Nematology, 2010, Vol. 12(2), 171-180

Phylogenetic relationships, based on SSU rDNA sequences,among the didelphic genera of the family Trichodoridae

from Portugal

Isabel M. DUARTE 1,∗, Maria Teresa M. DE ALMEIDA 2, Derek J.F. BROWN 3, Isabel MARQUES 4,Roy NEILSON 5 and Wilfrida DECRAEMER 6

1 Departamento de Biologia e Ecologia, Escola Superior Agrária de Coimbra, Bencanta, 3040-316 Coimbra, Portugal2 Departamento de Biologia, Universidade do Minho, Campus de Gualtar, 4710-057 Braga, Portugal

3 Central Laboratory of General Ecology, Gagarin Street 2, 1113 Sofia, Bulgaria4 Instituto Gulbenkian de Ciência, Rua da Quinta Grande, 6, 2781-901 Oeiras, Portugal

5 Scottish Crop Research Institute, Invergowrie, Dundee DD2 5DA, UK6 Royal Belgian Institute of Natural Sciences, Brussels, Belgium

Received: 31 January 2009; revised: 15 May 2009Accepted for publication: 18 May 2009

Summary – A survey of virus vector trichodorid nematodes was carried out in the central and northern regions of Portugal. Morphobio-metric identification showed the presence of trichodorid species previously reported from Portugal, except for Paratrichodorus porosus,which is reported for the first time in Continental Europe. Small subunit ribosomal DNA (SSU rDNA) sequences of ten different speciesoccurring in Portugal were obtained and a phylogenetic analysis based on their alignment was performed to infer relationships amongthe different Portuguese trichodorid species and three non-indigenous populations (Nanidorus minor, P. allius and P. teres). The re-sulting phylogenetic tree is in agreement with the currently accepted classification for Trichodoridae, except for Nanidorus, whichclusters together with Trichodorus species, while the genera Paratrichodorus and Trichodorus appear as two distinct groups. A betterunderstanding of the generic groupings in the family Trichodoridae was found. Based on the new molecular analyses we herein acceptNanidorus as a valid genus.

Keywords – 18S rDNA, molecular, Nanidorus, Paratrichodorus, Paratrichodorus porosus, phylogeny, tobacco rattle virus (TRV),Trichodorus, Tylolaimophorus minor.

Of the 102 species that represent the five generacurrently recognised by most authors in the Trichodoridaefamily, only a few didelphic species are known as virusvectors (Almeida & Decraemer, 2005; Decraemer &Robbins, 2007). The monodelphic genera, only recordedin Central and South America, have, as yet, no virusvector species. Trichodorid nematodes of the generaParatrichodorus and Trichodorus are known as naturalvectors of the three members of the Tobravirus genus,viz., Tobacco rattle virus (TRV), Pea early-browning virus(PEBV) and Pepper ringspot virus (PepRSV), to manyagronomically important crops (Taylor & Brown, 1997).Up to now, 16 trichodorid species have been reportedin Portugal (Almeida & Santos, 1997), including somevectors of TRV (Brown & Weischer, 1998; Duarte et al.,

∗ Corresponding author, e-mail: iduarte@esac.pt

2002). Based on conventional taxonomy, the trichodoridgroup is relatively well defined, especially at genus level.However, Karanastasi et al. (2001) reported differences inthe ultrastructure of the cuticle that were not completelygenus specific. Based on their observations, three groupswere established, two conforming to the extant taxonomy,representing Paratrichodorus and Trichodorus, and a thirdgroup comprising species of both genera. Furthermore,very little is known about the molecular phylogeny ofthese species (Boutsika et al., 2004a, b).

The 18S subunit of the ribosomal DNA (18S rDNA) isthe most frequently used DNA region to study molecularphylogenetic relationships among nematodes. It has bothconserved and variable regions and allows alignmentof unrelated taxa and design of universal primers that

© Koninklijke Brill NV, Leiden, 2010 DOI:10.1163/156854109X461721Also available online - www.brill.nl/nemy 171

I.M. Duarte et al.

facilitate taxa discrimination and, therefore, affords goodpotential for phylogenetic analysis. This region evolvesslowly, making it useful to examine deep evolutionaryevents (Powers, 2004).

The aim of this study was to determine, based onthe SSU rDNA sequence, the phylogenetic relationshipsamong trichodorid species occurring in Portugal andto try to clarify the taxonomic status of the nominalgenera.

Materials and methods

NEMATODE SPECIES

Nematodes were extracted directly from soil samplesusing a modified decanting and sieving technique withfinal separation overnight in Baermann funnels (Brown& Boag, 1988). Trichodorid specimens were collectedand identified by morphological and morphometric exam-

ination. Representative male and female specimens fromeach species were selected and kept in 1 M NaCl at−20◦C. Specimens of Nanidorus minor, Paratrichodorusspecies (P. divergens, P. hispanus, P. porosus and Para-trichodorus sp.) and Trichodorus (T. beirensis, T. lusitan-icus, T. primitivus, Trichodorus sp. A, Trichodorus sp. B)were studied, all of them, except for P. porosus, having al-ready been recorded in Portugal by Almeida (1993). Tri-chodorus spp. A and B are described and in preparation,whereas Paratrichodorus sp. is under study. Populationsof P. allius, N. minor and P. teres from other geographi-cal origins were also included. The SSU rDNA sequencesof four additional trichodorids (N. nanus, P. anemones,P. pachydermus and T. primitivus) were retrieved fromEMBL/GenBank/DDBJ database and added to the presentstudy. The populations of all species used in this work,their geographic origin and the respective accession num-ber of rDNA nucleotide sequences are presented in Ta-ble 1.

Table 1. Populations of the trichodorid species used.

Trichodorid populations Geographic origin* Accessionnumber

NanidorusN. minor (Colbran, 1956) Siddiqi, 1974 Quintal da Casa, Gafanha da Boavista, Ílhavo, Aveiro, Portugal DQ345526N. minor Greece AM269897N. nanus (Allen, 1957) Siddiqi, 1974 The Netherlands FJ040485

FJ040486Paratrichodorus

Paratrichodorus allius (Jensen, 1963) Siddiqi,1974

Washington State, USA AM269895

P. anemones (Loof, 1965) Siddiqi, 1974 Yorkshire, England AF036600P. divergens Almeida, Santos, Abrantes & De-

craemer, 2005Quintal da Casa, Jorjais de Perafita, Alijó, Vila Real, Portugal DQ345528

P. hispanus Roca & Arias, 1986 Esporões, Braga, Braga, Portugal DQ345527P. pachydermus (Seinhorst, 1954) Siddiqi, 1974 Woodhill, Scotland AF036601P. porosus (Allen, 1957) Siddiqi, 1974 Vila Praia de Âncora, Caminha, Viana do Castelo, Portugal DQ345524P. teres (Hooper, 1962) Siddiqi, 1974 Greece AM269896Paratrichodorus sp. Quintal da Capela, Jorjais de Perafita, Alijó, Vila Real, Portugal DQ345523

TrichodorusT. beirensis Almeida, De Waele, Santos &

Sturhan, 1989Campo do Salgueiro, Celorico da Beira, Guarda, Portugal DQ345530

T. lusitanicus Siddiqi, 1974 Chães Grande, Vale do Porco, Tondela, Viseu, Portugal DQ345532T. primitivus (de Man, 1880) Micoletzky, 1922 Qta da Pedralva, Ventosa do Bairro, Mealhada, Aveiro, Portugal DQ345533T. primitivus Scotland AF036609Trichodorus sp. A (Almeida, 1993) Eirado de Baixo, Cepães, Marinhas, Esposende, Braga, Portugal DQ345534Trichodorus sp. B (Almeida, 1993) Esporões, Braga, Braga, Portugal DQ345531

* Typefaces used: village, roman; council, boldface; district, italics; country, roman.

172 Nematology

Phylogenetic of Trichodoridae from Portugal

DNA EXTRACTION

Total DNA was extracted from individual adult speci-mens (Stanton et al., 1998) after morphological confirma-tion of each species. Photomicrographs of each specimenwere taken for archive purposes. Frozen nematodes keptin 1 M NaCl were transferred into a Syracuse dish fromwhere, under a microscope, each specimen was hand-picked, added to an Eppendorf tube with 20 μl 0.25 MNaOH and incubated at 25◦C for 24 h. Tubes were thenincubated at 99◦C for 2 min. Following the addition of10 μl 0.25 M HCl, 5 μl 0.5 M Tris-HCl pH 8.0 and 5 μl2% Triton X-100, a second incubation at 99◦C for 2 minwas performed. After a brief vortex, tubes were kept at4◦C until processed or stored in the freezer.

For each specimen a set of four PCR reactions gener-ating overlapping fragments, covering a ca 1.7 kb regionwithin the 18S rDNA, was performed.

PCR AMPLIFICATION

The PCR primers used in this study were designedbased on the alignment of the following sequences:Trichodorus primitivus (AF036609), Paratrichodorusanemones (AF036600) and P. pachydermus (AF036601).The primer positions in the 18S are schematised in Fig-ure 1 and respective sequences presented in Table 2.Primers were synthesised and supplied by Invitrogen, LifeTechnologies and MWG-Biotech. Negative controls with-out DNA were also performed. Known T. primitivus DNAwas used as a positive control in all subsequent PCR am-plification reactions.

The PCR amplification procedure was similar to thatdescribed by Zijlstra et al. (1997). Reactions were per-

formed with 10 mM Tris/HCI (pH 8.8), 50 mM KCl,1.5 mM MgCl2, 0.2 μM of each primer, 0.2 mM of dNTP,0.5-1.0 μl of nematode total DNA (0.05 to 0.5 ng DNAtemplate) and 2.5 units of Taq DNA polymerase. The re-actants for amplification were supplied by Invitrogen: LifeTechnologies. The thermal cycling parameters includedan initial denaturation step at 94◦C for 2 min, followedby 40 cycles of denaturation at 94◦C for 45 s, annealingat appropriate temperature specific for each primer com-bination for 30 s, extension at 72◦C for 2 min and a finalextension at 72◦C for 10 min. Reaction conditions wereadjusted according to primers.

The nucleotide sequences were obtained by direct se-quencing of purified PCR products (Quiquick Rapid PCRPurification Kit (Qiagen)) using the instructions listed bythe manufacturer and primers in the DNA sequencing kit,

Table 2. PCR primer sequences.

PCR Code- Primer sequenceproduct sense (5′ → 3′)

A 37-F GCCGCGAAAAGCTCATTACAAC494-R CCAGACTTGCCCTCCAATAGATCC

B 1091-F AGGAATTGACGGAAGGGCAC1570-R TGTACAAAGGGCAGGGACG

C 360-F CTACCACATCCAAGGAAGGC932-R TATCTGATCGCTGTCGAACC

D 773-F GCCTTTTATTGGTTATCGC1221-R TCCACCAACTAAGAACGGC

E 1091-F AGGAATTGACGGAAGGGCAC1671-R TCCTCTAAGTAAATCCCATTGG

Code indicates the nucleotide position on the corresponding T.primitivus sequence (AF036609); F, forward; R, reverse.

Fig. 1. Schematic representation of the primers used for PCR amplification of trichodorids SSU rDNA region. This figure is publishedin colour in the online edition that can be accessed via http://www.brill.nl/nemy

Vol. 12(2), 2010 173

I.M. Duarte et al.

dRhodamine Terminator Cycle Sequencing Ready Reac-tion (Applied Biosystems).

SEQUENCE AND PHYLOGENETIC ANALYSIS

ClustalW (Thompson et al., 1994), with default pa-rameters settings, was used to align the consensus se-quences. Tylolaimophorus minor (AJ966512) and Pris-matolaimus intermedius (AF036603) sequences were in-cluded in the alignment as outgroups. The alignment wasmanually edited with data columns containing less than50% of information omitted and sequences at the ex-tremes of the alignment sheared to effect a common startand end point.

Evolutionary model parameters were determined us-ing Tree-Puzzle (Strimmer & von Haeseler, 1996). Themost appropriate model was found to be a mixed «Modelrate of heterogeneity» (1 invariable + gamma distributedrates) with a Ts/Tv value of 1.45 and α of 0.19. Phylo-genetic analysis was inferred with Maximum Likelihood(ML), using the DNAML (PHYLIP) program (Felsen-stein, 1993). The default parameter settings were usedwith the exception of Gamma distributed rates, whichwere set to rate variation among sites, and with global re-arrangements allowed. In order to validate the tree, the ini-tial alignment was subjected to 1000 bootstraps using SE-QBOOT (PHYLIP). The final tree was drawn with TREE-VIEW (Page, 1996). Genetic distances were calculatedwith DNADIST (PHYLIP), assuming F84 as model ofnucleotide substitutions (Felsenstein & Churchill, 1996).The tree was confirmed by Maximum Parsimony (MP)DNAPARS (PHYLIP) and Bayesian inference (BI) (Mr-Bayes 3.1) (Huelsenbeck & Ronquist, 2001; Ronquist &Huelsenbeck, 2003).

Results

The presence of P. porosus in mainland Portugal andEurope is reported here for the first time. Nematodesequences obtained from this study are deposited in theEMBL/GenBank/DDBJ database (Table 1).

The GC content among sequences of Paratrichodorusspecies is lower (46.9-48.6%) than among Trichodorusspecies (48.8-49.3%). Nanidorus minor and N. nanussequences have a GC content (49.4-49.6%) closer toTrichodorus than to Paratrichodorus species.

A BLAST search for similarity with all the consensussequences isolated revealed, as expected, a greater simi-larity to trichodorids than to any other organisms (data not

shown). The percentage of similarity between all possiblesequence pairs, excluding the outgroups, varied between90 and 100% (Table 3).

PHYLOGENETIC ANALYSIS

The Trichodorus species investigated had genetic dis-tances ranging from 0.8% (T. beirensis and Trichodorussp. A) to 3.0% (Trichodorus sp. B and T. primitivusfrom Scotland), whereas in Paratrichodorus these val-ues ranged between 1.7% (P. hispanus and P. pachyder-mus from Scotland) and 11.9% (Paratrichodorus sp. andP. anemones from England) (Table 3). Genetic distancesbetween Nanidorus and Trichodorus species varied be-tween 3.9% and 5.4% (N. minor and T. lusitanicus andN. minor and Trichodorus sp. B, respectively) (Table 3).Much higher distances were found between the Nanidorusand Paratrichodorus species, ranging from 7.6% (N. mi-nor and P. pachydermus from Scotland) to 14.7% (N. mi-nor and P. anemones from England) (Table 3). Distancesbetween Paratrichodorus and Trichodorus were ca 5.2times greater than distances between species within Tri-chodorus. Genetic distances among the Paratrichodorusspecies studied were 4.5 times greater than among Tri-chodorus species (Table 3).

The best ML tree with a −Ln likelihood of 6540.436revealed two distinct clusters (Fig. 2). The bootstrapanalysis (1000 replicates) of 18 trichodorid populationsbelonging to 15 species had 79 and 99% bootstrapvalues for clusters I and II, respectively. While clusterI comprises the Trichodorus and Nanidorus populations,cluster II contains the Paratrichodorus species.

Cluster I primarily separated the Trichodorus speciesinto three subclusters, one of which may have evolved toNanidorus species (cluster IA), whilst the remaining sub-clusters represented all the studied Trichodorus species(clusters IB and IC). Cluster II is supported with a boot-strap value of 99% and revealed that Paratrichodorusspecies were divided into two different groups. One sub-cluster comprises P. allius, P. teres and P. porosus (clusterIIA), while the other (cluster IIB), comprises P. anemones,P. divergens, P. hispanus, P. pachydermus and Paratri-chodorus sp. Cluster IIB had the highest differences in ge-netic distances amongst all analysed species in this studyand this is reflected in the long branch lengths of bothP. anemones and the unidentified Paratrichodorus species(Fig. 2).

The population of P. anemones from England is locatedin the longest branch, indicating the most distant relation-ship with other Paratrichodorus species (genetic distances

174 Nematology

Phylogenetic of Trichodoridae from Portugal

Table 3. Similarity matrix between populations of Nanidorus, Paratrichodorus and Trichodorus species and Prismatolaimus intermediusand Tylolaimophorus minor, based on SSU rDNA sequences (above diagonal) and pairwise distance matrix calculated with F84 modelof nucleotide substitutions, with expected evolution parameters of Ts/Tv = 1.45 and gamma distribution = 2.294157. The geneticdistances were multiplied by 100 (below diagonal).

Nm Nm-Gr Nn6 Nn5 Tb TA Tl TB Tp Tp-Sct Pd Ph Pall-US Pt-Gr Ppo Ppa-Sct Pa-Sct P.sp. Tylol Prism

Nm 100 97 97 96 96 96 95 96 95 92 93 92 93 93 93 90 91 86 86Nm-Gr 0 97 97 96 96 96 95 96 95 92 93 92 93 93 93 90 91 86 86Nn6 2.61 2.61 99 96 96 96 95 96 95 92 93 92 92 93 93 90 91 86 86Nn5 2.68 2.68 0.06 96 96 96 95 96 95 92 93 92 92 93 93 90 91 86 86Tb 4.09 4.09 4.1 4.18 99 99 98 98 97 93 94 94 94 94 94 90 92 86 86TA 4.24 4.24 3.93 4 0.8 98 97 98 97 93 94 93 93 94 94 90 91 86 86Tl 3.85 3.85 4.04 4.12 0.93 1.07 97 98 97 93 94 94 94 94 94 90 91 86 86TB 5.4 5.4 5.14 5.22 2.12 2.48 2.49 97 96 92 93 93 93 93 93 90 91 85 85Tp 4.16 4.16 4.02 4.1 1.52 1.59 1.6 2.87 99 93 94 94 93 94 94 90 91 86 86Tp-Sct 4.27 4.27 4.14 4.21 1.67 1.74 1.68 3.04 0.12 92 93 93 93 93 93 90 91 86 86Pd 9.66 9.66 9.55 9.64 7.98 8.07 8.49 9.89 8.46 8.64 98 95 95 95 97 93 93 84 85Ph 7.67 7.67 8.05 8.13 6.56 6.83 7.23 8.17 7.2 7.36 2.1 96 96 96 98 93 95 85 86Pall-US 9.23 9.24 9.43 9.52 7.12 7.61 7.43 9.11 7.4 7.47 4.99 3.94 97 97 96 92 93 85 86Pt-Gr 8.7 8.7 9.5 9.59 7.13 7.62 7.44 8.88 7.5 7.57 5.82 4.37 2.64 97 96 91 93 85 86Ppo 8.07 8.08 8.91 9 6.44 7.09 6.46 8.44 6.88 7.04 5.18 3.94 2.98 3.31 97 91 93 86 86Ppa-Sct 7.55 7.55 7.76 7.84 6.04 6.69 6.6 7.98 6.66 6.81 3.15 1.69 3.61 3.87 2.98 93 94 85 86Pa-Sct 14.6 14.61 14.06 13.93 13.4 13.52 14.06 15.08 13.77 13.92 8.38 7.83 11.11 11.56 11.21 8.76 91 84 83P.sp. 11.9 11.91 11.85 11.95 10.97 11.3 11.9 12.81 11.52 11.75 7.62 5.93 9.01 8.72 8.28 6.92 11.91 85 84Tylol 25.25 25.26 23.8 23.94 25.19 24.91 24.8 28.21 24.54 24.62 31.04 27.83 29.76 27.45 26.98 28.41 32.59 29.47 86Prism 26.16 26.17 25.79 25.76 26.16 25.51 26.65 28.24 25.66 26.17 27.21 25.56 26.52 27.04 26.27 23.89 36.93 27.01 0

Nm, N. minor – Portugal; Nm-Gr, N. minor – Greece; Nn5, N. nanus (FJ040485); Nn6, N. nanus (FJ040486); Pa-Engl, P. anemones– England; Pall-US, P. allius – USA; Pd, P. divergens – Portugal; Ph, P. hispanus – Portugal; Ppa-Sct, P. pachydermus – Scotland;Ppo, P. porosus – Portugal; P.sp., Paratrichodorus sp. – Portugal; Pt-G, P. teres – Greece; Prism, Prismatolaimus intermedius; Tylol,Tylolaimophorus minor; Tb, Trichodorus beirensis – Portugal; Tl, T. lusitanicus – Portugal; Tp, T. primitivus – Portugal; Tp-Sct, T.primitivus – Scotland; TA, Trichodorus sp. A – Portugal; TB, Trichodorus sp. B – Portugal.

of 0.0838, 0.0783, 0.0876 and 0.1191 for P. divergens,P. hispanus, P. pachydermus and Paratrichodorus sp., re-spectively) (Table 3). The unidentified population of Para-trichodorus is located in the second longest branch withgenetic distances of 0.1191, 0.0762, 0.0593 and 0.0692for P. anemones, P. divergens, P. hispanus and P. pachy-dermus, respectively (Table 3). Results were confirmed byMP (Fig. 2) and BI (results not shown).

Discussion

Previous studies based on analysis of the SSU rDNAregion have allowed other authors to infer nematodemolecular phylogeny at different taxa levels (Aleshin etal., 1998; Blaxter et al., 1998, 2005; Kampfer et al.,1998; Bhadury et al., 2006; Holterman et al., 2006,2008a, b), some of them at species level, as for plant-parasitic groups such as Meloidogyne (De Ley et al.,2002), Bursaphelenchus (Kanzaki & Futai, 2002; Penaset al., 2006), Longidorus (Neilson et al., 2004) andXiphidorus (Oliveira et al., 2004a), with others used

to clarify synonymies, as for P. minor (syn. N. minor)(Boutsika et al., 2004a). To date, however, an extensivephylogenetic analysis of the family Trichodoridae hasbeen lacking.

The present study, based on the analyses of the align-ment of 18 trichodorid SSU rDNA sequences, allowedthe study of phylogenetic relationships among didel-phic species belonging to the genera Nanidorus, Para-trichodorus and Trichodorus (sensu Siddiqi, 1980, 2002)and to clarify the taxonomic status of Nanidorus.

The generic status of Nanidorus Siddiqi, 1974 wasproposed by Siddiqi (1980) and later reiterated (Sid-diqi, 2002). Nanidorus was differentiated from Paratri-chodorus based on: vulva shape (transverse slit-like inventral view vs a pore, a transverse slit or a longitudinalslit in Paratrichodorus), type of pharyngo-intestinal junc-tion (offset pharyngeal bulb vs either an offset pharyngealbulb, overlapping ventrosublateral pharyngeal glands ordorsal overlap of bulb by intestine or a combination ofboth type of overlaps), absence of body pores (cervicalpores (CP) in male, lateral body pores and caudal pores in

Vol. 12(2), 2010 175

I.M. Duarte et al.

Fig. 2. Phylogenetic relationships among Nanidorus, Paratrichodorus and Trichodorus species inferred from SSU rDNA sequencesderived from Maximum Likelihood (left) and Maximum Parsimony (right) analysis. Prismatolaimus intermedius and Tylolaimophorusminor were used as outgroups and bootstrap values (as percent of 1000 replications) are displayed at nodes. The scale bar of the ML treerepresents the number of nucleotide substitutions per position. Non-Portuguese sequences were obtained from EMBL/GenBank/DDBJdatabase. Abbreviations: Engl = England; Gr = Greece; Pt = Portugal; Sct = Scotland; US = USA. (Genetic distances based onTs/Tv = 1.45; α = 0.19.) This figure is published in colour in the online edition that can be accessed via http://www.brill.nl/nemy

both sexes vs body pores present, rarely absent), spiculetype (spicules longer than 1.5 times onchiostyle lengthvs spicules shorter), position of post-cloacal supplements(posterior on tail vs position variable), rarity or absenceof males vs males usually common in Paratrichodorus,a single ventromedian precloacal supplement (1 SP) vstwo to four SP and body length short (0.4-0.6 mm vs amuch wider range 0.38-1.72 mm). However, apart fromthe transverse slit-like vulva shape and the single precloa-cal SP in Nanidorus males (when present), some degreeof variability is known for all other characters in cur-rent Nanidorus species (Decraemer, 1980, 1995; Siddiqi,1980, 2002). Decraemer (1980) preferred not to split the

genus Paratrichodorus, even at subgenus level, because ofthe variation and doubtful diagnostic value of some of thecharacters, a decision since followed by most authors.

The molecular data studied herein provide new insights,particularly with respect to Nanidorus and, based onthe diverse grouping of Nanidorus and Paratrichodorusspecies, indicate strong evidence for regarding the formeras a distinct genus. Moreover, the phylogenetic tree ob-tained in this study showed both Nanidorus species (N.minor and N. nanus) strongly clustering with the Tri-chodorus group of species (supported by a high boot-strap value of 100%). Two of the Trichodorus species in-cluded, T. primitivus and T. lusitanicus, possess a trans-

176 Nematology

Phylogenetic of Trichodoridae from Portugal

verse slit-like vulva in ventral view, a feature originallyconsidered as the most important differentiating charac-ter of Nanidorus (Siddiqi, 1980). Since this feature occursin some Trichodorus spp. (and also in the genus Monotri-chodorus) (Siddiqi, 2002), it cannot be considered an apo-morphic feature for Nanidorus. So far, only the absence ofcaudal pores and a single SP in males appear to be clearsynapomorphies.

Boutsika et al. (2004a, b) found Paratrichodorus andTrichodorus species separated in distinct groups by aphylogenetic analysis based on 18S rDNA sequencesof three (P. minor (now N. minor), P. anemones andP. pachydermus) and four species (P. pachydermus, P.macrostylus, T. similis and T. primitivus), respectively.Furthermore, Boutsika et al. (2004a) also showed that P.minor (now N. minor) clustered separately from the othertwo Paratrichodorus species studied.

In another approach, Karanastasi et al. (2001) foundphenotypic differences in the ultrastructure of the cuti-cle in Trichodoridae, although they were apparently notstrictly genus-specific. Three groups based on cuticlestructure were established, two being genus-specific forParatrichodorus or Trichodorus species, respectively, al-though a third group included species from both genera,two of which were P. minor and P. nanus (now N. minorand N. nanus). Based on this attribute, these two specieswere placed in the same group as some Trichodorus spp.and a Paratrichodorus species (P. porosus). In a reviewof the ultrastructure of the nematode cuticle, Decraemeret al. (2003) considered that inferring nematode phylo-genetic relationships solely on the basis of cuticle mor-phology may be futile. However, we think that addi-tional information on cuticular ultrastructure from moretrichodorid species belonging to different genera shouldbe investigated and, when added to other morphologicaland molecular data, could help to clarify phylogenetic re-lationships in this family.

The N. minor populations from Greece and Portu-gal clustered together with 100% sequence similarity, al-though emanating from different geographical origins, afinding that suggests that the SSU rDNA has been totallyconserved.

Paratrichodorus anemones, P. divergens, P. hispanus,P. pachydermus and Paratrichodorus sp. from Portugalclustered together, a finding that agrees with their re-ported phenotypic similarities (Almeida, 1993; Decrae-mer, 1995; Almeida et al., 2005). Our analysis indicatesthat P. allius, P. porosus and P. teres form a distinctsubcluster. Specimens of the unidentified species of Por-

tuguese Paratrichodorus present morphobiometrical sim-ilarities with the Scottish P. pachydermus population, al-though their sequences are 94% similar and separatedby a large genetic distance (0.692). It could thereforebe suggested that these species are not intraspecific vari-ants of a single species, despite their clear similarities.The level of sequence divergence may be a result of ge-netic isolation and local biotope adaptation of the popu-lations and could reflect inter-specific variability. Contro-versy has surrounded attempts to define the morphobio-metric variability of speciation of other nematode popu-lations (Luc et al., 1998; Coomans et al., 2001; Lam-berti et al., 2004). The 18S rDNA used as the standardribosomal region to characterise nematodes molecularlyin the tree-of-life project (Stoeckler, 2003) possibly lacks,due to insufficient evolutionary change, enough discrim-inatory power to enable useful intraspecific phylogeneticinformation. Nevertheless, several reports have been pub-lished based on such intraspecific divergence for Longi-dorus diadecturus (0.6%; Neilson et al., 2004), for theXiphinema setariae/vulgare complex (0.4%; Oliveira etal., 2004b) and for the X. americanum-group populations(<0.5%; Lazarova et al., 2006).

The two Paratrichodorus species, P. allius and P.teres, albeit from different geographical origins, Amer-ica (USA) and Europe (Greece), respectively, clusteredtogether with a genetic distance of 0.0264, although, ac-cording to Decraemer (1995), there is a general morpho-logical resemblance between these species and they arenot usually confused in differential diagnosis.

The five examined Trichodorus species form a singlegroup, despite the fact that four of them, namely T.beirensis, T. lusitanicus and Trichodorus species A andB, clustered together and separately from T. primitivus, afinding that is in complete agreement with the phenotypic-based grouping (Almeida, 1993; Decraemer, 1995). Thelow genetic distances between them (0.0008 and 0.0249)could indicate that they are the result of recent speciationsince they could be clearly differentiated to species levelbased on morphological features, even when found mixedin soil samples (Almeida, 1993). This group of specieshas been exclusively reported in Portugal and are possiblyindigenous. They require further study to clarify theirbiological delimitation.

To elucidate Trichodoridae evolution, a larger numberof species and populations from diverse origins should beanalysed by phylogenetic analysis including other mark-ers. The cytochrome oxidase region I of mitochondr-ial DNA (mtDNA) sequence should also be investigated

Vol. 12(2), 2010 177

I.M. Duarte et al.

in this family. Combined analysis of morphological andmolecular data provides a new and better perspective forevaluating the evolution of trichodorids. It would also beinteresting to relate the speciation of trichodorids with theability of those species to transmit TRV isolates.

Acknowledgements

We are grateful to Eng. Almerinda Belchior from Eu-robata, Comércio de Produtos Alimentares, Eng. DelfimTeixeira from Zona Agrária de Chaves, Eng. Serafim An-drade and Eng. Graça Abreu from Direcção Regional deAgricultura de Beira Litoral (DRABL). We also wantto thank Mr António da Silva Garrido and Mr ManuelFernandes Marques from Cooperativa Agrícola de Es-posende, Mrs Vitalina Fernandes, Mr J.F. Reigota andEng. Pinheiro Duarte from DRABL, Zona Agrária deAveiro and Sociedade Agrícola da Quinta de Lagoalvade Cima, S.A., Alpiarça (www.lagoalva.pt/topo.html) andEng. Francisco Fernandes Farias (AGROTAB AgrotabEmpreendimentos Agro Industriais S.A.) for facilitatingthe collection of most Portuguese soil samples. Particularthanks are also due to Ms M. Graça Malhão for allowingthe collection of a P. porosus population from her veg-etable garden. We thank Dr Ana Paula Chung from Insti-tuto do Mar–Centro Interdisciplinar de Coimbra (IMAR-CIC) da Universidade de Coimbra, for assistance with op-erating the automated sequencers. We are grateful to Dr J.Helder for his valuable criticism of the manuscript whichallowed its improvement. Thanks also go to the ScientificProgramme of Universidade do Minho for suggestions inrevising the English text of the manuscript. This researchwas funded by CBMA (Centre of Molecular and En-vironmental Biology)/Department of Biology/Universityof Minho, and by Escola Superior Agrária de Coimbra,and was partly possible due to the facilities provided byIMAR-CIC, Departamento de Zoologia, Universidade deCoimbra. The work at the Scottish Crop Research Institutewas grant-aided by the Scottish Environment and RuralAffairs Department.

References

ALESHIN, V.X., KEDROVA, O.S., MILYUTINA, I.A., VLA-DYCHENSKAYA, N.S. & PETROV, N.B. (1998). Relation-ships among nematodes based on the analysis of 18S rRNAgene sequences, molecular evidence for a monophyly of chro-madorian and secernentian nematodes. Russian Journal ofNematology 6, 175-184.

ALMEIDA, M.T.S.C.M. DE (1993). Caracterização e ecolo-gia de populações portuguesas de Trichodorus spp. e Para-trichodorus spp. (Nematoda: Trichodoridae). Ph.D. Thesis,Universidade do Minho, Braga, Portugal, 567 pp.

ALMEIDA, M.T.S.C.M. DE & DECRAEMER, W. (2005). Tri-chodoridae, família de nematóides vetores de vírus. In: Luz,W.C. da, Fernandes, J.M., Prestes, A.M. & Picini, A.C. (Eds).Revisão Anual de Patologia de Plantas, Vol. 13. Passo Fundo,R.S., Brazil, pp. 115-190.

ALMEIDA, M.T.M. DE & SANTOS, M.S.N. DE A. (1997).Trichodorid nematodes in Portugal. In: Santos, M.S.N. de A.,Abrantes, I.M. de O., Brown, D.J.F. & Lemos, R.M. (Eds). Anintroduction to virus vector nematodes and their associatedviruses. Coimbra, Portugal, Instituto do Ambiente e Vida daUniversidade de Coimbra, pp. 443-465.

ALMEIDA, M.T.M. DE, SANTOS, M.S.N. DE A., ABRANTES,I.M. DE O. & DECRAEMER, W. (2005). Paratrichodorusdivergens sp. n., a new potential virus vector of tobaccorattle virus and additional observations on P. hispanus Roca& Arias, 1986 from Portugal (Nematoda: Trichodoridae).Nematology 7, 343-361.

ALTSCHUL, S.F., GISH, W., MILLER, W., MYERS, E.W. &LIPMAN, D.J. (1990). Basic local alignment search tool.Journal of Molecular Biology 215, 403-410.

BHADURY, P., AUSTEN, M.C., BILTON, D.T., LAMBSHEAD,P.J.D., ROGERS, A.D. & SMERDON, G.R. (2006). Devel-opment and evaluation of a DNA barcoding approach for therapid identification of nematodes. Marine Ecology ProgressSeries 320, 1-9.

BLAXTER, M.L., DE LEY, P., GAREY, J.R., LIU, L.X.,SCHELDEMAN, P., VIERSTRAETE, A., VANFLETEREN,J.R., MACKEY, L.Y., DORRIS, M., FRISSE, L.M. et al.(1998). A molecular evolutionary framework for the phylumNematoda. Nature 392, 71-75.

BLAXTER, M., MANN, J., CHAPMAN, T., THOMAS, F.,WHITTON, C., FLOYD, R. & ABEBE, E. (2005). Definingoperational taxonomic units using DNA barcode data. Philo-sophical Transactions of the Royal Society of London, SeriesB, Biological Sciences 360, 1935-1943.

BOUTSIKA, K., BLOK, V.C., PHILLIPS, M.S., LEWIS, S.A.,ROBBINS, R.T., FERRAZ, L.C.C.B. & BROWN, D.J.F.(2004a). Confirmation of the synonymy of Paratrichodoruschristiei (Allen, 1957) Siddiqi, 1974 with P. minor (Colbran,1956) Siddiqi, 1974 (Nematoda, Triplonchida) based onsequence data obtained for the ribosomal DNA 18S gene.Nematology 6, 145-151.

BOUTSIKA, K., BROWN, D.J.F., PHILLIPS, M.S. & BLOK,V.C. (2004b). Molecular characterisation of the ribosomalDNA of Paratrichodorus macrostylus, P. pachydermus, Tri-chodorus primitivus and T. similis (Nematoda: Trichodori-dae). Nematology 6, 641-654.

BROWN, D.J.F. & BOAG, B. (1988). An examination ofmethods used to extract virus-vector nematodes (Nematoda,

178 Nematology

Phylogenetic of Trichodoridae from Portugal

Longidoridae and Trichodoridae) from soil samples. Nema-tologia Mediterranea 16, 93-99.

BROWN, D.J.F. & WEISCHER, B. (1998). Specificity, exclusiv-ity and complementarity in the transmission of plant virusesby plant parasitic nematodes, an annotated terminology. Fun-damental and Applied Nematology 21, 1-11.

COOMANS, A., HUYS, R., HEYNS, J. & LUC, M. (2001).Character analysis, phylogeny, and biogeography of the genusXiphinema Cobb, 1913 (Nematoda: Longidoridae). Annalesdu Musée Royal de l’Afrique Centrale (Zoologie), Tervuren,Belgique 287, 1-289.

DECRAEMER, W. (1980). Systematics of the Trichodoridae(Nematoda) with keys to their species. Revue de Nématologie3, 81-99.

DECRAEMER, W. (1995). The family Trichodoridae: stubby rootand virus vector nematodes. Dordrecht, Kluwer AcademicPublishers, 360 pp.

DECRAEMER, W. & ROBBINS, R.T. (2007). The who, whatand where of Longidoridae and Trichodoridae. Journal ofNematology 39, 295-297.

DECRAEMER, W., KARANASTASI, E., BROWN, D.J.F. &THIERRY, B. (2003). Review of the ultrastructure of thenematode body cuticle and its phylogenetic interpretation.Biological Reviews of the Cambridge Philosophical Society78, 465-510.

DE LEY, I.T., DE LEY, P., VIERSTRAETE, A., KARSSEN,G., MOENS, M. & VANFLETEREN, J. (2002). Phylogeneticanalyses of Meloidogyne small subunit rDNA. Journal ofNematology 34, 319-327.

DUARTE, I.M., ALMEIDA, M.T.M. & BROWN, D.J.F. (2002).Tobacco rattle virus and its associated vector trichodoridnematodes in Portugal. Nematology 4, 264-265. [Abstr.]

FELSENSTEIN, J. (1993). Estimating effective population sizefrom samples of sequences, inefficiency of pairwise andsegregating sites as compared to phylogenetic estimates.Genetical Research 59, 139-147.

FELSENSTEIN, J. & CHURCHILL, G.A. (1996). A hiddenMarkov model approach to variation among sites in rates ofevolution. Molecular Biology and Evolution 13, 93-104.

HOLOVACHOV, O.V., BAKKER, J. & HELDER, J. (2006).Phylum-wide analysis of SSU rDNA reveals deep phyloge-netic relationships among nematodes and accelerated evolu-tion toward crown Clades. Molecular Biology and Evolution23, 1792-1800.

HOLTERMAN, M.H.M., HOLOVACHOV, O.V., VAN DEN

ELSEN, S.J.J., VAN MEGEN, H.H.B., BONGERS, A.M.T.,BAKKER, J. & HELDER, J. (2008a). Small subunit riboso-mal DNA-based phylogeny of basal Chromadoria (Nema-toda) suggests that transitions from marine to terrestrial habi-tats (and vice versa) require relatively simple adaptations.Molecular Phylogenetics and Evolution 48, 758-763.

HOLTERMAN, M.H.M., RYBARCZYK, K.D., VAN DEN

ELSEN, S.J.J., VAN MEGEN, H.H.B., MOOIJMAN, P.J.W.,SANTIAGO, R.P., BONGERS, A.M.T., BAKKER, J. &

HELDER, J. (2008b). A ribosomal DNA-based frameworkfor the detection and quantification of stress-sensitive nema-tode families in terrestrial habitats. Molecular Ecology Notes8, 23-34.

HUELSENBECK, J.P. & RONQUIST, F. (2001). MRBAYES:Bayesian inference of phylogeny. Bioinformatics 17, 754-755.

JENSEN, H.J., KOEPSELL, P.A. & ALLEN, T.C. (1974).Tobacco rattle virus and nematode vectors in Oregon. PlantDisease Reporter 58, 269-271.

KAMPFER, S., STURMBAUER, C. & OTT, C.J. (1998). Phylo-genetic analysis of rDNA sequences from Adenophorea ne-matodes and implications for the Adenophorea-Secernenteacontroversy. Invertebrate Biology 117, 29-36.

KANZAKI, N. & FUTAI, K. (2002). A PCR primer set for de-termination of phylogenetic relationships of Bursaphelenchusspecies within the xylophilus group. Nematology 4, 35-41.

KARANASTASI, E., DECRAEMER, W., ZHENG, J., ALMEIDA,M.T.M. & BROWN, D.J.F. (2001). Interspecific differencesin the fine structure of the body cuticle of TrichodoridaeThorne, 1935 (Nematoda, Diphtherophorina) and review ofanchoring structures of the epidermis. Nematology 3, 525-533.

LAMBERTI, F., HOCKLAND, S., AGOSTINELLI, A., MOENS,M. & BROWN, D.J.F. (2004). The Xiphinema america-num group. III. Keys to species identification. NematologiaMediterranea 32, 53-56.

LAZAROA, S.S., MALLOCK, G., OLIVEIRA, C.M.G., HUB-SCHEN, J. & NEILSON, R. (2006). Ribosomal and mitochon-drial DNA analyses of Xiphinema americanum-group popu-lations. Journal of Nematology 38, 404-410.

LUC, M., COOMANS, A., LOOF, P.A.A. & BAUJARD,P. (1998). The Xiphinema americanum group (Nematoda:Longidoridae). 2. Observations on Xiphinema brevicollumLordello & da Costa, 1961 and comments on the group. Fun-damental and Applied Nematology 21, 475-490.

NEILSON, R., YE, W., OLIVEIRA, C.M.G., HÜBSCHEN,J., ROBBINS, R.T., BROWN, D.J.F. & SZALANSKI, A.L.(2004). Phylogenetic relationships of Longidoridae species(Nematoda: Longidoridae) from North America inferred from18S rDNA sequence data. Helminthologia 41, 209-215.

OLIVEIRA, C.M.G., FERRAZ, L.C.C.B., MONTEIRO, A.R.,FENTON, B., MALLOCH, G. & NEILSON, R. (2004a).Molecular and morphometric analyses of Xiphidorus species(Nematoda, Longidoridae). Nematology 6, 715-728.

OLIVEIRA, C.M.G., HÜBSCHEN, J., BROWN, D.J.F., FER-RAZ, L.C.C.B., WRIGHT, F. & NEILSON, R. (2004b). Phy-logenetic relationships among Xiphinema and Xiphidorus ne-matode species from Brazil inferred from 18S rDNA se-quences. Journal of Nematology 36, 153-159.

PAGE, R.D.M. (1996). TreeView: An application to displayphylogenetic trees on personal computers. Computer Appli-cations in the Biosciences 12, 357-358.

Vol. 12(2), 2010 179

I.M. Duarte et al.

PENAS, A.C., METGE, K., MOTA, M. & VALADAS, V. (2006).Bursaphelenchus antoniae sp. n. (Nematoda: Parasitaphelen-chidae) associated with Hylobius sp. from Pinus pinaster inPortugal. Nematology 8, 659-669.

POWERS, T.O. (2004). Nematode molecular diagnostics: frombands to barcodes. Annual Review of Phytopathology 42, 367-383.

RONQUIST, F. & HUELSENBECK, J.P. (2003). MrBayes 3:Bayesian phylogenetic inference under mixed models. Bioin-formatics 19, 1572-1574.

SIDDIQI, M.R. (1974). Systematics of the genus TrichodorusCobb, 1913 (Nematoda: Dorylaimida), with descriptions ofthree new species. Nematologica 19, 259-278.

SIDDIQI, M.R. (1980). On the generic status of AtlantadorusSiddiqi, 1974 and Nanidorus Siddiqi, 1974 (Nematoda: Tri-chodoridae). Systematic Parasitology 1, 151-152.

SIDDIQI, M.R. (2002). Ecuadorus equatorius gen. n., sp.and Nanidorus mexicanus sp. n. (Nematoda: Trichodoridae).International Journal of Nematology 12, 197-202.

STANTON, J.M., MCNICOL, C.D. & STEELE, V. (1998).Non-manual lysis of second-stage Meloidogyne juveniles

for identification of pure and mixed samples based on thepolymerase chain reaction. Australasian Plant Pathology 27,112-115.

STOECKLER, M. (2003). Taxonomy, DNA, and the barcode oflife. BioScience 53, 2-3.

STRIMMER, K. & VON HAESELER, A. (1996). Quartet puz-zling: a quartet maximum likelihood method for reconstruc-tion tree topologies. Molecular Biology and Evolution 13,964-969.

TAYLOR, C.E. & BROWN, D.J.F. (1997). Nematode vectors ofplant viruses. Wallingford, UK, CABI Publishing, 286 pp.

THOMPSON, J.D., HIGGINS, D.G. & GIBSON, T.J. (1994).CLUSTAL W: improving the sensitivity of progressivemultiple sequence alignment through sequence weighting,position-specific gap penalties and weight matrix choice. Nu-cleic Acids Research 22, 4673-4680.

ZIJLSTRA, C., UENK, B.J. & VAN SILFHOUT, C.H. (1997).A reliable, precise method to differentiate species of root-knot nematodes in mixtures on the basis of ITS-RFLPs.Fundamental and Applied Nematology 20, 59-63.

180 Nematology