p> lanticod que sacoblar al cod de la molcula dARNm</p><p> lextrem 3 on shi acobla un aa particular -CCA a partir dun enzim especfic aminoacil-ARNt-sintetasa</p></li><li><p>Dels 64 codons possibles, 61 especifiquen aa particulars i 3 sn signes de finalitzaci. Aquest fet implica que hi ha ms dun triplet per a cada aa. Es diu que el codi gentic s degenerat ja que t codons sinnimsEL MISSATGE GENTIC ES LLEGEIX SEMPRE EN SENTIT 5- 3 TRIPLET DINICI</p></li><li><p>UCCACGCUUUAGCGAUGGCODONS: les paraules del llenguatge gentic = AMINOCID</p></li><li><p>IniciaciAquesta etapa comena quan la subunitat petita del ribosoma suneix a una cadena dARNm prop de lextrem 5 i exposa el seu primer cod anomenat cod iniciador. </p><p>A continuaci el primer A...</p></li></ul>