ORIGINAL PAPER

Overexpression of an adenosine diphosphate-ribosylation factorgene from the halophytic grass Spartina alterniflora conferssalinity and drought tolerance in transgenic Arabidopsis

Ratna Karan • Prasanta K. Subudhi

Received: 18 September 2013 / Revised: 21 October 2013 / Accepted: 2 November 2013

� Springer-Verlag Berlin Heidelberg 2013

Abstract

Key message Isolation, cloning, and expression char-

acterization of an ARF gene from S. alterniflora, dem-

onstrating its involvement in abiotic stress tolerance.

Abstract Adenosine diphosphate-ribosylation factors

(ARFs) are small guanine nucleotide-binding proteins that

play an important role in intracellular protein trafficking

necessary for undertaking multiple physiological functions

in plant growth and developmental processes. However,

little is known about the mechanism of ARF functioning at

the molecular level, as well as its involvement in abiotic

stress tolerance. In this study, we demonstrated the direct

involvement of an ARF gene SaARF from a grass halo-

phyte Spartina alterniflora in abiotic stress adaptation for

the first time. SaARF, which encodes a protein with pre-

dicted molecular mass of 21 kDa, revealed highest identity

with ARF of Oryza sativa. The SaARF gene is transcrip-

tionally regulated by salt, drought, cold, and ABA in the

leaves and roots of S. alterniflora. Arabidopsis plants

overexpressing SaARF showed improved seed germination

and survival of seedlings under salinity stress. Similarly,

SaARF transgenic Arabidopsis plants were more tolerant to

drought stress, compared to wild-type plants, by main-

taining chlorophyll synthesis, increasing osmolyte synthe-

sis, and stabilizing membrane integrity. Oxidative damage

due to moisture stress in transgenic Arabidopsis was also

reduced possibly by activating antioxidant genes, AtSOD1

and AtCAT. Our results suggest that enhanced drought and

salinity tolerance conferred by the SaARF gene may be due

to its role in mediating multiple abiotic stress tolerance

mechanisms.

Keywords Abiotic stress �ADP-ribosylation factor �Gene expression � GTP-binding protein � Halophyte �Transgenic Arabidopsis

Introduction

Adenosine diphosphate (ADP)-ribosylation factors (ARFs)

are small guanosine triphosphate (GTP) binding proteins

belonging to the Ras-like GTPase superfamily, which is

divided into several major subfamilies, including Ras, Rab,

Rho, Ran, Arf, and others (Zerial and Huber 1995). ARF is

a protein with a molecular mass of 21 kDa and was first

identified as a cofactor required for cholera toxin-mediated

ADP ribosylation of a trimeric G protein a-chain from the

cholate extracts of rabbit liver membranes (Kahn and

Gilman 1984). Extensive studies conducted in mammalian

and yeast systems led to the elucidation of the role of ARF

in regulating a diverse array of cellular and physiological

functions, such as the regulation of intracellular membrane

traffic (Balch et al. 1992), the actin cytoskeleton (D’Souza-

Schorey and Chavrier 2006), and organelle structure

(Donaldson and Jackson 2000).

Communicated by J. S. Shin.

Electronic supplementary material The online version of thisarticle (doi:10.1007/s00299-013-1537-8) contains supplementarymaterial, which is available to authorized users.

Present Address:

R. Karan

Agronomy Department, Institute of Food and Agricultural

Sciences, University of Florida, Gainesville, FL 32611, USA

P. K. Subudhi (&)

School of Plant, Environmental, and Soil Sciences, Louisiana

State University Agricultural Center, 104 Sturgis Hall, Baton

Rouge, LA 70803, USA

e-mail: psubudhi@agcenter.lsu.edu

123

Plant Cell Rep

DOI 10.1007/s00299-013-1537-8

ARFs are best known as GTP-dependent switches for

the assembly/disassembly of the coat proteins driving

vesicle budding. Guanosine diphosphate (GDP)-bound

ARF is inactive and remains in cytosol, whereas GTP-

bound ARF is activated by specific guanine nucleotide

exchange factor (GEF) and then interacts with downstream

effector proteins to regulate various cellular processes

(Gillingham and Munro 2007). Subsequently, the GTP

bound to ARF is hydrolyzed to GDP by GTPase-activating

protein (GAP), and ARF-GDP is released from the mem-

branes to facilitate docking and fusion of the vesicles with

target membranes (Donaldson and Jackson 2000; Inoue and

Randazzo 2007). GTP-ARF recruits coat proteins from the

cytosol and helps in the budding of specific membrane-

bound receptors and cargo molecules to facilitate vesicle

trafficking (Pimpl et al. 2000; Yahara et al. 2001). ARF

proteins act as regulators of vesicle-mediated protein traf-

ficking and activators of phospholipase D (Jones et al.

1999).

Studies in higher plants have shown that ARFs play a

role in regulating intracellular transport (Ritzenthaler et al.

2002), mitosis, and the cell cycle (McElver et al. 2000).

ARFs are also implicated in many physiological functions,

such as seed development (Tzafrir et al. 2002), auxin

transport (Geldner et al. 2003), epidermal cell polarity (Xu

and Scheres 2005), endocytosis (Naramoto et al. 2010),

flowering, and apical dominance (Gebbie et al. 2005). ARF

genes have been isolated and characterized in many crop

plants (potato—Szopa and Muller-Rober 1994; rice—Higo

et al. 1994; carrot—Asakura et al. 2007; maize—Verwoert

et al. 1995; wheat—Kobayashi-Uehara et al. 2001). The

preferential expression of ARF has been reported in dif-

ferent organs of carrot, wheat, and physic nut (Asakura

et al. 2007; Yao et al. 2009; Qin et al. 2011). Its increased

expression has been observed in postharvest ripening fruit

of banana (Wang et al. 2010), potato tubers (Liu et al.

2012), and early stages of endosperm development in

maize and rice (Liu et al. 2010; Zhou et al. 2010). ARFs

have been also reported to be involved in disease response

(Lee et al. 2003; Lee and Sano 2007; Coemans et al. 2008).

In carrot and physic nut, differential expression of the ARF

gene in response to environmental stresses has been

reported (Asakura et al. 2007; Qin et al. 2011). However,

there is no report till date that demonstrates the direct

involvement of the ARF gene in conferring tolerance to

abiotic stresses.

Salinity and drought are two major abiotic stresses that

pose serious threats to world food security. Plant growth,

development, and productivity are adversely affected due

to dysfunctions in cellular machinery caused by these

disturbances (Knight and Knight 2001). Plants have

developed complex adaptive genetic mechanisms to

respond to these environmental disturbances (Zhu 2002;

Nakashima et al. 2009). Compared with crop plants, which

are vulnerable to abiotic stresses, halophytes adapt well

under extreme environmental conditions due to their

superior stress tolerance mechanisms (Bressan et al. 2013).

A halophyte grass Spartina alterniflora, commonly known

as smooth cordgrass and possessing all known mechanisms

of salt tolerance, has been used as a model to mine useful

salt stress-responsive genes (Subudhi and Baisakh 2011).

Several studies have demonstrated the utility of genes from

this halophyte to improve abiotic stress tolerance (Baisakh

et al. 2012; Karan and Subudhi 2012a, b). In the present

investigation, we characterized ‘SaARF’, an ADP-ribosyl-

ation factor gene from this grass halophyte and studied the

effect of abiotic stress on its transcriptional regulation, as

well as abiotic stress tolerance in Arabidopsis. The possible

role in various abiotic stress tolerance mechanisms is

discussed.

Materials and methods

Spartina alterniflora plants and stress treatment

Young (3- to 4-leaf stage), uniform, clonally propagated

plants of S. alterniflora cv. ‘Vermilion’ were grown in

sand-filled plastic pots under normal growth conditions

inside a greenhouse with 14 h light and 10 h dark at

26/18 �C day/night temperatures and used for stress-related

experiments (Baisakh et al. 2008). Pots were supplied with

Hoagland nutrient solution (Hoagland and Arnon 1950).

Stress treatments were provided as reported earlier by

Karan and Subudhi (2012a). For salinity stress, a 5 %

(w/v) solution of commercial synthetic sea salts (Instant

Ocean, Aquarium Systems, Mentor, OH, USA) dissolved

in Hoagland solution was used. For drought stress, uniform

Spartina plants were uprooted and kept on Whatman paper

under normal growth conditions in a greenhouse. Cold

stress was imposed by keeping pots containing plants at

4 �C under dim light. For ABA treatment, plants were

supplied with 100 lM ABA (Sigma, USA). Leaf and root

tissues collected from at least three different plants at

different time points of stress (8, 24 and 48 h) were thor-

oughly washed, wiped with tissue paper, immediately

frozen in liquid nitrogen, and stored at -80 �C until further

use. Tissues harvested from plants without providing stress

were used as control.

Sequence analysis

An expressed sequence tag (accession number

#EH277338) of S. alterniflora isolated from a salt stressed

EST library referred to as ‘SaARF’ was characterized in

this study. Deduced amino acid sequence was used for

Plant Cell Rep

123

multiple sequence alignment with orthologs from different

organisms using the ClustalW program (www2.ebi.ac.uk/

clustalw); phylogenetic analyses were performed in MEGA

4 (Tamura et al. 2007). The phylogenetic tree of these

sequences was inferred using the neighbor-joining method

(Saitou and Nei 1987). The bootstrap consensus tree

inferred from 1,000 replicates was used to represent the

evolutionary history of the selected eukaryotic species.

RNA isolation and cDNA synthesis

The total RNA from the leaves and roots of harvested

samples was isolated using the RNeasy plant mini kit

(Qiagen, USA), and on-column DNAse I digestion was

carried out to avoid the possible contamination of genomic

DNA following the manufacturer’s instruction (New Eng-

land Biolab, USA). Quality of total RNA was checked in a

1.2 % formamide-denaturing agarose gel, and quantifica-

tion was carried out using ND-1000 spectrophotometer

(Nanodrop Technologies, USA). First strand cDNA was

synthesized using iScriptTM first strand cDNA synthesis kit

(Bio-Rad, USA) for expression study.

Quantitative real-time polymerase chain reaction

(qRT-PCR)

Quantitative RT-PCR experiments were performed fol-

lowing the protocol of Karan et al. (2009). cDNAs syn-

thesized from unstressed and stressed samples of S.

alterniflora were used for qRT-PCR. Each 10 ll of PCR

sample contained 5 ll of 29 SYBR Green mix (Quanta

Bioscience, USA), diluted cDNA, and 0.4 lM of each

primer—SaARFRTF and SaARFRTR primers specific to

the SaARF gene (Table 1). The S. alterniflora tubulin gene,

amplified by gene-specific primers (SaTUBRTF and SaT-

UBRTR) (Table 1), was used as an internal control for

expression normalization in different cDNA samples. Melt

curve analysis was performed to check the specificity of the

amplified product, and relative gene expression levels were

determined using the 2-DDCT method (Livak and

Schmittgen 2001). The CT (cycle threshold) values for

both target and internal control genes were means of at

least three technical replicates.

The same protocol was used to analyze the expression

patterns of six abiotic stress-related genes AtSod1 (super-

oxide dismutase), AtCat (catalase), AtNhx1 (vacuolar

Na?/H? antiporter), AtSos1 (plasma membrane Na?/H?

antiporter), AtP5cs (delta-1-pyrroline-5-carboxylate syn-

thase) and AtRd22 (responsive to dehydration) (primers

listed in Table 2) in 3-week-old T3 homozygous transgenic

Arabidopsis and wild-type Columbia ecotype plants grown

in potting medium PM-15-13 (Lehle seeds, USA) under

normal growth conditions. Arabidopsis tubulin gene-spe-

cific primers, AtTUBRTF and AtTUBRTR (Table 2), were

used to normalize the variation in initial cDNA templates

used for the expression analysis.

Generation of transgenic plants

The complete ORF of SaARF was amplified by PCR using

a forward primer, SaARFNcoIF, and a reverse primer, Sa-

ARFSpeIR (Table 1), containing the NcoI and SpeI

restriction endonuclease sites, respectively, and using Pfu

DNA polymerase (New England Biolab, USA). The PCR

product was digested with NcoI and SpeI, and the NcoI–

SpeI fragment of SaARF was cloned into the pCAM-

BIA1304 vector (CAMBIA, Australia) to generate the

binary vector 35S-SaARF. The identity and orientation for

the directional cloning of SaARF into pCAMBIA1304

vector was further confirmed by DNA sequencing. 35S-

SaARF construct was introduced into Agrobacterium strain

LBA4404 by the freeze–thaw method, and the transfor-

mation of wild-type Columbia ecotype of Arabidopsis

Table 1 Primers used for cloning and qRT-PCR of SaARF gene in S.

alterniflora

Name Sequence (50–30)

SaARFNcoIF CCCATGGGGCTCGCGTTTGGGAAGCTC

SaARFSpeIR GGACTAGTTCAAGCCTTGCTTGCAATGTTG

SaARFRTF AACTGCGTGATGCTGTGCTGC

SaARFRTR TGTACCAATGCCGCTGGCGC

pCAMF GGAGAGAACACGGGGGACTCTTG

SaTUBRTF GAAGGTGATGAGGGTGATGAGT

SaTUBRTR TTCAAGCAAACAAGCCTTCATA

Table 2 Stress-related gene primers used for qRT-PCR in SaARF

transgenic Arabidopsis

Primer name Sequence (50–30)

AtTUBRTF ATAACCGTTTCAAATTCTCTCTCTC

AtTUBRTR TGCAAATCGTTCTCTCCTTG

AtRD22F GATTCGTCTTCCTCTGATCTG

AtRD22R TGGGTGTTAACGTTTACTCCG

AtP5CSF GAGGGGGTATGACTGCAAAA

AtP5CSR AACAGGAACGCCACCATAAG

AtNHX1F CCGTGCATTACTACTGGAGACAAT

AtNHX1R GTACAAAGCCACGACCTCCAA

AtSOS1F TCGTTTCAGCCAAATCAGAAAGT

AtSOS1R TTTGCCTTGTGCTGCTTTCC

AtSOD1F TCAACTGGAAATATGCAAGCGAGGT

AtSOD1R ACCACACAGCTGAGTTGAGCAAA

AtCATF AGCGCTTTCGGAGCCTCGTG

AtCATR GGCCTCACGTTAAGACGAGTTGC

Plant Cell Rep

123

(Lehle seeds, USA) was carried out by floral dip method

(Clough and Bent 1998). Positive transgenic lines were

screened on 40 mg/L hygromycin containing MS medium

(Karan and Subudhi 2012a), and integration of transgene

was confirmed by PCR using a vector-specific forward

primer, pCAMF, and SaARF-specific reverse primer, Sa-

ARFSpeIR (Table 1). The expression of the SaARF trans-

gene in transgenic SaARF plants was verified by RT-PCR

using cDNA made from total RNA isolated from positive

SaARF transgenic plants. The SaARF transgenic plants of

T3 generation were used for salinity and drought stress

experiments.

Stress tolerance assays of transgenic plants

Seeds of wild-type and SaARF transgenic Arabidopsis

plants (T3 generation) were directly sown on the potting

medium PM-15-13 (Lehle seeds, USA) and kept at 4 �C for

4 days before proceeding to stress-related experiments in a

growth chamber containing white fluorescent light of

100 lmol m-2 s-1 under 16 h light/8 h dark photoperiod

at 23 ± 1 �C.

Seed germination assays under salinity stress were per-

formed by placing WT and transgenic seeds on MS media

containing 150 mM NaCl, and the number of germinated

seeds was counted on the third day. Germination was defined

as the complete protrusion of the radicle. For seedling sur-

vival assay, uniformly germinated seeds (for 3 days) under

normal growth conditions were further transferred to

200 mM NaCl containing MS media, and the number of

surviving seedlings was counted after 7 days of stress.

For the drought tolerance assay, 4-week-old normally

grown WT and SaARF transgenic plants were kept without

irrigation for 14 days. Rosette leaves harvested at different

time points were used for various physiological and bio-

chemical analyses. At least three independent experiments

with three replicates for each WT and SaARF transgenic

lines were analyzed.

Measurement of electrolyte leakage (EL), total

chlorophyll content, and proline content

Rosette leaves of 4-week-old WT and SaARF transgenic

Arabidopsis, grown under non-stress and stress conditions

for 1 week, were harvested and used for physiological and

biochemical measurements. For EL measurement, protocol

of Bajji et al. (2004) was used. Briefly, 100 mg leaves were

placed in 25 ml distilled water and shaken on a gyratory

shaker (200 rpm) at room temperature for 2 h, and the

initial conductivity (C1) was measured with a VWR

Traceable� Expanded Range Conductivity Meter (VWR,

USA). Samples were then boiled for 10 min to induce

maximum leakage. After the samples were cooled down to

room temperature, electrolyte conductivity (C2) was mea-

sured, and the relative electrical conductivity (C %) was

calculated using the formula: (C1/C2) 9 100.

To estimate total chlorophyll content in WT and SaARF

lines, protocol suggested by Arnon (1949) was followed. One

hundred milligrams of finely powdered leaf tissue was

homogenized in 1 ml of 80 % acetone and kept for 15 min at

room temperature in dark. The crude extract was centrifuged

for 20 min at 10,000 rpm (rotation per minute) at room tem-

perature, and the resultant supernatant was used for assessing

absorbance at 663 and 645 nm with a spectrophotometer

(Shimadzu UV-1600, Japan). Total chlorophyll content was

measured using the fresh weight (FW) of samples.

For the free proline estimation of WT and SaARF

transgenic plants, fresh leaf tissues were used following the

standard protocol of Bates et al. (1973). One hundred

milligrams of leaf tissue was used and extracted in 5 mL of

3 % sulphosalicylic acid at 95 �C for 15 min. After filtra-

tion, 2 mL of supernatant was transferred to a new tube

containing 2 mL of acetic acid and 2 mL of acidified

ninhydrin reagent. After 30 min of incubation at 95 �C,

samples were kept at room temperature for an additional

30 min, and 5 mL of toluene was added to the tube with

shaking at 150 rpm to extract red products. The absorbance

of the toluene layer was determined at 532 nm using

spectrophotometer (Shimadzu UV-1600, Japan). The

standard curve was prepared using different concentrations

of proline by the same method, which was then used for

measuring free proline content in experimental samples.

The experiment was repeated at least three times.

In situ histochemical localization of reactive oxygen

species

For detection of reactive oxygen species (ROS), histo-

chemical staining with nitroblue tetrazolium (NBT) was

followed according to Dong et al. (2009) with minor

modification. Leaves detached from 4-week-old WT and

the SaARF Arabidopsis plants grown under non-stress or

drought stress for next 7 days were vacuum-infiltrated in

1 mg/ml fresh NBT solution (prepared in 10 mM phos-

phate buffer, pH 7.8) and incubated at an ambient tem-

perature until the appearance of dark spots. The stained

leaves were then bleached in concentrated ethanol, kept in

70 % ethanol, and photographed. Images were opened in

Adobe Photoshop version 7 (Adobe Systems Incorporated,

San Jose, CA, USA), and stained areas of leaves were

quantified following Lehr et al. (1997).

Statistical analysis

Mean values, standard errors, and t tests were performed

with the help of pre-loaded software in Excel, available for

Plant Cell Rep

123

statistical calculations (http://www.Physics.csbsju.edu/

stats/t-test.html). At least three biological samples with

three replicates for each WT and SaARF transgenic lines

were analyzed.

Results

SaARF is a highly conserved ortholog of ADP-

ribosylation factor

A full-length cDNA fragment with high similarity to the

ARF gene was obtained from a salt stressed cDNA library

of S. alterniflora (Baisakh et al. 2008) and designated as

SaARF. Sequence analysis of SaARF revealed the presence

of an ORF that encoded a single peptide of 181 amino acid

residues (Supplementary Fig. 1). The molecular mass of

the native SaARF protein was estimated to be 20.6 kDa.

SaARF gene sequence alignment with the ARFs of Arabi-

dopsis thaliana varied from 66 % identity (AT2G24765) to

84 % identity (AT1G70490) (Supplementary Fig. 2).

Deduced amino acid sequence comparisons of SaARF with

its orthologs from other species showed 97–99 % identity

with ARFs from Oryza sativa, A. thaliana, Zea mays,

Triticum aestivum, and Nicotiana benthamiana, while it

was 87 and 77 % identical with Homo sapiens and Sac-

charomyces cerevisiae, respectively. The SaARF protein

has four characteristic motifs unique for GTP binding, a

potential glycine-myristoylation site at position 2, and

conserved residues from 35 to 94 responsible for activating

phospholipase D (Fig. 1a). The structure of ARF proteins

was highly conserved across different species.

Fig. 1 Multiple sequence alignment and phylogenetic analysis of

SaARF protein. a Multiple sequence alignment of SaARF with ARF

proteins from various organisms. Conserved amino acids residues in

different accessions are shown in the same color. Four conserved

regions responsible for guanosine triphosphate (GTP) binding are

shown by horizontal arrows (Kahn et al. 1995); a site of myristoyla-

tion is indicated by a star (Antonny et al. 1997). Residues 35–94

(large box) are required for binding phospholipase D and adaptor

protein AP-1 (Liang et al. 1997). b Phylogenetic tree of SaARF. The

amino acid sequences of ARFs were subjected to a bootstrap test of

phylogeny by the MEGA 4.0 program using a neighbor-joining

method with 1,000 replicates. Accession numbers of ARF sequences

are: AAA32729 (A. thaliana), AAH10487 (Mus musculus),

AAO62347 (Gossypium hirsutum), AAP73857 (O. sativa),

AAU82112 (T. aestivum), ABB16972 (Solanum tuberosum),

ABY76246 (Brassica napus), BAF34209 (Nicotiana tabacum),

BAJ87426 (H. vulgare), CAA56351(Z. mays), EAL04312 (Candida

albicans), NP_001019399 (H. sapiens), XP_002318935 (Populus

trichocarpa), XP_002466220 (Sorghum bicolor), XP_003557369

(Brachypodium distachyon), and YDL137W (S. cerevisiae). Monocot

ARFs are shown in group ‘‘A’’, dicot ARFs in group ‘‘B’’, and

mammalian ARFs in group ‘‘C’’. The only exception is the underlined

BAJ87426 (Hordeum vulgare), which is clustered in the dicot group

Plant Cell Rep

123

Phylogenetic analysis revealed the clustering of monocot

SaARFs in one group, whereas dicots formed a distinct

group with a clear separation from mammalian and yeast

proteins (Fig. 1b). The only exception was Hordeum

vulgare, which was grouped with dicots. This analysis

suggests an evolutionary conserved function and possible

evolution from a common ancestor.

SaARF gene is transcriptionally regulated by abiotic

stresses in the leaf and root of S. alterniflora

To understand the possible regulation of the SaARF gene

by salinity, drought, cold, and ABA in leaves and roots of

S. alterniflora, a qRT-PCR study was carried out. In

leaves, salt and drought stress continuously increased the

expression of SaARF gene and increased fourfold by

48 h of stress, while cold and ABA increased the

expression of SaARF up to 24 h and then decreased to a

basal level by 48 h (Fig. 2a). In roots, SaARF expression

increased up to fourfold by 8 h salinity stress and

induced up to fivefold by 48 h of stress (Fig. 2b).

Expression of SaARF under drought stress in root was

highly conspicuous, increased gradually, and increased

eightfold during 48 h of stress. In roots, cold stress

increased the expression of SaARF by around twofold in

8 h and started decreasing afterwards, while ABA

increased its expression by 2.5-fold during 24 h of

exposure, and then decreased and reached to a basal level

by 48 h. Induced expression of SaARF transcripts with

8 h of salinity, drought, cold, and ABA indicated its

possible involvement in abiotic stress mechanisms

operating in S. alterniflora.

Overexpression of SaARF improved seed germination

and seedling survival under salinity stress

To identify the possible role of SaARF toward salinity

tolerance in plants, SaARF was transformed into Arabi-

dopsis ecotype Columbia, and the expression of the trans-

gene was confirmed by RT-PCR (Fig. 3b). Seeds of three

independent homozygous SaARF transgenic lines in T3

generation were analyzed for salinity tolerance. Seed ger-

mination under 150 mM NaCl stress was only 10 % in

wild-type (WT) Columbia ecotype, whereas it increased

significantly in all three SaARF overexpressing transgenic

lines with germination ranging from 50 to 70 % (Fig. 3c,

d). Similarly, there was fourfold increase in seedling sur-

vival under salinity stress in SaARF overexpressing

Arabidopsis plants compared to WT plants (Fig. 3f, g).

This analysis clearly revealed the probable involvement of

the SaARF gene in salinity stress tolerance mechanisms in

plants.

Overexpression of SaARF enhanced drought tolerance

by altering osmolyte synthesis

Wild-type and SaARF transgenic plants were compared for

their performance under drought stress to further investi-

gate the role of SaARF in conferring drought tolerance.

Under drought stress, most of the WT plants appeared

dehydrated and weak, and eventually died, while SaARF

overexpressing Arabidopsis plants grew normally and set

seeds (Fig. 4a). Total chlorophyll content was significantly

higher in SaARF transgenic plants than WT under drought

stress (Fig. 4b). Proline, an osmolyte responsible for

Fig. 2 Expression kinetics of SaARF in leaves and roots of S.

alterniflora under different abiotic stresses. Expression patterns of

SaARF at different time intervals in leaves (a) and roots (b) under

salinity stress (5 % sea salt), drought (kept on Whatman paper), cold

(at 4 �C), and ABA (100 lM). Samples were harvested at different

time intervals: 8, 24, and 48 h. Samples harvested before stress were

used as control (c). The tubulin gene of S. alterniflora was used as an

internal control for the normalization of different cDNA samples.

Error bars represent standard error of means based on three

independent reactions

Plant Cell Rep

123

maintaining osmotic balance under stress conditions, was

significantly higher in SaARF plants compared with WT

(Fig. 4c). Similarly, electrolyte leakage was relatively less

in SaARF overexpressing plants than WT under drought

stress (Fig. 4d). These results indicated the indirect

involvement of SaARF in photosynthesis, maintenance of

membrane integrity, and osmolyte synthesis, which could

be responsible for improving drought tolerance in plants.

SaARF minimizes ROS production under drought stress

by regulating antioxidant genes

Leaves of WT and SaARF transgenic lines were stained

with nitroblue tetrazolium (NBT) to investigate the role of

SaARF in protecting plants from oxidative damage caused

by drought stress. Minimal NBT staining of SaARF leaves

than the WT leaves suggested low ROS levels and less

damage to the transgenic leaves than WT leaves (Fig. 5a,

b). Increased expression of several known stress-responsive

genes was observed (Fig. 6). SaARF transgenic plants

showed a higher expression of antioxidant genes, such as

AtSod1 (superoxide dismutase) and AtCat (catalase), than

the WT plants. Among the two ion transporter genes, At-

Nhx1 (vacuolar Na?/H? antiporter) showed enhanced

expression, whereas the expression of AtSos1 (plasma

membrane Na?/H? antiporter) remained unaffected in

SaARF plants. The expression of proline biosynthesis gene

AtP5cs (delta-1-pyrroline-5-carboxylate synthase) and

drought stress-responsive gene AtRd22 (responsive to

dehydration) was higher in SaARF transgenic plants com-

pared to the WT plants.

Discussion

The ARF gene plays an important role in cellular processes

of eukaryotic organisms and notably intracellular vesicular

trafficking (Balch et al. 1992). Studies have shown that

vesicular trafficking is necessary for protein movement,

signal transduction, and multiple developmental processes

(Yao and Xue 2011). Cellular homeostasis is maintained by

the movement of newly synthesized proteins from the

endoplasmic reticulum (ER) to the correct destination—such

as the trans-Golgi network (TGN), the plasma membrane

Fig. 3 Salinity tolerance assay in SaARF overexpressing Arabidopsis

plants. (a) Schematic representation of 35S-SaARF construct, (b) RT-

PCR analysis of SaARF transgenic Arabidopsis plants, (c) germination

of wild-type (WT) and SaARF transgenic plant’s seeds in 150 mM of

NaCl after three days, (d) germination percent of SaARF seeds under

150 mM of NaCl after 3 days, (e) seedlings of WT and SaARF

transgenic lines grown under normal growth conditions for 7 days,

(f) seedlings of WT and SaARF lines after exposure to 200 mM NaCl

for 7 days, (g) percentage of surviving seedlings after 7 days of

exposure to 200 mM NaCl stress. Error bars represent standard error

of means based on three independent experiments. Comparisons were

made between WT and individual transgenic lines under salinity

stress by a paired t test. ** and * indicate significant differences in

transgenic lines compared with the WT at P \ 0.01 and P \ 0.05,

respectively. WT represents Arabidopsis Columbia ecotype; T11, T21

and T31 represent three independent SaARF transgenic lines

Plant Cell Rep

123

(PM), lysosomes, and vacuoles—for retrograde transport,

recycling by transport vesicles, and degradation. Endosomal

trafficking is known to regulate multiple signaling pathways

and developmental processes in eukaryotic cells (Reyes

et al. 2011). Furthermore, cell endocytosis and exocytosis

are dependent on vesicular trafficking.

Fig. 4 Drought tolerance assay in SaARF overexpressing Arabi-

dopsis plants. (a) Three-week-old wild-type (WT) and SaARF plants

were withheld for irrigation for 14 days, and photographs were taken;

(b) chlorophyll content; (c) proline content; and (d) percentage of

electrolyte leakage measured from the rosette leaves of WT and

SaARF plants after 7 days of drought stress. Error bars represent

standard error of means based on three independent experiments.

Comparisons were made between WT and individual transgenic lines

under drought stress by paired t test. ** and * indicate significant

differences between transgenic lines and WT at P \ 0.01 and

P \ 0.05, respectively. WT represents Arabidopsis Columbia eco-

type; T11, T21 and T31 represent three independent SaARF

transgenic lines. FW represents fresh weight of rosette leaves

Fig. 5 ROS detection in SaARF transgenic Arabidopsis plants under

drought stress. The leaves of unstressed and 7 days drought stressed

WT and the SaARF transgenic Arabidopsis plants were immersed in

1 mg/ml fresh NBT solution; (a) photographs were taken after

washing with ethanol, and (b) quantification of stained spots were

done using Adobe Photoshop. The experiment was repeated at least

three times using rosette leaves from each WT and 35S-SaARF plants,

and the photograph represents one of the three experiments. The

graphs represent the mean ± SE of three biological replicates (n = 3)

Plant Cell Rep

123

In this study, an ARF gene of the halophytic plant S.

alterniflora, ‘‘SaARF,’’ was investigated for its role in the

plant’s adaptation under salinity and drought stresses. To

date, a number of ARF genes have been isolated from

various eukaryotes, and their amino acid sequences have

shown highly conserved motifs for the binding of GTP

(Kahn et al. 1995), GAPs (Amor et al. 1994), and guanine

nucleotide exchange factors (GEFs) Sec7 (Mossessova

et al. 1998). It has a potential myristoylation site at Gly-2

(Antonny et al. 1997) and at amino acid residues 35–94,

which activates phospholipase D (Liang et al. 1997). Pre-

sence of all the above motifs in SaARF protein indicates

potentially conserved structures of the SaARF protein such

as those of other organisms (Fig. 1a). The SaARF protein is

highly identical to ARF of monocot plants, such as O.

sativa, Z. mays, and T. aestivum, and seems to have

evolved from a common ancestor (Fig. 1b). Furthermore,

SaARF was found to be 84 % identical with ARF of

Arabidopsis with accession number AT1G70490 (Supple-

mentary Fig. 2) of 15 ARF members of Arabidopsis

(Gebbie et al. 2005).

Plants are constantly challenged with environmentally

extreme conditions and therefore have developed mecha-

nisms to sense and transduce signals to the appropriate

genetic machinery to prepare plants for the unfavorable

impending changes in the surrounding environment. Plants

respond to such stresses by changing its pattern of protein

expression. Plants have to maintain its cellular activity to

continue its growth under stress environments, which

requires the transportation of protein molecules to various

cellular compartments inside the cell. Since the direct role

of ARF in vesicular trafficking in plants is well established

(Ritzenthaler et al. 2002), it is tempting to speculate how

intracellular transportation is regulated and integrated into

signaling pathways and cellular responses in achieving

tolerance to multiple abiotic stresses (Levine 2002).

The ARF gene has been reported to be preferentially

expressed in different organs of wheat (Yao et al. 2009)

and in caryopses at early developmental stages in maize

(Liu et al. 2010) and rice (Zhou et al. 2010). ARF has been

reported to be induced by ethylene in regulating posthar-

vest ripening of banana (Wang et al. 2010), and its

expression was enhanced in flowers and buds in cotton

(Ren et al. 2004) and potato tubers (Liu et al. 2012).

Although organ-specific transcriptional regulation of ARF

in plants was indicated in numerous studies, as discussed

above, the role of ARF in abiotic stress response was only

studied in physic nuts (Jatropha curcas) (Qin et al. 2011).

In this plant, drought, salinity, ABA, ethephon, heat, and

cold influenced the expression of ARF gene in the leaf,

stem, and root. In our study, the SaARF gene was consti-

tutively expressed in the leaves and roots of S. alterniflora,

which was further upregulated by salinity, drought, cold,

and ABA (Fig. 2), indicating the stress-responsive nature

of SaARF.

Previous studies have provided evidence for the

involvement of this gene in plants’ response to diseases

(Lee et al. 2003; Coemans et al. 2008), growth, and

development (Yao et al. 2009; Zhou et al. 2010). Gebbie

et al. (2005) provided evidence that ARF plays an important

role in new cell wall formation since many of the compo-

nent processes, such as cell division, cell expansion, and

cellulose production, are dependent on vesicle trafficking

regulated by the ARF gene. Further, influences on hormonal

and signaling pathways in their study using the antisense

approach were concluded due to changes in flowering pat-

tern and apical dominance. The overexpression of TaARF in

Arabidopsis resulted in increased leaf area, increased

Fig. 6 Expression of stress-responsive genes in SaARF Arabidopsis

plants. Relative mRNA levels of stress-responsive genes were

determined by quantitative RT-PCR using cDNA synthesized from

total RNAs isolated from the shoots of 3-week-old WT and SaARF

transgenic Arabidopsis plants grown under normal conditions in

potting medium. The Arabidopsis tubulin gene was used as an internal

control for the normalization of different cDNA samples. Error bars

represent standard error of means based on three independent

reactions

Plant Cell Rep

123

growth rate, and earlier transition to flowering (Yao et al.

2009). Data from our study suggest that SaARF may be

involved in the trafficking of protein molecules related to

abiotic stress tolerance mechanisms. Since ARF over-

expressing plants were able to grow and maintain a sig-

nificantly higher level of photosynthesis and membrane

stability under drought stress compared to WT plants, it

could be possible by maintaining the cell division and cell

expansion under stress conditions (Gebbie et al. 2005). This

is further supported by the fact that ARF is a crucial factor

for root and root hair growth (Song et al. 2006).

Considering the stress inducible nature of SaARF in S.

alterniflora, the SaARF gene was further tested for its role

toward abiotic stress adaptations in plants. Overexpressing

SaARF Arabidopsis plants showed increased seed germi-

nation and seedling survival than WT plants under salinity

stress, suggesting the involvement of SaARF in salinity

stress adaptation of plants (Fig. 3). Under drought stress,

SaARF Arabidopsis plants were healthy and green, while

WT plants lost their vigor and growth. SaARF plants accu-

mulated more chlorophyll and proline under drought stress

and showed improved cell membrane stability as its elec-

trolyte leakage was significantly lower than the WT (Fig. 4).

SaARF overexpression minimized oxidative damage

caused by drought stress-induced accumulation of ROS, as

shown in Fig. 5. Plants have evolved a complex antioxi-

dant system to detoxify stress-induced ROS by enzymes,

such as superoxide dismutase (Sod) (Alscher et al. 2002)

and catalase (Cat) (Havir and McHale 1989). ARF has

been previously documented to regulate metabolism and

antioxidant capacity in transgenic potato tubers (Zuk et al.

2003). Increased expression of AtSod1 and AtCat in SaARF

Arabidopsis plants (Fig. 6) revealed further evidence for

indirect involvement of SaARF in improving osmotic stress

tolerance by scavenging ROS produced by drought stress.

Proline is an important osmolyte for adjusting osmosis,

stabilizing cellular structures, and providing osmotic stress

tolerance to plants (Verbruggen and Hermans 2008; Karan

and Subudhi 2012a, b). Enhanced expression of the proline

biosynthesis gene AtP5cs (Yoshiba et al. 1995) leads to the

production of additional proline in SaARF Arabidopsis

plants and suggests the influence of ARF on abiotic stress

tolerance via proline biosynthesis pathways. In addition,

the enhanced expressions of the ion transporter gene At-

Nhx1 (Apse et al. 2003) and the dehydration responsive

gene AtRd22 (Yamaguchi-Shinozaki and Shinozaki 1993)

in SaARF Arabidopsis plants suggested for the first time

the importance of the ARF gene in regulating abiotic stress

responses in plants, possibly by the cross-talking of dif-

ferent abiotic stress signaling pathways (Knight and Knight

2001), which are dependent on intracellular trafficking and

are influenced by various plant hormones such as ABA

(Levine 2002).

The demonstration of the defensive role played by the

small GTP-binding protein SaARF in plant cells against

environmental disturbances in this study suggest that Sa-

ARF would be a potential candidate gene in developing

plants tolerant to multiple abiotic stresses using the trans-

genic approach. However, how the ARF gene regulates

vesicle formation and trafficking and influences multiple

tolerance mechanisms should be explored.

Acknowledgments This work was supported by Hatch and special

grant funds from the United States Department of Agriculture—

National Institute of Food and Agriculture. The manuscript was

approved for publication by the Director of Louisiana Agricultural

Experiment Station, USA as manuscript number 2013-306-11800.

References

Alscher RG, Erturk N, Heath LS (2002) Role of superoxide

dismutases (SODs) in controlling oxidative stress in plants.

J Exp Bot 53:1331–1341

Amor JC, Harrison DH, Kahn RA, Ringe D (1994) Structure of the

human ADP-ribosylation factor 1 complexed with GDP. Nature

372:704–708

Antonny B, BeraudDufour S, Chardin P, Chabre M (1997) N-terminal

hydrophobic residues of the G-protein ADP-ribosylation factor-1

insert into membrane phospholipids upon GDP to GTP

exchange. Biochemistry 36:4675–4684

Apse MP, Sottosanto JB, Blumwald E (2003) Vacuolar cation/H

exchange, ion homeostasis, and leaf development are altered in a

T-DNA insertional mutant of AtNHX1, the Arabidopsis vacuolar

Na?/H? antiporter. Plant J 36:229–239

Arnon D (1949) Copper enzymes in isolated chloroplasts. Polyphe-

noloxidase in Beta vulgaris. Plant Physiol 24:1–15

Asakura Y, Ishigaki E, Sugiyama R, Kurosaki F (2007) Cloning and

expression of cDNAs encoding ADP-ribosylation factor in carrot

seedling. Plant Sci 172:189–195

Baisakh N, Subudhi PK, Varadwaj P (2008) Primary responses to salt

stress in a halophyte, smooth cordgrass (Spartina alterniflora

Loisel.). Funct Integr Genomics 8:287–300

Baisakh N, RamanaRao MV, Rajasekaran K, Subudhi P, Janda J,

Galbraith D, Vanier C, Pereira A (2012) Enhanced salt stress

tolerance of rice plants expressing a vacuolar H? -ATPase

subunit c1 (SaVHAc1) gene from the halophyte grass Spartina

alterniflora Loisel. Plant Biotech J 10:453–464

Bajji M, Bertin P, Lutts S, Kinet JM (2004) Evaluation of drought

resistance-related traits in durum wheat somaclonal lines

selected in vitro. Aust J Exp Agric 44:27–35

Balch WE, Kahn RA, Schwaninger R (1992) ADP-ribosylation factor

required for vesicular trafficking between the endoplasmic

reticulum and the cis-Golgi compartment. J Biol Chem

267:13053–13061

Bates LS, Waldren RP, Teare ID (1973) Rapid determination of free

proline for water stress studies. Plant Soil 39:205–207

Bressan RA, Park HC, Orsini F, Oh D, Dassanayake M, Inan G, Yun

G, Bohnert HJ, Maggio A (2013) Biotechnology for mechanisms

that counteract salt stress in extremophile species: a genome-

based view. Plant Biotech Rep 7:27–37

Clough SJ, Bent AF (1998) Floral dip: a simplified method for

Agrobacterium mediated transformation of Arabidopsis thaliana.

Plant J 16:735–743

Plant Cell Rep

123

Coemans B, Takahashi Y, Berberich T, Ito A, Kanzaki H, Matsumura

H, Saitoh H, Tsuda S, Kamoun S, Sagi L, Swennen R, Terauchi

R (2008) High-throughput in planta expression screening

identifies an ADP-ribosylation factor (ARF1) involved in non-

host resistance and R gene-mediated resistance. Mol Plant Pathol

9:25–36

D’Souza-Schorey C, Chavrier P (2006) ARF proteins: roles in

membrane traffic and beyond. Nat Rev Mol Cell Biol 7:347–358

Donaldson JG, Jackson CL (2000) Regulators and effectors of the

ARF GTPases. Curr Opin Cell Biol 12:475–482

Dong CH, Zolman BK, Bartel B, Lee BH, Stevenson B, Agarwal M,

Zhu JK (2009) Disruption of Arabidopsis CHY1 reveals an

important role of metabolic status in plant cold stress signaling.

Mol Plant 2:59–72

Gebbie LK, Burn JE, Hocart CH, Williamson RE (2005) Genes

encoding ADP-ribosylation factors in Arabidopsis thaliana L.

Heyn.; genome analysis and antisense suppression. J Exp Bot

56:1079–1091

Geldner N, Anders N, Wolters H, Keicher J, Kornberger W, Muller P,

Delbarre A, Ueda T, Nakano A, Jurgens G (2003) The

Arabidopsis GNOM ARF-GEF mediates endosomal recycling,

auxin transport, and auxin-dependent plant growth. Cell

112:219–230

Gillingham AK, Munro S (2007) The small G proteins of the Arf

family and their regulators. Annu Rev Cell Dev Biol 23:579–611

Havir EA, McHale NA (1989) Enhanced peroxidatic activity in

specific catalase isozymes of tobacco, barley, and maize. Plant

Physiol 91:812–815

Higo H, Kishimoto N, Saito A, Higo K (1994) Molecular cloning and

characterization of a cDNA encoding a small GTP-binding

protein related to mammalian ADP ribosylation factor from rice.

Plant Sci 100:41–49

Hoagland DR, Arnon DI (1950) The water-culture method for

growing plants without soil. Calif Agr Expt Sta Circ 347:1–32

Inoue H, Randazzo PA (2007) Arf GAPs and their interacting

proteins. Traffic 8:1465–1475

Jones DH, Bex B, Fensome A, Cockcroft S (1999) ADP ribosylation

factor 1 mutants identify a phospholipase D effector region and

reveal that phospholipase D participates in lysosomal secretion

but is not sufficient for recruitment of coatomer I. Biochem J

341:185–192

Kahn RA, Gilman AG (1984) Purification of a protein cofactor

required for ADP-ribosylation of the stimulatory regulatory

component of adenylate cyclase by cholera toxin. J Biol Chem

259:6228–6234

Kahn RA, Clark J, Rulka C, Stearns T, Zhang CJ, Randazzo PA, Terui

T, Cavenagh M (1995) Mutational analysis of Saccharomyces

cerevisiae ARF1. J Biol Chem 270:143–150

Karan R, Subudhi PK (2012a) A stress inducible SUMO conjugating

enzyme gene (SaSce9) from a grass halophyte Spartina alter-

niflora enhances salinity and drought stress tolerance in Arabi-

dopsis. BMC Plant Biol 12:187

Karan R, Subudhi PK (2012b) Overexpression of a nascent polypep-

tide associated complex gene (SabNAC) of Spartina alterniflora

improves tolerance to salinity and drought in transgenic Arabi-

dopsis. Biochem Biophys Res Commun 424:747–752

Karan R, Singla-Pareek SL, Pareek A (2009) Histidine kinase and

response regulator genes as they relate to salinity tolerance in

rice. Funct Integr Genomics 9:411–417

Knight H, Knight MR (2001) Abiotic stress signalling pathways:

specificity and cross-talk. Trends Plant Sci 6:262–267

Kobayashi-Uehara A, Shimosaka E, Handa H (2001) Cloning and

expression analysis of cDNA encoding an ADP-ribosylation

factor from wheat: tissue-specific expression of wheat ARF.

Plant Sci 160:535–542

Lee MH, Sano H (2007) Attenuation of the hypersensitive response

by an ATPase associated with various cellular activities (AAA)

protein through suppression of a small GTPase, ADP ribosyl-

ation factor, in tobacco plants. Plant J 51:127–139

Lee WY, Hong JK, Kim CY, Chun HJ, Park HC, Kim JC, Yun DJ,

Chung WS, Lee SH, Lee SY, Cho MJ, Lim CO (2003) Over-

expressed rice ADP-ribosylation factor 1 (RARF1) induces

pathogenesis-related genes and pathogen resistance in tobacco

plants. Physiol Plant 119:573–581

Lehr HA, Mankoff DA, Corwin D, Santeusanio G, Gown AM (1997)

Application of Photoshop-based image analysis to quantification

of hormone receptor expression in breast cancer. J Histochem

Cytochem 45:1559–1565

Levine A (2002) Regulation of stress responses by intracellular

vesicle trafficking? Plant Physiol Biochem 40:531–535

Liang JO, Sung TC, Morris AJ, Frohman MA, Kornfeld S (1997)

Different domains of mammalian ADP-ribosylation factor 1

mediate interaction with selected target proteins. J Biol Chem

272:33001–33008

Liu Y, Li J, Li Y, Wei M, Cui Q, Wang Q (2010) Molecular cloning,

sequence and expression analysis of ZmArf2, a maize ADP-

ribosylation factor. Mol Biol Rep 37:755–761

Liu B, Si H, Zhang N, Wang D (2012) Identification of differentiallyexpressed genes in potato associated with tuber dormancy

release. Mol Biol Rep 39:11277–11287

Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression

data using real-time quantitative PCR and the 2-DDCT method.

Methods 25:402–408

McElver J, Patton D, Rumbaugh M, Liu CM, Yang LJ, Meinke D

(2000) The TITAN5 gene of Arabidopsis encodes a protein

related to the ADP-ribosylation factor family of GTP binding

proteins. Plant Cell 12:1379–1392

Mossessova E, Gulbis JM, Goldberg J (1998) Structure of the guanine

nucleotide exchange factor Sec7 domain of human Arno and

analysis of the interaction with ARF GTPase. Cell 92:415–423

Nakashima K, Ito Y, Yamaguchi-Shinozaki K (2009) Transcriptional

regulatory networks in response to abiotic stresses in Arabi-

dopsis and grasses. Plant Physiol 149:88–95

Naramoto S, Kleine-Vehn J, Robert S, Fujimoto M, Dainobu T,

Paciorek T, Ueda T, Nakano A, Van Montagu MC, Fukuda H,

Friml J (2010) ADP-ribosylation factor machinery mediates

endocytosis in plant cells. Proc Natl Acad Sci USA

107:21890–21895

Pimpl P, Movafeghi A, Coughlan S, Denecke J, Hillmer S, Robinson

DG (2000) In situ localization and in vitro induction of plant

COPI-coated vesicles. Plant Cell 12:2219–2236

Qin X, Lin F, Lii Y, Gou C, Chen F (2011) Molecular analysis of

ARF1 expression profiles during development of physic nut

(Jatropha curcas L.). Mol Biol Rep 38:1681–1686

Ren MZ, Chen QJ, Zhang R, Guo SD (2004) The structural

characteristics, alternative splicing and genetic expression ana-

lysis of ADP-ribosylation factor 1 (arf1) in cotton. Acta Genet

Sin 31:850–857

Reyes FC, Buono R, Otegui MS (2011) Plant endosomal trafficking

pathways. Curr Opin Plant Biol 14:666–673

Ritzenthaler C, Nebenfuhr A, Movafeghi A, Stussi-Garauda C,

Behniac L, Pimplc P, Staehelin LA, Robinson DG (2002)

Reevaluation of the effects of brefeldin A on plant cells using

tobacco Bright Yellow 2 cells expressing Golgi-targeted green

fluorescent protein and COPI antisera. Plant Cell 14:237–261

Saitou N, Nei M (1987) The neighbor-joining method: a new method

for reconstructing phylogenetic trees. Mol Biol Evol 4:406–425

Song XF, Yang CY, Liu J, Yang WC (2006) RPA, a class II ARFGAP

protein, activates ARF1 and U5 and plays a role in root hair

development in Arabidopsis. Plant Physiol 141:966–976

Plant Cell Rep

123

Subudhi PK, Baisakh N (2011) Spartina alterniflora Loisel., a

halophyte grass model to dissect salt stress tolerance. In Vitro

Cell Dev Biol Plant 47:441–457

Szopa J, Muller-Rober B (1994) Cloning and expression analysis of

an ADP-ribosylation factor from Solanum tuberosum L. Plant

Cell Rep 14:180–183

Tamura K, Dudley J, Nei M, Kumar S (2007) MEGA4: molecular

evolutionary genetics analysis (MEGA) software version 4.0.

Mol Biol Evol 24:1596–1599

Tzafrir I, McElver JA, Liu CM, Yang LJ, Wu JQ, Martinez A, Patton

DA, Meinke DW (2002) Diversity of TITAN functions in

Arabidopsis seed development. Plant Physiol 128:38–51

Verbruggen N, Hermans C (2008) Proline accumulation in plants: a

review. Amino Acids 35:753–759

Verwoert IIGS, Brown A, Slabas AR, Stuitje AR (1995) A Zea mays

GTP-binding protein of the ARF family complements an

Escherichia coli mutant with a temperature-sensitive malonyl-

coenzyme A: acyl carrier protein transacylase. Plant Mol Biol

27:629–633

Wang Y, Wu J, Xu BY, Liu JH, Zhang JB, Jia CH, Jin ZQ (2010)

Cloning of an ADP-ribosylation factor gene from banana (Musa

acuminata) and its expression patterns in postharvest ripening

fruit. J Plant Physiol 167:989–995

Xu J, Scheres B (2005) Dissection of Arabidopsis ADP-RIBOSYL-

ATION FACTOR 1 function in epidermal cell polarity. Plant

Cell 17:525–536

Yahara N, Ueda T, Sato K, Nakano A (2001) Multiple roles of Arf1

GTPase in the yeast exocytic and endocytic pathways. Mol Biol

Cell 12:221–238

Yamaguchi-Shinozaki K, Shinozaki K (1993) The plant hormone

abscisic acid mediates the drought-induced expression but not

the seed-specific expression of rd22, a gene responsive to

dehydration stress in Arabidopsis thaliana. Mol Gen Genet

238:17–25

Yao HY, Xue HW (2011) Signals and mechanisms affecting vesicular

trafficking during root growth. Curr Opin Plant Biol 14:571–579

Yao Y, Ni Z, Du J, Han Z, Chen Y, Zhang Q, Sun Q (2009) Ectopic

overexpression of wheat adenosine diphosphate-ribosylation

factor, TaARF, increases growth rate in Arabidopsis. J Integr

Plant Biol 51:35–44

Yoshiba Y, Kiyosue T, Katagiri T, Ueda H, Mizoguchi T, Yamag-

uchi-Shinozaki K, Wada K, Harada Y, Shinozaki K (1995)

Correlation between the induction of a gene for D1-pyrroline-5-

carboxylate synthetase and the accumulation of proline in

Arabidopsis thaliana under osmotic stress. Plant J 7:751–760

Zerial M, Huber LA (1995) Guidebook to the small GTPases. Oxford

University Press, Oxford

Zhou X, Li J, Cheng W, Liu H, Li M, Zhang Y, Li W, Han S, Wan Y

(2010) Gene structure analysis of rice ADP-ribosylation factors

(OsARFs) and their mRNA expression in developing rice plants.

Plant Mol Biol Rep 28:692–703

Zhu JK (2002) Salt and drought stress signal transduction in plants.

Annu Rev Plant Biol 53:247–273

Zuk M, Prescha A, Kepczynski J, Szopa J (2003) ADP ribosylation

factor regulates metabolism and antioxidant capacity of trans-

genic potato tubers. J Agric Food Chem 51:288–294

Plant Cell Rep

123