Linköping University Post Print   

  

Altered early infant gut microbiota in children developing allergy up to 5 years of age

  

  

Ylva Sjögren, Maria Jenmalm, Malin Böttcher, Bengt Björkstén and Eva Sverremar-Ekström

  

  

  

  

N.B.: When citing this work, cite the original article.

  

  

  

The definitive version is available at www.blackwell-synergy.com:

Ylva Sjögren, Maria Jenmalm, Malin Böttcher, Bengt Björkstén and E Sverremar-Ekström, Altered early infant gut microbiota in children developing allergy up to 5 years of age, 2009, CLINICAL AND EXPERIMENTAL ALLERGY, (39), 4, 518-526. http://dx.doi.org/10.1111/j.1365-2222.2008.03156.x Copyright: Blackwell Publishing Ltd

http://www.blackwellpublishing.com/

Postprint available at: Linköping University Electronic Press http://urn.kb.se/resolve?urn=urn:nbn:se:liu:diva-17517  

Altered early infant gut microbiota in children developing allergy up to five years of age. Gut microbiota and allergy development. Ylva M. Sjögren1, Maria C. Jenmalm2, Malin F. Böttcher2, Bengt Björkstén3, Eva Sverremark-Ekström1

1 The Department of Immunology, the Wenner Gren Institute, Stockholm University, Stockholm, Sweden. 2 The Division of Paediatrics, the Department of Clinical and Experimental Medicine, Faculty of Health Sciences, Linköping University, Linköping, Sweden. 3 The Institute of Environmental Medicine, Karolinska Institutet, Stockholm, Sweden.

Corresponding author. Mailing address: Ylva M. Sjögren The Department of Immunology The Wenner-Gren Institute Arrhenius laboratory of Natural Sciences F5 Svante Arrhenius väg 16-18 Stockholm University 106 91 Stockholm Sweden Phone: +46 8 16 44 36 Fax: +46 8 6129542 E-mail: ylva.sjogren@imun.su.se

Word count. 4432

Sjögren 2

2

ABSTRACT

Background: Early colonization with bifidobacteria and lactobacilli is postulated to protect

children from allergy, while Clostridium difficile colonization might be associated with

allergic disease. Previous studies of the infant gut microbiota in relation to subsequent allergy

development have mostly employed culture dependent techniques, studied genera of bacteria

and the follow up period was limited to two years.

Objective: To relate gut microbiota in early infancy, notably bifidobacteria and lactobacilli at

species level, to allergy development during the first five years of life and study if

environmental factors influence the early infant gut microbiota.

Methods: Faecal samples were collected at one week, one month and two months after birth

from 47 Swedish infants, followed prospectively to five years of age. Bacterial DNA was

analysed with Real-time PCR and related to allergy development, family size as well as

endotoxin and Fel d 1 levels in house dust samples. Primers binding to Clostridium difficile,

four species of bifidobacteria, two lactobacilli groups and Bacteroides fragilis were used.

Children regarded as allergic manifested allergic symptoms and were skin prick test positive

during their first five years while non-allergic children were neither.

Results: Children who developed allergy were significantly less often colonized with

lactobacilli group I (Lactobacillus (L.) rhamnosus, L. casei, L. paracasei), Bifidobacterium

adolescentis and Clostridium difficile during their first two months. Infants colonized with

several Bifidobacterium species had been exposed to higher amounts of endotoxin and grew

up in larger families than infants harbouring few species.

Conclusion: A more diverse gut microbiota early in life might prevent allergy development

and may be related to the previously suggested inverse relationship between allergy, family

size and endotoxin exposure.

Key words

Gut microbiota, infant, allergy, siblings, endotoxin, Fel d 1, bifidobacteria, lactobacilli,

Clostridium difficile.

Abbreviations

AB Asthma bronchialis

AD Atopic dermatitis

ARC Allergic rhinitis/conjunctivitis

B. Bifidobacterium

C. Clostridium

DNA Deoxyribonucleic acid

EU Endotoxin units

Fel d 1 major allergen of cat (Felis domesticus)

G- Gram negative

G+ Gram positive

L. Lactobacillus

PCR Polymerase chain reaction

SPT Skin prick test

Sjögren 4

INTRODUCTION

The commensal gut microbiota, comprising 500-1000 different species of bacteria [1] is

essential for oral tolerance induction and gut homeostasis [2, 3]. Colonization of the neonate

starts immediately after birth and early colonizers are e.g. Escherichia coli, Streptococcus,

Bifidobacterium (B.) and Bacteroides (reviewed in [4]). Studies have shown differences in

the gut microbiota of children raised in affluent and non-affluent societies. For example, a

lower proportion of Swedish children harbour lactobacilli, compared to Estonian and

Ethiopian children [5, 6]. Also, Swedish children are colonized somewhat later and have a

less diverse enterobacterial microbiota than Pakistani infants [7]. Furthermore, colonization

with clostridia, including Clostridium (C.) difficile, has been associated with allergy

development up to two years in several studies [8-10]. Children not developing allergy during

their first two years have instead been shown to be more frequently colonized with

enterococci and bifidobacteria as infants [9]. However, the influence of the infant gut

microbiota on later allergy development needs to be further elucidated.

Type of delivery, diet and country of birth influence the infant gut microbiota [5-7, 11,

12]. Yet, other factors might also contribute to the colonization of the infant gut.

Interestingly, number of siblings associates weakly with amount of bifidobacteria, in faeces

from one month old infants [12]. Exposure to endotoxin, which is present in the outer

membrane of Gram-negative (G-) bacteria, is higher in Estonian compared to Swedish homes

[13]. Possibly, children living in an environment with high exposure to endotoxin might

harbour a more diverse gut microbiota as suggested previously [5]. Also, as the endotoxin

levels in house dust correlate with pet keeping [14], high levels of pet allergens could be

viewed as a marker of bacterial exposure. These factors are particularly interesting to relate to

the infant gut microbiota, as allergy development is inversely associated with number of

siblings and exposure to endotoxin [13, 15, 16].

4

Sjögren 5

As species differences among bifidobacteria in allergic and non-allergic children have

been reported previously [17], further studies of bacterial diversity within various genera of

bacteria are of interest. Most previous studies have employed cultivation dependent

techniques [9, 17]. Recently, sequencing of bacterial genomes has made it possible to study

presence and amounts of bacteria with molecular methods. The 16SrDNA and 23SrDNA of

bacteria, containing both variable and conserved regions, are often targeted for primer and

probe design thus facilitating the analysis of bacteria at species level [18]. One method using

these primers is real-time PCR, a method which is more sensitive and less time-consuming

than cultivation techniques [18].

Hence, we hypothesize that children who develop allergy have an altered early infant

gut microbiota, at species level, compared to children who do not develop allergy.

Furthermore, the gut microbiota is influenced by household factors known to be inversely

associated with allergy development i.e. family size and endotoxin and Fel d 1 exposure.

Therefore, the presence and amounts of certain gut microbes in early infancy were related to

subsequent allergy development up to five years of age and to family size as well as house

dust levels of endotoxin and Fel d 1. Real-time PCR was employed for analysis of the

following bacterial species; C. difficile, B. bifidum, B. longum, B. adolescentis, B. breve,

Bacteroides fragilis, Lactobacilli group I (L. rhamnosus, L. paracasei, L. casei) and

Lactobacilli group II (L. gasseri, L. johnsonii group). The Lactobacilli and Bifidobacterium

species were chosen due to their abundance in early faecal samples from infants [19, 20] and

their postulated role in allergy development [17]. Also, C. difficile has been associated with

allergy development [10]. Furthermore, a component from Bacteroides fragilis has recently

been shown to be a potent immunomodulator [21] and thus this bacteria was also included.

5

Sjögren 6

6

MATERIAL AND METHODS

Study population

The study population, including 123 Swedish children, has been described in detail by

Voor et al [22]. The children were born between March 1996 and October 1999 in Linköping,

Sweden. All were born at term and they had an uncomplicated perinatal period. Inclusion in

this study was based on availability of faecal samples at one week, one month and/or at two

months of age and known allergy status up to the age of five. In all, 47 infants were included.

Sixteen infants developed allergy during their first five years of life, while 31 remained non-

allergic throughout the study period (Table 1). The allergic children had shown symptoms of

allergic disease and at least one positive skin prick test (SPT) during their first five years of

life, while the non-allergic children had not shown symptoms of allergic disease, nor had a

positive SPT. The study was approved by the Regional Ethics Committee for Human

Research at Linköping University. The parents of all children gave their informed consent in

writing.

Table 1. Demographic data of the subjects. None of the differences between the non-allergic and allergic group were statistically significant (p>0.05).

Subjects n=47

Non-allergic n=31

Allergic n=16

Female subjects 23 (49%) 14 (45%) 9 (56%) Born with Caesarean section 3 (6%) 3 (10%) 0 (0%) Any atopic heredity 37 (79%) 22 (71%) 15 (94%) Allergic mother 13 (28%) 8 (26%) 5 (31%) Exclusively breastfed ≥ 2 months 45 (96%) 31 (100%) 14 (88%) Oral antibiotics ≤ 2 months 2 (4%) 2 (6%) 0 (0%) Pets 7 (15%) 6 (19%) 1 (6%) Number of family members 3 (3-8) + 3 (3-8) 3 (3-5) + Household area/individual (m2) 28 (18-47) + 28 (18-47) 27 (20-38) + + Three children were excluded due to unavailable data on family members. Median values of family members and household area/individual are shown with the range in brackets.

A clinical examination of the babies was made at three, six and twelve months and at

two and five years. At these occasions, skin prick tests were performed, and questionnaires

were completed regarding symptoms of allergy, use of antibiotics and family size. Atopic

dermatitis was defined as pruritic chronic or chronically relapsing dermatitis with typical

morphology and distribution. Asthma was defined as three or more episodes of bronchial

obstruction during the last 12-month period, of which at least one should be verified by a

physician. Allergic rhinitis/conjunctivitis was defined as rhinitis and/or conjunctivitis

following at least twice in one hour after allergen exposure and not in relation to an obvious

infection e.g. fever or a cold.

Skin prick tests, with fresh skimmed cow’s milk and thawed egg white, were performed

at all follow ups. From 12 months, the children were tested with cat allergen extract and at

two and five years also with birch- and timothy extracts (ALK, Hørsholm, Denmark). The

SPT was considered to be positive if the mean diameter of the wheal reaction was ≥3 mm.

Only three children were SPT positive at the first clinical examination at three months

of age. Therefore it is not likely that the allergic children were allergic already when the

faecal samples were collected (at one week, one month and two months after birth). At five

years of age, nine of the allergic children were SPT positive against inhalant allergens while

seven of the allergic children manifested earlier food sensitization. Fifteen children had

atopic dermatitis (AD) during their first five years of life. At age five, six children had

allergic rhinitis/conjunctivitis (ARC) either in combination with asthma (AB) (three) or

without (three), and one child had asthma in combination with atopic dermatitis. Thus, seven

children were included in the group ARC/AB ever, and nine children were included in the

group AD only.

Sjögren 8

The demographic data were similar in infants who developed and did not develop

allergy (Table 1). The majority of the children, in the total cohort, had a history of atopic

disease in the immediate family (79%). In total, three children were delivered with caesarean

section. During their first two months, when the faecal samples were collected, almost all

(96%) in the total cohort were exclusively breastfed and only two infants received antibiotics.

Extraction of DNA from faecal samples

Faecal samples were collected at home when the infants were one week (collected at

day five or six), one month and two months old. Approximately one gram voided stool was

collected into sterile plastic containers by the parents and frozen at -20ºC. The stool sample

was brought in a plastic bag with ice to the research nurse who stored the sample at -70ºC

until analysis.

Qiamp DNA Stool Mini Kit™ (Qiagen, Hilden, Germany) was used for the isolation of

DNA from the faecal samples. According to the manufacturer’s instructions, 180-220 mg

frozen faeces were subjected to DNA isolation procedures. A protocol for increasing the

bacterial DNA over human DNA was used. The concentration of nucleic acids was measured

with BIO-RAD Smartspec (Bio-Rad laboratories, Hercules, CA, USA) at 260 nm using BIO

RAD trUView Disposable Cuvettes (Bio-Rad laboratories, Hercules, CA, USA).

Reference bacterial DNA

Reference DNA from B. adolescentis DSM 20083, B. bifidum DSM 20456, B. breve

DSM 20213, B. infantis DSM 20088, B. longum DSM 20219, C. difficile DSM 21296, L.

gasseri DSM 20243 and L. rhamnosus DSM 20711 were purchased from BIOTECHON

Diagnostics (Potsdam, Germany). Also reference DNA from B. adolescentis ATCC 15703D,

C. difficile ATCC 9689D, B. breve ATCC 15700D and B. infantis ATCC 15697D were

8

Sjögren 9

purchased from LGC Promochem (Borås, Sweden). The bacterial DNA was solved in 1X TE

buffer (pH 8) or water according to the manufacturer´s instructions and stored at -200C.

Real-time PCR for quantification of bacterial DNA

For concentrations and sequences of primers see table 2. The primers were used due to

their specificity in binding to the specific bacterial DNA, as well as for their suitability in

SYBR Green PCR chemistry. The primers for B. longum, Bacteroides fragilis, Lactobacilli

group I and Lactobacilli group II were designed by us. The primer for B. longum was

designed to detect the different suggested subspecies of B. longum including B. infantis [23].

Since different Lactobacilli species have shown similarities in the 16SrDNA-23SrDNA we

choose to design primers directed towards two of these groups [24], here referred to as

Lactobacilli group I and Lactobacilli group II. Primer design was performed by running

published sequences, retrieved from Nucleotide Database at National Center for

Biotechnology Information (NCBI), of the above bacteria’s genes for 16SrRNA and

23SrRNA in Primer Express software version (Applied Biosystems) using TaqMan MGB

Quantification protocol. This resulted in primers suitable for SYBR green PCR chemistry i.e.

with a melting temperature of 58-60° and a GC content of 30-80%. Suggested forward and

reverse primers were then tested for their specificity using Basic Local Alignment Serach

Tool (BLAST) under NCBI (www.ncbi.nlm.nih.gov/BLAST). Primer sets binding to the

appropriate bacterial DNA were then tested with the reference bacteria and optimization of

primer concentrations was performed. The concentrations giving the lowest CT value

combined with no primer-dimer, as seen by melting curve analysis, were chosen. Regarding

some of the already published primers, adjustments of primer-concentrations needed to be

done to fit SYBR Green chemistry (Table 2).

9

Sjögren 10

Table 2. Sequences and concentrations of primer sets used. The specific primers amplified regions in the 16SrRNA for B. bifidum, B. breve, B. longum or C. difficile and in the 16S-23SrRNA intragenic spacer for B. adolescentis, Lactobacilli gr. I, Lactobacilli gr. II or Bacteroides fragilis. Bacteria Sequence (5´ 3´) Conc.

(nM) Amplicon length

B. bifidum (39) F: CCACATGATCGCATGTGATTG R: CCGAAGGCTTGCTCCCAAA

F: 250 R: 250

278 bp

B. breve (39) F: CCGGATGCTCCATCACAC R: ACAAAGTGCCTTGCTCCCT

F: 200 R: 50

288 bp

B. longumt F: CAGTTGATCGCATGGTCTTCTG R: CGCGACCCCATCCCATA

F: 400 R: 650

54 bp

B. adolescentis (40) F: ATAGTGGACGCGAGCAAGAGA R: TTGAAGAGTTTGGCGAAATCG

F: 300 R: 150

71 bp

Lactobacilli gr. It F: AAGAAATTCGCATCGCATAACC R: TGCGCCCTTTGTAACTTAACC

F: 150 R: 650

62 bp

Lactobacilli gr. IIt F: GGAAGGCGAAAGATGATGGA R: GCTTGGCTTTCTCGATGACTTCT

F: 650 R: 400

62 bp

C. difficile (41) F: TTGAGCGATTTACTTCGGTAAAGA R: CCATCCTGTACTGGCTCACCT

F: 500 R: 500

157 bp

Bacteroides fragilist F: CCGTTATTCTCCACTCCGATACC R: TCATGTCAAAGATCGTTTGATTACAC

F: 400 R: 400

67 bp

t = this study, F=forward primer, R=reverse primer, bp=base pair. Conc.=concentration.

The SYBR Green real-time PCR was performed using 96-well detection plates

(ABgene, Epsom, UK) together with adhesive films (ABgene, Epsom, UK) in ABI prism

7000 (Applied Biosystem, Stockholm, Sweden). The Absolute Quantification protocol in

7000 System software version 1.2.3f2 (Applied Biosystems) was employed together with a

standard curve set up from known amounts of reference bacterial DNA. The standards were

diluted in 10-fold dilution series and ranged from 5 ng to 50 fg. All samples were performed

in triplicates. Each well contained 2xPower SYBR Green mastermix (Applied Biosystems,

Stockholm, Sweden), forward and reverse primer (MWG-Biotech, Edersburg, Germany),

DNA and water. The amplification was performed as follows: 2 min at 50°, 10 min at 95°

followed by 40 cycles of 15s at 95°C (denaturation) and 1 min at 60° (annealing and

10

Sjögren 11

extension). To determine the specificity of the PCR a melting curve analysis was performed

by slow heating from 60-99°C with continuous fluorescence collection.

To avoid detecting false positives, triplicates with CT values above 35 were considered

as negative. The Absolute Quantification protocol in 7000 System software calculated the

amount of specific bacterial DNA from the standard curve. The amount of the specific

bacterial DNA was then related to the total amount of nucleic acids in each sample. The

specific bacterial DNA is thus expressed as percent specific bacterial DNA of total nucleic

acids and referred to as relative amounts of specific bacterial DNA. The limit of detection

was 5*10-6 % specific bacterial DNA of total nucleic acids.

Endotoxin and Fel d 1 analyses

Dust samples were collected from carpets in the children´s homes once when the

children were 3-12 months old. The collection procedures as well as analyses are further

described in [13]. In short, the analyses were performed under sterile conditions with a

chromogenic Limulus Amebocyte Lysate assay. The lowest limit of detection of endotoxin

was 0.50 EU/mg dust and values below this detection limit was assigned the value 0.25

EU/mg. Fel d 1 were analysed by ELISA (Indoor Biotechnologies, Cardiff, UK) and the

lowest detection limit was 4 ng/g dust.

Statistics

Fisher’s exact test was performed to evaluate whether presence of bacteria at various

occasions differed between children developing and not developing allergy and for evaluation

of demographic markers. Mann-Whitney U test was performed to evaluate whether the two

populations had different amounts of specific bacterial DNA in their faeces and whether

infants with high (3-4) compared to low (0-2) number of Bifidobacterium species had been

11

Sjögren 12

exposed to different endotoxin levels. In addition, Mann-Whitney U test (with Monte Carlo

permutation as correction for ties) was used to evaluate whether the allergic and non-allergic

group differed regarding harbouring the different bacteria at several occasions. Spearman’s

rank coefficient was calculated to investigate whether relative amount of bacterial DNA

correlated with endotoxin units, Fel d 1 levels and number of family members. Any

association between number of Bifidobacterium species and number of family members were

calculated with Cuzick’s non-parametric test for trend. The two children, who received

antibiotics, while the samples were collected, were excluded from the analyses of

environmental factors and gut microbiota. Many statistical tests were performed and thus

some p-values close to 0.05 might be false significances. The study is unfortunately not

sufficiently powered to detect very low p-values. Importantly, it should be viewed as

exploratory and consequently p<0.05 were chosen as statistically significant. Noteworthy,

future larger studies are of importance to investigate if these results could be replicated.

12

Sjögren 13

RESULTS

Presence and amounts of bacteria

Bifidobacteria were detected in all infants in at least one of the three samples collected

during the first two months of life. The most commonly detected Bifidobacterium species

were B. longum and B. adolescentis (Table 3), and B. longum also occurred in the highest

amounts (Fig. 1). Bifidobacterium breve was the least common of the Bifidobacterium

species studied. Few infants were colonised with C. difficile. Bifidobacterium longum, B.

adolescentis and Bacteroides fragilis were commonly present already in one week old

infants, whereas the other bacteria tended to become more frequently detected as the infants

grew older. Lactobacilli occurred in lower amounts than bifidobacteria (Fig. 1). The two

infants who received antibiotics harboured few Bifidobacterium species. However, DNA

from Bacteroides fragilis constituted a major fraction of the nucleic acids purified from the

faecal samples of these children (close to one percent). Two of the three children who were

born with caesarean section harboured C. difficile. The samples from the two children who

were not exclusively breastfed did not appear to differ from the samples from exclusively

breastfed children.

B. adolescentis and Lactobacilli group I were more common in early infant faecal

samples from non-allergic compared to allergic children.

At one week of age, 23/25 (92%) of the non-allergic infants harboured B. adolescentis

and 12/25 (48%) harboured Lactobacilli group I, while only 8/13 (62%) and 1/13 (8%) of the

infants who developed allergy during their first five years were colonized with these bacteria

(p=0.03 and p=0.02 respectively, Table 3). Also, Bifidobacterium adolescentis, Lactobacilli

group I and C. difficile were more often detected in the three samples, obtained during the

13

Sjögren 14

Table 3. Proportion of infants colonized with Bifidobacterium, Lactobacillus, C. difficile and Bacteroides fragilis during the first two months of life. The numbers in the headers show the number of infants with available faecal samples at the different time points. The figures, after the different bacteria, show the percent of infants who were colonized with the bacteria. Infants who developed allergy during their first five years of life are in group A whereas infants who remained non-allergic throughout the study period are in group NA.

1 week (%) 1 month (%) 2 months (%) Bacteria All

n=38 NA

n=25A

n=13All

n=42NA

n=28A

n=14All

n=41 NA

n=27 A

n=14B. longum 84 80 92 90 86 100 90 89 93 B. adolescentis 82 92a 62a 69 75 57 83 85 79 B. bifidum 61 60 62 71 75 64 71 67 79 B. breve 37 40 31 43 43 43 49 56 36 ≥3 Bifidobacterium sp. 55 60 46 60 61 57 76 78 71 Lactobacilli group I 34 48b 8b 62 71 43 61 67 50 Lactobacilli group II 34 32 38 43 36 57 54 48 64 C. difficile 5 8 0 12 14 7 27 37 7 Bacteroides fragilis 61 56 69 57 54 64 59 59 57

ap =0.03, bp =0.02

Fig. 1. Relative amounts of B. longum and Lactobacilli gr. I at one week after birth in relation to allergy development up to five years of age. Open circles denote those infants who did not develop allergy (n=25) and filled circles show those who developed allergy during their first five years of life (n=13). The results are expressed as percent specific bacterial DNA of total amount nucleic acids. The short lines demonstrate the median values and the dotted line illustrates the detection limit. The p-value indicates the difference between the non-allergic and allergic group regarding the relative amounts of Lactobacilli gr. I.

first two months of life, from non-allergic infants than in the samples from allergic infants

(p=0.045, p=0.02 and p=0.03 respectively, Fig. 2). The colonization pattern of the other

bacteria was similar in infants who did and did not develop allergy (Table 3). The number of

stool samples, with three or more Bifidobacterium species, was also similar in the two groups

14

Sjögren 15

(Table 3). With the exception of Lactobacilli group I at one week (Fig. 1), the relative

amounts of the different bacteria did not differ in samples from infants who did and did not

become allergic.

Fig. 2. Number of occasions with detectable B. adolescentis, Lactobacilli group I and C. difficile during the first two months of life in relation to allergy development up to age five. The y-axis shows the percentage of infants who did (A, n=11) or did not develop allergy (NA, n=21) during their first five years of life. The bacteria were studied on three occasions during the first two months and the x-axis illustrates the number of occasions with detectable bacteria. As calculated with Mann-Whitney U test, the non-allergic children harboured B. adolescentis, Lactobacilli gr. I and C. difficile on more occasions than the allergic group (p=0.045, p=0.02 and p=0.03 respectively). None of the other investigated bacteria occurred at different occasions between the allergic and the non-allergic group. Children are only included if faecal samples from all occasions were available.

The allergic children were divided into two groups depending on their allergic

symptoms during their first five years (see study population). Nine children were included in

the atopic dermatitis only group (AD only) and seven children in the allergic

rhinitis/conjunctivitis and/or asthma ever group (ARC/AB ever). There was no difference

regarding the presence of any of the investigated bacteria between the AD only and the

ARC/AB ever group. As shown for the total allergic group, the AD only tended to be less

frequently colonized with B. adolescentis and Lactobacilli group I one week after birth

compared with the non-allergic group (p=0.06 and p=0.03, respectively). No other bacteria

differed in prevalence between the AD only group and the non-allergic group. Interestingly,

none of the bacteria investigated occurred differently between the ARC/AB ever group

compared with the non-allergic group (p= 0.16 and 0.36 for B. adolescentis and Lactobacilli

15

Sjögren 16

gr. I). However, the small numbers in each group when separating the children into the AD

only group (nine children) and the AB/ARC ever group (seven children) could greatly bias

the results.

Environmental factors influence the early infant gut microbiota.

The number of family members correlated significantly with the number of

Bifidobacterium species in faecal samples collected at one week and two months after birth

(p=0.04 and p=0.02, Table 4). Colonization with several (3-4) Bifidobacterium species, at

one week and two months of age tended to be associated with exposure to higher levels of

endotoxin than colonization with low numbers (0-2) of Bifidobacterium species (Fig. 3). This

was particularly obvious during the first week of life (Fig. 3b). There was no similar

correlation with the Fel d 1 levels in house dust.

Table 4. Number of faecal Bifidobacterium species (B. sp) during the first two months in relation to number of family members. The association between number of family members and number of B. sp was calculated with Cuzick’s non-parametric test for trend.

1 week 1 month 2 months family

members mean B. sp. (n infants)

mean B. sp.(n infants)

mean B. sp.(n infants)

3 2.5 (16) 2.6 (19) 2.7 (20) 4 2.5 (8) 2.9 (7) 3.1 (7) 5 3.0 (8) 2.7 (9) 3.1 (7) 6 3.5 (2) 3.5 (2) 3.5 (2) 8 4.0 (1) 4.0 (1) 4.0 (1)

p-value 0.04 0.17 0.02

In one- and two-month faecal samples the relative amounts of B. longum correlated or

tended to correlate with both endotoxin (r=0.41, p=0.02 and r=0.35, p=0.06) and Fel d 1

levels (r=0.38, p=0.03 and r=0.52, p=0.004). The relative amounts of C. difficile in two-

month faecal samples correlated negatively with Fel d 1 levels (r=-0.53, p=0.003), and also

tended to be inversely associated with Fel d 1 and endotoxin in one-month faecal samples

16

Sjögren 17

(r=-0.32 p=0.07 and r=-0.34, p=0.06 respectively). B. bifidum in faecal samples collected at

one month and two months was instead dependent on number of family members (r=0.46

p=0.006 and r=0.43, p=0.01 respectively). However, in one month samples, B. adolescentis

was negatively associated with number of family members (r=-0.34, p=0.04). Yet, the many

statistical tests performed, in combination with a limited sample size, could lead to false

significances.

Fig. 3. Number of faecal Bifidobacterium species in relation to endotoxin levels in house dust (EU/mg dust). The white boxes symbolize samples with two or less Bifidobacterium species (B. sp.) and the grey boxes those with three or more. In figure a and b, the number of B. sp. is measured in faecal samples collected at one week after birth. In figure c and d, the faecal samples were collected at one month and two months, respectively.

17

Sjögren 18

DISCUSSION

Infants who harboured Lactobacilli group I and B. adolescentis at one week after birth

were less likely to develop allergic disease during the first five years of life. Bifidobacterium

longum, which includes B. infantis, was the most prevalent Bifidobacterium species in the

infant faecal samples, which is in accordance with previous findings [20, 25]. Also B.

adolescentis was common, which is in agreement with some [26] but not all previous studies

[20, 25]. Both Lactobacilli group I and Lactobacilli group II were present in the early faecal

samples. Others have shown that Swedish infants harbour lactobacilli species, belonging to

these groups, during their first two months [19].

In most previous studies the early infant gut microbiota has been related to allergy

development during the first two years of life [8-10]. At this age, allergic manifestations are

mostly limited to the skin and gut. The children in our study were followed up to the age of

five, i.e. to an age when respiratory allergy and sensitization to inhaled allergens have

become the major clinical manifestation of allergy. Also, although our study size is somewhat

limited, allergy is well-defined, as both sensitization and symptoms were used to classify the

children as allergic and non-allergic. Interestingly, infants who harboured Lactobacilli group

I at one week of age less frequently developed allergic disease than infants lacking these

bacteria at the same time. Also, non-allergic children were more likely to harbour

Lactobacilli group I on several occasions during their first two months of life. When the

allergic children were grouped based on symptoms, it was shown that children who only

suffered from atopic dermatitis were less often colonized with Lactobacilli gr. I, one week

after birth, compared to the non-allergic children. These findings could be supported by

clinical studies, in which different strains of probiotic lactobacilli reduced the incidence of

infant eczema [27] and IgE-associated eczema [28]. However, bacterial colonization in the

seven children with respiratory allergy did not differ from bacterial colonization in the non-

18

Sjögren 19

allergic children. It is difficult to interpret the role of Lactobacilli group I on respiratory

allergies as only one child developed respiratory allergy without previous atopic dermatitis.

Furthermore, only seven children had developed allergic asthma and rhinitis/conjunctivitis at

age five. Children belonging to the AD only group, at age five, might develop respiratory

allergy later as a substantial proportion of sensitized children with atopic eczema develop

respiratory allergy before age seven [29].

Bifidobacterium adolescentis was more commonly detected in infants not developing

allergic disease, which is in contrast with two previous reports on allergic and non-allergic

infants [17] and children [30]. In contrast to these studies, our study population was

investigated in early infancy, before the onset of allergic disease. There may be a time

window of opportunity, only open very early in life, when microbial stimuli can influence the

development of the immune system [31]. Results from animal experiments support this

theory. In a murine model, B. infantis could restore oral tolerance in neonatal ex-germ-free

mice but not in adult mice [2]. Another study on allergic and non-allergic infants did not find

any association between allergic disease and colonization with B. adolescentis [32]. Yet, in

contrast to the study by Stsepetova [30], B. pseudocatenulatum were more frequently

detected in the allergic infants [32]. Studies show that different Bifidobacterium species elicit

different immune responses from diverse immune cells [33, 34]. Speculatively, the

colonization with several different species of commensal flora might lead to balanced

immune responses contributing to the development of a fully functional immune system

protecting children from allergy development. However, under certain conditions i.e. when

the gut microbiota is less diverse, certain species could appear to have a detrimental role in

allergic disease. This could also be the case for C. difficile. Previous studies suggest that

colonization early in life with C. difficile is more common among infants who develop

allergic disease than among infants who do not [10]. We could not confirm this, as infants

19

Sjögren 20

who developed allergy were less likely to be colonized with C. difficile during their first two

months. The low rate of C. difficile colonization combined with the relatively few number of

allergic children may explain the lack of a reverse association in our study. Nevertheless,

several studies, showing more clostridia, also indicate less other commensal bacteria in

children developing or suffering from allergy [8, 9, 35]. Therefore, it might rather be a gut

microbiota with lower diversity that is associated with allergy development. Interestingly, a

large recent study did not find any relationship between the presence of different bacteria and

allergy development up to 18 months of age [11], but indeed showed that infants who

developed allergy had a lower diversity in their gut microbiota [36]. In order to further

understand the influence of the gut microbiota on immune responses and allergy development

additional prospective studies and molecular studies are needed.

Lifestyle factors have been inversely associated with allergy development, and could

possibly influence the gut microbiota and how it establishes early in life. Interestingly, we

show that certain household factors are associated with the diversity of the bifidobacterial

flora. The number of Bifidobacterium species at one week and two months correlated

significantly with the number of family members. Higher counts of bifidobacteria [12] and

later acquisition of Clostridium species in infants with siblings [11] have been reported

previously. Thus, family members and siblings may rapidly contaminate the infant with a

commensal microbiota. This is further supported by experiments in rats showing that ex-

germfree rats encounter a normal gut microbiota almost as quickly when they are reared with

conventional rats as when they are inoculated with gut microbiota from conventional rats

[37].

Exposure to high levels of endotoxin in house dust was also associated with a more

diverse Bifidobacterium microbiota at one week and two months after birth. Endotoxin is a

component in G- bacteria and should probably be viewed as a marker of total bacterial

20

Sjögren 21

exposure in the homes and not as a factor directly related to the G+ bifidobacterial

microbiota. However, postnatal colonization with the G- and facultative aerobic

enterobacterial microbiota, is important to establish an appropriate environment for anaerobic

bacteria, such as bifidobacteria and Bacteroides [4]. Today, staphylococci are acquired the

first days after birth among Swedish infants, while it takes up to two months before most

infants have achieved an enterobacterial microbiota [38]. Speculatively, high bacterial

exposure may lead to early colonization with appropriate facultative aerobic bacteria, which

in turn would facilitate colonization of commensal anaerobic bacteria. The positive

association between endotoxin and Fel d 1 levels in house dust with the relative amount of B.

longum, and the inverse relationship with C. difficile, would support this possibility. Many

statistical tests were performed and p-values close to 0.05 might be false significances. Yet,

there are several indications in this study that larger families and more microbial exposure

lead to a gut flora with higher diversity. These data are also in line with the finding that

certain bacteria were less frequently detected in infants developing allergy. However, future

studies, with different and larger cohorts, are needed to verify these results. It will also be

necessary to perform more detailed studies of how a diverse microbiota, or certain species of

bacteria, influences infant immune responses. How these immune responses relate to allergy

development also needs to be further explored.

In conclusion, children who develop allergic disease were less often colonized with

Lactobacilli group I, B. adolescentis and C. difficile during their first two months of life. As

family size and endotoxin exposure appeared to influence the Bifidobacterium flora, a more

diverse gut microbiota early in life could, to some extent, explain the inverse association

between these household factors and allergy development.

21

Sjögren 22

ACKNOWLEDGMENTS

We are grateful to all children and parents participating in this study and to the

following people at Linköping University Hospital; research nurse Lena Lindell, laboratory

technologist Ann-Marie Fornander and Dr Sara Tomicic for excellent assistance and Dr Karel

Duchén for clinical evaluation of the children. We are also grateful to Tiina Rebane at Tartu

University Clinics, Jan-Olov Persson at Stockholm University for statistical help and

Elisabeth K. Norin at Karolinska Institutet for critically reading the manuscript.

This work was supported by the Ekhaga foundation, the Cancer and Allergy

foundation, Mjölkdroppen, the Magnus Bergvall foundation, the Swedish Research Council

(57X-15160-05-2 and 74X-20146-01-2), the National Swedish Association against Allergic

Diseases, the National Heart and Lung Association and the Swedish Foundation for Health

Care Sciences and Allergy Research.

22

Sjögren 23

REFERENCES

1. Sonnenburg JL, Angenent LT, Gordon JI. Getting a grip on things: how do communities of bacterial symbionts become established in our intestine? Nat Immunol 2004; 5:569-73.

2. Sudo N, Sawamura S, Tanaka K, Aiba Y, Kubo C, Koga Y. The requirement of intestinal bacterial flora for the development of an IgE production system fully susceptible to oral tolerance induction. J Immunol 1997; 159:1739-45.

3. Rakoff-Nahoum S, Paglino J, Eslami-Varzaneh F, Edberg S, Medzhitov R. Recognition of commensal microflora by toll-like receptors is required for intestinal homeostasis. Cell 2004; 118:229-41.

4. Mackie RI, Sghir A, Gaskins HR. Developmental microbial ecology of the neonatal gastrointestinal tract. Am J Clin Nutr 1999; 69:1035S-45S.

5. Sepp E, Julge K, Vasar M, Naaber P, Björkstén B, Mikelsaar M. Intestinal microflora of Estonian and Swedish infants. Acta Paediatr 1997; 86:956-61.

6. Bennet R, Eriksson M, Tafari N, Nord CE. Intestinal bacteria of newborn Ethiopian infants in relation to antibiotic treatment and colonisation by potentially pathogenic gram-negative bacteria. Scand J Infect Dis 1991; 23:63-69.

7. Adlerberth I, Carlsson B, de Man P et al. Intestinal colonization with Enterobacteriaceae in Pakistani and Swedish hospital-delivered infants. Acta Paediatr Scand 1991; 80:602-10.

8. Kalliomäki M, Kirjavainen P, Eerola E, Kero P, Salminen S, Isolauri E. Distinct patterns of neonatal gut microflora in infants in whom atopy was and was not developing. J Allergy Clin Immunol 2001; 107:129-34.

9. Björkstén B, Sepp E, Julge K, Voor T, Mikelsaar M. Allergy development and the intestinal microflora during the first year of life. J Allergy Clin Immunol 2001; 108:516-20.

10. Penders J, Thijs C, van den Brandt PA et al. Gut microbiota composition and development of atopic manifestations in infancy: the KOALA Birth Cohort Study. Gut 2007; 56:661-67.

11. Adlerberth I, Strachan DP, Matricardi PM et al. Gut microbiota and development of atopic eczema in 3 European birth cohorts. J Allergy Clin Immunol 2007; 120:343-50.

12. Penders J, Thijs C, Vink C et al. Factors influencing the composition of the intestinal microbiota in early infancy. Pediatrics 2006; 118:511-21.

13. Böttcher MF, Björkstén B, Gustafson S, Voor T, Jenmalm MC. Endotoxin levels in Estonian and Swedish house dust and atopy in infancy. Clin Exp Allergy 2003; 33:295-300.

23

Sjögren 24

14. Heinrich J, Gehring U, Douwes J et al. Pets and vermin are associated with high endotoxin levels in house dust. Clin Exp Allergy 2001; 31:1839-45.

15. Strachan DP. Family size, infection and atopy: the first decade of the "hygiene hypothesis". Thorax 2000; 55:S2-10.

16. Braun-Fahrländer C, Riedler J, Herz U et al. Environmental exposure to endotoxin and its relation to asthma in school-age children. N Engl J Med 2002; 347:869-77.

17. He F, Ouwehand AC, Isolauri E, Hashimoto H, Benno Y, Salminen S. Comparison of mucosal adhesion and species identification of bifidobacteria isolated from healthy and allergic infants. FEMS Immunol Med Microbiol 2001; 30:43-47.

18. Matsuki T, Watanabe K, Tanaka R. Genus- and species-specific PCR primers for the detection and identification of bifidobacteria. Curr Issues Intest Microbiol 2003; 42:61-69.

19. Ahrné S, Lönnermark E, Wold AE et al. Lactobacilli in the intestinal microbiota of Swedish infants. Microbes Infect 2005; 7:1256-62.

20. Sakata S, Tonooka T, Ishizeki S et al. Culture-independent analysis of fecal microbiota in infants, with special reference to Bifidobacterium species. FEMS Microbiol Lett 2005; 243:417-23.

21. Mazmanian SK, Kasper DL. The love-hate relationship between bacterial polysaccharides and the host immune system. Nat Rev Immunol 2006; 6:849-58.

22. Voor T, Julge K, Böttcher MF, Jenmalm MC, Duchén K, Björkstén B. Atopic sensitization and atopic dermatitis in Estonian and Swedish infants. Clin Exp Allergy 2005; 35:153-59.

23. Klein G. International Committee on Systematics of Prokaryotes; Subcommittee on the taxonomy of Bifidobacterium, Lactobacillus and related organisms: Minutes of the meetings, 1 and 2 April 2005, Stuttgart-Hohenheim, Germany. Int J Syst Evol Microbiol 2006; 56:2501-03.

24. Song Y, Kato N, Liu C, Matsumiya Y, Kato H, Watanabe K. Rapid identification of 11 human intestinal Lactobacillus species by multiplex PCR assays using group- and species-specific primers derived from the 16S-23S rRNA intergenic spacer region and its flanking 23S rRNA. FEMS Microbiol Lett 2000; 187:167-73.

25. Grönlund MM, Gueimonde M, Laitinen K et al. Maternal breast-milk and intestinal bifidobacteria guide the compositional development of the Bifidobacterium microbiota in infants at risk of allergic disease. Clin Exp Allergy 2007; 37:1764-72.

26. Suzuki S, Shimojo N, Tajiri Y, Kumemura M, Kohno Y. Differences in the composition of intestinal Bifidobacterium species and the development of allergic diseases in infants in rural Japan. Clin Exp Allergy 2007; 37:506-11.

27. Kalliomäki M, Salminen S, Arvilommi H, Kero P, Koskinen P, Isolauri E. Probiotics in primary prevention of atopic disease: a randomised placebo-controlled trial. Lancet 200; 357:1076-79.

24

Sjögren 25

28. Abrahamsson TR, Jakobsson T, Böttcher MF et al. Probiotics in prevention of IgE-associated eczema: a double-blind, randomized, placebo-controlled trial. J Allergy Clin Immunol 2007; 119:1174-80.

29. Lowe AJ, Hosking CS, Bennett CM et al. Skin prick test can identify eczematous infants at risk of asthma and allergic rhinitis. Clin Exp Allergy 2007; 37:1624-31.

30. Stsepetova J, Sepp E, Julge K, Vaughan E, Mikelsaar M, de Vos WM. Molecularly assessed shifts of Bifidobacterium ssp. and less diverse microbial communities are characteristic of 5-year-old allergic children. FEMS Immunol Med Microbiol 2007; 51:260-69.

31. Garn H, Renz H. Epidemiological and immunological evidence for the hygiene hypothesis. Immunobiology 2007;212:441-52.

32. Gore C, Munro K, Lay C et al. Bifidobacterium pseudocatenulatum is associated with atopic eczema: a nested case-control study investigating the fecal microbiota of infants. J Allergy Clin Immunol 2008; 121:135-40.

33. Young SL, Simon MA, Baird MA et al. Bifidobacterial species differentially affect expression of cell surface markers and cytokines of dendritic cells harvested from cord blood. Clin Diagn Lab Immunol 2004; 11:686-90.

34. He F, Morita H, Ouwehand AC et al. Stimulation of the secretion of pro-inflammatory cytokines by Bifidobacterium strains. Microbiol Immunol 2002; 46:781-85.

35. Böttcher MF, Nordin EK, Sandin A, Midtvedt T, Björkstén B. Microflora-associated characteristics in faeces from allergic and nonallergic infants. Clin Exp Allergy 2000; 30:1590-96.

36. Wang M, Karlsson C, Olsson C et al. Reduced diversity in the early fecal microbiota of infants with atopic eczema. J Allergy Clin Immunol 2008; 121:129-34.

37. Midtvedt T, Carlstedt-Duke B, Hoverstad T, Midtvedt AC, Norin KE, Saxerholt H. Establishment of a biochemically active intestinal ecosystem in ex-germfree rats. Appl Environ Microbiol 1987; 53:2866-71.

38. Adlerberth I, Lindberg E, Åberg N et al. Reduced enterobacterial and increased staphylococcal colonization of the infantile bowel: an effect of hygienic lifestyle? Pediatr Res 2006; 59:96-101.

39. Matsuki T, Watanabe K, Fujimoto J et al. Quantitative PCR with 16S rRNA-gene-targeted species-specific primers for analysis of human intestinal bifidobacteria. Appl Environ Microbiol 2004; 70:167-73.

40. Haarman M, Knol J. Quantitative real-time PCR assays to identify and quantify fecal Bifidobacterium species in infants receiving a prebiotic infant formula. Appl Environ Microbiol 2005; 71:2318-24.

25

Sjögren 26

26

41. Rinttilä T, Kassinen A, Malinen E, Krogius L, Palva A. Development of an extensive set of 16S rDNA-targeted primers for quantification of pathogenic and indigenous bacteria in faecal samples by real-time PCR. J Appl Microbiol 2004; 97:1166-77.