how anti-tumor immunity leads to autoimmunity in

HAL Id: tel-01492922https://tel.archives-ouvertes.fr/tel-01492922

Submitted on 20 Mar 2017

HAL is a multi-disciplinary open accessarchive for the deposit and dissemination of sci-entific research documents, whether they are pub-lished or not. The documents may come fromteaching and research institutions in France orabroad, or from public or private research centers.

L’archive ouverte pluridisciplinaire HAL, estdestinée au dépôt et à la diffusion de documentsscientifiques de niveau recherche, publiés ou non,émanant des établissements d’enseignement et derecherche français ou étrangers, des laboratoirespublics ou privés.

The Janus face of immunity : how anti-tumor immunityleads to autoimmunity in paraneoplastic neurological

diseasesChristina Gebauer

To cite this version:Christina Gebauer. The Janus face of immunity : how anti-tumor immunity leads to autoimmunityin paraneoplastic neurological diseases. Immunology. Université Paul Sabatier - Toulouse III, 2016.English. �NNT : 2016TOU30139�. �tel-01492922�

https://tel.archives-ouvertes.fr/tel-01492922

https://hal.archives-ouvertes.fr

et discipline ou spécialité

Jury :

le 15. Novembre 2016

Université Toulouse 3 Paul Sabatier (UT3 Paul Sabatier)

The Janus Face of Immunity How anti-tumor immunity leads to autoimmunity in

paraneoplastic neurological diseases

ED BSB : Immunologie

UMR 1043 Centre de Physiopathologie Toulouse Purpan

Prof. Roland LIBLAU

Christina GEBAUER

Prof. Eliane PIAGGIO Prof. Doron MERKLER Prof. Francois GHIRINGHELLI Prof. Joost VAN MEERWJIK Prof. Jacqueline MARVEL

Rapportrice Rapporteur Rapporteur

Président Examinatrice

et discipline ou spécialité

Jury :

le

15. Novembre 2016

Université Toulouse 3 Paul Sabatier (UT3 Paul Sabatier)

The Janus Face of Immunity How anti-tumor immunity leads to autoimmunity in

paraneoplastic neurological diseases

ED BSB : Immunologie

UMR 1043 Centre de Physiopathologie Toulouse Purpan

Prof. Roland LIBLAU

Christina GEBAUER

Prof. Eliane PIAGGIO Prof. Doron MERKLER Prof. Francois GHIRINGHELLI Prof. Joost VAN MEERWJIK Prof. Jacqueline MARVEL

Rapportrice Rapporteur Rapporteur

Président Examinatrice

☺

☺

☺

☺

☺

☺

☺

☺

☺

☺

[email protected]

γ

γ

γ

α

α β

0 5 10 15 200

20

40

60

80

100

days post-injection

% o

f tum

or -

free

anim

als

ns ****

0 5 10 15 200

20

40

60

80

days post-injection

Tum

or s

urfa

ce (m

m2 )

********

****

CD4+ T cells CD8+ T cells CD4+ T cells CD8+ T cells0

20

40

60

80

100

% a

mon

g Th

y1.2

+ CD

45.1

+ T

cells

divided cellsdivided IFN-γ+ cells

4T1-HA 4T1

*****

****

γ α

γ

-35

-30

-25

-20

-15

-10

-5

0

5

10

15

% w

eigh

t lo

ss

ns

****

-35

-30

-25

-20

-15

-10

-5

0

5

10

15

% w

eigh

t lo

ssns

****

0-103

103

104

105

0

-103

103

104

105

0-103

103

104

105

0

-103

103

104

105

0-103

103

104

105

0

-103

103

104

105

1.1498.4

0-103

103

104

105

0

-103

103

104

105

21.478.1

0-103

103

104

105

0

-103

103

104

105

3.8095.9

0-103

103

104

105

0

-103

103

104

105

81.4

0-103

103

104

105

0

50

100

150

CamK-HA (n=8) WT (n=4)0

5

10

15

20

25

rela

tive

fold

incr

ease

of

MH

CII

0

2

4

6

8

10

# Th

y1.2

+CD

45hi

gh c

ells

(x10

4 )

ns

****

0

2

4

6

8

10

# C

D45

high

CD

11bhi

gh c

ells

(x10

4 )

ns

****

3.9%

31.2%

18.1%

46.8%

CD45.1+ CD4+ T cellsCD45.1+ CD8+ T cellsCD45.1- CD4+ T cellsCD45.1- CD8+ T cells

γ α

IFNγ+TNFα+ GM-CSF+ IL-17A+0

5

10

25

50

75

100

% a

mon

g Th

y1.2

+ CD

45.1

+ CD

8+ T

cel

ls

transferred CD8

CNS (n=10)Tumor (n=5)Spleen (n=10)

ns**

**

ns


5

10

25

50

75

100

% a

mon

g Th

y1.2

+ CD

45.1

+ CD

4+ T

cel

ls

transferred CD4

***

**** **

*


5

10

25

50

75

100

% a

mon

g Th

y1.2

+ CD

45.1

- CD8

+ T

cells

endogenous CD8

Tumor (n=5)CNS (n=10)

Spleen (n=10)

**

*

***

****


5

10

25

50

75

100

% a

mon

g Th

y1.2

+ CD

45.1

- CD4

+ T

cells

endogenous CD4

*

***

******

***

CD44highCD62Llow KLRG1highCD127low CD44highCD62Lhigh0

10

2020

40

60

80

100

% a

mon

g Th

y1.2

+ CD

45.1

+ CD

4 +T

cel

ls

transferred CD4

***

**

*


20

40

60

80

100

% a

mon

g Th

y1.2

+ CD

45.1

+ CD

8 +T

cel

ls

transferred CD8

***

*

* CNS (n=8)TUMOR (n=3)SPLEEN (n=8)

ns


10

2020

40

60

80

100

% a

mon

g Th

y1.2

+ CD

45.1

- CD4

+ T

cells

endogenous CD4

*

ns

**

**


20

40

60

80

100

% a

mon

g Th

y1.2

+ CD

45.1

- CD8

+T

cells

endogenous CD8

*

**TUMOR (n=3)CNS (n=8)

SPLEEN (n=8)

*** *

*

αα

α

-35

-30

-25

-20

-15

-10

-5

0

5

10

15

% w

eigh

t los

s

IgG (n=16)PS/2 (n=15)

ns

0.0

0.5

1.0

1.5

2.0

2.5

3.0

# T

cells

in th

e C

NS

Thy1.2+CD45.1- Thy1.2+CD45.1+

ns

ns

0 5 10 15 20 250

50

100

150

days post-injection

tum

or s

urfa

ce (m

m2) 4T1-HA (n=6)

4T1 (n=6)

0

500

1.0K

1.5K

100

101

102

103

104

93.598.2

100

101

102

103

104

0

100

200

300

400

WT stomac

h

Tg stomac

h

WT duodenum

Tg duodenum

WT jejunum

Tg jejunum

Tg CNS0.0

0.2

0.4

0.6

0.8

ΔΔCp

D10-14 (n=15) D21 (n=5)0.0

0.2

0.4

0.6

0.8

1.0

1.2

# Th

y1.2

+CD

45.1

- T c

ells

(x10

^4)

n.s.

D10-14 (n=15) D21 (n=5)0.0

0.2

0.4

0.6

0.8

1.0

1.2

# Th

y1.2

+CD

45.1

+ T

cel

ls (x

10^4

)

**

D39 (n=7) D39 (n=7)0.0

0.2

0.4

0.6

0.8

1.0

1.2

# Th

y1.2

+CD

45.1

+ T

cells

(x10

4 )

n.s.

reinjection of 4T1-HA + CD4 and CD8 T cells

reinjection of 4T1-HA

reinjection of 4T1-HA + CD4 and CD8 T cells

reinjection of 4T1-HA

D39 (n=7) D39 (n=7)0.0

0.2

0.4

0.6

0.8

1.0

1.2

# Th

y1.2

+CD

45.1

- T c

ells

(x10

4 )

n.s.

CD4 CD8 CD4 CD80

20

40

60

80

100

% C

D25+

cel

ls

amon

g CD

44+C

D62L

- cel

ls CNS (n=8)

TUMOR (n=3)SPLEEN (n=8)

Thy1.2+CD45.1+ Thy1.2+CD45.1-

*** **

**** *

CTLA4 blockade elicits paraneoplasticneurological disease in a mouse model

Lidia M. Yshii,1,2 Christina M. Gebauer,1,* Beatrice Pignolet,1,3,* Emilie Maure,1

Clemence Queriault,1 Mandy Pierau,4 Hiromitsu Saito,5 Noboru Suzuki,5

Monika Brunner-Weinzierl,4 Jan Bauer6 and Roland Liblau1

*These authors contributed equally to this work.

CTLA4 is an inhibitory regulator of immune responses. Therapeutic CTLA4 blockade enhances T cell responses against cancer

and provides striking clinical results against advanced melanoma. However, this therapy is associated with immune-related adverse

events. Paraneoplastic neurologic disorders are immune-mediated neurological diseases that develop in the setting of malignancy.

The target onconeural antigens are expressed physiologically by neurons, and aberrantly by certain tumour cells. These tumour-

associated antigens can be presented to T cells, generating an antigen-specific immune response that leads to autoimmunity within

the nervous system. To investigate the risk to develop paraneoplastic neurologic disorder after CTLA4 blockade, we generated a

mouse model of paraneoplastic neurologic disorder that expresses a neo-self antigen both in Purkinje neurons and in implanted

breast tumour cells. Immune checkpoint therapy with anti-CTLA4 monoclonal antibody in this mouse model elicited antigen-

specific T cell migration into the cerebellum, and significant neuroinflammation and paraneoplastic neurologic disorder developed

only after anti-CTLA4 monoclonal antibody treatment. Moreover, our data strongly suggest that CD8+ T cells play a final effector

role by killing the Purkinje neurons. Taken together, we recommend heightened caution when using CTLA4 blockade in patients

with gynaecological cancers, or malignancies of neuroectodermal origin, such as small cell lung cancer, as such treatment may

promote paraneoplastic neurologic disorders.

1 INSERM UMR U1043 - CNRS U5282, Universite de Toulouse, UPS, Centre de Physiopathologie de Toulouse Purpan, Toulouse,31300, France

2 Department of Pharmacology, Institute of Biomedical Sciences I, University of Sao Paulo, 05508-900, Brazil3 Department of Clinical Neurosciences, Toulouse University Hospital, 31059, France4 Department of Experimental Paediatrics, University Hospital, Otto-von-Guericke University Magdeburg, 39120, Germany5 Department of Animal Genomics, Functional Genomics Institute, Mie University Life Science Research Center, 2-174 Edobashi,

Tsu, Mie 514-8507, Japan6 Department of Neuroimmunology, Center for Brain Research, Medical University of Vienna, A-1090, Austria

Correspondence to: Roland Liblau, MD, PhD,

Centre de Physiopathologie de Toulouse, Purpan Hospital, Place du Docteur Baylac TSA

40031, 31059 Toulouse Cedex 9, France

E-mail: [email protected]

Keywords: paraneoplastic neurological disorder; CTLA4; immunotherapy; Purkinje cells; neuroinflammation

Abbreviations: HA = haemagglutinin; mAb = monoclonal antibody

doi:10.1093/brain/aww225 BRAIN 2016: Page 1 of 12 | 1

Received April 15, 2016. Revised July 21, 2016. Accepted July 21, 2016.

� The Author (2016). Published by Oxford University Press on behalf of the Guarantors of Brain. All rights reserved.

For Permissions, please email: [email protected]

Brain Advance Access published September 6, 2016

by guest on September 7, 2016

http://brain.oxfordjournals.org/D

ownloaded from

IntroductionParaneoplastic neurological disorders are immune-mediated

diseases that develop in the setting of malignancy and offer

a unique prospect to analyse the interplay between tumour

immunity and autoimmune disease (Albert and Darnell,

2004; Steinman, 2014). In paraneoplastic neurological dis-

orders, the pathogenic adaptive immune response targets

proteins, so-called onconeural antigens, normally expressed

by neurons and aberrantly expressed by tumour cells

(Furneaux et al., 1990). Highly specific anti-neuronal auto-

antibodies in the serum and CSF represent key diagnostic

biomarkers. When these autoantibodies recognize cell sur-

face antigens, they most likely contribute to pathogenicity

(Tuzun et al., 2009; Graus et al., 2010). In contrast, when

onconeural antigens are localized intracellularly, T cells

provide a beneficial anti-tumoural response but are impli-

cated in inducing the deleterious autoimmune neurological

reaction (Pellkofer et al., 2004; Pignolet et al., 2013).

Paraneoplastic cerebellar degeneration, characterized by

the selective loss of Purkinje neurons in the cerebellum, is

an illustrative example of paraneoplastic neurological dis-

order targeting intracellular neuronal antigens (Albert et al.,

1998). Paraneoplastic cerebellar degeneration develops, in

particular, in patients with gynaecologic carcinomas that

express the Purkinje neuron-specific CDR2 protein, with

small cell lung cancer that expresses the neuronal HuD

protein, or with testicular cancer that expresses the Ma2

antigen (Mason et al., 1997; Albert et al., 1998; Dalmau

et al., 2004).

Cytotoxic T lymphocyte-associated antigen 4 (CTLA4) is

expressed transiently following activation of conventional T

cells, and constitutively by regulatory T cells (Tregs). This

receptor has a crucial role in limiting T cell responses

(Allison, 2015). Therefore, therapeutic blockade of

CTLA4 with antibodies has been tested to enhance anti-

tumour immunity, and proved to be efficient in murine

cancer models (Leach et al., 1996). This has led to the

clinical development of anti-CTLA4 antibody (ipilimumab)

as immunotherapy in patients with advanced melanoma or

other carcinomas (Hodi et al., 2010; Robert et al., 2011).

The benefit of this therapy for tumour control and survival

has since been confirmed. Collectively, immune checkpoint

inhibitors, and their combination, have revolutionized the

field of cancer immunotherapy (Allison, 2015). However,

anti-CTLA4 therapy is associated with a high frequency of

immune-related adverse events, notably autoimmune hypo-

physitis (Bertrand et al., 2015).

Patients affected with gynaecological cancers, or malig-

nancies of neuroectodermal origin, such as small cell lung

cancer, are particularly prone to develop paraneoplastic

neurological disorders. We, therefore, sought to investigate

whether the risk to develop paraneoplastic neurological dis-

order of autoimmune nature could be enhanced by anti-

CTLA4 therapy. To test this hypothesis, we generated a

mouse system in which the same model antigen is expressed

in cerebellar Purkinje cells and in an implanted breast

tumour. Using this in vivo setting, we assessed the impact

of anti-CTLA4 therapy on development of paraneoplastic

neurological disorder.

Materials and methods

Mice

6.5-TCR mice, CL4-TCR mice, L7-Cre, Mog-HA, and theRosa-Stop-HA (Rosa26rtm(HA)1Lib) mice have been describedelsewhere (Kirberg et al., 1994; Morgan et al., 1996; Saitoet al., 2005; Saxena et al., 2008). L7-Cre mice were back-crossed at least six times on the BALB/c background. We ob-tained the L7-HA mice by crossing L7-Cre with Rosa-Stop-HAmice. Mice were kept in specific pathogen-free conditionswithin the UMS006 animal facility, Toulouse, France. All pro-cedures involving animals were in accordance with theEuropean Union guidelines following approval by the localethics committee.

Reverse transcription polymerasechain reaction

To assess influenza virus haemagglutinin (HA) expression,total RNA was extracted with TRIzol

�(Life), followed by re-

verse transcription (SuperScript�

III, Invitrogen). The cDNAwas used as template for quantitative PCR using SYBR

�

Green I master mix (Roche) on a LightCycler 480 thermocy-cler (Roche). The following primers were used to amplify HA(forward 5’AAACTCTTCGCGGTCTTTCCA 3’, reverse 5’GATAAGGTAGCTTGGGCTGC 3’), Ctla4 (forward 5’GCTTCCTAGATTA CCCCTTCTGC 3’, reverse 5’ CGGGCATGGTTCTGGATCA 3’), and Hprt (forward 5’ TTGCTCGAGATGTCATGAAGGA 3’, reverse 5’ TGAGAGATCATCT CCACCAATAACTT 3’). HA mRNA expression was normalized toHprt mRNA.

Cell line and tumour implantation

The BALB/c mouse 4T1 breast cancer cell line and its 4T1-HAderivative that expresses HA (a gift from D. Klatzman) werecultured as described (Aslakson and Miller, 1992). 4T1 or4T1-HA cells (105) were injected subcutaneously into the leftflank of mice. Tumours were measured with a Vernier calliperdaily for 20 days, and the tumour size (w � l) is expressed asmm2.

Haemagglutinin-specific T cells

Naive HA-specific CD4+ and CD8+ T cells were purified from6.5-TCR and CL4-TCR mice, respectively. Spleens and lymphnodes were collected and T cells were purified (DynabeadsUntouched Mouse CD4+ or CD8+ Cells kit; Invitrogen).CD4+ T cells were incubated with anti-CD25 (clone PC61)monoclonal antibody (mAb) for Treg depletion. Naive Tcells were further purified based on expression of CD62L(Miltenyi Biotech). Naive CD4+ and CD8+ T cells (107

each), depleted of Tregs, were injected intravenously into the

2 | BRAIN 2016: Page 2 of 12 L. M. Yshii et al.



ownloaded from

mice. Mice were assessed daily for weight and neurologicalsigns.

Anti-CTLA4 and anti-CD8 treatment

For in vivo antibody therapy, the hamster anti-mouse CTLA4mAb (UC10-4F10-11) was produced by culturing hybridomacell lines in RPMI 1640 supplemented with low IgG foetalbovine serum. Antibodies were purified from supernatantsusing protein G purification (GE Healthcare). Mice were trea-ted through intraperitoneal injections of anti-CTLA4 mAb(100mg/mouse) at Days �1, 0, 2, 4, 6, 8, 10, 12, 14 and16. In one experiment, depleting anti-CD8 mAb (53.6.7) orcontrol IgG (200mg/mouse) were injected intraperitoneally atDays 7, 9, 11, 13, 15, 17 and 19.

Motor behavioural tests

Motor coordination was assessed with a Rotarod device(Bioseb) with acceleration from 4 to 40 rpm over a 600 speriod. For training, mice were tested on seven consecutivedays, thrice daily. During the investigation period (Day 0 toDay 20), the latency to fall was measured for each mousetwice daily, and the longest time was recorded. The 100%represents the Day 0 value. To test the spontaneous motoractivity an automated actimeter (ActiTrack) was used. Thisapparatus consists of four 22.5 cm2 surface areas with 16surrounding infrared beams coupled to a control unit. Theactivity was recorded for 10min every day, and total distancetravelled (m) was recorded.

Purification and activation of cere-bellum-infiltrating mononuclear cells

Brain-infiltrating mononuclear cell purification was describedpreviously (Martin-Blondel et al., 2015). Briefly, 15 days aftertumour implantation, mice were perfused with phosphate-buf-fered saline (PBS) and their cerebellum was dissected.Mononuclear cells were collected and used for flow cytometrystaining or in vitro stimulation with peptides. For the latter,cerebellum-infiltrating mononuclear cells were stimulatedin vitro for 16 h with HA512-520 or control H-2-Kd-bindingpeptide (Cw3170-179) for CD8+ T cells, and HA110-119 or con-trol H-2-IAd-binding peptide (OVA323-339) for CD4+ T cells.The cells were incubated with GolgiPlug

TM

(1:1000; BD) andGolgiStop

TM

(1:1000; BD) for 16 h.

Flow cytometry analysis

Lymph node cells, splenocytes, and tumour-infiltrating cellswere stained with anti-Thy1.2 (53-2.1, BD), anti-CD45 (30-F11, Biolegend), anti-CD8� (53-6.7, BD), anti-CD4 (RM4-5,BD), and anti-CD152 (UC10-4B9, eBioscience) mAbs.Cerebellum-infiltrating cells were stained with the followingantibodies: anti-Thy1.2, anti-CD45, anti-B220 (RA3-6B2,BD), anti-CD138 (281-2, BD), anti-CD8�, anti-CD4, anti-CD11b (M1/70, eBioscience), anti-IFN-� (XMG1.2, BD),anti-TNF-� (MP6-XT22, BD), and anti-IL-17A (TC11-18H10, BD). 4T1 and 4T1-HA tumour cells were stainedwith anti-CD80 (16-10A1, eBioscience) and anti-CD86 (GL1,BD) mAbs and in agreement with previous data (Ruocco et al.,

2012), we found no detectable CD80 and CD86 expression.Data were recorded on an LSRII Fortessa (BD Bioscience) andanalysed with the FlowJo software (Tree Star).

Immunohistochemistry

The light microscopical stainings were performed as described(Bien et al., 2012; Bauer and Lassmann, 2016). The primaryantibodies used were: anti-Calbindin D28K (1:2000, Swant),anti-CD3 (1:200, SP7, Zytomed), anti-CD8� (1:100, 4SM15,eBioscience), anti-Iba-1 (1:1000, Wako Chemicals), anti-Granzyme B (1:25, Santa Cruz), anti-activated caspase 3(1:3000, BD), anti-Mac3 (1:200, BD), anti-b2-microglobulin(1:1000, Santa Cruz), and anti-C9neo (a kind gift by DrPaul Morgan, Cardiff, UK). Staining for immunoglobulin (Ig)was performed using biotinylated donkey-anti-mouse Ig(Jackson). Quantification of immunohistochemistry data wasperformed by manual counting of Purkinje cells per mm2 ofPurkinje cell layer. In brief, for each mouse, the number ofPurkinje cells was determined from five equally sized cerebellarcortex regions (central lobules II, III, simple lobule, ansiformlobule, paramedian lobule) and normalized for the length ofthe Purkinje cell layer.

Immunofluorescence

The fluorescent stainings were performed as previouslydescribed (Bauer and Lassmann, 2016). The primary antibo-dies used were: rabbit anti-Calbindin D28K (1:2000, Swant),mouse anti-Calbindin D28K (1:2000, Sigma), mouse anti-HA37-38 hybridoma supernatant (1:10), rabbit anti-IP3R1(1:500, ThermoFisher), mouse anti-H-2Kd (1:500,ThermoFisher), anti-Granzyme B (1:25, Santa Cruz) and ratanti-CD8� (1:50). Images were analysed using ImageJ software(NIH).

Statistical analysis

Statistical analyses for two sets of data with normal distribu-tion and for paired data were performed using the Student’s t-test. Comparisons between multiple groups were performedusing the one-way ANOVA (post-test Tukey). For tumoursize and weight loss, data were analysed using the two-wayANOVA (post-test Sidak). The analyses were performed onPrism 6 (GraphPad Software). Groups were considered statis-tically different at a P-value50.05. The data are representedas mean � SEM (standard error of the mean).

Results

Model of paraneoplastic neurologicaldegeneration

To model experimentally paraneoplastic cerebellar degener-

ation, we designed a mouse model expressing the influenza

virus haemagglutinin (HA) specifically in Purkinje cells. We

crossed the Rosa-Stop-HA mice with the L7-Cre mice,

which express the Cre recombinase specifically in Purkinje

cells. In the resulting L7-HA mice, the stop cassette is

Paraneoplastic neurological disorder BRAIN 2016: Page 3 of 12 | 3



ownloaded from

excised due to L7-controlled Cre expression, leading to select-

ive expression of HA in Purkinje cells (Fig. 1A). Transcription

of HA was detected by reverse transcriptase polymerase chain

reaction (RT-PCR) in the cerebellum but not in other organs

of L7-HA mice, including the rest of the CNS. Cerebellum of

MOG-HA mice, which express HA in oligodendrocytes, was

used as a positive control (Saxena et al., 2008) (Fig. 1B).

Furthermore, by immunohistofluorescence, we confirmed

that HA protein expression was confined to Purkinje cells

in L7-HA mice as shown by the co-staining for HA and

calbindin (Fig. 1C). As expected, HA expression was not de-

tected in littermate control mice (wild-type).

Figure 1 Generation and characterization of the L7-HA mice. (A) Scheme of the L7-HA double knock-in mice. Top: In the Rosa-Stop-

HA mice, a LoxP-flanked Stop cassette followed by the haemagglutinin (HA) sequence was introduced in the Rosa26 locus. Middle: In the L7-Cre

mice, the Cre sequence was inserted in the Purkinje cell-specific L7/pcp2 gene. Bottom: In L7-HA mice, resulting from the crossing of the Rosa-

Stop-HA and L7-Cre mice, the Cre-mediated recombination within the Rosa26 locus permits transcription of HA. (B) HA mRNA expression

assessed by quantitative RT-PCR in different organs of L7-HA mice (black bar) or cerebellum of MOG-HA mice (open bar). One experiment

representative of three is shown. n.d. = not detected. (C) Expression of HA protein in Purkinje cells from L7-HA mice. Double immunostaining

for HA (green) and calbindin (Calb, red). Top row: Littermate control mouse (WT), bottom row: L7-HA mouse. Nuclear staining (DAPI). Scale

bar = 50mm. (D–G) CTLA4 expression was assessed by flow cytometry on Day 5 in transferred HA-specific Thy1.2+CD4+ (D) or

Thy1.2+CD8+ (E) T cells in the lymph nodes of Thy1.1 congenic mice bearing 4T1 or 4T1-HA tumour, and in tumour-infiltrating total CD4+

(F) and CD8+ (G) T cells.




ownloaded from

To further model paraneoplastic neurological disorder,

L7-HA or wild-type mice were challenged with the 4T1-

HA breast cancer cells that express the HA antigen. Given

the key role of T cells as effectors of tumour control and

paraneoplastic neurological disorder pathogenesis (Albert

and Darnell, 2004; Dalmau and Rosenfeld, 2008;

Pignolet et al., 2013), on the day of tumour implantation,

mice were transferred with HA-specific naive CD4+ and

CD8+ (CD4/CD8) T cells. CD4/CD8 T cells were capable

of partially controlling tumour growth as compared to mice

injected with tumour only (Fig. 2A), but they elicited no

patent neurological manifestations.

Anti-CTLA4 antibody triggers weightloss and reduced locomotion in L7-HA mice

We next addressed whether treatment with a mAb blocking

CTLA4 would increase anti-tumour immunity since a high

proportion of T cells activated by the HA-expressing

tumour expressed CTLA4/CD152 (Fig. 1D–G). Anti-

CTLA4 mAb therapy protected mice almost completely

from tumour outgrowth, regardless of their expression of

HA in the cerebellum (Fig. 2A). Strikingly, L7-HA mice

bearing 4T1-HA tumour and treated with anti-CTLA4

mAb lost weight significantly, from Day 15 onwards (Fig.

2B; P5 0.0001).

To investigate whether mice also developed neurological

signs, we evaluated motor activity. L7-HA mice bearing

4T1-HA tumour and treated with anti-CTLA4 mAb dis-

played a significant reduction in forced motor activity on

the Rotarod during the diseased period (Fig. 2C;

P5 0.0001). Using the actimeter test, we also revealed

reduced spontaneous locomotion in 4T1-HA tumour-bear-

ing L7-HA mice that received anti-CTLA4 mAb (Fig. 2D).

Importantly, no such clinical manifestations developed in

4T1-HA tumour-bearing wild-type mice treated with anti-

CTLA4 mAb or in 4T1-HA tumour-bearing L7-HA mice

not treated with anti-CTLA4 mAb (Fig. 2B–D).

Figure 2 CTLA4 blockade allows tumour control but causes weight loss and motor impairment in L7-HAmice. (A) Tumour size

was determined in L7-HA or wild-type (WT) mice implanted with 4T1-HA tumour cells (105), injected with no T cells or naive HA-specific CD4+

and CD8+ T cells (107 each), with or without treatment with anti-CTLA4 mAb. The values are from the subgroup of mice shown in (B), in which

tumour size was assessed daily (5 to 20 mice per group). (B) Weight of 4T1-HA tumour-bearing L7-HA or wild-type mice described in A. The

values are from 45 pooled experiments, involving 12 to 32 mice per group. (C) Rotarod performance in wild-type versus L7-HA mice treated as

described in A. �D0-D5 = sum of the percentage of time (normalized to Day 0) spent by a mouse on the Rotarod from Day 0 to 5, i.e. before

disease onset. No significant differences between groups exist before disease onset. �D15-D20 = sum of the time spent by a mouse on the

Rotarod from Day 15 to 20, i.e. after onset of weight loss. The data are from 45 pooled experiments. (D) Distance (m) travelled during a 10min

cycle. �D0-D5 = sum of the distance travelled from Day 0 to 5, i.e. before disease onset. �D15-D20 = sum of the distance travelled from Day 15

to 20, i.e. after disease onset. No significant differences between groups exist before disease onset. Pooled data from two independent ex-

periments. *P5 0.05; **P5 0.01; and ****P5 0.0001.




ownloaded from

Collectively, these results show that clinical signs resem-

bling paraneoplastic neurological disorder occur upon

CTLA4 blockade, only when the antigen is expressed

both in the CNS and tumour.

Therapeutic CTLA4 blockage inducescerebellar inflammation and Purkinjecell loss in L7-HA mice

To uncover the structural defects underlying the phenotype

caused by anti-CTLA4 mAb therapy in L7-HA mice, we

performed neuropathological analyses. L7-HA mice im-

planted with 4T1-HA tumour and treated with anti-

CTLA4 mAb showed a massive infiltration of T cells in

the cerebellum (Fig. 3C). In addition, clear local microglial

activation was present in these mice (Fig. 3F). Other brain

regions were spared from inflammation (data not shown).

Neither T cell infiltration nor microglial activation was de-

tected in the cerebellum of wild-type mice treated with anti-

CTLA4 mAb (Fig. 3A and D), or L7-HA mice not treated

with anti-CTLA4 mAb (Fig. 3B and E).

CTLA4 blockade also resulted in loss of Purkinje cell soma

and dendritic arborization in L7-HA mice (Fig. 3I), but not in

control mice (Fig. 3G and H), as detected by calbindin immu-

nostaining. This Purkinje cell loss was further confirmed by

IP3R1 immunoreactivity (Fig. 3J), another characteristic

marker of Purkinje cells (Miyata et al., 1999). No detectable

Ctla4 mRNA expression was detected in the cerebellum of

L7-HA mice, whereas a strong signal was evidenced in the

spleen (data not shown). We then quantified the number of

Purkinje cells by counting Calbindin+ cell bodies in 20 to

40mm of Purkinje cell layer. A very significant reduction in

Purkinje cells was observed in L7-HA mice treated with anti-

CTLA4 mAb, in comparison to the other groups (Fig. 3K).

The magnitude of Purkinje cell loss was similar between Days

20 and 45, underlining the acute nature of the paraneoplastic

autoimmune process (data not shown). Overall, in the 32 L7-

HA mice treated with anti-CTLA4 mAb, the mean loss of

Purkinje cells was 40%, with marked interindividual variabil-

ity ranging from 0 to 81% (Fig. 3K). Six L7-HA mice treated

with anti-CTLA4 mAb presented normal Purkinje cell dens-

ity, including five without cerebellar microglia activation and

T cell infiltration. Collectively, these data suggest that the

penetrance of disease is not 100% in our model. Thus, in

L7-HA mice treated with anti-CTLA4 mAb, paraneoplastic

neurological disorder is the consequence of massive cerebellar

inflammation associated with the destruction of onconeural

antigen-expressing Purkinje neurons.

Immune mechanisms of Purkinje celldeath in L7-HA mice with paraneo-plastic neurological disorder

To gain insight into the immune cells responsible for

Purkinje cell loss the cerebellum of L7-HA mice with para-

neoplastic neurological disorder was further studied by

flow cytometry. Contrasting with control mice, the cerebel-

lum of L7-HA mice with paraneoplastic neurological dis-

order harboured CD45high CD11blow lymphocytes as well

as CD45high CD11bhigh myeloid cells (Fig. 4A). Some B

cells (13.2 � 3.4% of blood-derived CD45high cells) includ-

ing a small number of CD138+ plasma cells (range 24 to

90 cells/cerebellum, n = 14) were present on Day 15 after

disease induction. T cells were the dominant population

with a mean of 2000 (range 3 to 9219 cells, n = 12)

CD4+ and 1300 (range 2 to 7405, n = 12) CD8+ T cells.

We then assessed the antigen specificity of these cerebellum-

infiltrating T cells. Few CD4+ T cells reacted ex vivo to HA

peptide by production of either IL-17 or IFN-� (Fig. 4B).

By contrast, cerebellum-infiltrating CD8+ T cells exhibited

a marked HA-specific production of IFN-� and TNF-� (Fig.

4C). These data indicate that HA-specific CD8+ T cells are

enriched in the cerebellum of L7-HA mice with paraneo-

plastic neurological disorder.

To further dissect the interaction between CD8+ T cells

and Purkinje cells, immunohistological investigations were

conducted in L7-HA mice exhibiting marked ongoing loss

of Purkinje cells and their neighbouring dendritic tree (Fig.

5A and B). Numerous CD8+ T cells were localized in close

contact with Purkinje soma or along their dendrites (Fig.

5C and D). In some instances, intimate interactions be-

tween CD8+ T cells and Purkinje cells were evidenced,

with indentation of the neuronal surface and polarization

of the cytolytic granules towards the CD8+ T cell/Purkinje

cell interface (Fig. 5E and F). Possibility of direct targeting

of Purkinje cells by HA-specific cytotoxic CD8+ T cells was

further strengthened by in situ detection of MHC class I-

expression in Purkinje neurons (Fig. 5G). In L7-HA mice

with paraneoplastic neurological disorder, some Purkinje

cells exhibited DNA fragmentation (Fig. 5H) and caspase

3 activation (Fig. 5I), indicating ongoing apoptosis.

Neuronophagia of cells with Purkinje-like morphology by

macrophages/microglia was also detected (Fig. 5J). We also

assessed Ig deposition and complement activation in the

cerebellum of these mice. Whereas Ig leaked into the cere-

bellum due to blood–brain barrier disruption

(Supplementary Fig. 1A), there was neither Ig binding

(Supplementary Fig. 1B) nor C9neo deposition

(Supplementary Fig. 1C) on Purkinje cells. Therefore, our

data suggest that the humoral immune response does not

play a main role in this model. Together, these findings

indicate that cerebellar inflammation is associated with

MHC class I expression on Purkinje cells, physical contact

with CD8+ T cells, which polarize their lytic granules to-

wards the neurons, strongly suggesting that cytotoxic T

cells deliver a lethal hit to Purkinje cells in an antigen-spe-

cific manner. To further explore the in vivo role of CD8+ T

cells in our model, we treated mice with a depleting anti-

CD8 mAb. Whereas mice treated or not with control IgG

exhibited loss of Purkinje cells (mean loss of 36 and 44%,

respectively), the five mice treated with the depleting anti-

CD8 mAb did not (data not shown).




ownloaded from

Figure 3 Treatment with anti-CTLA4 antibody induces marked cerebellar inflammation and Purkinje cell loss selectively in

L7-HA mice. (A–I) Histological analysis 20 days after transfer of naive HA-specific CD4+ and CD8+ T cells in L7-HA mice (B, C, E, F, H and I)

or littermate controls (A, D and G) implanted with 4T1-HA, with (A, C, D, F, G and I) or without (B, E and H) anti-CTLA4 mAb treatment.

Representative staining in brown for CD3+ cells (A–C; top row), microglia (Iba-1, D–F; middle row), and Purkinje cells (calbindin, G–I; bottom row);

nuclear counterstaining: haematoxylin (blue). Arrows in (I) point to loss of Purkinje cells. Scale bars = 100 mm. (J) Representative images of

immunofluorescence confocal microscopy using co-staining with anti-calbindin and anti-IP3R1 antibodies to label Purkinje cells with independent

markers. Nuclear staining was performed with DAPI. Scale bar = 50 mm. (K) Quantitative evaluation of the density of Purkinje cells in 4T1-HA

tumour-bearing wild-type (WT) and L7-HA mice, treated or not with anti-CTLA4 mAb. Results are expressed as mean � SEM of 6–32 mice per

group from six independent experiments analysed at either Day 20 or 45 (****P5 0.0001).




ownloaded from

Finally, we wondered whether analogous immunological

events could contribute to Purkinje cell targeting in human

paraneoplastic neurological disorder in which autoantibo-

dies have no demonstrated pathogenic effect. Confirming a

previous report (Aboul-Enein et al., 2008), close apposition

between CD8+ T cells and remaining calbindin+ Purkinje

cells was detected in patients with anti-Hu or anti-Ma2

antibody-associated encephalitis with prominent cerebellar

involvement (Fig. 5K and L).

DiscussionUsing a mouse model prone to develop paraneoplastic

neurological disorder, we explored the delicate balance

between tumour immunity and autoimmunity. As expected,

the anti-tumour T cell response was sufficient to reduce

tumour growth. Similar to the human situation, anti-

CTLA4 mAb, which antagonizes an inhibitory pathway

in T cells, increased the efficacy of this anti-tumour immun-

ity. Strikingly, however, this enhanced tumour control was

obtained at the expense of autoimmune paraneoplastic

neurological disorder. Actually, without anti-CTLA4 ther-

apy, none of the studied animals developed cerebellar in-

flammation, whereas the use of anti-CTLA4 mAb led to

cerebellar inflammation in 27/32 mice (84%).

Anti-CTLA4 therapy promotes anti-tumour immunity

through several converging mechanisms in both mice and

humans (Allison, 2015). In mice, anti-CTLA4 treatment

Figure 4 Characterization of immune cells within the cerebellum of L7-HA mice. Flow cytometry analysis of the cerebellum-

infiltrating cells in wild-type (WT) and L7-HA mice implanted with 4T1-HA, 15 days after transfer of naive HA-specific CD4+ and CD8+ T cells and

treatment with anti-CTLA4 mAb. (A) Cerebellum-infiltrating cells were stained with anti-CD45 (blood-derived cells), anti-CD11b (myeloid cells),

anti-Thy1.2 (T cells), anti-B220 (B cells), anti-CD138 cells (plasma cells), anti-CD4 and anti-CD8 mAbs. (B) Cerebellum-infiltrating CD4+ T cells

were stimulated in vitro for 16h with HA110-119 or a control H-2-IAd-binding peptide and IFN-� and IL-17A production was assessed by intracellular

staining. The absolute number of CD4+ T cells that produce IFN-� or IL-17A is shown in the right panels. The mouse indicated by a plus sign is

depicted on the flow cytometry plot presented on the left. (C) Cerebellum-infiltrating CD8+ T cells were stimulated in vitro for 16h with HA512-520

or a control H-2-Kd-binding peptide and IFN-� and TNF-� production was assessed. The absolute number of CD8+ T cells that produce IFN-� or

TNF-� is plotted on the right panels (*P5 0.05). The mouse indicated by a plus sign is depicted on the flow cytometry plot presented on the left.




ownloaded from

depletes Treg cells selectively from tumour via Fc� recep-

tor-expressing local macrophages, while the absolute num-

bers of effector T cells are increased (Simpson et al., 2013).

In addition, CTLA4 blockade on effector T cells, notably

on cytotoxic CD8+ T cells, appears essential for the

enhanced anti-tumour response following anti-CTLA4 ther-

apy. In that respect, human studies have shown that

CTLA4 blockade therapy increases the amplitude of

Figure 5 Immune mechanisms of Purkinje cell loss in experimental and human paraneoplastic cerebellar degeneration.

Cerebellum of wild-type (A) and L7-HA mice (B–J) 20 days after transfer of anti-HA specific T cells and anti-CTLA4mAb therapy. (A and B)

Calbindin staining shows marked loss of Purkinje cells in the L7-HA mice. Scale bars = 100 mm. (C) Double staining for CD8 (orange-brown) and

calbindin (dark blue) shows the presence of large numbers of CD8+ T cells in the molecular layer of the cerebellum. Scale bar = 50 mm. (D)

Double staining for CD8 and calbindin reveals cytotoxic T cells in contact with Purkinje cells. Scale bar = 20 mm. (E and F) Confocal fluorescence

triple staining for Granzyme-B (red), CD8 (green) and calbindin (blue) shows CD8+ T cells in close apposition to Purkinje cells. Note the position

of cytotoxic granules all facing the plasma membrane of the Purkinje cells. Scale bars = 10 mm. (G) Double staining for calbindin (blue) and b2-microglobulin (brown) showing MHC class I upregulation in the Purkinje cell. Scale bar = 25 mm. (H) Double staining for TUNEL (blue) and

calbindin reveals degeneration of a Purkinje cell (arrowhead). Scale bar = 50 mm. (I) Presence of a caspase-3-positive cell with condensed nucleus

in the Purkinje cell layer. Scale bar = 10mm. (J) Microglial cells stained for Mac-3 enclosing a Purkinje cell. Scale bar = 25 mm. (K) Double staining

for calbindin (blue) and CD8 (brown) shows severe loss of Purkinje cells and dendritic arborization in a patient with anti-Hu antibody-associated

paraneoplastic neurological disorder. Scale bar = 200mm. Arrowheads point at some remaining Purkinje cells. The inset shows a higher magni-

fication of a CD8+ T cell (arrowhead) in tight apposition to a Purkinje cell. (L) Loss of Purkinje cells (arrowheads) can also be seen in a patient

with anti-Ma2 antibody-associated paraneoplastic neurological disorder. Scale bar = 200 mm. Here the insets reveal multiple CD8+ T cells at-

tacking Purkinje cells.




ownloaded from

melanoma-specific CD8+ T cell responses against self-

antigens and, possibly, against tumour neoantigens

(Kvistborg et al., 2014; Van Allen et al., 2015).Importantly, CTLA4 deficiency is associated with multi-

tissue lymphocytic infiltration and damage of likely autoim-

mune origin (Waterhouse et al., 1995; Ise et al., 2010). Here

again, CTLA4 maintains T cell tolerance by regulating the

pathogenicity of autoantigen-specific T cells by both effector

T cell autonomous effects and non-cell autonomous mechan-

isms, involving Treg cells (Wing et al., 2008; Ise et al., 2010).

Furthermore, patients with CTLA4 haploinsufficiency present

multi-tissue inflammation, including brain and cerebellar in-

volvement (Kuehn et al., 2014; Schubert et al., 2014). Partly

mirroring these data, anti-CTLA4 therapy has been asso-

ciated with immune-related adverse events in �60% of trea-

ted patients (Bertrand et al., 2015). In particular, CNS

autoimmunity is part of the spectrum of immune-related ad-

verse events of anti-CTLA4 therapy. Indeed, autoimmune

hypophysitis has been widely recognized as a frequent side

effect of ipilimumab therapy (Iwama et al., 2014; Bertrand

et al., 2015). Exacerbation of pre-existing autoimmune dis-

ease has also been reported in patients with advanced mel-

anoma treated with ipilimumab (Johnson et al., 2016).

Whether de novo development of autoimmune side effects

is related to genetic susceptibility or to pre-existing serologic

evidence for autoantibodies is currently unknown.

In our mouse model, immune checkpoint therapy elicited

migration of antigen-specific T cells into the cerebellum and

subsequent killing of neurons, only when the antigen was

expressed in neurons. Our data strongly suggest that CD8+

T cells play a final effector role by specifically killing MHC

class I-expressing Purkinje cells in paraneoplastic cerebellar

degeneration. Purkinje cells have indeed been reported to

express MHC class I molecules (McConnell et al., 2009), a

feature confirmed here both in vitro upon IFN-� incubation

and in vivo. Based on these data and on the strong pro-

duction of IFN-� by cerebellum-infiltrating CD8+ T cells, it

is tempting to speculate that a pathogenic feed-forward

loop takes place. This involves IFN-� secretion by CD8+

T cells upon local recognition of onconeural antigens that

further promotes MHC class I presentation by neurons, in

turn rendering them vulnerable to killing by antigen-specific

CD8+ T cells. A similar scenario is likely at play in human

paraneoplastic neurological disorders with autoantibodies

against intracellular neuronal antigens. Indeed, an IFN-�

signature has been reported in the CSF of such patients

(Roberts et al., 2015). Additionally, CDR2-specific CD8+

T cells are present in the blood and CSF of patients with

paraneoplastic cerebellar degeneration (Albert et al., 1998,

2000) and they can kill CDR2-expressing target cells in an

HLA-restricted manner (Santomasso et al., 2007). Finally,in situ evidence for direct killing of neurons by cytotoxic T

cells has been documented by converging studies (Bien

et al., 2012). Our still images from the experimental

model and from tissue of patients with paraneoplastic

neurological disorder point to a possible T cell cooperation

for killing, as some target neurons are contacted

simultaneously by two or more CD8+ T cells. This feature

was recently associated with high probability of target cell

death using dynamic two-photon imaging in experimental

models of viral infection (Halle et al., 2016).

Our data highlight the induction of paraneoplastic neuro-

logical disorder after therapeutic blockade of CTLA4, rais-

ing the concern that checkpoint inhibitors, by enhancing

anti-tumour immunity, may inadvertently increase the like-

lihood for paraneoplastic neurological disorders.

Paraneoplastic neurological disorder development has

been associated with a better control of the underlying

tumour, attributed to a partly efficient anti-tumour adap-

tive immunity (Pignolet et al., 2013). In addition, the onco-

logic response to anti-CTLA4 therapy correlates with

immune-related adverse events (Bertrand et al., 2015).

Gynaecologic cancers and certain cancers of neuroectoder-

mal origin are particularly associated with paraneoplastic

neurological disorders. Consequently, the enhanced and

diversified anti-tumour T cell response promoted by anti-

CTLA4 therapy could lead to paraneoplastic neurological

disorder, in patients harbouring these types of cancers. As

suggested, based on theoretical grounds (Pignolet et al.,

2013; Steinman, 2014), our experimental model argues

that immune checkpoint inhibitors may favour paraneo-

plastic neurological disorder development. Interestingly,

two cases of autoimmune encephalomyelitis developing

after the first injection of immune checkpoint inhibitors

have been recently reported (Williams et al., 2016). The

sero-prevalence of anti-neuronal autoantibodies can be as

high as 29% in patients with small cell lung cancer

(Pignolet et al., 2013; Gozzard et al., 2015) and anti-neur-

onal antibodies are associated with T cells with the same

specificity (Albert et al., 2000). Therefore, a close monitor-

ing of neurological symptoms is warranted, at least in the

subgroup of patients with anti-neuronal autoantibodies,

when immune checkpoint inhibitors are being used.

AcknowledgementsWe acknowledge Dr Isabelle Dusart for advice regarding

the study of the cerebellum, and Drs Anne Dejean,

Abdelhadi Saoudi, Nicolas Blanchard, and Daniel

Gonzalez-Dunia for their valuable inputs on the manu-

script. The authors acknowledge the technical assistance

provided by CPTP Cytometry and Imaging facilities, and

histology and animal facility staff of US006.

FundingThis work was supported by grants from FP7-PEOPLE-

2012-ITN-Neurokine, ERA-NET Meltra-BBB, Midi-

Pyrenees Region, Fondation ARC pour la recherche sur le

cancer ARC, and Ligue regionale contre le cancer (R.L.).

L.M.Y. was supported by grant #2013/22196-4 from Sao

Paulo Research Foundation (FAPESP).




ownloaded from

Supplementary materialSupplementary material is available is available at Brain

online.

ReferencesAboul-Enein F, Hoftberger R, Buxhofer-Ausch V, Drlicek M,

Lassmann H, Budka H, et al. Neocortical neurones may be targeted

by immune attack in anti-Yo paraneoplastic syndrome. Neuropathol

Appl Neurobiol 2008; 34: 248–52.

Albert ML, Austin LM, Darnell RB. Detection and treatment of acti-

vated T cells in the cerebrospinal fluid of patients with paraneoplas-

tic cerebellar degeneration. Ann Neurol 2000; 47: 9–17.

Albert ML, Darnell JC, Bender A, Francisco LM, Bhardwaj N, Darnell

RB. Tumor-specific killer cells in paraneoplastic cerebellar degener-

ation. Nat Med 1998; 4: 1321–4.Albert ML, Darnell RB. Paraneoplastic neurological degenerations:

keys to tumour immunity. Nat Rev Cancer 2004; 4: 36–44.

Allison JP. Checkpoints. Cell 2015; 162: 1202–5.Aslakson CJ, Miller FR. Selective events in the metastatic process

defined by analysis of the sequential dissemination of subpopula-

tions of a mouse mammary tumor. Cancer Res 1992; 52: 1399–405.

Bauer J, Lassmann H. Neuropathological Techniques to investigate

central nervous system sections in multiple sclerosis. Methods Mol

Biol 2016; 1304: 211–29.

Bertrand A, Kostine M, Barnetche T, Truchetet ME, Schaeverbeke T.

Immune related adverse events associated with anti-CTLA-4 antibo-

dies: systematic review and meta-analysis. BMC Med 2015; 13: 211.Bien CG, Vincent A, Barnett MH, Becker AJ, Blumcke I, Graus F,

et al. Immunopathology of autoantibody-associated encephalitides:

clues for pathogenesis. Brain 2012; 135 (Pt 5): 1622–38.

Dalmau J, Graus F, Villarejo A, Posner JB, Blumenthal D, Thiessen B,

et al. Clinical analysis of anti-Ma2-associated encephalitis. Brain

2004; 127 (Pt 8): 1831–44.

Dalmau J, Rosenfeld MR. Paraneoplastic syndromes of the CNS.

Lancet Neurol 2008; 7: 327–40.

Furneaux HM, Rosenblum MK, Dalmau J, Wong E, Woodruff P,

Graus F, et al. Selective expression of Purkinje-cell antigens in

tumor tissue from patients with paraneoplastic cerebellar degener-

ation. N Engl J Med 1990; 322: 1844–51.

Gozzard P, Woodhall M, Chapman C, Nibber A, Waters P, Vincent

A, et al. Paraneoplastic neurologic disorders in small cell lung car-

cinoma: a prospective study. Neurology 2015; 85: 235–9.

Graus F, Saiz A, Dalmau J. Antibodies and neuronal autoimmune

disorders of the CNS. J Neurol 2010; 257: 509–17.

Halle S, Keyser KA, Stahl FR, Busche A, Marquardt A, Zheng X, et al.

In Vivo Killing Capacity of Cytotoxic T Cells Is Limited and

Involves Dynamic Interactions and T Cell Cooperativity. Immunity

2016; 44: 233–45.

Hodi FS, O’Day SJ, McDermott DF, Weber RW, Sosman JA, Haanen

JB, et al. Improved survival with ipilimumab in patients with meta-

static melanoma. N Engl J Med 2010; 363: 711–23.

Ise W, Kohyama M, Nutsch KM, Lee HM, Suri A, Unanue ER, et al.

CTLA-4 suppresses the pathogenicity of self antigen-specific T cells

by cell-intrinsic and cell-extrinsic mechanisms. Nat Immunol 2010;

11: 129–35.

Iwama S, De Remigis A, Callahan MK, Slovin SF, Wolchok JD,

Caturegli P. Pituitary expression of CTLA-4 mediates hypophysitis

secondary to administration of CTLA-4 blocking antibody. Sci

Transl Med 2014; 6: 230ra45.

Johnson DB, Sullivan RJ, Ott PA, Carlino MS, Khushalani NI, Ye F,

et al. Ipilimumab therapy in patients with advanced Melanoma and

preexisting autoimmune disorders. JAMA Oncol 2016; 2: 234–40.

Kirberg J, Baron A, Jakob S, Rolink A, Karjalainen K, von Boehmer

H. Thymic selection of CD8+ single positive cells with a class II

major histocompatibility complex-restricted receptor. J Exp Med

1994; 180: 25–34.

Kuehn HS, Ouyang W, Lo B, Deenick EK, Niemela JE, Avery DT,

et al. Immune dysregulation in human subjects with heterozygous

germline mutations in CTLA4. Science 2014; 345: 1623–7.

Kvistborg P, Philips D, Kelderman S, Hageman L, Ottensmeier C,

Joseph-Pietras D, et al. Anti-CTLA-4 therapy broadens the melan-

oma-reactive CD8+ T cell response. Sci Transl Med 2014; 6:

254ra128.

Leach DR, Krummel MF, Allison JP. Enhancement of antitumor im-

munity by CTLA-4 blockade. Science 1996; 271: 1734–6.

Martin-Blondel G, Pignolet B, Tietz S, Yshii L, Gebauer C, Perinat T,

et al. Migration of encephalitogenic CD8 T cells into the central

nervous system is dependent on the alpha4beta1-integrin. Eur J

Immunol 2015; 45: 3302–12.Mason WP, Graus F, Lang B, Honnorat J, Delattre JY, Valldeoriola F,

et al. Small-cell lung cancer, paraneoplastic cerebellar degeneration

and the Lambert-Eaton myasthenic syndrome. Brain 1997; 120 (Pt

8): 1279–300.

McConnell MJ, Huang YH, Datwani A, Shatz CJ. H2-K(b) and H2-

D(b) regulate cerebellar long-term depression and limit motor learn-

ing. Proc Natl Acad Sci USA 2009; 106: 6784–9.

Miyata M, Miyata H, Mikoshiba K, Ohama E. Development of

Purkinje cells in humans: an immunohistochemical study using a

monoclonal antibody against the inositol 1,4,5-triphosphate type 1

receptor (IP3R1). Acta Neuropathol 1999; 98: 226–32.

Morgan DJ, Liblau R, Scott B, Fleck S, McDevitt HO, Sarvetnick N,

et al. CD8( + ) T cell-mediated spontaneous diabetes in neonatal

mice. J Immunol 1996; 157: 978–83.

Pellkofer H, Schubart AS, Hoftberger R, Schutze N, Pagany M,

Schuller M, et al. Modelling paraneoplastic CNS disease: T-cells

specific for the onconeuronal antigen PNMA1 mediate autoimmune

encephalomyelitis in the rat. Brain 2004; 127 (Pt 8): 1822–30.

Pignolet BS, Gebauer CM, Liblau RS. Immunopathogenesis of para-

neoplastic neurological syndromes associated with anti-Hu antibo-

dies: a beneficial antitumor immune response going awry.

Oncoimmunology 2013; 2: e27384.Robert C, Thomas L, Bondarenko I, O’Day S, Weber J, Garbe C, et al.

Ipilimumab plus dacarbazine for previously untreated metastatic

melanoma. N Engl J Med 2011; 364: 2517–26.Roberts WK, Blachere NE, Frank MO, Dousmanis A, Ransohoff RM,

Darnell RB. A destructive feedback loop mediated by CXCL10 in

central nervous system inflammatory disease. Ann Neurol 2015; 78:

619–29.

Ruocco MG, Pilones KA, Kawashima N, Cammer M, Huang J, Babb

JS, et al. Suppressing T cell motility induced by anti-CTLA-4 mono-

therapy improves antitumor effects. J Clin Invest 2012; 122: 3718–

30.

Saito H, Tsumura H, Otake S, Nishida A, Furukawa T, Suzuki N. L7/

Pcp-2-specific expression of Cre recombinase using knock-in ap-

proach. Biochem Biophys Res Commun 2005; 331: 1216–21.

Santomasso BD, Roberts WK, Thomas A, Williams T, Blachere NE,

Dudley ME, et al. A T-cell receptor associated with naturally occur-

ring human tumor immunity. Proc Natl Acad Sci USA 2007; 104:

19073–8.

Saxena A, Bauer J, Scheikl T, Zappulla J, Audebert M, Desbois S,

et al. Cutting edge: multiple sclerosis-like lesions induced by effector

CD8 T cells recognizing a sequestered antigen on oligodendrocytes. J

Immunol 2008; 181: 1617–21.

Schubert D, Bode C, Kenefeck R, Hou TZ, Wing JB, Kennedy A, et al.

Autosomal dominant immune dysregulation syndrome in humans

with CTLA4 mutations. Nat Med 2014; 20: 1410–16.Simpson TR, Li F, Montalvo-Ortiz W, Sepulveda MA, Bergerhoff K,

Arce F, et al. Fc-dependent depletion of tumor-infiltrating regulatory

T cells co-defines the efficacy of anti-CTLA-4 therapy against mel-

anoma. J Exp Med 2013; 210: 1695–710.




ownloaded from

Steinman L. Conflicting consequences of immunity to cancer versusautoimmunity to neurons: insights from paraneoplastic disease.

Eur J Immunol 2014; 44: 3201–5.

Tuzun E, Zhou L, Baehring JM, Bannykh S, Rosenfeld MR, Dalmau J.

Evidence for antibody-mediated pathogenesis in anti-NMDAR en-cephalitis associated with ovarian teratoma. Acta Neuropathol

2009; 118: 737–43.

Van Allen EM, Miao D, Schilling B, Shukla SA, Blank C, Zimmer L,

et al. Genomic correlates of response to CTLA-4 blockade in meta-static melanoma. Science 2015; 350: 207–11.

Waterhouse P, Penninger JM, Timms E, Wakeham A, Shahinian A,Lee KP, et al. Lymphoproliferative disorders with early lethality in

mice deficient in Ctla-4. Science 1995; 270: 985–8.

Williams TJ, Benavides DR, Patrice KA, Dalmau JO, de Avila AL, Le

DT, et al. Association of autoimmune encephalitis with combinedimmune checkpoint inhibitor treatment for Metastatic cancer.

JAMA Neurol 2016; 73: 928–33. doi:10.1001.

Wing K, Onishi Y, Prieto-Martin P, Yamaguchi T, Miyara M,

Fehervari Z, et al. CTLA-4 control over Foxp3 + regulatory T cellfunction. Science 2008; 322: 271–5.




ownloaded from

α

γ

α

γ

α

PAPER TYPE

www.landesbioscience.com OncoImmunology e27384-1

OncoImmunology 2:12, e27384; December 2013; © 2013 Landes Bioscience

REVIEW

Introduction

Paraneoplastic neurological disorders (PNDs) are neurologi-cal manifestations associated with cancer that do not originate from tumor growth or the metabolic, infectious and toxic com-plications of malignancy and/or its treatment. This group of syn-dromes is highly diverse in terms of tissue damage and clinical signs. PNDs develop in the frame of naturally occurring antitu-mor immune responses. The targets of such an immunological response against malignant cells are self antigens physiologi-cally expressed by the normal nervous system and ectopically expressed by cancer cells. One of the most frequent PND is the paraneoplastic encephalomyelopathy/paraneoplastic sensory neuronopathy (PEM/PSN). PEM/PSN has also been named anti-Hu antibody-associated (or simply anti-Hu) syndrome, after

its linkage with high circulating levels of anti-Hu antibodies has been appreciated.

Clinical Aspects of the Anti-Hu Syndrome

In 85% of the cases, the anti-Hu syndrome is associated with lung cancer, mostly small-cell lung cancer (SCLC). More rarely, it develops in association with extrathoracic neoplasms such as neuroblastoma or intestinal, prostate, breast, bladder, and ovary carcinomas. Some patients affected by the anti-Hu syndrome present more than one primary cancer. Neurological manifes-tations compatible with the diagnosis of PEM/PSN have been observed in 1.4% of 432 SCLC patients and much more rarely in individuals bearing other types of cancer.1,2

A polyclonal antibody response against nuclear antigens expressed in the central nervous system (CNS), enteric neurons and dorsal root ganglion neurons, but not in other adult nor-mal tissues was first identified in 1985 in 2 patients presenting SCLC associated with subacute sensory neuropathy.3 The expres-sion “anti-Hu antibodies” was coined based on the first 2 letters of the surname of these patients. Anti-Hu antibodies were soon detected in multiple patients manifesting a rapid development of diverse neurological manifestations, including sensory neuropa-thy, cerebellar ataxia, limbic encephalitis, brainstem encephalitis, myelitis, or intestinal pseudo-obstruction. Anti-Hu antibodies are in fact frequently detected in multiple of the above-mentioned syndromes occurring in a paraneoplastic context. Interestingly, high titers of anti-Hu antibodies are absent in SCLC patients who do not exhibit neurological disorders.

Of major clinical importance, these neurological manifesta-tions precede the diagnosis of the cancer in more than 80% of the cases. Therefore, the detection of high circulating titers of anti-Hu antibodies in patients with a neurological condition indicates a paraneoplastic syndrome and should lead to a very thorough search of the underlying neoplasm. In some instances, the tumor

*Correspondence to: Roland S Liblau; [email protected]

Submitted: 10/28/2013; Revised: 11/29/2013; Accepted: 12/01/2013; Published

Online: 12/10/2013

Citation: Pignolet BSL, Gebauer CMT, Liblau RS. Immunopathogenesis of

paraneoplastic neurological syndromes associated with anti-Hu antibodies:

A beneficial antitumor immune response going awry. OncoImmunology

2013; 2:e27384; http://dx.doi.org/10.4161/onci.27384

Immunopathogenesis of paraneoplastic neurological syndromes associated

with anti-Hu antibodiesA beneficial antitumor immune response going awry

Béatrice SL Pignolet1,2,3,4, Christina MT Gebauer1,2,3, and Roland S Liblau1,2,3,4,*

1INSERM-UMR1043; Toulouse, France; 2CNRS, U5282; Toulouse, France; 3Universite de Toulouse; UPS; Centre de Physiopathologie Toulouse Purpan (CPTP); Toulouse, France; 4CHU Toulouse Purpan; Toulouse, France

Keywords: anti-Hu syndrome, autoimmunity, cancer, central nervous system, paraneoplastic neurological disorder

Abbreviations: BDNF, brain-derived neurotrophic factor; CNS, central nervous system; CSF, cerebrospinal fluid; DRG, dorsal root ganglia; ELAV, embryonic lethal abnormal visual; PBMC, peripheral blood mononuclear cell;

PEM, paraneoplastic encephalomyelopathy; PND, paraneoplastic neurological disorder; PSN, paraneoplastic sensory neuronopathy; SCLC, small-cell lung cancer; TCR, T cell receptor

Paraneoplastic neurological disorders (PNDs) are syn-dromes that develop in cancer patients when an efficient anti-tumor immune response, directed against antigens expressed by both malignant cells and healthy neurons, damages the nervous system. Herein, we analyze existing data on the mech-anisms of loss of self tolerance and nervous tissue damage that underpin one of the most frequent PNDs, the anti-Hu syn-drome. In addition, we discuss future directions and propose potential strategies aimed at blocking deleterious encephali-togenic immune responses while preserving the antineoplas-tic potential of treatment.

e27384-2 OncoImmunology Volume 2 Issue 12

is discovered only post-mortem or never, indicating either a com-plete disease regression4 or the occurrence of such autoimmune neurological manifestations independent of neoplasia. Indeed, cases of limbic encephalitis associated with anti-Hu antibodies but not with cancer have been described in children.5 A sponta-neously regressing or occult neuroblastoma cannot be formally excluded in these rare cases.

Interestingly, tumors exhibit a significantly less severe course and a lower propensity to generate metastases in patients with PEM/PSN than in patients who do not develop PNDs.6,7 The effect on tumor spread and overall survival is however moder-ate, and only 30% of patients survive for more than 2 y.7,8 In as much as 60% of the cases, the prognosis of the patients is determined by the outcome of the neurological disorders rather than by tumor progression.9 Of note, SCLC patients who do not manifest PNDs but harbor low titers of anti-Hu antibodies experience tumors of low stage, frequently respond to therapy, and live longer than cancer patients not producing anti-Hu anti-bodies.10,11 These findings reinforce the hypothesis that effective antitumor immune responses targeting Hu antigens may be dis-sociated from autoimmune manifestations.

As anti-Hu antibodies bind to antigens expressed both in malignant cells and healthy neurons, it was tempting to hypoth-esize that the anti-Hu syndrome could be an autoimmune disease triggered by cancer. This is reminiscent of vitiligo, developing in certain cases of melanoma,12 although in the case of PNDs, the cells targeted by the autoimmune process belong to a different tissue than their malignant counterparts, i.e., the immunoprivi-leged CNS.

Hu Antigens

Hu antigens in healthy neuronsThe search for the molecular targets of anti-Hu antibodies led

to the identification of 3 proteins of approximate molecular weight of 35–38 KDa expressed in the CNS. In malignant cells, the 38 KDa band is not detected. Screening a cDNA expression library from the human cerebellum with the sera of patients affected by the anti-Hu syndrome allowed for the cloning of the highly homologous genes HuD (official name: ELAV like neuron-specific RNA binding protein 4, ELAVL4), HuC, (official name: ELAV like neuron-specific RNA binding protein 3, ELAVL3) and HuB (official name; ELAV like neuron-specific RNA binding protein 2, ELAVL2; also known as Hel-N1). The Hu family actually con-sists of 4 members: HuA (official name: ELAV like RNA binding protein 1, ELAVL1; also known as HuR), HuB, HuC, and HuD. These proteins share extensive homology and are highly-con-served across species.13 HuA, the most divergent, is ubiquitously expressed13,14 and is not recognized by paraneoplastic antibodies. In contrast, HuB, HuC, and HuD expression is restricted to neu-rons, which all express one or more of these proteins.13

The Hu proteins are highly homologous to the Drosophila melanogaster nuclear protein ELAV (embryonic lethal abnormal visual), which plays a key role in neuronal development.15,16 HuB, HuC, and HuD operate as neuron-specific RNA-binding pro-teins. They contain 3 distinct RNA recognition motifs that bind

to AU-rich sequences, which often characterize the 3′ untrans-lated region of mRNAs and control their expression.17 Indeed, the Hu proteins have been implicated in mRNA stabilization and RNA turnover.18,19 Among various target mRNAs, HuD has recently been shown to bind, hence stabilizing, the brain-derived neurotrophic factor (BDNF)-coding mRNA.20 Moreover, neuro-nal Hu proteins have been shown to bind pre-mRNA species, thus regulating their alternative splicing.21 HuD is highly expressed in the nucleus, but also translocates to the cytoplasm, where it local-izes within small granules.22 The cytoplasmic localization of HuD appears to be essential for neuronal differentiation.23 In addition, HuD has been shown to interact with AKT1 to trigger the out-growth or neurites.24 Thus, Hu proteins, in particular HuD, have a major impact on multiple key neuronal processes.

Hu antigens in malignant cellsWhereas HuB, HuC, and HuD are all expressed in CNS neu-

rons, HuD is Hu antigen most frequently expressed by SCLC cells. This is a consistent observation in SCLC patients, irrespec-tive of whether they develop PEM/PSN or not.6,25 The HuD-coding mRNA has also been detected in SCLC cell lines.26 No somatic mutations or deletions/insertions affecting HuD have been observed in SCLC cell lines or tumors, including those from patients with PEM/PSN.27–29 However, a fine analysis of the post-translational modifications of HuD in cancer cells from patients developing or not PNDs has not been performed to date. Indeed, malignant cell-specific post-translational modifications of HuD may favor the development of an immune response that cross-reacts with neuronal Hu proteins. Moreover, the possible function(s) of HuD in the tumor biology, if any, has not been uncovered so far. SCLC and many cancers associated with PEM/PSN exhibit a neuroectodermal origin. The neuroectoderm includes the neural crest (melanocytes, dorsal root ganglia, gan-glia of the autonomous nervous system, adrenal glands, Schwann cells,…) and the neural tube (brain, spinal cord, retina, neuro-hypophysis). As a result, most SCLCs are composed of cells with a neuroendocrine phenotype, characterized by elevated expres-sion levels of L-dopa decarboxylase, neuron-specific enolase, and neuropeptides.30 These features resemble those of neural crest-derived endocrine cells disseminated in the normal bron-chial mucosa. Such a shared embryonic origin could explain the expression of HuD by SCLC cells.

Autoimmune responses against Hu proteins

Humoral responsesThe serum of patients with the anti-Hu syndrome reacts with

HuB, HuC, and HuD. Since HuD is the only Hu protein con-sistently expressed by SCLCs,25 it is the most likely initiator of autoimmune response against Hu antigens.

The presence of anti-HuD antibodies can be revealed using a large variety of techniques. The initial screening is generally performed by indirect immunohistochemistry on frozen sections of healthy human or rodent cerebral cortex, which results in a strong nuclear and weak cytoplasmic staining in the presence of anti-HuD antibodies (Fig. 1A). To firmly identify the antigenic targets, immunoblotting is performed as a complementary test


(Fig. 1B), using either neuronal nuclear extracts or recombinant HuD.31–33 ELISA can also be used, but its sensitivity appears to be lower than that than of immunob-lotting on purified HuD.33

The titers of circulating anti-Hu antibodies usually ranges from 2000 to 64 000 fold dilution in patients with PEM/PSN.32,34 Elevated serum titers of anti-Hu antibodies provide a highly valuable diagnostic biomarker. Conversely, low levels of anti-Hu antibodies can be detected in the absence of PNDs in 16 to 22.5% of SCLC patients and in less than 1% of patients with other malignancies.10,33,35

The anti-HuD IgG response is polyclonal and subclass distribu-tion analyses revealed that anti-Hu IgGs belong predominantly to the IgG1 and IgG3 isotypes.34,36,37 The HuD domains encompassing residues 90–101 and 171–206 are recognized by all anti-Hu serum samples. Conversely, the 223–234, 235–252, and 354–373 epitopes only react with sera of some patients with the anti-Hu syndrome.38

The titers of anti-Hu antibod-ies in the cerebrospinal fluid (CSF) vary from 100 to 4000 fold dilu-tion, pointing to intrathecal syn-thesis.32,39,40 Indeed, when adjusted to the same IgG concentration, the CSF/serum anti-Hu antibody index is > 1 in 86% of patients with paraneoplastic encephalomyelopathy.39 In patients exhibit-ing a CSF/serum antibody index > 1.5, a strong indication of the oligoclonal intrathecal synthesis of HuD-specific IgGs was obtained using isoelectric focusing followed by immunoblotting on HuD-loaded nitrocellulose membranes.41 Collectively, these findings indicate that anti-HuD autoantibodies are produced intrathecally in patients with robust CNS involvement. However, patients presenting with isolated PSNs do not exhibit intrathe-cal anti-Hu antibody synthesis.32 Interestingly, plasmapheresis succeeds in reducing the levels of anti-Hu autoantibodies in the serum but not in the CSF.39

Anti-Hu antibodies persist over time in the serum of SCLC patients with PEM/PSN while SCLC patients who do not develop PND remain seronegative.42 Importantly, 8–40% of the patients with PEM/PSN and anti-Hu antibodies also harbor autoantibodies targeting other neural antigens.35,43,44

Functional properties of anti-Hu antibodiesSince anti-Hu antibodies target intracellular antigens, their

pathogenic and antitumor potential is questionable. Interestingly,

a study documented the expression of Hu-related antigens on the surface of SCLC and neuroblastoma cell lines.45 Whether neu-rons exhibit a similar expression pattern of Hu proteins is cur-rently undetermined.

Experimentally, the contribution of anti-Hu antibodies to the development of PEM/PSN has been investigated in vitro, in cell cultures, and in vivo, upon injection of human antibodies to laboratory animals. In vitro, monoclonal antibodies specific for HuD have been shown to promote the apoptotic demise of neuroblastoma cell lines and primary myenteric neurons.46 The serum or IgG preparations from patients with the anti-Hu syn-drome could also kill human HuD-expressing cell lines and primary rodent neurons, a phenomenon that was accelerated in the presence of the complement system.46–48 However, this observation is not universal, and the lack of cytotoxic effects of anti-Hu positive sera on HuD+ cancer cells or primary murine neurons has also been reported.49,50 Moreover, even when neuro-nal cytotoxicity was observed, the specificity of the pathogenic autoantibodies was questioned, as the patients’ IgGs, but not an anti-HuD monoclonal antibody tested alongside, mediated such

Figure 1. Detection of autoantibodies associated with the anti-Hu syndrome. (A) Patient sera containing Hu-specific autoantibodies specifically recognize neurons in the central nervous system (CNS) (magnifi-cation 200 ×). Briefly, hippocampal (left panels) and cerebellar (right panels) rat slices (EuroImmun) were incubated with serum from either an individual not affected by paraneoplastic neurological disorders (PNDs) (negative control), either a patient with a confirmed anti-Hu syndrome (positive control), or a sub-ject suspected to suffer from the anti-Hu syndrome, followed by the detection of bound IgG using biotinyl-ated goat anti-human IgG, ABC and VIP kits (Eurobio). The test serum turned out to contain anti-neuron antibodies exhibiting a staining pattern compatible with that of anti-Hu antibodies. (B) The molecular identification of the specificity of such neuron-specific IgGs is made by immunoblotting-based diagnostic tests. Patient-derived serum (1/100 dilution) and cerebrospinal fluid (when available) are incubated on a membrane stripped (right panel) with paraneoplastic neurological syndrome-associated antigens, includ-ing amphiphysin, CV2, PNMA2 (Ma2/Ta), Ri, Yo, and Hu proteins (EuroImmun). Upon washing, bound IgGs are detected using alkaline phosphatase-conjugated anti-human IgG antibodies and their position is con-fronted to a reference scheme.


an effect.48 As discussed above, the serum of patients with PND often contain multiple neuron-targeting autoantibodies, some of which recognize surface receptors. Therefore, unless proper spec-ificity assays are conducted, for instance upon pre-absorbing IgG preparations on recombinant HuD, formal conclusions regarding the impact of anti-Hu antibodies on neuronal viability are dif-ficult to reach.

The intravenous administration of IgGs from patients with PEM/PSN and high titers of anti-Hu antibody to mice did not result in any CNS lesion.51,52 In addition, all attempts to gener-ate rodent models of the anti-Hu syndrome upon immunization with recombinant HuD failed to induce any signs of disease, CNS inflammation or neuronal degeneration, despite the devel-opment of high circulating titers of anti-HuD antibodies.51,53

Thus, although the presence of high anti-Hu titers in PND patients represents a highly valuable diagnostic tool, their role in disease pathogenesis appears at best dubious. Nevertheless, these autoantibodies reflect a strong autoimmune/antitumor immune response in which autoreactive T cells, specific for HuD or other self antigens, are likely to be involved.

T cell responsesThe peripheral blood mononuclear cells (PBMCs) of SCLC

patients with the anti-Hu syndrome exhibit an accumulation of activated HLA-DR+CD4+ T cells and memory CD45RO+CD4+ helper T cells as compared with anti-Hu antibody-negative SCLC patients.54,55 An increase in activated CD8+ T cells in these patients has also been reported.55 CD25brightCD4+ FOXP3+ T cells of untested immunosuppressive potential are elevated in SCLC patients regardless of the development of PEM/PSN. However, a reduced expression of FOXP3-, transforming growth factor β1 (TGFβ1)- and cytotoxic T lymphocyte-associated pro-tein 4 (CTLA4)-coding mRNAs has been detected in regulatory T cells from SCLC patients with PEM/PSN, suggesting a defect in their immunosuppressive activity.56 Consistent with the pleio-cytosis observed in diagnostic CSF analyses,57 increased amounts of T cells, mostly memory CD4+ and CD8+ T cells, characterize the CSF of patients with the anti-Hu syndrome.58

The involvement of (most often circulating) autoreactive T cells in the anti-Hu syndrome has been investigated using a vari-ety of methodological approaches. The PBMCs of SCLC patients with high anti-Hu antibody titers proliferate more vigorously in response to HuD and secrete abundant interferon γ (IFNγ), but not IL-4, as compared with PBMCs from SCLC patients without anti-Hu antibodies.54 HuD is therefore a likely antigenic target for primed autoreactive CD4+ T cells, presumably of the T

H1

subtype, implicating cell-mediated immunity in the anti-Hu syn-drome. However, CD4+ T-cell depletion, purification or block-ade experiments using anti-HLA class II antibodies have not yet been performed, and would be needed to unambiguously identify the responding cell type.

CD8+ T cells are considered to be the killer cell by excellence and are suspected to play a key pathogenic role in paraneoplastic cerebellar degeneration, another type of PND.59,60 In addition, solid tumors can express high level of MHC class I molecules and accumulating data indicate that MHC class I molecules can be upregulated on neurons, in particular during inflammatory

conditions.61 Thus, both cancer cells and neurons could be the targets of CD8+ T cells. However, in the past decade, efforts to identify HuD-specific CD8+ T cells in SCLC patients with the anti-Hu syndrome, using a combination of cytokine release assays and flow cytometry based on HLA:HuD peptide tetramers, have yielded conflicting observations. Indeed, some investigators have reported negative results,62,63 while others have found consistent evidence for such HuD-specific CD8+ T cells.64–66 This discrep-ancy may relate to the methodological approaches employed by these groups. Alternatively, it could be connected to timing, as the PBMCs of patients assessed within the first 3 mo of PEM/PSN onset exhibited more robust IFNγ ELISPOT responses to HuD-derived peptides than the PMBCs of patients tested later.65 Finally, the abovementioned discrepancy may reflect the assay used for the detection of HuD-specific CD8+ T cells. Indeed, in a study involving 4 HLA-A03:01-expressing patients with the anti-Hu syndrome, the PBMCs of only one were found to exhibit a classical cytotoxic profile with IFNγ secretion in response to the HuD

140–148 peptide. Surprisingly, the PBMCs of 2 patients

displayed a robust production of interleukin (IL)-5 and IL-13 in response to HuD

164–172 stimulation, but almost undetectable

cytotoxicity or IFNγ production.67 Of note, the PBMCs of none of the control subjects exhibited any type of response to HuD-derived peptides. These data suggest that anti-HuD CD8+ T-cell responses could be skewed toward a type 2, non-cytotoxic, profile in some patients with the anti-Hu syndrome, a pattern that could be easily missed using usual functional assays. However, whether the type of CD8+ T-cell response observed in PBMCs is reflective of what occurs within neoplastic lesions and in the nervous sys-tem is unknown. If so, how the effective antitumor response and neurological damage could be mechanistically explained?

Finally, it is possible that autoreactive T cells in the anti-Hu syndrome recognize additional or alternative neuronal antigens. Indeed, although antigens recognized by autoantibodies and autoreactive T cells largely overlap in most organ-specific auto-immune diseases, this is not necessarily the case.68 This aspect has not yet received adequate attention.

How is immune tolerance to neuronal Hu antigens broken in patients with PEM/PSN?

Studies performed in mice revealed that HuD-specific CD8+ T cells can be elicited upon immunization with recombinant adenoviruses expressing full-length HuD.69 However, the need for adjuvants and for further in vitro stimulation to detect HuD-specific CD8+ T cells point to a reduced frequency of HuD-specific T-cell precursors, their limited functional avidity, and/or to the existence of robust immunosuppressive network that oper-ate in vivo to maintain these cells under control. The robust ex vivo CD8+ T-cell response generated in HuD-deficient, but not in wild-type, mice provided direct evidence for partial induction of tolerance to HuD under physiological conditions.69 Interestingly, HuD is expressed, although at low levels, by MHCIIhigh thy-mic medullary epithelial cells and thymic CD8+ dendritic cells (http://immgen.org/). Importantly, patients with the anti-Hu syndrome do not manifest autoimmune reactions in tissues other than the nervous system, underlining the selective breakdown of tolerance to HuD, but not other Hu antigens such as HuA.


However, up to 40% of patients with the anti-Hu syndrome harbor autoantibodies specific for other neuronal proteins, such as the P/Q type voltage-gated calcium channel (associated with Lambert–Eaton myasthenic syndrome), indi-cating that self sensitization is not exquisitely directed to Hu antigens.43

Given the constant expression of HuD by SCLC cells, it is currently unclear why some patients develop PEM/PSN whereas others do not. Parameters intrinsic to the tumor and/or to the host may contribute to this range of variability. In patients with SCLC and the anti-Hu syndrome, MHC class I molecules were detected by immunohistochemistry at moder-ate or high levels in the neoplastic lesions of 13 out of 15 cases, whereas such levels were observed in none of 11 SCLC patients who did not develop PEM/PSN. In addition, the focal expression of HLA-DR was more frequent in tumors from SLCL patients with the anti-Hu syndrome than in patients without (6/15 vs 0/11).42 As a cause or consequence of this HLA expression pattern, tumors from PND patients may be heavily infiltrated with inflammatory cells.70 However, a thorough comparison of the cellular and molecular immune signature of neoplastic lesions from patients who developed or not PNDs has not yet been performed. This is highly relevant since the type, density, and location of tumor-infiltrating immune cells as well as the expression of genes related to immu-nological functions carry prognostic and predic-tive value.71 As mentioned earlier, either cancer cell-specific post-translational modifications of HuD and an unusual antigen processing within neoplastic lesions could favor the development of autoimmune responses targeting neuronal Hu. Such mechanisms have been implicated in tissue-specific autoimmune diseases in non-para-neoplastic contexts.68,72,73 As for host factors, the HLA-DR3 and HLA-DQ2 have been associated with the anti-Hu syndrome in one study,74 but not in a second one assessing only DR alleles.75 To date, no other genetic polymorphisms have been associated with PEM/PSN.

Here is a plausible scenario for the development of an auto-immune reaction against Hu proteins in patients with cancer of neuroectodermal origin. Although all SCLCs express HuD, the cross-presentation of HuD by dendritic cells and the activation of an efficient anti-Hu T-cell response is expected to occur only in a subset of patients, based on the available T-cell repertoire and genetic polymorphisms impacting on the magnitude and quality of the immune response, such as those within the HLA locus. The priming of a T-cell response specific for HuD (and possibly other onconeural antigens) may be sustained within the neoplastic lesion itself, owing to the ability of malignant cells to express MHC mol-ecules, possibly resulting in the inhibition of tumor growth. Since

15% of SCLC patients harbor low circulating titers of anti-Hu antibodies in the absence of neurological manifestations, HuD-specific immune responses might need to exceed a minimal threshold to overcome the relative immune privilege of the CNS. Above such a threshold, the HuD-specific immune response is expected to involve the CNS, as documented by the intrathecal synthesis of HuD-specific IgGs,41 as well as by the detection of HuD-specific CD8+ T cells in the CSF.67 This chronic autoim-mune reaction ultimately leads to neuronal destruction and fixed neurological disability (Fig. 2). The stabilization of neurological signs as well as the disappearance of anti-Hu antibodies has been associated with complete tumor response to therapy.7,76 These data suggest that malignant cells fuel the autoimmune process through the release of tumor-associated antigens.

Mechanisms of Tissue Damage in the Nervous System

The anti-Hu paraneoplastic syndrome is a heterogeneous dis-order with highly diverse clinical and pathological manifestations

Figure 2. Immunopathogenesis of the anti-Hu syndrome. An anti-Hu syndrome occurs when a vigorous immune response develops against the normally neuron-restricted antigen HuD ectopically expressed by an underlying tumor, most often small-cell lung carcinoma (SCLC). Tissue-resident dendritic cells capture antigens derived from malignant cells, including HuD (A). After the homing of these dendritic cells to tumor-draining lymph nodes, tumor-associ-ated antigens, including HuD, are processed and presented to activate antigen-specific CD4+ and CD8+ T cells (B). The activation of tumor-specific T cells may also occur within neoplastic lesions. In either case, tumor-specific T cells can reach neoplastic lesions. As cancer cells some-times express MHC class I molecules and likely present HuD-derived peptides, they become attractive targets for HuD-specific CD8+ T cell killing. Partial (or in rare cases complete) control of the tumor growth is therefore afforded (C). In parallel, the HuD-specific T cells activated in tumor-draining lymph nodes and/or within neoplastic lesions, circulate and acquire the capacity to cross the blood-brain-barrier (D). In the central nervous system (CNS), neurons can also express MHC class I molecules, in particular under inflammatory conditions, and can therefore present peptides derived from the highly homologous HuD, HuB, HuC proteins. Thus, neurons become additional targets for HuD-specific CD8+ T cells, resulting in neuronal tissue damage and the related paraneoplastic neurological manifestations (E).


in terms of lesion sites, inflammatory infiltrates, and neuronal damage. Despite this heterogeneity, a good correlation exists between the location and magnitude of neuronal loss or tissue damage and the type and severity of the clinical signs. Variable regions of the nervous system can be affected, with a prefer-ential targeting of the hippocampus, lower brain stem, spinal cord, and dorsal root ganglia (DRG).9,77,78 However, the cortex, medulla, amygdala, putamen, cingulate gyrus, and pons can also be affected.77,78 Neuropathological lesions are usually more wide-spread than anticipated based on clinical data. In the affected areas, neuronal loss, axonal damage, reactive gliosis, and microg-lial nodules are conspicuous.79 In contrast, there is no evidence of astrocyte and oligodendrocyte loss or demyelination.79 Ongoing neuronal apoptosis is either lacking or only occasionally detected, possibly a result of the subacute/chronic course of the disease or the post-mortem origin of the tissue under investigation.77,79

In patients with PEM/PSN, IgG deposits are detected in the nervous tissue, predominantly in the nuclei of CNS and DRG neurons, and to a lesser degree in the cytoplasm.10,37,80 This cel-lular distribution is highly reminiscent of the staining pattern observed with anti-Hu antibodies. The extraction of IgGs depos-ited in nervous tissues revealed that at least part of these IgGs are indeed anti-Hu antibodies. In some patients, abundant IgG deposits have been detected on the neuronal surface,37 suggesting the co-existence of additional anti-neuron autoantibodies. The amount of anti-Hu IgGs in specific areas of the nervous system is higher than its serum counterpart.80 However, the major clinical signs do not correlate with the localization of anti-Hu IgGs, as assessed by histology.78,80 Furthermore, in mice transferred with IgG from patients affected by the anti-Hu syndrome, intraneuro-nal IgG deposits were no longer detected if the animals were per-fused before brain tissue processing.51 The question of whether the anti-Hu IgGs deposited in the neuronal tissue of patients with PEM/PSN represents an artifact or a phenomenon of poten-tial pathogenic relevance is therefore raised. Irrespective of this issue, which requires further investigation, the complement sys-tem does not seem to play a significant role in the pathogenesis of the anti-Hu syndrome. Indeed, parenchymal C3 immunore-activity is weak or absent and no C9neo staining (a marker of complement-mediated tissue injury) is observed in affected brain areas.37,77,79,81

Inflammatory infiltrates are commonly found in DRG as well as in the CNS perivascular space and parenchyma. They are mainly composed of T cells, whereas natural killer (NK) cells are absent.37,77,79,81 B cells are occasionally detected in the perivascu-lar cuffs and meninges but they rarely infiltrate the brain paren-chyma. In inflamed tissues, macrophages are mostly restricted to the perivascular space, whereas CD68+ microglial cells are found in the parenchyma.37,77,82,83 Among T lymphocytes, CD4+ T cells are mainly located in perivascular areas, whereas CD8+ T cells represent by far the major component of the parenchy-mal infiltrates.37,77,79,82,83 CD8+ T cells usually form clusters and frequently localize around neurons.77,79 Immunohistochemical analyses revealed a close contact of cytotoxic granule-containing T cells with neurons in the brain tissue or DRG of patients with the anti-Hu syndrome, with, in some instances, indentation of

the neuronal surface by the “attacking” CD8+ T cells.83 MHC class I molecules has been shown to be expressed on neurons in the inflamed nervous tissue from patients with PEM/PSN.79,84 In this context, the close apposition of CD8+ T cells with neu-rons and the polarization of membranous CD107a79 may reflect a cognate, antigen-dependent, in vivo interaction leading to the neuronal demise. In addition, CD8+ T cell-derived IFNγ has recently been demonstrated to promote the loss of dendrites and synapses, underlying the need to assess presence of this cytokine (or phosphorylated signal transduction and activator of transcrip-tion 1, STAT1) in brain sections from patients affected by the anti-Hu syndrome.85 In these individuals, the amount of reactive microglia is increased in all affected areas of the CNS. Microglial cells participate in the clusters of inflammatory cells in the gray matter and, together with CD8+ T cells, surround neurons.77

Collectively, these observations strongly suggest that a cyto-toxic CD8+ T cell-mediated attack contributes to neuronal death and axonal damage that characterize the anti-Hu syndrome, and therefore to its neurological manifestations. However, it remains to be determined whether these CD8+ T cells are Hu-specific. Studies of the specificity of tissue-derived TCRs should help resolve this question. To date, the analysis of TCR β chain usage by immunohistochemistry has revealed an overrepresentation of certain Vβ families in 3 out of 5 patients with PEM/PSN. Lesion-infiltrating T cells expressing the expanded Vβ fami-lies were mostly CD8+ T cells. Interestingly, in some patients, similarly expanded Vβ sequences were detected in the CSF or affected areas of the nervous system as well as within neoplastic lesions.76,86

Future Directions

Future investigations to obtain better insights into the mecha-nisms leading to antitumor immunity and nervous tissue autoim-munity in patients with PEM/PDN should integrate the in-depth molecular analysis of tissue samples (neoplastic lesions as well as neural tissue) and the development of relevant animal models. In turn, this new knowledge should assist the development of effective immunotherapies, which are dearly needed for patients suffering from the anti-Hu syndrome.

The mechanisms that trigger anti-Hu antibody-associated PNDs are not yet elucidated but appear tightly linked to the development of a partly efficient antitumor immune response. The comparison of the type, density, and location of tumor-infiltrating immune cells in SCLC patients who developed or not an anti-Hu syndrome, complemented by gene-expression profiling studies, may identify signatures that are predictive of improved tumor control and/or PND development. Confronted to data emerging from a wide variety of cancers,71 this infor-mation will help investigators to assess whether the magnitude and functional orientation of intratumoral adaptive immune responses correlate with development of the anti-Hu syndrome. Similarly, the immune reaction developing in the nervous tissue of patients with PEM/PDN needs to be dissected at the molecu-lar level using unbiased approaches. Given the dramatic and sub-acute course of the neurological disease in many patients with the


anti-Hu syndrome, post-mortem tissues are available in which neurons are actively targeted by the immune system. A thorough investigation of the antigen specificity of CNS-infiltrating CD8+ T cells using a combination of tissue laser microdissection, TCR cloning and antigen screening76,87 will inform whether HuD is the key antigenic target for pathogenic T cells or whether alterna-tive/additional autoantigens are involved.

Animal models represent valuable tools to test hypotheses regarding the initiation and the effector mechanisms of human autoimmune diseases, as well as for the development of new therapeutic strategies. A valid animal model for the anti-Hu syn-drome should recapitulate the following features: (1) the existence of one or more antigens that are expressed by both malignant cells and normal neurons; (2) the development of a detectable immune response against such shared antigens; (3) the inhibi-tion of tumor growth by this antitumor immune response; (4) the immune infiltration of the nervous system as well as neuronal death and its related clinical consequences as a result of the anti-tumor/autoimmune response. To date, no animal model of the anti-Hu syndrome has been successfully developed. Attempts to mimic the human disease through the transfer of patient-derived IgGs or the deliberate immunization of experimental animals with HuD have resulted in high titers of circulating anti-HuD antibodies but no neuropathological lesions.51,88 Interestingly, a mouse strain bearing a conditional deletion of both Trp53 and Rb1 in the lung develops Hu-expressing SCLCs. Although about 15% of these mice also develop high titers of anti-Hu antibodies in the serum, no neurological signs become manifest.89 Similarly, the adoptive transfer of rat T

H1 cells specific for an onconeural

antigen led to meningeal and perivascular CNS inflammation but failed to induce neuronal damage or overt clinical manifesta-tions in recipient animals.90 Therefore, a robust animal model is still needed to pinpoint the immunological mechanisms leading to neurological tissue damage in patients with the anti-Hu syn-drome, and to test therapeutic strategies aimed at blocking the encephalitogenic immune response without affecting productive antitumor immunity.

An early diagnosis of PEM/PSN is possible since the anti-Hu antibody provides a highly specific biomarker. The effective treatment of the underlying tumor represents the main but not the sole facet of PEM/PSN management. Indeed, a wealth of data suggests that immunotherapy should be initiated before neuro-logical symptoms have reached their plateau. To date, various approaches have been used, ranging from high-dose corticoste-roids, to intravenous immunoglobulins and cyclophosphamide, but they have provided benefit to a few patients.7,44,91 A study showed no detectable adverse effects of these immunotherapies on tumor control or patient survival, although it was underpow-ered to detect the negative impact of a given intervention.7 Based on the information detailed above, pointing at CD8+ T cells as key immune effectors of the neurological tissue damage expe-rienced by patients with the anti-Hu syndrome, an early and aggressive targeting of these cells should be envisioned. Approved molecules preventing the entry of T cells into the nervous system, such as anti-α4 integrin antibodies or functional antagonists of the sphingosine-1-phosphate receptor, represent very attractive possibilities in this respect.92–94 In addition, given the deleterious role of IFNγ in CD8+ T cell-mediated neurological disorders,85,95 IFNγ blockade could also constitute a valuable strategy, provided that it does not interfere with anticancer therapy. Conversely, the blockade of immune checkpoints96 should be tested with utmost caution in patients bearing tumors potentially associated with the anti-Hu syndrome, as they may unleash a dramatic neurological autoimmunity, in particular among individuals with detectable anti-Hu antibodies.

Disclosure of Potential Conflicts of Interest

No potential conflicts of interest were disclosed.

Acknowledgments

We thank Jean-Yves Delattre from ICM, Pitié-Salpetrière, Paris for the Figure 1, Daniel Gonzalez-Dunia for critical read-ing of the manuscript and ARC, INSERM and Région Midi-Pyrénées for financial support.

References1. Darnell RB, Posner JB. Observing the invisible: suc-

cessful tumor immunity in humans. Nat Immunol 2003; 4:201; http://dx.doi.org/10.1038/ni0303-201; PMID:12605223

2. Seute T, Leffers P, ten Velde GP, Twijnstra A. Neurologic disorders in 432 consecutive patients with small cell lung carcinoma. Cancer 2004; 100:801-6; http://dx.doi.org/10.1002/cncr.20043; PMID:14770437

3. Graus F, Cordon-Cardo C, Posner JB. Neuronal antinuclear antibody in sensory neuronopathy from lung cancer. Neurology 1985; 35:538-43; PMID:2984600; http://dx.doi.org/10.1212/WNL.35.4.538

4. Darnell RB, DeAngelis LM. Regression of small-cell lung carcinoma in patients with para-neoplastic neuronal antibodies. Lancet 1993; 341:21-2; PMID:8093269; http://dx.doi.org/10.1016/0140-6736(93)92485-C

5. Honnorat J, Didelot A, Karantoni E, Ville D, Ducray F, Lambert L, Deiva K, Garcia M, Pichit P, Cavillon G, et al. Autoimmune limbic encepha-lopathy and anti-Hu antibodies in children with-out cancer. Neurology 2013; 80:2226-32; http://dx.doi.org/10.1212/W NL.0b013e318296e9c3 ; PMID:23658383

6. Dalmau J, Graus F, Rosenblum MK, Posner JB. Anti-Hu--associated paraneoplastic encepha-lomyelitis/sensory neuronopathy. A clini-cal study of 71 patients. Medicine (Baltimore) 1992; 71:59-72; PMID:1312211; http://dx.doi.org/10.1097/00005792-199203000-00001

7. Keime-Guibert F, Graus F, Broët P, Reñé R, Molinuevo JL, Ascaso C, Delattre JY. Clinical out-come of patients with anti-Hu-associated encepha-lomyelitis after treatment of the tumor. Neurology 1999; 53:1719-23; PMID:10563618; http://dx.doi.org/10.1212/WNL.53.8.1719

8. Monstad SE, Drivsholm L, Storstein A, Aarseth JH, Haugen M, Lang B, Vincent A, Vedeler CA. Hu and voltage-gated calcium channel (VGCC) antibod-ies related to the prognosis of small-cell lung can-cer. J Clin Oncol 2004; 22:795-800; http://dx.doi.org/10.1200/JCO.2004.01.028; PMID:14990634

9. Graus F, Keime-Guibert F, Reñe R, Benyahia B, Ribalta T, Ascaso C, Escaramis G, Delattre JY. Anti-Hu-associated paraneoplastic encephalomyeli-tis: analysis of 200 patients. Brain 2001; 124:1138-48; PMID:11353730; http://dx.doi.org/10.1093/brain/124.6.1138

10. Dalmau J, Furneaux HM, Gralla RJ, Kris MG, Posner JB. Detection of the anti-Hu antibody in the serum of patients with small cell lung cancer--a quantitative western blot analysis. Ann Neurol 1990; 27:544-52; http://dx.doi.org/10.1002/ana.410270515; PMID:2163235

11. Graus F, Dalmou J, Reñé R, Tora M, Malats N, Verschuuren JJ, Cardenal F, Viñolas N, Garcia del Muro J, Vadell C, et al. Anti-Hu antibodies in patients with small-cell lung cancer: association with complete response to therapy and improved survival. J Clin Oncol 1997; 15:2866-72; PMID:9256130

12. Byrne KT, Turk MJ. New perspectives on the role of vitiligo in immune responses to melanoma. Oncotarget 2011; 2:684-94; PMID:21911918

13. Okano HJ, Darnell RB. A hierarchy of Hu RNA binding proteins in developing and adult neurons. J Neurosci 1997; 17:3024-37; PMID:9096138


14. Ma WJ, Cheng S, Campbell C, Wright A, Furneaux H. Cloning and characterization of HuR, a ubiq-uitously expressed Elav-like protein. J Biol Chem 1996; 271:8144-51; PMID:8626503; http://dx.doi.org/10.1074/jbc.271.14.8144

15. Robinow S, Campos AR, Yao KM, White K. The elav gene product of Drosophila, required in neu-rons, has three RNP consensus motifs. Science 1988; 242:1570-2; PMID:3144044; http://dx.doi.org/10.1126/science.3144044

16. Robinow S, White K. Characterization and spa-tial distribution of the ELAV protein during Drosophila melanogaster development. J Neurobiol 1991; 22:443-61; http://dx.doi.org/10.1002/neu.480220503; PMID:1716300

17. Chung S, Jiang L, Cheng S, Furneaux H. Purification and properties of HuD, a neuronal RNA-binding protein. J Biol Chem 1996; 271:11518-24; PMID:8626712; http://dx.doi.org/10.1074/jbc.271.19.11518

18. Bolognani F, Perrone-Bizzozero NI. RNA-protein interactions and control of mRNA stability in neu-rons. J Neurosci Res 2008; 86:481-9; http://dx.doi.org/10.1002/jnr.21473; PMID:17853436

19. Perrone-Bizzozero N, Bolognani F. Role of HuD and other RNA-binding proteins in neural develop-ment and plasticity. J Neurosci Res 2002; 68:121-6; PMID:11948657; http://dx.doi.org/10.1002/jnr.10175

20. Allen M, Bird C, Feng W, Liu G, Li W, Perrone-Bizzozero NI, Feng Y. HuD promotes BDNF expression in brain neurons via selective stabiliza-tion of the BDNF long 3’UTR mRNA. PLoS One 2013; 8:e55718; http://dx.doi.org/10.1371/journal.pone.0055718; PMID:23383270

21. Ince-Dunn G, Okano HJ, Jensen KB, Park WY, Zhong R, Ule J, Mele A, Fak JJ, Yang C, Zhang C, et al. Neuronal Elav-like (Hu) proteins regulate RNA splicing and abundance to control glutamate levels and neuronal excitability. Neuron 2012; 75:1067-80; http://dx.doi.org/10.1016/j.neuron.2012.07.009; PMID:22998874

22. Anderson KD, Merhege MA, Morin M, Bolognani F, Perrone-Bizzozero NI. Increased expression and localization of the RNA-binding protein HuD and GAP-43 mRNA to cytoplasmic granules in DRG neurons during nerve regeneration. Exp Neurol 2003; 183:100-8; PMID:12957493; http://dx.doi.org/10.1016/S0014-4886(03)00103-1

23. Kasashima K, Terashima K, Yamamoto K, Sakashita E, Sakamoto H. Cytoplasmic localization is required for the mammalian ELAV-like protein HuD to induce neuronal differentiation. Genes Cells 1999; 4:667-83; PMID:10620013; http://dx.doi.org/10.1046/j.1365-2443.1999.00292.x

24. Fujiwara T, Fukao A, Sasano Y, Matsuzaki H, Kikkawa U, Imataka H, Inoue K, Endo S, Sonenberg N, Thoma C, et al. Functional and direct interaction between the RNA binding protein HuD and active Akt1. Nucleic Acids Res 2012; 40:1944-53; http://dx.doi.org/10.1093/nar/gkr979; PMID:22075994

25. Manley GT, Smitt PS, Dalmau J, Posner JB. Hu antigens: reactivity with Hu antibodies, tumor expression, and major immunogenic sites. Ann Neurol 1995; 38:102-10; http://dx.doi.org/10.1002/ana.410380117; PMID:7541976

26. Cho JH, Noguchi M. Expression of HuD (a para-neoplastic encephalomyelitis antigen) mRNA in lung cancer. J Korean Med Sci 1997; 12:305-10; PMID:9288629

27. Carpentier AF, Voltz R, DesChamps T, Posner JB, Dalmau J, Rosenfeld MR. Absence of HuD gene mutations in paraneoplastic small cell lung cancer tissue. Neurology 1998; 50:1919; PMID:9633765; http://dx.doi.org/10.1212/WNL.50.6.1919

28. D’Alessandro V, Muscarella LA, la Torre A, Bisceglia M, Parrella P, Scaramuzzi G, Storlazzi CT, Trombetta D, Kok K, De Cata A, et al. Molecular analysis of the HuD gene in neuroendocrine lung cancers. Lung Cancer 2010; 67:69-75; http://dx.doi.org/10.1016/j.lungcan.2009.03.022; PMID:19410329

29. Sekido Y, Bader SA, Carbone DP, Johnson BE, Minna JD. Molecular analysis of the HuD gene encoding a paraneoplastic encephalomyelitis antigen in human lung cancer cell lines. Cancer Res 1994; 54:4988-92; PMID:8069866

30. Gazdar AF, Carney DN, Becker KL, Deftos LJ, Liang V, Go W, Marangos PJ, Moody TW, Wolfsen AR, Zweig MH. Expression of peptide and other mark-ers in lung cancer cell lines. Recent Results Cancer Res 1985; 99:167-74; PMID:2999915; http://dx.doi.org/10.1007/978-3-642-82533-0_17

31. Graus F, Elkon KB, Cordon-Cardo C, Posner JB. Sensory neuronopathy and small cell lung cancer. Antineuronal antibody that also reacts with the tumor. Am J Med 1986; 80:45-52; PMID:2417479; http://dx.doi.org/10.1016/0002-9343(86)90047-1

32. Vega F, Graus F, Chen QM, Poisson M, Schuller E, Delattre JY. Intrathecal synthesis of the anti-Hu antibody in patients with paraneoplas-tic encephalomyelitis or sensory neuronopathy: clinical-immunologic correlation. Neurology 1994; 44:2145-7; PMID:7969974; http://dx.doi.org/10.1212/WNL.44.11.2145

33. Verschuuren JJP, Perquin M, ten Velde G, De Baets M, Vriesman PB, Twijnstra A. Anti-Hu antibody titre and brain metastases before and after treatment for small cell lung cancer. J Neurol Neurosurg Psychiatry 1999; 67:353-7; PMID:10449558; http://dx.doi.org/10.1136/jnnp.67.3.353

34. Blaes F, Klotz M, Funke D, Strittmatter M, Kraus J, Kaps M. Disturbance in the serum IgG subclass distribution in patients with anti-Hu positive para-neoplastic neurological syndromes. Eur J Neurol 2002; 9:369-72; PMID:12099920; http://dx.doi.org/10.1046/j.1468-1331.2002.00416.x

35. Monstad SE, Knudsen A, Salvesen HB, Aarseth JH, Vedeler CA. Onconeural antibodies in sera from patients with various types of tumours. Cancer Immunol Immunother 2009; 58:1795-800; http://dx.doi.org/10.1007/s00262-009-0690-y; PMID:19294382

36. Greenlee JE, Boyden JW, Pingree M, Brashear HR, Clawson SA, Keeney PM. Antibody types and IgG subclasses in paraneoplastic neurological syndromes. J Neurol Sci 2001; 184:131-7; PMID:11239946; http://dx.doi.org/10.1016/S0022-510X(01)00442-7

37. Jean WC, Dalmau J, Ho A, Posner JB. Analysis of the IgG subclass distribution and inflammatory infil-trates in patients with anti-Hu-associated paraneo-plastic encephalomyelitis. Neurology 1994; 44:140-7; PMID:8290049; http://dx.doi.org/10.1212/WNL.44.1.140

38. Sodeyama N, Ishida K, Jaeckle KA, Zhang L, Azuma A, Yamada M, Mizusawa H, Wada Y. Pattern of epitopic reactivity of the anti-Hu antibody on HuD with and without paraneoplastic syndrome. J Neurol Neurosurg Psychiatry 1999; 66:97-9; PMID:9886463; http://dx.doi.org/10.1136/jnnp.66.1.97

39. Furneaux HF, Reich L, Posner JB. Autoantibody synthesis in the central nervous system of patients with paraneoplastic syndromes. Neurology 1990; 40:1085-91; PMID:2356009; http://dx.doi.org/10.1212/WNL.40.7.1085

40. Graus F, Vega F, Delattre JY, Bonaventura I, Reñé R, Arbaiza D, Tolosa E. Plasmapheresis and anti-neoplastic treatment in CNS paraneoplastic syn-dromes with antineuronal autoantibodies. Neurology 1992; 42:536-40; PMID:1312683; http://dx.doi.org/10.1212/WNL.42.3.536

41. Rauer S, Kaiser R. Demonstration of anti-HuD specific oligoclonal bands in the cerebrospinal f luid from patients with paraneoplastic neurological syndromes. Qualitative evidence of anti-HuD spe-cific IgG-synthesis in the central nervous system. J Neuroimmunol 2000; 111:241-4; PMID:11063845; http://dx.doi.org/10.1016/S0165-5728(00)00391-X

42. Dalmau J, Graus F, Cheung NK, Rosenblum MK, Ho A, Cañete A, Delattre JY, Thompson SJ, Posner JB. Major histocompatibility proteins, anti-Hu anti-bodies, and paraneoplastic encephalomyelitis in neuroblastoma and small cell lung cancer. Cancer 1995; 75:99-109; PMID:7804984; http://dx.doi.org/10.1002/1097-0142(19950101)75:1<99::AID-CNCR2820750117>3.0.CO;2-I

43. Pittock SJ, Kryzer TJ, Lennon VA. Paraneoplastic antibodies coexist and predict cancer, not neurologi-cal syndrome. Ann Neurol 2004; 56:715-9; http://dx.doi.org/10.1002/ana.20269; PMID:15468074

44. Sillevis Smitt P, Grefkens J, de Leeuw B, van den Bent M, van Putten W, Hooijkaas H, Vecht C. Survival and outcome in 73 anti-Hu positive patients with paraneoplastic encephalomyelitis/sensory neuronop-athy. J Neurol 2002; 249:745-53; http://dx.doi.org/10.1007/s00415-002-0706-4; PMID:12111309

45. Torà M, Graus F, de Bolòs C, Real FX. Cell surface expression of paraneoplastic encephalomyelitis/sen-sory neuronopathy-associated Hu antigens in small-cell lung cancers and neuroblastomas. Neurology 1997; 48:735-41; PMID:9065557; http://dx.doi.org/10.1212/WNL.48.3.735

46. De Giorgio R, Bovara M, Barbara G, Canossa M, Sarnelli G, De Ponti F, Stanghellini V, Tonini M, Cappello S, Pagnotta E, et al. Anti-HuD-induced neuronal apoptosis underlying paraneoplastic gut dysmotility. Gastroenterology 2003; 125:70-9; PMID:12851872; http://dx.doi.org/10.1016/S0016-5085(03)00664-4

47. Greenlee JE, Parks TN, Jaeckle KA. Type IIa (‘anti-Hu’) antineuronal antibodies produce destruction of rat cerebellar granule neurons in vitro. Neurology 1993; 43:2049-54; PMID:8413965; http://dx.doi.org/10.1212/WNL.43.10.2049

48. Schäfer KH, Klotz M, Mergner D, Mestres P, Schimrigk K, Blaes F. IgG-mediated cytotoxicity to myenteric plexus cultures in patients with para-neoplastic neurological syndromes. J Autoimmun 2000; 15:479-84; http://dx.doi.org/10.1006/jaut.2000.0454; PMID:11090247

49. Hormigo A, Lieberman F. Nuclear localiza-tion of anti-Hu antibody is not associated with in vitro cytotoxicity. J Neuroimmunol 1994; 55:205-12; PMID:7829670; http://dx.doi.org/10.1016/0165-5728(94)90011-6

50. Tanaka K, Ding X, Tanaka M. Effects of antineu-ronal antibodies from patients with paraneoplastic neurological syndrome on primary-cultured neurons. J Neurol Sci 2004; 217:25-30; PMID:14675605; http://dx.doi.org/10.1016/j.jns.2003.08.006

51. Sillevis Smitt PA, Manley GT, Posner JB. Immunization with the paraneoplastic encephalomy-elitis antigen HuD does not cause neurologic disease in mice. Neurology 1995; 45:1873-8; PMID:7477985; http://dx.doi.org/10.1212/WNL.45.10.1873

52. Uchuya M, Graus F, Vega F, Reñé R, Delattre JY. Intravenous immunoglobulin treatment in para-neoplastic neurological syndromes with antineuro-nal autoantibodies. J Neurol Neurosurg Psychiatry 1996; 60:388-92; PMID:8774401; http://dx.doi.org/10.1136/jnnp.60.4.388

53. Sakai K, Gofuku M, Kitagawa Y, Ogasawara T, Hirose G. Induction of anti-Purkinje cell antibodies in vivo by immunizing with a recombinant 52-kDa paraneo-plastic cerebellar degeneration-associated protein. J Neuroimmunol 1995; 60:135-41; PMID:7642741; http://dx.doi.org/10.1016/0165-5728(95)00063-8


54. Benyahia B, Liblau R, Merle-Béral H, Tourani JM, Dalmau J, Delattre JY. Cell-mediated autoimmu-nity in paraneoplastic neurological syndromes with anti-Hu antibodies. Ann Neurol 1999; 45:162-7; PMID:9989617; http://dx.doi.org/10.1002/1531-8249(199902)45:2<162::AID-ANA5>3.0.CO;2-R

55. de Beukelaar JW, Sillevis Smitt PA, Hop WC, Kraan J, Hooijkaas H, Verjans GM, Gratama JW. Imbalances in circulating lymphocyte subsets in Hu antibody associated paraneoplastic neurological syndromes. Eur J Neurol 2007; 14:1383-91; http://dx.doi.org/10.1111/j.1468-1331.2007.01986.x ; PMID:18028190

56. Tani T, Tanaka K, Idezuka J, Nishizawa M. Regulatory T cells in paraneoplastic neurologi-cal syndromes. J Neuroimmunol 2008; 196:166-9; http://dx.doi.org/10.1016/j.jneuroim.2008.03.002; PMID:18455243

57. Psimaras D, Carpentier AF, Rossi C; PNS Euronetwork. Cerebrospinal f luid study in paraneo-plastic syndromes. J Neurol Neurosurg Psychiatry 2010; 81:42-5; http://dx.doi.org/10.1136/jnnp.2008.159483; PMID:19324868

58. de Jongste AH, de Graaf MT, van den Broek PD, Kraan J, Smitt PA, Gratama JW. Elevated numbers of regulatory T cells, central memory T cells and class-switched B cells in cerebrospinal f luid of patients with anti-Hu antibody associated paraneoplastic neurolog-ical syndromes. J Neuroimmunol 2013; 258:85-90; http://dx.doi.org/10.1016/j.jneuroim.2013.02.006; PMID:23566401

59. Albert ML, Darnell JC, Bender A, Francisco LM, Bhardwaj N, Darnell RB. Tumor-specific killer cells in paraneoplastic cerebellar degeneration. Nat Med 1998; 4:1321-4; http://dx.doi.org/10.1038/3315; PMID:9809559

60. Santomasso BD, Roberts WK, Thomas A, Williams T, Blachère NE, Dudley ME, Houghton AN, Posner JB, Darnell RB. A T-cell receptor associated with nat-urally occurring human tumor immunity. Proc Natl Acad Sci U S A 2007; 104:19073-8; PMID:18045792; http://dx.doi.org/10.1073/pnas.0704336104

61. Liblau RS, Gonzalez-Dunia D, Wiendl H, Zipp F. Neurons as targets for T cells in the nervous system. Trends Neurosci 2013; 36:315-24; http://dx.doi.org/10.1016/j.tins.2013.01.008; PMID:23478065

62. de Beukelaar JW, Verjans GM, van Norden Y, Milikan JC, Kraan J, Hooijkaas H, Sintnicolaas K, Gratama JW, Sillevis Smitt PA. No evidence for circulating HuD-specific CD8+ T cells in patients with paraneoplastic neurological syndromes and Hu antibodies. Cancer Immunol Immunother 2007; 56:1501-6; http://dx.doi.org/10.1007/s00262-007-0295-2; PMID:17597332

63. de Jongste AH, de Graaf MT, Martinuzzi E, van den Broek PD, Kraan J, Lamers CH, Mallone R, Gratama JW, Sillevis Smitt PA. Three sensitive assays do not provide evidence for circulating HuD-specific T cells in the blood of patients with paraneoplastic neuro-logical syndromes with anti-Hu antibodies. Neuro Oncol 2012; 14:841-8; http://dx.doi.org/10.1093/neuonc/nos118; PMID:22591661

64. Plonquet A, Garcia-Pons F, Fernandez E, Philippe C, Marquet J, Rouard H, Delfau-Larue MH, Kosmatopoulos K, Lemonnier F, Farcet JP, et al. Peptides derived from the onconeural HuD pro-tein can elicit cytotoxic responses in HHD mouse and human. J Neuroimmunol 2003; 142:93-100; PMID:14512168; http://dx.doi.org/10.1016/S0165-5728(03)00269-8

65. Rousseau A, Benyahia B, Dalmau J, Connan F, Guillet JG, Delattre JY, Choppin J. T cell response to Hu-D peptides in patients with anti-Hu syn-drome. J Neurooncol 2005; 71:231-6; http://dx.doi.org/10.1007/s11060-004-1723-1; PMID:15735910

66. Tanaka M, Tanaka K. Pathogenesis and treatment of paraneoplastic neurologic syndrome. Expert Rev Neurother 2002; 2:901-9; http://dx.doi.org/10.1586/14737175.2.6.901; PMID:19810923

67. Roberts WK, Deluca IJ, Thomas A, Fak J, Williams T, Buckley N, Dousmanis AG, Posner JB, Darnell RB. Patients with lung cancer and paraneoplastic Hu syndrome harbor HuD-specific type 2 CD8+ T cells. J Clin Invest 2009; 119:2042-51; http://dx.doi.org/10.1172/JCI36131; PMID:19509467

68. Meresse B, Malamut G, Cerf-Bensussan N. Celiac disease: an immunological jigsaw. Immunity 2012; 36:907-19; http://dx.doi.org/10.1016/j.immuni.2012.06.006; PMID:22749351

69. DeLuca I, Blachère NE, Santomasso B, Darnell RB. Tolerance to the neuron-specific paraneo-plastic HuD antigen. PLoS One 2009; 4:e5739; http://dx.doi.org/10.1371/journal.pone.0005739; PMID:19492067

70. Rosenblum MK. Paraneoplasia and autoimmunologic injury of the nervous system: the anti-Hu syndrome. Brain Pathol 1993; 3:199-212; PMID:8293180; ht tp : //d x .doi .org /10.1111/j.1750 -3639.1993.tb00747.x

71. Galon J, Angell HK, Bedognetti D, Marincola FM. The continuum of cancer immunosurveil-lance: prognostic, predictive, and mechanistic signatures. Immunity 2013; 39:11-26; http://d x .doi .or g /10 .1016 / j . i m mu n i . 2013.07.0 08 ; PMID:23890060

72. Marrack P, Kappler JW. Do MHCII-presented neo-antigens drive type 1 diabetes and other autoimmune diseases? Cold Spring Harb Perspect Med 2012; 2:a007765; http://dx.doi.org/10.1101/cshperspect.a007765; PMID:22951444

73. Sollid LM, Jabri B. Celiac disease and transgluta-minase 2: a model for posttranslational modification of antigens and HLA association in the pathogen-esis of autoimmune disorders. Curr Opin Immunol 2011; 23:732-8; http://dx.doi.org/10.1016/j.coi.2011.08.006; PMID:21917438

74. de Graaf MT, de Beukelaar JW, Haasnoot GW, Levering WH, Rogemond V, Didelot A, Honnorat J, Gratama JW, Smitt PA. HLA-DQ2+ individu-als are susceptible to Hu-Ab associated paraneo-plastic neurological syndromes. J Neuroimmunol 2010; 226:147-9; http://dx.doi.org/10.1016/j.jneu-roim.2010.05.035; PMID:20547426

75. Uchuya M, Fleury A, Graus F, Costagliola D, Liblau R, Merle-Beral H, Théodorou I, Delattre JY. Lack of association between human leukocyte antigens and the anti-Hu syndrome in patients with small-cell lung cancer. Neurology 1998; 50:565-6; PMID:9484403; http://dx.doi.org/10.1212/WNL.50.2.565

76. Pellkofer HL, Voltz R, Goebels N, Hohlfeld R, Dornmair K. Cross-reactive T-cell receptors in tumor and paraneoplastic target tissue. Arch Neurol 2009; 66:655-8; http://dx.doi.org/10.1001/archneu-rol.2009.56; PMID:19433667

77. Bernal F, Graus F, Pifarré A, Saiz A, Benyahia B, Ribalta T. Immunohistochemical analysis of anti-Hu-associated paraneoplastic encephalomyelitis. Acta Neuropathol 2002; 103:509-15; http://dx.doi.org/10.1007/s00401-001-0498-0; PMID:11935268

78. Dalmau J, Posner JB. Neurologic paraneoplastic antibodies (anti-Yo; anti-Hu; anti-Ri): the case for a nomenclature based on antibody and antigen speci-ficity. Neurology 1994; 44:2241-6; PMID:7991105; http://dx.doi.org/10.1212/WNL.44.12.2241

79. Bien CG, Vincent A, Barnett MH, Becker AJ, Blümcke I, Graus F, Jellinger KA, Reuss DE, Ribalta T, Schlegel J, et al. Immunopathology of autoan-tibody-associated encephalitides: clues for patho-genesis. Brain 2012; 135:1622-38; http://dx.doi.org/10.1093/brain/aws082; PMID:22539258

80. Dalmau J, Furneaux HM, Rosenblum MK, Graus F, Posner JB. Detection of the anti-Hu antibody in specific regions of the nervous system and tumor from patients with paraneoplastic encephalomyelitis/sensory neuronopathy. Neurology 1991; 41:1757-64; PMID:1944905; http://dx.doi.org/10.1212/WNL.41.11.1757

81. Graus F, Campo E, Cruz-Sanchez F, Ribalta T, Palacin A. Expression of lymphocyte, macrophage and class I and II major histocompatibility complex antigens in normal human dorsal root ganglia. J Neurol Sci 1990; 98:203-11; PMID:1700807; http://dx.doi.org/10.1016/0022-510X(90)90261-K

82. Antoine JC, Mosnier JF, Honnorat J, Convers P, Absi L, Lapras J, Michel D. Paraneoplastic demy-elinating neuropathy, subacute sensory neuropathy, and anti-Hu antibodies: clinicopathological study of an autopsy case. Muscle Nerve 1998; 21:850-7; PMID:9626244; http://dx.doi.org/10.1002/( S IC I )10 9 7- 4598 (19 98 07 ) 21 :7< 850 : : A I D -MUS2>3.0.CO;2-5

83. Wanschitz J, Hainfellner JA, Kristoferitsch W, Drlicek M, Budka H. Ganglionitis in paraneoplastic subacute sensory neuronopathy: a morphologic study. Neurology 1997; 49:1156-9; PMID:9339709; http://dx.doi.org/10.1212/WNL.49.4.1156

84. Plonquet A, Gherardi RK, Créange A, Antoine JC, Benyahia B, Grisold W, Drlicek M, Dreyfus P, Honnorat J, Khouatra C, et al. Oligoclonal T-cells in blood and target tissues of patients with anti-Hu syndrome. J Neuroimmunol 2002; 122:100-5; PMID:11777548; http://dx.doi.org/10.1016/S0165-5728(01)00452-0

85. Kreutzfeldt M, Bergthaler A, Fernandez M, Brück W, Steinbach K, Vorm M, Coras R, Blümcke I, Bonilla WV, Fleige A, et al. Neuroprotective inter-vention by interferon-γ blockade prevents CD8+ T cell-mediated dendrite and synapse loss. J Exp Med 2013; 210:2087-103; http://dx.doi.org/10.1084/jem.20122143; PMID:23999498

86. Voltz R, Dalmau J, Posner JB, Rosenfeld MR. T-cell receptor analysis in anti-Hu associated paraneoplas-tic encephalomyelitis. Neurology 1998; 51:1146-50; PMID:9781545; http://dx.doi.org/10.1212/WNL.51.4.1146

87. Siewert K, Malotka J, Kawakami N, Wekerle H, Hohlfeld R, Dornmair K. Unbiased identification of target antigens of CD8+ T cells with combinatorial libraries coding for short peptides. Nat Med 2012; 18:824-8; http://dx.doi.org/10.1038/nm.2720; PMID:22484809

88. Carpentier AF, Rosenfeld MR, Delattre JY, Whalen RG, Posner JB, Dalmau J. DNA vaccination with HuD inhibits growth of a neuroblastoma in mice. Clin Cancer Res 1998; 4:2819-24; PMID:9829748

89. Kazarian M, Calbo J, Proost N, Carpenter CL, Berns A, Laird-Offringa IA. Immune response in lung cancer mouse model mimics human anti-Hu reactivity. J Neuroimmunol 2009; 217:38-45; http://dx.doi.org/10.1016/j.jneuroim.2009.08.014; PMID:19765830

90. Pellkofer H, Schubart AS, Höftberger R, Schutze N, Pagany M, Schüller M, Lassmann H, Hohlfeld R, Voltz R, Linington C. Modelling paraneoplastic CNS disease: T-cells specific for the onconeuronal antigen PNMA1 mediate autoimmune encephalomyelitis in the rat. Brain 2004; 127:1822-30; http://dx.doi.org/10.1093/brain/awh205; PMID:15201193

91. Oh SJ, Dropcho EJ, Claussen GC. Anti-Hu-associated paraneoplastic sensory neuropathy responding to early aggressive immunotherapy: report of two cases and review of literature. Muscle Nerve 1997; 20:1576-82; PMID:9390671; http://dx.doi.org/10.1002/(SICI)1097-4598 (199712)20 :12 <1576 : : A ID-MUS13>3.0.CO;2-Z

92. Brinkmann V, Billich A, Baumruker T, Heining P, Schmouder R, Francis G, Aradhye S, Burtin P. Fingolimod (FTY720): discovery and development of an oral drug to treat multiple sclerosis. Nat Rev Drug Discov 2010; 9:883-97; PMID:21031003; http://dx.doi.org/10.1038/nrd3248


93. Ifergan I, Kebir H, Alvarez JI, Marceau G, Bernard M, Bourbonnière L, Poirier J, Duquette P, Talbot PJ, Arbour N, et al. Central nervous system recruit-ment of effector memory CD8+ T lymphocytes dur-ing neuroinflammation is dependent on α4 integrin. Brain 2011; 134:3560-77; http://dx.doi.org/10.1093/brain/awr268; PMID:22058139

94. Planas R, Jelčić I, Schippling S, Martin R, Sospedra M. Natalizumab treatment perturbs memory- and marginal zone-like B-cell homing in secondary lym-phoid organs in multiple sclerosis. Eur J Immunol 2012; 42:790-8; http://dx.doi.org/10.1002/eji.201142108; PMID:22144343

95. Scheikl T, Pignolet B, Dalard C, Desbois S, Raison D, Yamazaki M, Saoudi A, Bauer J, Lassmann H, Hardin-Pouzet H, et al. Cutting edge: neuronal rec-ognition by CD8 T cells elicits central diabetes insipi-dus. J Immunol 2012; 188:4731-5; http://dx.doi.org/10.4049/jimmunol.1102998; PMID:22504649

96. Riley JL. Combination checkpoint blockade--taking melanoma immunotherapy to the next level. N Engl J Med 2013; 369:187-9; http://dx.doi.org/10.1056/NEJMe1305484; PMID:23724866

3302 Guillaume Martin-Blondel et al. Eur. J. Immunol. 2015. 45: 3302–3312DOI: 10.1002/eji.201545632

Migration of encephalitogenic CD8 T cells intothe central nervous system is dependenton the α4β1-integrin

Guillaume Martin-Blondel∗1,2,3, Beatrice Pignolet∗2,3,5, Silvia Tietz4,Lidia Yshii2,3, Christina Gebauer2,3, Therese Perinat4, Isabelle VanWeddingen2, Claudia Blatti4, Britta Engelhardt∗∗4 and Roland Liblau∗∗2,3

1 Department of Infectious and Tropical Diseases, Toulouse University Hospital, Toulouse,France

2 INSERM U1043 - CNRS UMR 5282, Centre de Physiopathologie de Toulouse Purpan (CPTP),Toulouse, France

3 Universite Toulouse III, Toulouse, France4 Theodor Kocher Institute, University of Bern, Bern, Switzerland5 Department of Clinical Neurosciences, Toulouse University Hospital, Toulouse, France

Although CD8 T cells are key players in neuroinflammation, little is known about theirtrafficking cues into the central nervous system (CNS). We used a murine model of CNSautoimmunity to define the molecules involved in cytotoxic CD8 T-cell migration into theCNS. Using a panel of mAbs, we here show that the α4β1-integrin is essential for CD8T-cell interaction with CNS endothelium. We also investigated which α4β1-integrin lig-ands expressed by endothelial cells are implicated. The blockade of VCAM-1 did notprotect against autoimmune encephalomyelitis, and only partly decreased the CD8+

T-cell infiltration into the CNS. In addition, inhibition of junctional adhesion molecule-Bexpressed by CNS endothelial cells also decreases CD8 T-cell infiltration. CD8 T cells mayuse additional and possibly unidentified adhesion molecules to gain access to the CNS.

Keywords: α4β1-Integrin � CD8 T cell � Junctional adhesion molecule-B � Migration � Neuroin-flammation

� Additional supporting information may be found in the online version of this article at thepublisher’s web-site

Introduction

The central nervous system (CNS) is considered as a uniqueimmune-privileged environment allowing a basal immune surveil-lance under physiological conditions, and restraining potentiallydeleterious inflammatory reactions in disease states [1, 2]. A tightcontrol of the trafficking of immune cells toward the CNS is a

Correspondence: Dr. Roland Liblaue-mail: [email protected]

major parameter contributing to this immune-privileged status[3]. Indeed, circulating immune cells have to cross protective bar-riers using a complex multistep cascade that involves distinct traf-ficking cues both at the surface of the CNS endothelial cells andof immune cells [4].

The current knowledge regarding T-cell migration into the CNSderives mainly from CD4 T cells whereas little is known for CD8

∗These authors contributed equally to this work.∗∗These authors are co-principal investigators of this work.

C© 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.eji-journal.eu

Eur. J. Immunol. 2015. 45: 3302–3312 Cellular immune response 3303

T cells. Under inflammatory conditions, either due to autoimmuneresponses or infection, the inflamed blood-brain barrier (BBB)endothelium upregulates the expression of adhesion molecules(selectins and cell adhesion molecules of the immunoglobulinsuperfamily). Several surface molecules expressed by CD4 T cells,such as P-selectin glycoprotein ligand-1, αLβ2, α4β1, CD6, or α6β1,regulate sequential steps for transmigration that include tethering,rolling, capture, firm adhesion, and finally diapedesis of blood-borne circulating T cells across the endothelial layer [4]. Anti-gen recognition in the subarachnoidal spaces then allow T cellsto migrate through the glia limitans superficialis into the CNSparenchyma, leading to clinical disease [5]. In this scenario, apivotal role for the interaction between the α4β1-integrin het-erodimer expressed by activated T helper 1 CD4 cells, and vascularcell adhesion protein 1 (VCAM-1), its main ligand on BBB endothe-lial cells, has been demonstrated [6–10]. However, as Th17 CD4cells were shown to infiltrate the brain in the absence of α4-integrin in an αLβ2-dependent manner [10, 11], α4-independentroutes to the CNS exist for other crucial T-cell subsets.

Although cumulative evidence points to a key role for CD8T cells in several inflammatory CNS disorders such as MS, autoim-mune encephalitis, or immune reconstitution inflammatory syn-drome (IRIS) affecting the CNS [12–14], little is known abouttrafficking of CD8 T cells into the CNS. Interaction betweenP-selectin glycoprotein ligand-1 and P-selectin contributes to therecruitment of human CD8 T cells in brain vessels [15]. CD8T-cell migration is not affected by blocking interactions betweenαLβ2/ICAM-1, ALCAM/CD6, PECAM-1/PECAM-1, or CCL2/CCR2,while all of them were previously shown to partake in the recruit-ment of other immune cell populations to the CNS [16, 17]. Theconflicting results about neutralization of α4-integrin in EAE andin coronavirus-induced encephalitis, restricting or not CD8 T-cellinfiltration of the CNS, suggest that these cells may use alternativeand possibly unidentified adhesion molecules to gain access to theCNS, raising the potential for selective control of their traffickinginto the brain [10, 17, 18].

Using a murine model of CNS autoimmunity, the aim of ourstudy was to define the role of α4-integrins in the CD8 T-cellmigration across the BBB during neuroinflammation, and to spec-ify which of the heterodimers containing the α4-integrin subunit,namely α4β1 and α4β7, is implicated.

Results

α4β1-Integrin blockade protects CamK-HA mice fromdeveloping CD8 T-cell-mediated encephalomyelitis

CamK-HA mice selectively express the Haemagglutinin (HA) ofthe Influenza virus in neurons under the control of the calmodulinkinase promoter. These mice, but not control littermates, exhib-ited severe encephalomyelitis characterized by weight loss, neu-rological signs, and death in 40–50% of recipients after the adop-tive transfer of 5 × 106 in vitro generated cytotoxic HA-specificCD8 T cells. Diabetes insipidus caused by the CD8-mediated

destruction of arginine-vasopressin hypothalamic neurons was aprominent clinical manifestation in the surviving CamK-HA recip-ients [19]. Endogenous CD4 and CD8 T cells also infiltrated theCNS of CamK-HA mice developing encephalomyelitis (SupportingInformation Fig. 1A–B). However, because CD4 T cell-depletedrecipients underwent weight loss and diabetes insipidus, endoge-nous CD4 T cells are not required for disease development (Sup-porting Information Fig. 1C–D).

To delineate in this model the role of α4-integrin in CD8 T-cellmigration to the CNS, we first showed that in vitro differentiatedcytotoxic HA-specific CD8 T cells express both α4- and β7-integrinsubunits, and the α4β7-integrin heterodimer (Fig. 1A). Becausethere is no mAb against the α4β1-integrin heterodimer, we usedan in vitro binding assay to indirectly show that in vitro differen-tiated cytotoxic HA-specific CD8 T cells express the α4β1-integrinheterodimer. While HA-specific CD8 T cells untreated or treatedwith a control IgG bind to recombinant ICAM-1 and VCAM-1,an anti-α4-integrin mAb completely inhibited binding to VCAM-1(one-way ANOVA, p < 0.00001), but did not affect binding toICAM-1 (Fig. 1B). As VCAM-1 is the main ligand of the α4β1-integrin heterodimer, this suggests that HA-specific CD8 T cellsexpress the functional α4β1-integrin heterodimer.

We then assessed whether treatment of CamK-HA mice withanti-α4-integrin mAb could protect against CD8 T-cell-mediatedencephalomyelitis. Therefore, we treated CamK-HA recipientswith an anti-α4-integrin or a control IgG at day 0, 4, and 8 afterthe adoptive transfer of 5 × 106 cytotoxic HA-specific CD8 T cells.Compared to recipients receiving the control IgG, CamK-HA recip-ients treated by anti-α4-integrin mAb lost less weight (one-wayANOVA, p < 0.0001) and showed no death (0/10 versus 5/10,Log-rank test, p = 0.006). In addition, survivors experienced lessdiabetes insipidus (2/10 versus 4/5) (Fig. 1C–E). Since α4-integrinis a subunit shared by both α4β1- and α4β7-integrin heterodimers,we then investigated which one is involved in CD8 T-cell migra-tion into the CNS. Currently no mAb is available that specificallyrecognizes the α4β1-integrin heterodimer, while the DATK32 mAbrecognizes and blocks specifically the α4β7-integrin heterodimer[7]. We therefore treated CamK-HA recipients with this anti-α4β7-integrin mAb. Recipients underwent the same clinical phenotypeas mice receiving the control mAb. Indirectly, this strongly sug-gests that the α4β1-integrin is the essential heterodimer for acti-vated CD8 T-cell migration into the CNS in our model. However,α4-integrin blockade did not fully abrogate the neurological signsinduced by HA-specific CD8 T-cell transfer in CamK-HA mice assignificant weight loss developed when compared to control lit-termates (Fig. 1C), and central diabetes insipidus was detected in20% of treated recipients.

Blockade of the α4β1-integrin reduces CD8 T-cellinfiltration and microglial activation in the CNS

We next investigated the impact of α4β1-integrin blockade on CNSinflammatory infiltrate composition and tissue damage. Eight daysafter the adoptive transfer of 5 × 106 cytotoxic HA-specific CD8


3304 Guillaume Martin-Blondel et al. Eur. J. Immunol. 2015. 45: 3302–3312

Figure 1. α4β1-integrin blockade protectsCamK-HA mice from developing CD8 T-cell-mediated encephalomyelitis. (A) FACS analy-sis of α4-integrin subunit, β7-integrin subunit,and α4β7-integrin heterodimer expression on invitro differentiated cytotoxic HA-specific CD8T cells (one experiment representative of threeexperiments of in vitro differentiation of HA-specific cytotoxic CD8 T cells).(B) In vitro bind-ing assay of cytotoxic HA-specific CD8 T cellsto recombinant ICAM-1 or VCAM-1 IgG anda control protein (DNER-IgG), after pretreat-ment with isotype control rat IgG2b or anti-α4-integrin-IgG. Pooled data from three inde-pendent experiments, each point representingthe mean of triplicates. One-way ANOVA ****p <

0.00001. (C and D) Adoptive transfer at day 0 of5 × 106 cytotoxic HA-specific CD8 T cells in non-transgenic mice or in CamK-HA mice treated atday 0, 4, and 8 by an anti-α4, an anti-α4β7, or acontrol IgG mAb. Impact on the weight (C) andon survival (D) of the recipient mice is shown.(C) One-way ANOVA ***p < 0.0001. (D) Log-rank(Mantel–Cox) test *p < 0.01. (E) Incidence of dia-betes insipidus among survivors at day 24 afterthe adoptive transfer of 5 × 106 cytotoxic HA-specific CD8 T cells in nontransgenic mice orin CamK-HA mice treated at day 0, 4, and 8 byan anti-α4, an anti-α4β7, or a control IgG mAb.Diabetes insipidus is defined using dipsticks bya urine-specific gravity � 1010 on three consec-utive days. (C), (D), and (E) are pooled data fromthree independent experiments, each involv-ing three to five mice per group. Data representmean ± SEM.

T cells, CamK-HA recipients treated with an anti-α4-integrin mAbor a control IgG were sacrificed and their CNS-infiltrating cellswere analyzed by flow cytometry. A drastic reduction in the num-ber of CD45high Thy1.2+ T cells infiltrating the CNS was observedin recipients treated with the anti-α4-integrin mAb (1333 ± 263versus 35 452 ± 5748 cells/CNS, respectively, Mann–Whitney test,p < 0.0001; Fig. 2A–B). Ex vivo analysis of splenocytes showedthat the anti-α4-integrin mAb did not deplete CD8 T cells in theperiphery, and even promoted the accumulation of transferredcells in the secondary lymphoid organs (Supporting InformationFig. 2A–B). Moreover, ex vivo analyses and restimulation with thecognate HA peptide showed that the anti-α4-integrin mAb alsodid not affect activation of transferred CD8 T cells collected fromspleen and lymph nodes (Supporting Information Fig. 2C–F). Inthe CNS, we observed a decrease in microglial activation, eval-uated by MHC class II expression on CD45int CD11b+ cells, in

recipients treated by the anti-α4-integrin mAb (MFI for MHC classII 589 ± 127 versus 6825 ± 1172, Mann–Whitney test, p = 0.0002;Fig. 2C–D). Histological analysis also corroborated the markedreduction in the parenchymal CD8 T-cell infiltration in recipi-ents treated by the anti-α4-integrin mAb-treated animals (Mann–Whitney test, p = 0.0002; Fig. 2E–G), while some meningeal CD8T cells could still be detected. Antagonization of α4β1-integrin,therefore inhibits CD8 T-cell infiltration and microglial activationin the CNS parenchyma of recipient CamK-HA mice.

VCAM-1 blockade retains the clinical phenotype andonly partly decreases CD8 T cell CNS infiltration

To further investigate how α4β1-integrin contributes to CD8 T celltrafficking to the CNS, we investigated which ligand expressed



Figure 2. Blockade of the α4β1-integrin reduces T-cell infiltration and microglial activation in the CNS. (A–D) FACS analysis of CNS-infiltratingcells at day 8 after adoptive transfer of 5 × 106 cytotoxic HA-specific CD8 T cells in CamK-HA mice treated at day 0 and 4 by an anti-α4 or a controlIgG mAb. (A) Illustration of the gating strategy. (B) Absolute number of CD45high Thy1.2+ T cells infiltrating the CNS. Each dot shows an individualanimal. Mann–Whitney test ***p < 0.0001. (C) Overlay of MHC class II expression on CD45int CD11b+ cells in mice treated by a control IgG (black line),or anti-α4 mAb (red line). One representative out of three independent experiments is shown. (D) The MFI of MHC class II expression on CD45int

CD11b+ microglial cells is shown. Mann–Whitney test ***p = 0.0002. Each dot shows an individual animal. (B and D) are pooled data from threeindependent experiments, each involving three to five mice per group. Data represent mean ± SEM. (E–G) Brain CD8 T-cell infiltration at day 8 afteradoptive transfer of 5 × 106 cytotoxic HA-specific CD8 T cells in CamK-HA mice treated at day 0 and 4 by a control IgG (E) or an anti-α4-integrinmAb (F; bar = 50 μm). (G) Histological scoring for parenchymal CD8 T-cell infiltration. Pool of three independent experiments, each involving threeto five mice per group. Mann–Whitney test ***p = 0.0002. Data represent mean ± SEM.

on brain microvascular endothelial cells may interact with α4β1-integrin. First, we blocked in vivo VCAM-1, the major ligand forα4β1-integrin [20], using two distinct mAbs. As both mAbs pro-vided identical results (Fig. 3A), the two groups were pooled inFigure 3B and C. CamK-HA recipients treated by anti-VCAM-1 mAblost more weight (one-way ANOVA, p < 0.0001) and developeddiabetes insipidus more frequently (9/11 versus 1/6, chi-squaretest with Yates’ correction, p = 0.036) compared to mice treated bythe anti-α4-integrin mAb (Fig. 3A–C). Clinical outcomes (weightloss, diabetes insipidus, and death) were not significantly differ-ent between recipient mice treated with the anti-VCAM-1 mAbs orwith the control IgG.

To assess the impact of VCAM-1 inhibition on CD8 T-cell infil-tration of the CNS, and to unambiguously identify and enumer-ate the transferred cells, CD45.1+ HA-specific CD8 T cells were

injected in CD45.2+ CamK-HA mice (Fig. 3D). Flow cytometryanalysis of CNS-infiltrating cells from CamK-HA recipients 8 daysafter the adoptive transfer revealed a significant reduction in thenumber of transferred CD45.1+ CD8 T cells in mice treated withanti-VCAM-1 mAbs compared to mice receiving the control IgG(7990 ± 1862 versus 14 331 ± 1582 cells, Mann–Whitney test,p = 0.01; Fig. 3E). However, VCAM-1 blockade reduced the num-ber of CNS-infiltrating transferred CD8 T cells to a much lesserextent than the use of anti-α4-integrin mAb (161 ± 48 cells, Mann–Whitney test, p < 0.0001). Collectively, these data indicate thatblockade of VCAM-1 partially inhibits the α4β1-dependent migra-tion of CD8 T cells across the BBB, but does not protect mice fromdeveloping CNS tissue damage, suggesting that additional vascu-lar ligands of α4β1-integrin might be implicated in CD8 T celltrafficking into the CNS.



Figure 3. VCAM-1 blockade retains the clinical phenotype and only partly decreases CD8 T cell CNS infiltration. (A–C) Adoptive transfer of 5 ×106 cytotoxic HA-specific CD8 T cells in CamK-HA mice treated at day 0, 4, and 8 by an anti-α4-integrin, a control IgG, anti-VCAM-1 (clone 429or 6C7.1), or an anti-JAM-B mAb. Impact on the weight (A), survival (B), and on development of diabetes insipidus (C). Pool of two independentexperiments, each involving three to six mice per group. (A) One-way ANOVA ***p < 0.0001. (B) Log-rank (Mantel–Cox) test, ns. Data represent mean± SEM. (D–F) FACS analysis of CNS-infiltrating cells at day 8 after adoptive transfer of 5 × 106 CD45.1+ cytotoxic HA-specific CD8 T cells in CD45.2+

CamK-HA mice treated at day 0 and 4 by a control IgG, an anti-α4-integrin, an anti-VCAM-1 (clone 6C7.1), an anti-JAM-B, or both an anti-VCAM-1and anti-JAM-B mAbs. (D) Illustration of the general gating strategy. (E) Absolute number of CD45.1+ CD8+ T cells infiltrating the CNS. Pool of twoto three independent experiments using three to five mice per group. Mann–Whitney test, *p < 0.05, **p < 0.001, ***p < 0.0001. Data represent mean± SEM. (F) Percentage of CD45.1+ CD8+ T cells that are CD44+ CD62L− and that produce IFN-γ and TNF-α. Pool of two independent experimentsusing two to three mice per group. One-way ANOVA, ns. Data represent mean ± SEM.

JAM-B is a ligand for α4β1-integrin implicated in CD8T-cell migration to the CNS

Because junctional adhesion molecule-B (JAM-B) had beenreported to be a ligand for α4β1-integrin on endothelial cells[21], we assessed the contribution of JAM-B as another putativeBBB endothelial ligand for α4β1-integrin in CD8 T-cell migrationinto the CNS. Indeed, CNS microvascular endothelial cells expressJAM-B in addition to PECAM-1 (Fig. 4). We investigated whetherJAM-B could be potential ligand for α4β1-integrin expressed onCD8 T cells. We treated CamK-HA recipients with an anti-JAM-BmAb at day 0, 4, and 8 after the adoptive transfer of 5 × 106 cyto-toxic HA-specific CD8 T cells. While CamK-HA recipients treatedby the anti-JAM-B mAb displayed significantly less weight losscompared to recipients treated by control IgG or anti-VCAM-1

mAbs, they displayed the same incidence of diabetes insipidus anddeath (Fig. 3A–C). Flow cytometry analysis of the CNS of CamK-HA recipients treated by anti-JAM-B mAb showed a significantdecrease in the number of infiltrating CD45.1+ CD8 transferredcells compared to mice receiving the control IgG (7016 ± 2029versus 14 331 ± 1582 cells/CNS, Mann–Whitney test, p = 0.017;Fig. 3E). This decrease was similar to that achieved when block-ing VCAM-1 (Mann–Whitney test, ns), but clearly inferior to theinhibition achieved by the anti-α4-integrin mAb (Mann–Whitneytest, p = 0.0017; Fig. 3E). Increased dose of anti-JAM-B mAbdid not improve the reduction of CNS-infiltrating CD45.1+ CD8+

transferred cells, suggesting that saturating concentrations of theantibody were obtained (Supporting Information Fig. 3). There-fore, JAM-B expressed by BBB endothelial cells might represent aligand for α4β1-integrin-mediated migration of CD8 T cells into



Figure 4. CNS microvascular endothelial cells express JAM-B in addition to PECAM-1. (A–C) Immunofluorescence staining for JAM-B in themouse CNS was evaluated on cryosections (6 μm) of brains of CamK-HA mice day 8 after adoptive transfer of 5 × 106 cytotoxic HA-specificCD8 T cells. Double immunofluorescence staining of JAM-B (A) and PECAM-1 (B) show colocalization of JAM-B and PECAM-1 staining (C) onall vessels in the mouse cortex. Arrowheads point to representable JAM-B positive (A) and JAM-B/PECAM-1 double positive vessels (C). (D–F)Double immunofluorescence staining of JAM-B (D, arrowheads) and VCAM-1 (E) show a colocalization of JAM-B and VCAM-1 (F) on blood vessels(arrowhead), however JAM-B immune staining can additionally be detected on endothelial cells staining negative for VCAM-1. (F) Arrowheads withstars point to JAM-B positive vessels that do not stain positive for VCAM-1. (G–I) Isotype control staining with rabbit IgG control antibody (G) andPECAM-1 (H) shows no staining for the rabbit IgG (G and I). The variability in background with the anti-JAM-B antibody observed in (A), (D), and (J)is related to the area in the CNS and the inflammatory status of the brain. All sections were counter-stained with DAPI to show cell nuclei. Barsare 50 μm. Panel shown above constitutes one representative staining; in total three individual tissues were processed.

the CNS. In order to test the hypothesis that VCAM-1 and JAM-Bare complementary ligands for α4β1-integrin, we treated recipi-ents with both anti-JAM-B and anti-VCAM-1 mAbs. Coadministra-tion of both mAbs did not demonstrate a synergistic reduction inthe number of CNS-infiltrated CD45.1+ CD8 transferred T cells(Fig. 3E). We finally investigated the phenotype of CD8 T cellsthat entered the CNS of CamK-HA recipients after blockade of α4-integrin, α4β7-integrin, VCAM-1, or JAM-B. Whereas their abso-lute numbers differed importantly between groups, the proportionof transferred CD45.1+ CD8 T cells that are CD44+ CD62L−, andthat produce both IFN-γ and TNF-α did not significantly differbetween groups (Fig. 3F).

Discussion

Molecular cues used by CD8 T cells to migrate into the CNS arepoorly defined. Using a murine model of CNS autoimmune neu-roinflammation, we showed that the migration of cytotoxic CD8T cells to the CNS relies on the α4β1-integrin heterodimer. We alsoshowed that VCAM-1 and JAM-B expressed by BBB endothelialcells are likely implicated in this process, but that their inhibitionis insufficient to completely block CD8 T-cell infiltration into theCNS or to mitigate the clinical encephalomyelitis signs.

Two studies using animal models of neuroinflammation andin vitro transmigration assays demonstrated that blocking the



α4-integrin decreases migration of CD8 T cells across CNS vascu-lar structures [17, 18]. However, because the α4-integrin is com-mon to α4β1- and α4β7-integrin heterodimers [22], it is unknownwhich one is implicated. Our model showed that blockade ofα4-integrin, but not of the α4β7-integrin heterodimer, preventsencephalomyelitis and tissue damage by interfering with cytotoxicCD8 T-cell entry into the CNS. These results strongly suggest thatthe α4β1-integrin is the essential heterodimer for the interaction ofactivated CD8 T cells with the BBB. Similarly, blocking α4-integrincan abrogate the development of EAE mediated by encephali-togenic CD4 Th1 cells [7–10]. Those cells critically rely on β1-integrin to accumulate in the CNS during EAE [6]. Moreover,blocking the α4β7-integrin heterodimer fails to inhibit EAE devel-opment in mice and Rhesus monkeys [7, 23], and ectopic expres-sion of the α4β7-integrin ligand MAdCAM-1 in CNS endothelialcells fails to trigger CNS recruitment of α4β7-expressing T cells[24]. Thus, α4β1-integrin rather than α4β7-integrin mediates bothCD4 and CD8 T-cell interaction with CNS endothelium. How-ever, as α4-integrin blockade did not totally abrogate clinical signsand CNS infiltration of transferred CD8 T cells in our model, anα4β1-independent route, although accessory, remains operative.Its molecular bases are still to be determined.

The most studied brain endothelial ligand for α4β1-integrin isVCAM-1 [20]. VCAM-1 is constitutively expressed at low level onthe BBB endothelium, and mediates both the initial capture andthe subsequent G-protein-dependent arrest of CD4 Th1 cells uponinteraction with the α4β1-integrin [8]. Expression of VCAM-1is upregulated in inflammatory conditions on endothelial cellsof the BBB and of the blood-leptomeningeal barrier, as well ason choroid plexus epithelium of the blood-cerebrospinal fluidbarrier, further increasing α4β1/VCAM-1-mediated T-cell adhe-sion to inflamed CNS endothelium [25, 26]. It was previouslyshown that VCAM-1 blockade inhibits clinical or histopathologi-cal signs of EAE mediated by encephalitogenic CD4 Th1 cells [7].In a model of OVA-expressing Listeria monocytogenes infection,access of OVA-specific CD8 T cells to the CNS was inhibited by theantibody-mediated blockade of VCAM-1 to the same extent as didthe α4-integrin blockade [18]. Unexpectedly, blockade of VCAM-1 in our model only had a partial effect on CD8 T-cell migrationto the CNS, as the number of CNS-infiltrated CD8 T cells wasreduced by 46% compared to mice treated by the control IgG(Fig. 3D). This decrease was not clinically relevant as recipientstreated with different clones of anti-VCAM-1 mAb experiencedweight loss, death, and diabetes insipidus to the same extent asmice treated by the control IgG. Therefore, VCAM-1 blockade wasnot sufficient in our model to inhibit α4β1-expressing CD8 T-cellsmigration into the CNS. Several differences between our study andthat of Young et al. [18] might explain those discordant results,including the genetic background of the mice, BALB/c or (BALB/c× C57BL6) F1 versus C57BL6/J, the localization of the HA andOVA antigens in different cells, neurons and oligodendrocytes,respectively, and the state of differentiation of the encephalito-genic CD8 T cells (terminally differentiated highly cytotoxic ver-sus shortly activated CD8 T cells). Moreover, the L. monocytogenesinfection within the CNS in this model might induce additional

triggers including increased expression of VCAM-1 at the BBB,allowing for increased VCAM-1-dependence of CD8 T-cell migra-tion into the CNS. It was suggested that natalizumab, a humanizedmAb against the human α4 subunit of α4β1-integrin and α4β7,might also affect CD4 and CD8 T-cell expression of α4-integrin-unrelated molecules such as CD62L, CXCR3, and αLβ2 in long-term treated natalizumab patients [27, 28]. Here, we have useda very short treatment. In addition, the high specificity of PS/2for the murine α4-integrin subunit makes this antibody unlikelyto cross-react with other integrin subunit or unrelated moleculessuch as selectins. Indeed, PS/2 recognizes the functional epitopeB2 on the α4-integrin subunit and was shown to specifically blockα4β1-mediated lymphocyte binding to VCAM-1 and fibronectin aswell as α4β7-dependent binding to VCAM-1 and MAdCAM-1 invitro [29, 30]. Another explanation could be that, in our model,VCAM-1 is not the sole, or even not the main, ligand for α4β1-integrin.

In that respect, we investigated if other known α4β1-integrinligands might be implicated. At least two additional vascular lig-ands have been described, the CS1 domain of a spliced variant offibronectin [31, 32], and JAM-B [21, 33]. Since no reliable block-ing antibody against CS1 domain is currently available, the roleof fibronectin in the migration process of CD8 T cells could notbe explored yet. Because α4β1–JAM-B interaction has only beeninvestigated in vitro or in vivo in skin microvasculature [21], andbecause JAM-B is expressed by the BBB in our model, we focusedon this putative ligand for CD8 T-cell migration to the CNS. Mem-bers of the classical JAM family are transmembrane type 1 proteinswith two immunoglobulin domains highly expressed in cells thatpresent well organized tight junctions, such as the endotheliumof the BBB [34]. JAM-A, interacting with αLβ2-integrin, is impli-cated in cell migration to the CNS. A blocking mAb directed toJAM-A significantly inhibited leukocyte infiltration in the CSF andthe brain parenchyma in a model of cytokine-induced meningi-tis [35]. However, those results were not confirmed in infectiousmeningitis [36]. JAM-B plays a central role in the regulation ofparacellular permeability [34], but also impacts T-cell rolling andfirm adhesion [21]. Although a lack of JAM-B expression at steadystate on brain endothelial cells was suggested [37], we show thatJAM-B is expressed on brain endothelial cells in our murine modelof CNS autoimmunity. Because blockade of JAM-B was associatedto a partial protection against encephalomyelitis and a significantreduction in the number of infiltrated CD8 T cells, however to alesser extent than α4β1-integrin blockade, our data suggest thatJAM-B participates to the CD8 T-cell migration process to the CNS.

The discovery of the role of α4β1–VCAM-1 interaction inT-cell migration to the CNS led to the development of natal-izumab, which has proven to be highly beneficial in relapsing-remitting MS [38]. Unfortunately, natalizumab is associated withan increased risk of developing progressive multifocal leukoen-cephalopathy (PML), an opportunistic disease of the CNS causedby John Cunningham (JC) virus infection of oligodendrocytes[39]. Development of PML following natalizumab therapy likelyrelies on a multifactorial scenario including permissiveness foractive JC virus replication and impaired immune surveillance



[40–43]. Compared with untreated MS patients, natalizumabtreatment induces a decrease in cerebrospinal fluid CD4 and CD8T cells [44, 45]. Because CD4 and CD8 T cells are crucial incontrolling JC virus reactivation and dissemination [46, 47], ourresults suggest that development of PML is, at least in part, due tonatalizumab-mediated inhibition of CNS immunosurveillance byJC virus-specific CD8 T cells. Furthermore, natalizumab-associatedPML in MS patients is often complicated after natalizumab with-drawal by IRIS, darkening again the prognosis [48]. Although CD4T cells might participate [49], a clear dominance of CD8 T cellsin CNS-infiltrates has been observed in natalizumab-associatedPML-IRIS occurring in patients with MS [50], reminiscent of thePML-IRIS pathology described in HIV-infected patients [51]. Thisindirectly supports the idea that the discontinuation of natal-izumab allows migration of CD8 T cell to the CNS.

Migration of encephalitogenic CD8 T cells to the CNS isdependent on the α4β1-integrin. α4β1-Integrin blockade in MSis beneficial but exposes to opportunistic viral infections due tothe disruption of CNS immune surveillance. Because CD8 T cellsrequirements for CNS migration are distinct from those of otherimmune cells, future work should help identify novel molecu-lar targets to block specifically CNS recruitment of destructiveimmune cells while leaving the migration of protective immunecell subsets into the CNS unaffected.

Materials and methods

Mice

The CL4-TCR transgenic mouse line expresses an H-2Kd-restrictedTCR (Vα10; Vβ8.2) against the Influenza virus HA transmembranepeptide amino acids 512–520 (IYSTVASSL) [52]. The CamK-iCre[53] and the Rosa26tm(HA)1Lib [54] mice have been described pre-viously. CamK-HA mice were obtained by crossing the CamK-iCretransgenic mice with the Rosa26tm(HA)1Lib mice [19]. Cre-mediatedgenomic DNA recombination and the resulting transcription of HAoccurred only in CamK-HA mice and were confined to the brainand spinal cord [19]. Mice were backcrossed at least six timeson the BALB/c background. In some experiments, to benefit froma congenic marker allowing the distinction between transferredHA-specific CD8 T cells (CD45.1) and recipient T cells (CD45.2),donor and recipient mice on a (BALB/c × C57BL6) F1 backgroundwere used. Of note, the number of T cells infiltrating the CNS ofCamK-HA mice did not differ between the BALB/c and the (BALB/c× C57BL6) F1 backgrounds (Supporting Information Fig. 4). Allmice were 6–9-week-old at the onset of the experiments. Micewere kept under specific pathogen-free conditions. This study wascarried out in strict accordance with EU regulations and with therecommendations of the French national chart for ethics of ani-mal experiments (articles R 214-87–90 of the “Code rural”). Theprotocol was approved by the committee on the ethics of ani-mal experiments of the region Midi-Pyrenees (permit numbers:04-U563-DG-06 and MP/18/26/04/04). All procedures were per-

formed under deep anesthesia as described below and all effortswere made to minimize animal suffering.

In vitro differentiation and adoptive transfer ofHA-specific cytotoxic CD8 T cells

HA-specific cytotoxic CD8 T cells were generated as previouslydescribed [55]. Briefly, 5.105 purified naive CD8 T cells from CL4-TCR mice were stimulated with 5.106 irradiated syngeneic spleno-cytes in DMEM supplemented with 10% FCS (Life Technologies,Paisley, Scotland) containing 1 mM HA peptide, 1 ng/mL IL-2, and20 ng/mL IL-12. On day 5, cells were collected by Ficoll densityseparation and 5 × 106 living cytotoxic CD8 T cells were injectedintravenously in recipient mice. Cells routinely contained >98%CD8+ CD3+ Vβ8.2+ T cells and >95% of them produce high levelsof granzyme B and IFN-γ.

Antibodies used for in vivo experiments

mAbs were injected intravenously. Entotoxin-free rat mAbagainst mouse α4-integrin (clone PS/2, IgG2b, 250 μg/injection),α4β7-integrin (clone DATK32, IgG2a, 500 μg/injection),VCAM-1 (clone 6C7.1, IgG1, 250 μg/injection), andantiendoglin (control IgG, clone MJ7/18, IgG2a, 250 μg/injection) were produced in B.E.’s lab. The rat anti-CD4-depletingmAb (clone GK1.5, IgG2b, 500 μg/injection) was produced inR.L.’s lab. The anti-VCAM-1 clone 429 (IgG2a, 100 μg/injection)and the anti-JAM-B clone 150005 (IgG2a, 100 μg/injection,or 200 μg/injection where indicated) were purchased fromeBioscience and R&D Systems, respectively.

Purification of mononuclear cells

Mice were deeply anesthetized and perfused with 20 mL of PBS.For purification of mononuclear cells, brains were collected inPBS and dissociated using a glass Potter. Brain suspensions wereenzymatically digested for 1 h at 37°C in RPMI 1640 medium(Invitrogen) containing collagenase D (1 mg/mL), and DNaseI (10 mg/mL). The digested suspensions were filtered (70 mmcell strainer, Falcon), CNS-infiltrating mononuclear cells were col-lected after Percoll density separation and directly used for FACSstaining. For purification of mononuclear cells from spleen andcervical draining lymph nodes, organs were collected in PBS anddissociated using a glass Potter. After red blood cell lysis, mononu-clear cells were used for FACS staining.

Ex vivo restimulation of HA-specific CD8 T cells

Mononuclear cells from spleen and cervical lymph nodes (4 ×106) were plated in a 24-well plate for 6 h and restimulatedwith 1 μM of HA peptide or of H-2Kd-binding noncognate antigen



(Cw3 peptide, RYLKNGKETL). GolgiPlugTM (BD Pharmingen) wasadded for the last 2 h before mononuclear cells were used for FACSstaining.

FACS analysis

In vitro differentiated cytotoxic HA-specific CD8 T cells werestained using a viability dye and anti-CD8α (53-6.7, BD Pharmin-gen), anti-α4-integrin (hybridoma supernatant, clone PS/2), anti-β7-integrin (hybridoma supernatant, clone FIB504), or anti-α4β7-integrin heterodimer (hybridoma supernatant, clone DATK32).Mononuclear cells were stained using a viability dye and anti-CD45 (30-F11, BD Pharmingen), anti-CD45.1 (A20, Biolegend),anti-CD45.2 (104, BD Pharmingen), anti-CD11b (M1/70, eBio-science), anti-Thy1.2 (53-2.1, eBioscience), anti-CD4 (RM4-5,BD Pharmingen), anti-CD8 (53-6.7, BD Pharmingen), anti-MHCclass II (M5/114.15.2, eBioscience), anti-CD44 (IM7, Biolegend),anti-CD62L (MEL-14, BD Pharmingen), and anti-CD25 (PC61,BD Pharmingen) mAbs. After fixation and permeabilization, cellswere intracellularly stained for IFN-γ (XMG1.2, BD Biosciences)and TNF-α (MP6-XT22, BD Pharmingen). Data were collected onan LSRII or FACSCalibur (Becton Dickinson) and analyzed withFlowJo software (Tree Star).

In vitro binding assay system

Wells of diagnostic microscope slides (ER-202W-CE24, ThermoScientific) were coated with protein A (20 μg/mL in PBS pH 9)for 1 h at 37°C. After protein A incubation, wells were washedthree times with PBS (pH 7.4) and blocked with 1.5% BSA in PBSfor 30 min at 37°C. Subsequently, wells were washed once withPBS (pH 7.4) and recombinant proteins (100 nM) were incubatedfor 2 h at 37°C (recombinant DNER-Fc chimera, R&D 2254-DN;recombinant mouse ICAM-1-Fc chimera R&D 796-IC; recombinantVCAM-1-Fc chimera, R&D 643-VM). After recombinant protein-coating, wells were washed twice with PBS (pH 7.4) and blockedwith 1.5% BSA in PBS for 30 min at room temperature.

To perform the in vitro binding assay, HA-specific cytotoxicCD8 T cells were collected at 5 × 106 cells/mL in assay medium(DMEM, 25 mM HEPES, 5% calf serum, 2% L-glutamine) andincubated with either the blocking antibody (PS/2, 10 μg/mL) orthe isotype control antibody (rat IgG2b, 10 μg/mL) for 20 minat room temperature. Antibodies were washed away by centrifu-gation for 3 min at 1400 rpm. Diagnostic microscope slides wereplaced on a rotating platform and 20 μL cell suspension (1 × 105

cells/well) was added and incubated on the recombinant proteinsfor 30 min. Slides were washed twice with PBS and fixed in 2.5%v/v glutaraldehyde in PBS.

The number of adherent cells was evaluated by counting boundcells per field of view under the microscope using a grid ocular.

Immunofluorescence staining

Preparation of mouse tissue and staining procedures were per-formed as published previously [56]. Briefly, mice were perfused

with PBS or 1% formaldehyde in PBS through the left ventricle ofthe heart. Dissected tissues were embedded in Tissue-Tek (Sakura,the Netherlands), frozen, and stored at −80°C. For immunofluo-rescence staining of JAM-B, 6 μm cryostat sections were fixedwith ice-cold methanol for 20 s, followed by blocking with block-ing buffer (2% BSA, 1% FCS, 1% donkey serum in PBS). Sub-sequently, primary rabbit anti-JAM-B antibody (αJB829 1:250;kindly provided by Beat Imhof, Geneva, Switzerland) and eitherrat antimouse PECAM-1 (Mec 13.3, 20 μg/mL) or rat antimouseVCAM-1 (6C7.1, 10 μg/mL) were incubated with the sectionsfor 1 h. In between and after antibody incubation, sections werewashed with PBS. Sections were then incubated with secondaryantibodies goat antirat Alexa 488 (1:200, Invitrogen MP A11006)and donkey antirabbit Cy3 (1:200, JIR 111-165-144) and DAPI(0.5 μg/mL, Invitrogen D3571) for 1 h and coverslipped withMowiol (Sigma–Aldrich, USA). For immunofluorescence stainingof CD8, cryostat sections were fixed in ethanol for 10 min at4°C, followed by acetone for 1 min at room temperature. Sub-sequently, sections were dried for 30 min at room temperature.Blocking solution, skimmed milk (5% in TBS) was incubated for20 min. Primary rat-antimouse CD8 antibody (Lyt 2, eBiosciences)and secondary goat-antirat IgG-Cy3 antibody (eBiosciences) werediluted in blocking solution. Antibody incubation was performedfor 1 h at room temperature. To visualize the cell nuclei, DAPI(0.5 μg/mL, Invitrogen D3571) was incubated for 5 min at roomtemperature. Sections were washed with TBS between incubationsteps and finally mounted with Mowiol (Sigma–Aldrich) and ana-lyzed using a Nikon Eclipse 600 fluorescence microscope.

Statistical analysis

Differences between two sets of data were evaluated by a two-tailed Mann–Whitney U test. For analysis of scatter plots com-paring �3 groups of mice, one-way ANOVA with Bonferroni’sposttest was used. Survival curves were plotted by the Kaplan–Meier method and compared with the log-rank test. Data repre-sent mean ± SEM. Probability values of p � 0.05 were consideredstatistically significant. All tests were carried out using GraphPadPrism 5 (GraphPad Software, La Jolla, CA, USA).

Acknowledgments: This work was supported by an internationalARSEP grant (to B.E. and R.L.), the Toulouse University Hospital,the French National Institute for Medical Research (INSERM), theFrench National Research Agency (ANR-13-BSV3-0003-01), andEuropean Union, FP7-PEOPLE-2012-ITN NeuroKine to R.L., andthe Swiss National Science Foundation (Grant No. 149420)and the Swiss Multiple Sclerosis Society to B.E. S.T. has been sup-ported by a fellowship from the German Research Foundation. Wethank Dr. Beat Imhof (Geneva, Switzerland) for kindly providingthe anti-JAM-B antibody.



Conflict of interest: The authors declare no financial or commer-cial conflict of interest.

References

1 Galea, I., Bechmann, I. and Perry, V. H., What is immune privilege (not)?

Trends Immunol. 2007. 28: 12–18.

2 Liblau, R. S., Gonzalez-Dunia, D., Wiendl, H. and Zipp, F., Neurons as

targets for T cells in the nervous system. Trends Neurosci. 2013. 36: 315–

324.

3 Wilson, E. H., Weninger, W. and Hunter, C. A., Trafficking of immune

cells in the central nervous system. J. Clin. Invest. 2010. 120: 1368–1379.

4 Engelhardt, B. and Ransohoff, R. M., Capture, crawl, cross: the T cell code

to breach the blood-brain barriers. Trends Immunol. 2012. 33: 579–589.

5 Bartholomaus, I., Kawakami, N., Odoardi, F., Schlager, C., Miljkovic, D.,

Ellwart, J. W., Klinkert, W. E. et al., Effector T cell interactions with

meningeal vascular structures in nascent autoimmune CNS lesions.

Nature 2009. 462: 94–98.

6 Bauer, M., Brakebusch, C., Coisne, C., Sixt, M., Wekerle, H., Engelhardt,

B. and Fassler, R., Beta1 integrins differentially control extravasation of

inflammatory cell subsets into the CNS during autoimmunity. Proc. Natl.

Acad. Sci. USA 2009. 106: 1920–1925.

7 Engelhardt, B., Laschinger, M., Schulz, M., Samulowitz, U., Vestwe-

ber, D. and Hoch, G., The development of experimental autoim-

mune encephalomyelitis in the mouse requires alpha4-integrin but not

alpha4beta7-integrin. J. Clin. Invest. 1998. 102: 2096–2105.

8 Vajkoczy, P., Laschinger, M. and Engelhardt, B., Alpha4-integrin-VCAM-

1 binding mediates G protein-independent capture of encephalitogenic

T cell blasts to CNS white matter microvessels. J. Clin. Invest. 2001. 108:

557–565.

9 Yednock, T. A., Cannon, C., Fritz, L. C., Sanchez-Madrid, F., Steinman, L.

and Karin, N., Prevention of experimental autoimmune encephalomyeli-

tis by antibodies against alpha 4 beta 1 integrin. Nature 1992. 356: 63–66.

10 Rothhammer, V., Muschaweckh, A., Gasteiger, G., Petermann, F., Heink,

S., Busch, D. H., Heikenwalder, M. et al., Alpha4-integrins control viral

meningoencephalitis through differential recruitment of T helper cell

subsets. Acta Neuropathol. Commun. 2014. 2: 27.

11 Rothhammer, V., Heink, S., Petermann, F., Srivastava, R., Claussen, M. C.,

Hemmer, B. and Korn, T., Th17 lymphocytes traffic to the central nervous

system independently of alpha4 integrin expression during EAE. J. Exp.

Med. 2011. 208: 2465–2476.

12 Martin-Blondel, G., Delobel, P., Blancher, A., Massip, P., Marchou, B.,

Liblau, R. S. and Mars, L. T., Pathogenesis of the immune reconstitution

inflammatory syndrome affecting the central nervous system in patients

infected with HIV. Brain 2011. 134: 928–946.

13 Saxena, A., Martin-Blondel, G., Mars, L. T. and Liblau, R. S., Role of CD8

T cell subsets in the pathogenesis of multiple sclerosis. FEBS Lett. 2011.

585: 3758–3763.

14 Bien, C. G., Vincent, A., Barnett, M. H., Becker, A. J., Blumcke, I., Graus,

F., Jellinger, K. A. et al., Immunopathology of autoantibody-associated

encephalitides: clues for pathogenesis. Brain 2012. 135: 1622–1638.

15 Battistini, L., Piccio, L., Rossi, B., Bach, S., Galgani, S., Gasperini, C., Otto-

boni, L. et al., CD8+ T cells from patients with acute multiple sclerosis

display selective increase of adhesiveness in brain venules: a critical role

for P-selectin glycoprotein ligand-1. Blood 2003. 101: 4775–4782.

16 Cayrol, R., Wosik, K., Berard, J. L., Dodelet-Devillers, A., Ifergan, I., Kebir,

H., Haqqani, A. S. et al., Activated leukocyte cell adhesion molecule

promotes leukocyte trafficking into the central nervous system. Nat.

Immunol. 2008. 9: 137–145.

17 Ifergan, I., Kebir, H., Alvarez, J. I., Marceau, G., Bernard, M., Bourbon-

niere, L., Poirier, J. et al., Central nervous system recruitment of effector

memory CD8+ T lymphocytes during neuroinflammation is dependent

on alpha4 integrin. Brain 2011. 134: 3560–3577.

18 Young, K. G., Maclean, S., Dudani, R., Krishnan, L. and Sad, S., CD8+T cells primed in the periphery provide time-bound immune-surveillance

to the central nervous system. J. Immunol. 2011. 187: 1192–1200.

19 Scheikl, T., Pignolet, B., Dalard, C., Desbois, S., Raison, D., Yamazaki, M.,

Saoudi, A. et al., Cutting edge: neuronal recognition by CD8 T cells elicits

central diabetes insipidus. J. Immunol. 2012. 188: 4731–4735.

20 Elices, M. J., Osborn, L., Takada, Y., Crouse, C., Luhowskyj, S., Hemler,

M. E. and Lobb, R. R., VCAM-1 on activated endothelium interacts with

the leukocyte integrin VLA-4 at a site distinct from the VLA-4/fibronectin

binding site. Cell 1990. 60: 577–584.

21 Ludwig, R. J., Hardt, K., Hatting, M., Bistrian, R., Diehl, S., Radeke, H. H.,

Podda, M. et al., Junctional adhesion molecule (JAM)-B supports lympho-

cyte rolling and adhesion through interaction with alpha4beta1 integrin.

Immunology 2009. 128: 196–205.

22 Luo, B. H., Carman, C. V. and Springer, T. A., Structural basis of integrin

regulation and signaling. Annu. Rev. Immunol. 2007. 25: 619–647.

23 Haanstra, K. G., Hofman, S. O., Lopes Estevao, D. M., Blezer, E. L., Bauer,

J., Yang, L. L., Wyant, T. et al., Antagonizing the alpha4beta1 integrin,

but not alpha4beta7, inhibits leukocytic infiltration of the central nervous

system in rhesus monkey experimental autoimmune encephalomyelitis.

J. Immunol. 2013. 190: 1961–1973.

24 Doring, A., Pfeiffer, F., Meier, M., Dehouck, B., Tauber, S., Deutsch, U.

and Engelhardt, B., TET inducible expression of the alpha4beta7-integrin

ligand MAdCAM-1 on the blood-brain barrier does not influence the

immunopathogenesis of experimental autoimmune encephalomyelitis.

Eur. J. Immunol. 2011. 41: 813–821.

25 Laschinger, M. and Engelhardt, B., Interaction of alpha4-integrin with

VCAM-1 is involved in adhesion of encephalitogenic T cell blasts to brain

endothelium but not in their transendothelial migration in vitro. J. Neu-

roimmunol. 2000. 102: 32–43.

26 Steiner, O., Coisne, C., Cecchelli, R., Boscacci, R., Deutsch, U., Engelhardt,

B. and Lyck, R., Differential roles for endothelial ICAM-1, ICAM-2, and

VCAM-1 in shear-resistant T cell arrest, polarization, and directed crawl-

ing on blood-brain barrier endothelium. J. Immunol. 2010. 185: 4846–4855.

27 Jilek, S., Mathias, A., Canales, M., Lysandropoulos, A., Pantaleo, G.,

Schluep, M. and Du Pasquier, R. A., Natalizumab treatment alters the

expression of T-cell trafficking marker LFA-1 alpha-chain (CD11a) in MS

patients. Mult. Scler. 2013 [Epub ahead of print].

28 Schwab, N., Schneider-Hohendorf, T., Posevitz, V., Breuer, J., Gobel, K.,

Windhagen, S., Brochet, B. et al., L-selectin is a possible biomarker for

individual PML risk in natalizumab-treated MS patients. Neurology 2013.

81: 865–871.

29 Berlin, C., Berg, E. L., Briskin, M. J., Andrew, D. P., Kilshaw, P. J., Holz-

mann, B., Weissman, I. L. et al., Alpha 4 beta 7 integrin mediates lym-

phocyte binding to the mucosal vascular addressin MAdCAM-1. Cell 1993.

74: 185–195.

30 Kamata, T., Puzon, W. and Takada, Y., Identification of putative ligand-

binding sites of the integrin alpha 4 beta 1 (VLA-4, CD49d/CD29). Biochem.

J. 1995. 305: 945–951.

31 Man, S., Tucky, B., Bagheri, N., Li, X., Kochar, R. and Ransohoff, R. M.,

Alpha4 Integrin/FN-CS1 mediated leukocyte adhesion to brain microvas-

cular endothelial cells under flow conditions. J. Neuroimmunol. 2009. 210:

92–99.



32 van der Laan, L. J., van der Goes, A., Wauben, M. H., Ruuls, S. R.,

Dopp, E. A., De Groot, C. J., Kuijpers, T. W. et al., Beneficial effect of

modified peptide inhibitor of alpha4 integrins on experimental allergic

encephalomyelitis in Lewis rats. J. Neurosci. Res. 2002. 67: 191–199.

33 Cunningham, S. A., Rodriguez, J. M., Arrate, M. P., Tran, T. M. and Brock,

T. A., JAM2 interacts with alpha4beta1. Facilitation by JAM3. J. Biol. Chem.

2002. 277: 27589–27592.

34 Martin-Padura, I., Lostaglio, S., Schneemann, M., Williams, L., Romano,

M., Fruscella, P., Panzeri, C. et al., Junctional adhesion molecule, a novel

member of the immunoglobulin superfamily that distributes at intercel-

lular junctions and modulates monocyte transmigration. J. Cell Biol. 1998.

142: 117–127.

35 Del Maschio, A., De Luigi, A., Martin-Padura, I., Brockhaus, M., Bartfai, T.,

Fruscella, P., Adorini, L. et al., Leukocyte recruitment in the cerebrospinal

fluid of mice with experimental meningitis is inhibited by an antibody to

junctional adhesion molecule (JAM). J. Exp. Med. 1999. 190: 1351–1356.

36 Lechner, F., Sahrbacher, U., Suter, T., Frei, K., Brockhaus, M., Koedel, U.

and Fontana, A., Antibodies to the junctional adhesion molecule cause

disruption of endothelial cells and do not prevent leukocyte influx into

the meninges after viral or bacterial infection. J. Infect. Dis. 2000. 182:

978–982.

37 Aurrand-Lions, M., Johnson-Leger, C., Wong, C., Du Pasquier, L. and

Imhof, B. A., Heterogeneity of endothelial junctions is reflected by differ-

ential expression and specific subcellular localization of the three JAM

family members. Blood 2001. 98: 3699–3707.

38 Polman, C. H., O’Connor, P. W., Havrdova, E., Hutchinson, M., Kappos,

L., Miller, D. H., Phillips, J. T. et al., A randomized, placebo-controlled

trial of natalizumab for relapsing multiple sclerosis. N. Engl. J. Med. 2006.

354: 899–910.

39 Bloomgren, G., Richman, S., Hotermans, C., Subramanyam, M., Goelz, S.,

Natarajan, A., Lee, S. et al., Risk of natalizumab-associated progressive

multifocal leukoencephalopathy. N. Engl. J. Med. 2012. 366: 1870–1880.

40 Bonig, H., Wundes, A., Chang, K. H., Lucas, S. and Papayannopoulou, T.,

Increased numbers of circulating hematopoietic stem/progenitor cells

are chronically maintained in patients treated with the CD49d blocking

antibody natalizumab. Blood 2008. 111: 3439–3441.

41 del Pilar Martin, M., Cravens, P. D., Winger, R., Frohman, E. M., Racke, M.

K., Eagar, T. N., Zamvil, S. S. et al., Decrease in the numbers of dendritic

cells and CD4+ T cells in cerebral perivascular spaces due to natalizumab.

Arch. Neurol. 2008. 65: 1596–1603.

42 Perkins, M. R., Ryschkewitsch, C., Liebner, J. C., Monaco, M. C., Himel-

farb, D., Ireland, S., Roque, A. et al., Changes in JC virus-specific

T cell responses during natalizumab treatment and in natalizumab-

associated progressive multifocal leukoencephalopathy. PLoS Pathog.

2012. 8: e1003014.

43 Warnke, C., Mausberg, A. K., Stettner, M., Dehmel, T., Nekrich, L., Meyer

zu Horste, G., Hartung, H. P. et al., Natalizumab affects the T-cell receptor

repertoire in patients with multiple sclerosis. Neurology 2013. 81: 1400–

1408.

44 Schneider-Hohendorf, T., Rossaint, J., Mohan, H., Boning, D., Breuer, J.,

Kuhlmann, T., Gross, C. C. et al., VLA-4 blockade promotes differential

routes into human CNS involving PSGL-1 rolling of T cells and MCAM-

adhesion of TH17 cells. J. Exp. Med. 2014. 211: 1833–1846.

45 Stuve, O., Marra, C. M., Jerome, K. R., Cook, L., Cravens, P. D., Cepok, S.,

Frohman, E. M. et al., Immune surveillance in multiple sclerosis patients

treated with natalizumab. Ann. Neurol. 2006. 59: 743–747.

46 Gasnault, J., Kahraman, M., de Goer de Herve, M. G., Durali, D., Del-

fraissy, J. F. and Taoufik, Y., Critical role of JC virus-specific CD4 T-cell

responses in preventing progressive multifocal leukoencephalopathy.

AIDS 2003. 17: 1443–1449.

47 Du Pasquier, R. A., Schmitz, J. E., Jean-Jacques, J., Zheng, Y., Gordon,

J., Khalili, K., Letvin, N. L. et al., Detection of JC virus-specific cytotoxic

T lymphocytes in healthy individuals. J. Virol. 2004. 78: 10206–10210.

48 Tan, I. L., McArthur, J. C., Clifford, D. B., Major, E. O. and Nath,

A., Immune reconstitution inflammatory syndrome in natalizumab-

associated PML. Neurology 2011. 77: 1061–1067.

49 Aly, L., Yousef, S., Schippling, S., Jelcic, I., Breiden, P., Matschke, J.,

Schulz, R. et al., Central role of JC virus-specific CD4+ lymphocytes

in progressive multi-focal leucoencephalopathy-immune reconstitution

inflammatory syndrome. Brain 2011. 134: 2687–2702.

50 Metz, I., Radue, E. W., Oterino, A., Kumpfel, T., Wiendl, H., Schippling,

S., Kuhle, J. et al., Pathology of immune reconstitution inflammatory

syndrome in multiple sclerosis with natalizumab-associated progressive

multifocal leukoencephalopathy. Acta Neuropathol. 2012. 123: 235–245.

51 Martin-Blondel, G., Bauer, J., Cuvinciuc, V., Uro-Coste, E., Debard, A.,

Massip, P., Delisle, M. B. et al., In situ evidence of JC virus control by

CD8+ T cells in PML-IRIS during HIV infection. Neurology 2013. 81: 964–

970.

52 Morgan, D. J., Liblau, R., Scott, B., Fleck, S., McDevitt, H. O., Sarvetnick,

N., Lo, D. et al., CD8(+) T cell-mediated spontaneous diabetes in neonatal

mice. J. Immunol. 1996. 157: 978–983.

53 Casanova, E., Fehsenfeld, S., Mantamadiotis, T., Lemberger, T., Greiner,

E., Stewart, A. F. and Schutz, G., A CamKIIalpha iCre BAC allows brain-

specific gene inactivation. Genesis 2001. 31: 37–42.

54 Saxena, A., Bauer, J., Scheikl, T., Zappulla, J., Audebert, M., Desbois, S.,

Waisman, A. et al., Cutting edge: multiple sclerosis-like lesions induced

by effector CD8 T cells recognizing a sequestered antigen on oligoden-

drocytes. J. Immunol. 2008. 181: 1617–1621.

55 Vizler, C., Bercovici, N., Heurtier, A., Pardigon, N., Goude, K., Bailly, K.,

Combadiere, C. et al., Relative diabetogenic properties of islet-specific

Tc1 and Tc2 cells in immunocompetent hosts. J. Immunol. 2000. 165: 6314–

6321.

56 Wyss, L., Schafer, J., Liebner, S., Mittelbronn, M., Deutsch, U., Enzmann,

G., Adams, R. H. et al., Junctional adhesion molecule (JAM)-C deficient

C57BL/6 mice develop a severe hydrocephalus. PLoS One 2012. 7: e45619.

Abbreviations: BBB: Blood-brain barrier · IRIS: Immune reconstitution

inflammatory syndrome · JAM-B: Junctional adhesion molecule-B · PML:

Progressive multifocal leukoencephalopathy

Full correspondence: Dr. Roland Liblau, INSERM U1043 - CNRS UMR5282, Centre de Physiopathologie de Toulouse Purpan (CPTP), PurpanHospital, Place du Docteur Baylac TSA 40031, 31059 Toulouse Cedex 9,FranceFax: +33-561-77-21-38e-mail: [email protected]

Received: 5/3/2015Revised: 21/8/2015Accepted: 7/9/2015Accepted article online: 31/8/2015


ECI

2015R

eviewS

eries

2712 Lidia Yshii et al. Eur. J. Immunol. 2015. 45: 2712–2720DOI: 10.1002/eji.201545759

Neurons and T cells: Understanding this interactionfor inflammatory neurological diseases

Lidia Yshii1,2,3, Christina Gebauer1,2, Raphael Bernard-Valnet1,2

and Roland Liblau1,2

1 INSERM U1043 - CNRS UMR 5282, Centre de Physiopathologie Toulouse-Purpan, Toulouse,France

2 Universite Toulouse III, Toulouse, France3 Institute of Biomedical Sciences I, University of Sao Paulo, Sao Paulo, Brazil

Central nervous system (CNS) inflammation occurs in a large number of neurologicaldiseases. The type and magnitude of CNS inflammation, as well as the T-cell contribution,vary depending on the disease. Different animal models of neurological diseases haveshown that T cells play an important role in CNS inflammation. Furthermore, recentstudies of human neurological disorders have indicated a significant role for T cells indisease pathology. Nevertheless, how individual T-cell subsets affect neuronal survival,damage and/or loss remains largely unclear. In this review we discuss the processesby which T cells mediate either beneficial or deleterious effects within the CNS, withemphasis on the direct interaction between T cells and neurons, as occurs in multiplesclerosis, paraneoplastic cerebellar degeneration, and viral encephalitis. The therapeuticapproaches targeting T cells and their mediators as treatment for neurological diseasesare also described here.

Keywords: Autoimmunity � Central nervous system � Inflammation � Neurodegeneration �

Neurons � T cells � Viral infection

Introduction

Due to its limited regenerative capacity, the central nervoussystem (CNS) needs to protect itself against potentially dam-aging exuberant immune responses. This is achieved througha singular state of reduced exposure to the immune system,known as “immune privilege” (reviewed in [1, 2]). This “immuneprivilege” occurs thanks to the blood–brain barrier (BBB), lim-ited major histocompatibility complex (MHC) molecule expres-sion in the brain, and neuronal expression of molecules withimmunosuppressive properties, such as TGF-β and CD200 [3]. Allthese contribute to protect neurons and axons from microglia-and/or T-cell-induced damage although it is not as drastic aspreviously thought. Activated immune cells can enter the CNS

Correspondence: Prof. Roland Liblaue-mail: [email protected]

through various routes under specific conditions through selec-tive receptor–ligand interactions (reviewed in [4]). Recent stud-ies have identified an unconventional lymphatic drainage systemfrom the CNS interstitial fluid and cerebrospinal fluid (CSF) tothe deep cervical lymph nodes [5, 6]. Whether immune cellsexit the CNS using these lymphatic vessels is currently underinvestigation.

Inflammation occurs in a large number of neurological dis-eases with etiologies as diverse as ischemia, trauma, infection,autoimmunity, or neurodegeneration [7, 8]. The type and mag-nitude of CNS inflammation, and the possible contribution ofT cells, vary largely depending on the considered disease. A piv-otal role has been attributed to T cells in animal models of CNSinflammation, and similar observations are emerging from thestudy of human neurological disorders (reviewed in [7, 9]). More-over, CNS-resident cells, including some neurons, constitutivelyexpress MHC class I molecules [10, 11], challenging the classicalview that neurons might be excluded from cytotoxic T-cell (CTL)


Eur. J. Immunol. 2015. 45: 2712–2720 HIGHLIGHTS 2713

recognition [12]. In addition, MHC class I expression on neuronsand glial cells increases strikingly under pathological conditions[13]. Importantly, recent data indicate that neurons can processand present viral or exogenous antigens to CTLs, resulting in neu-ronal cell death [14, 15].

In this review, we discuss the processes by which T cells canhave either beneficial or deleterious effects within the CNS, witha special emphasis on the direct interaction between T cells andneurons. We also review the different therapeutical approachestargeting T cells and their mediators for the treatment of neuro-logical diseases.

T-cell migration into the CNS

T cells enter into the CNS through migration across the BBB, theblood–leptomeningeal barrier, or the choroid plexus (reviewed in[16]). Integrins, selectins, and chemokine receptors expressed onT cells regulate this transmigration, and T-cell ligands are upreg-ulated on CNS endothelial cells during neuroinflammation [16].In particular, the interaction between α4β1-integrin, expressed byactivated T cells, and vascular cell adhesion protein 1 (VCAM-1), expressed on blood vessels, has been shown to have a piv-otal role for CD4+ and CD8+ T-cell migration into the CNS[17–19]. Th17 cells, however, have been shown to adhere toendothelial cells and extravasate into the CNS independentlyof α4β1 [20], using either a melanoma cell adhesion molecule(MCAM)- [21], or lymphocyte function-associated antigen 1 (LFA-1)-dependent pathway [22]. Moreover, the chemokine receptorCCR6 has been shown to control the migration of Th17 cells intothe CNS through the choroid plexus in a mouse model of multi-ple sclerosis, experimental autoimmune encephalomyelitis (EAE)[23]. Additionally, CD4+FoxP3+ T regulatory (Treg) cells dependon LFA-1 to migrate into the CNS in the absence of α4-integrinduring EAE [24]. In humans, blocking CCR5 appears to limit thetraffic of CD8+ T cells into the CNS of patients suffering fromprogressive multifocal leukoencephalopathy-associated immunereconstitution inflammatory syndrome (PML-IRIS), which is anunbalanced immune reaction to the JC virus responsible for PML[25, 26]. Moreover, CCR5 deficiency in humans is a strong riskfactor for CNS infection by West Nile virus (WNV) [27], most likelybecause CCR5-deficient cells limit the local migration of effectorT cells.

Collectively, these data suggest that different immune cell sub-sets use various molecular cues to penetrate the CNS. These spe-cific pathways offer the possibility of blocking only the immunecell type involved in a particular disease.

Neuronal protection against T-cell-mediatedinflammation

While T cells are considered destructive in many neurological dis-orders (see “Inflammatory and neurodegenerative diseases medi-ated by T cells”), they can also promote neuroprotection in the

same experimental situations [28]. For instance, Th1 and Th2CD4+ T cells have been shown to produce neurotrophins, whichare neurotrophic growth factors that contribute to the develop-ment, function, and survival of neurons [29]. The production ofthe neurotrophin BDNF (brain-derived neurotrophic factor), inparticular, is enhanced upon antigen stimulation of T cells, whichin turn has been shown to support neuronal survival by inducingaxonal outgrowth and regeneration [30]. Additionally, both BDNFand neurotrophin-3 were detected in activated T cells infiltratingthe CNS during EAE, suggesting that the damaging consequencesof T cells can be counteracted by neurotrophic factors producedby T cells [28].

Importantly, the interactions between T cells and neu-rons are bidirectional. Neurons have evolved mechanisms todirectly protect the CNS from T-cell-mediated inflammation. Forexample, neurons have been shown to promote T-cell apop-tosis through Fas/FasL interactions [31] and produce anti-inflammatory cytokines, such as TGF-β, which is associated withresistance to EAE [32, 33]. Furthermore, a pro-inflammatory envi-ronment results in increased production of TGF-β and enhancedsurface expression of CD80/CD86 by neurons [32]. In turn,TGF-β and CD80/CD86 maintain the antigen-independent CD4+

T-cell proliferation and promote the conversion of pathogenicCD4+ T cells into TGFβ+CTLA-4+ Treg cells, which then suppressencephalitogenic T cells and inhibit EAE [32].

In addition, Treg cells counteract effector immune mechanismswithin tissues, preserving neuronal function. In particular, Tregcells can control CNS inflammation in EAE [34, 35]. For instance,Treg cells expressing the transcription factor FoxA1 (FoxA1+Tregcells) have been shown to enhance their own expression of pro-grammed cell death ligand 1 (PD-L1) and kill pathogenic CD4+

T cells, thereby suppressing EAE in a FoxA1- and PD-L1-dependentway [36]. There is also evidence that CD8+CD122+ T cells pro-duce IL-10, which inhibits proliferation of CTLs as well as theirIFN-γ production, resulting in suppression of EAE, especially inthe late phase [37].

In addition, after CNS injury, CD4+ T-cell infiltration occursindependently of MHC class II expression. The CNS-invadingCD4+ T cells exhibit increased IL-4 output as compared withthat of their peripheral counterparts, as a result of MyD88 signal-ing triggered by damage-associated molecular pattern molecules(DAMPs) [38]. The T-cell-derived IL-4 indirectly triggers neuro-protection and axon growth through activation of IL-4 receptorson neurons, enhancing the neurotrophin signaling pathway [38].In a model of acute spinal cord injury, both Th1 cells and Tregcells have been shown to be required for recovery [39]. Likewise,in amyotrophic lateral sclerosis (ALS) mouse model, Treg cellsare recruited to attenuate the cytotoxic activity of microglia and,consequently, promote neuroprotection [40, 41].

Nevertheless, within the CNS, effector T cells mostly con-tribute to inflammation and neurodegeneration in both ster-ile and nonsterile situations [7]. We therefore concentratebelow on pathological conditions in which T cells promote neu-ronal/axonal damage and discuss the mechanisms involved and


2714 Lidia Yshii et al. Eur. J. Immunol. 2015. 45: 2712–2720

how to therapeutically interfere with disease-promoting T-cellpopulations.

T-cell activities in the CNS during viral infections

The interaction between CD8+ T cells and neurons during viralinfections differs according to the virus involved.

Exposure to the neurotropic herpes simplex virus type 1 (HSV-1) results in chronic infection of neurons in the trigeminal gan-glia. During latency, no infectious viral particles are produced andHSV-1 proteins are not detectable [42]. HSV-1-specific CTLs havebeen shown to localize in close proximity to HSV-1-infected neu-ronal cell body in human trigeminal ganglia [43]. HSV-1-specificCTL activation or retention involves CD4+ T cells, as well as localAPCs [44]. CD8+ T cells have been shown to use at least twononcytolytic mechanisms to maintain HSV-1 latency [45]. First,granzyme B delivered by HSV-1-specific CD8+ T cells to infectedneurons can directly cleave ICP4, a viral protein required for effi-cient transcription of early and late viral genes, without impairingneuronal survival in vitro [45]. Second, IFN-γ secretion by HSV-1-specific CTLs has been implicated in inhibiting the expressionof HSV-1 gene products required for viral reactivation [45]. Thus,Granzyme B and IFN-γ are essential to control the reactivation ofHSV-1 from latency.

In contrast to the noncytolytic mechanisms employed by CTLsin response to HSV-1 infection, mouse models for WNV infectionhave revealed that CD8+ T cells are required to clear the virusfrom infected neurons in an MHC class I-dependent manner [46].Mice lacking MHC I molecules have an increased and sustainedWNV infection in both peripheral and CNS tissues [46]. Indeed,CD8+ T cells have been shown to directly kill infected neuronsthrough both the perforin and Fas/FasL ligand pathways to elimi-nate WNV from the CNS [47]. Additionally, CD8+ T cells produceTNF-related apoptosis-inducing ligand (TRAIL) to restrict WNVinfection of CNS neurons [48]. Furthermore, upon WNV infection,production of CXCL10 by neurons is induced by IFN-γ, thereby pro-moting the recruitment of CXCR3-expressing CD8+ T cells into theCNS [49]. However, CXCL10 expression can vary between neu-ronal subsets: cerebellar granule neurons present higher expres-sion of CXCL10 in comparison to cortical neurons, indicating adifferential regulation of inflammatory responses according to theneuron subtypes [49].

The neurotropic Borna disease virus (BDV) is another exam-ple in which CD8+ T cells clear the virus through direct killingof infected neurons. Interestingly, BDV triggers up-regulation ofMHC class I on primary murine neurons, thereby allowing cog-nate interaction between these neurons and virus-specific CTLs[15]. This leads to morphological and functional alterations of theinfected neurons, preceding their subsequent apoptosis [15].

In the viral deja vu model (antiviral CTLs targeting an epitopeshared by the initial virus persisting in neurons and the secondaryvirus) in mice infected with a lymphocytic choriomeningitis virus(LCMV) variant, an original non-neurotoxic phenomenon resultsfrom the CTL attack on neurons in vivo [50]. Indeed, infection

with this variant results in a rapid loss of dendrites and synapses,induced by the release of IFN-γ by CTLs in close contact with neu-rons, and subsequent IFN-γ receptor signaling in neurons, inde-pendent of Fas/FasL or perforin involvement [50]. Of note, in CNSlesions of Rasmussen encephalitis patients, a similar phosphory-lation of STAT1 observed in the murine deja vu model is oftenfound within neurons in close contact with CD8+ T cells [50].

IFN-γ produced by CD8+ T cells may promote neurotoxicitythrough additional mechanisms. For example, the IFN-γ receptorcan form a complex with the AMPA receptor subunit GluR1 inneurons, increasing the excitability and vulnerability to glutamateexcitotoxicity [51]. In addition, IFN-γ signaling in neurons hasbeen shown to reduce the synaptic conduction below a criticalthreshold and enhances the expression of MHC class I moleculeson neurons [51]. These effects may render neurons more sus-ceptible to CD8+ T cell-mediated cytolysis during the course ofinflammatory diseases.

Thus, the collective effect of TRAIL, FasL, and perforin, and theincreased expression of MHC class I molecules, underlies someof the molecular tools by which effector CD8+ T cells directlyinteract with and kill infected neurons to contain viral infection[47, 48]. Moreover, production of CXCL10 by neurons furtherattracts effector CD8+ T cells at sites of viral infection. However,the molecular tools used by T cells to control the viral infectionof CNS neurons seems to be dependent on the virus involved andmay even differ according to the infected neuronal subset.

Inflammatory and neurodegenerative diseasesmediated by T cells

The potential implication of T cells, and particularly CD8+

T cells, in CNS autoimmune diseases is receiving increasing atten-tion [7, 8, 52, 53]. Indeed, the list of human neurological dis-eases in which T cells have been suggested to target neurons oraxons, directly or indirectly, is continuously growing (see Table1). We describe below three selected diseases in which T cellstarget neurons through different mechanisms. In multiple sclero-sis (MS) and paraneoplastic cerebellar degeneration (PCD) theadaptive immune system is a key mediator of CNS tissue dam-age whereas Parkinson’s disease (PD), a primary neurodegener-ative disease with secondary inflammation, is mostly mediatedby innate immune cells [8]. In MS, axonal transection and neu-ronal loss have been shown to develop in the context of a complexT-cell-mediated chronic inflammation [54]. Contrary to this, inPCD, a rare autoimmune disease associated with gynecologic can-cers, there is evidence suggesting that the selective loss of Purkinjeneurons likely results from direct interaction between CTLs andPurkinje neurons [55]. Finally, recent data highlight the possiblecontribution of T cells in PDs [14].

Multiple sclerosis and EAE, its popular animal model

MS is very likely an autoimmune disease of the CNS whichleads to multifocal demyelination and neurodegeneration [9]. MS



Table 1. Human neurological diseases involving targeting of CNS neurons by infiltrating T cells

Disease Targeted neurons Pathogenic T-cell population(s)

Infectious diseasesHTLV-1 associated myelopathy/tropical spastic

paraparesis (HAM/TSP)a)Axonal loss in spinal cord Cytotoxic CD8+ T cells

JC virus PML-IRISb) Cerebellar granule cells; cortical neurons CD8+ T cells/CD4+ T cellsViral encephalitisc) Infected neurons Mostly CD8+ T cellsAcute/subacute postviral encephalitisd) Neurons CD8+ and CD4+ T cellsToxoplasmic encephalitise) Infected neurons CD8+ T cells

(Plausible) Autoimmune diseasesNarcolepsyf) Hypothalamic Orexin neurons CD8+ T cells/CD4+ T cellsAnti-Hu syndromeg) Most neurons CD8+ T cellsEncephalitis associated with anti-Ma1/2

antibodyDiencephalic neurons CD8+ T cells

Stiff-person syndromeh) GABAergic neurons CD8+ T cellsParaneoplastic cerebellar degenerationi) Purkinje neurons CD8+ T cellsIdiopathic central diabetes insipidus j) Neurohypophysis AVP neurons CD8+ T cellsMultiple sclerosisk, l) Most axons/neurons Th17; CD8+ T cellsFebrile infection-related epilepsy syndrome

(FIRES)m)Temporal neurons and basal ganglia T cells

Other diseasesParkinson’s diseasen) Substantia nigra dopaminergic neurons CD4+ T cellsRasmussen’s diseaseo) Cortical neurons CD8+ T cellsCLIPPERSp) Brainstem and cerebellum CD4+ > CD8+ T cellsHemophagocytic lymphohistiocytosisq) Gray and white matter CD8+ T cells (and NK cells)CTLA-4 haploinsufficiencyr) Gray and white matter Unknown

a)Matsuura et al., J. Neuropathol. Exp. Neurol. (2015) 74:2b)Schippling et al., Ann. Neurol. (2013) 74:622c) Phares et al., J Virol (2012) 86:2416d)Gogate et al., J Neuropathol Exp Neurol (1996) 55:435e)Blanchard et al., Parasite Immunol (2015) 37:150f) Liblau et al., Lancet Neurol (2015) 14:318g)Pignolet et al., Oncoimmunology (2013) 2:e27384h)Poh et al., J Neurol Sci (2014) 337:235i) Albert et al., Nat Med (1998) 4:1321j) Scheikl et al., J Immunol (2012) 188:4731k)Aktas et al., Neuron (2005) 46:421l) Huseby et al., J Exp Med (2001) 194:669m)Rebillard et al., Lancet Neurology Autoimmune Disorders Conference (2015) personal communicationn)Brochard et al., J Clin Invest (2009) 119:182o)Varadkar et al., Lancet Neurol (2014) 13:195p)Simon et al., J Neurol Neurosurg Psychiatry (2012) 83:15q)Deiva et al., Neurology (2012) 78:1150r) Kuehn et al., Science (2014) 345:1623.

development involves both genetic [56] and environmental fac-tors [57]. Extensive axonal/neuronal damage is observed in MSpathology, with transected axons and reduced neuronal densityresulting in brain and spinal cord atrophy [54, 58]. These findingsare associated with focal infiltration by macrophages and T cells,which form demyelinated plaques within the white matter and inthe cortex. These infiltrating immune cells secrete proinflamma-tory cytokines, chemokines and reactive oxygen species that affectthe neurons, due to chronic inflammation and oxidative stress, aswell as mitochondrial and ion channel dysfunction, culminatingin neuronal death [9].

Extensive studies in EAE mice and MS patients have suggesteda key role for several T-cell subsets in MS pathogenesis, but their

contribution to the disease is still under investigation. While theinitial animal models of EAE emphasized the role of CD4+ T cells[59], Lucchinetti et al. [60] demonstrated that CD8+ T-cell infil-tration is present in more than 70% of human MS cortical plaquebiopsies. Moreover, CD8+ T cells have been shown to be far morenumerous than CD4+ T cells in active parenchymal MS lesions[61]. Notably, higher levels of IL-17A have been detected in thecerebrospinal fluid (CSF) of MS patients compared with that fromhealthy subjects, and a large proportion (approx. 80%) of CNS-infiltrating T cells express IL-17 in active MS lesions [62, 63]. Inthe classical EAE model, MOG-specific Th17 cells have been shownto form direct physical contacts with neurons and their processeswithin demyelinating lesions [64]. These contacts were shown to



be LFA-1-dependent, but antigen- and MHC class II-independent[64]. Nevertheless, Th17 cells induced a marked, localized andpartially reversible raise in Ca2+ concentration within axons thatcould lead to axon transection and neuronal soma degeneration[64], while Th1 cells were much less efficient at killing neuronsthrough this mechanism [65]. In contrast, encephalitogenic CD4+

T cells have been shown to contribute to neuronal damage byreleasing TRAIL and activate caspase 3 in neurons [65].

Increasing evidence indicates that CD8+ T cells contribute toMS pathogenesis, and animal models in which CD8+ T cells are themain effectors of disease have been developed [66]. For instance,myelin basic protein (MBP)-specific CD8+ T cells have been shownto cause severe CNS autoimmune disease in mice [67]. The MBP-specific CTLs induce demyelination and neuronal apoptosis, in anIFN-γ-dependent fashion, leading to motor function impairment[67]. In a humanized mouse model of EAE, it was demonstratedthat MHC class I alleles and CD8+ T cells are directly implicated.In fact, MHC class I-restricted CD8+ T cells efficiently initiatedthe first attack [68]. Furthermore, T-cell infiltrates were locatedpredominantly in the spinal cord and cerebellum, with signs ofdemyelination and neuronal degeneration [68].

Collectively, these mouse models highlight the potential forauto reactive CD4+ and CD8+ T cells to contribute directly or indi-rectly to axonal or neuronal damage. The advances in two-photonin vivo imaging techniques, which allow real-time intravital mon-itoring of T-cell dynamics and function, will undoubtedly furtherour understanding of the underlying mechanisms [69].

Paraneoplastic cerebellar degeneration

PCD is a rare and severe neurological disease, caused by the selec-tive loss of Purkinje neurons in the cerebellum. PCD developsmainly in patients with breast or ovarian carcinomas [53, 70].An autoimmune response targeting a cytoplasmic protein (namedcdr2) expressed in both tumor cells and Purkinje neurons [55] isthought to ultimately lead to neuroinflammation [71]. However,the presence of cdr2-expressing tumor cells is not sufficient toinduce PCD. Actually, 60% of ovarian tumors and 25% of breasttumors express cdr2 in the absence of PCD [70].

The immunopathogenesis of PCD is not fully clarified. Althoughpatients are diagnosed based on high titers of anti-cdr2 autoanti-bodies, the direct pathogenic contribution of anti-cdr2 autoanti-bodies is very unlikely, given the intracellular location of the tar-get auto-antigen [72]. However, a recent report of a study usingcerebellar organotypic slice culture demonstrated that anti-cdr2antibody internalization caused deregulation of Ca2+ homeosta-sis, leading to morphological changes of Purkinje cells and alter-ations in the cell signaling pathways, resulting in neurodegenera-tion [73]. According to one possible scenario, dendritic cells thathave phagocytosed apoptotic tumor cells would activate tumor-specific CD4+ and CD8+ T cells in local lymph nodes [72]. As apossible result, most tumors detected in PCD patients have limiteddisease spread [74]. However, cdr2-specific CTLs would migrateto the CNS and target Purkinje neurons [55]. Indeed, CD8+ T cells

are found in the cerebellum of patients with PCD [75]. Moreover,granzyme B-containing CD8+ T cells are observed close to thePurkinje neurons [75], which can express MHC class-I molecules[10].

Although cdr2-specific CTLs were found in the blood and CSFof PCD patients [55, 76], there is no evidence that they causecerebellar pathology. This is in part due to the lack of appropriateanimal models of PCD.

Parkinson’s disease

PD, the most prevalent movement disorder, is caused by the selec-tive degeneration of dopaminergic neurons in the substantia nigra(SN), which are located in the midbrain. CD4+ and CD8+ T cellshave been detected within the SN in postmortem specimens fromPD patients [77]. The same observation was made in the mousemodel of 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP)-induced dopaminergic neuronal death [77]. Further investigationindicated that CD4+ T cells contribute to the neuronal loss inducedby MPTP, through activation of the Fas/FasL pathway [77]. More-over, MHC class I was detected in dopaminergic neurons of the SNin both healthy control and PD postmortem tissues [14]. The samestudy showed that human stem cell-derived dopaminergic neuronscan display MHC class I upon IFN-γ treatment [14]. High exposureto the dopamine precursor, L-DOPA, has been shown to induceMHC class I expression on murine dopaminergic neurons, priorto their subsequent destruction by CTLs [14]. Both studies concurto suggest that T cells contribute to the neuronal loss observed inPD [14, 77]. However, the precise T-cell subset at play remains tobe firmly determined. Furthermore, other immune cells, such asactivated microglia and astrocytes are believed to cause neuronaldeath in a nonantigen-specific way [78]. This neuroinflammationin PD could well participate to dopaminergic neuronal demise.However, although actively studied, therapeutic immunomodula-tion has not yet been proved successful in PD.

Therapeutic implications of understanding theconsequences of neuron/T-cell interaction

In experimental models such as EAE, the range of possibilities totherapeutically target pathogenic T cells is remarkable. Transla-tion to humans may take 15 years or more and, unfortunately, ithas not been consistently correlated with success.

The use of T-cell depletion strategies has been revived thanksto the approval for, and strong beneficial effect of, Alemtuzumabin active MS [79, 80]. Alemtuzumab, a humanized anti-CD52mAb, induces long-lasting (2–3 years) CD8+ and CD4+ T-celldepletion [81]. In view of the data described above, it is note-worthy that the progressive T-cell reconstitution after cycles ofAlemtuzumab injection favors cells with a regulatory phenotype(CD25+FOXP3+CD127low), as well as CD4+ and CD8+ T cells pro-ducing IL-10 and TGF-β [82]. A transient increase in circulatingIL-4+ T cells has also been noted [82]. During the reconstitution



phase, T cells also produce high levels of neurotrophic factors,such as BDNF, CNTF, and PDGF, which favor survival and differ-entiation of neurons and oligodendrocytes in vitro [83]. Whetherthese reconstituted T cells can penetrate the CNS and exert neu-roprotective functions, however, remains uncertain.

Due to the lack of appropriate techniques, the selective elimi-nation of functional T-cell subsets such as Th1, Th17, effector ormemory cytotoxic CD8+ T cells has not been clinically tested.Daclizumab, a humanized anti-CD25 mAb inhibiting signalingthrough the high-affinity IL-2R, was initially investigated in MS toblunt activated pathogenic CD25+ T cells [84, 85]. Unexpectedly,Daclizumab treatment led to only a marginal reduction in conven-tional CD4+ and CD8+ T-cell numbers and function, but elicitedregulatory mechanisms involving CD56bright NK cells [84, 86].

Blocking the migration of T cells (as well as other leukocytes)from the blood to the CNS using anti-integrin monoclonal antibod-ies or a structural analog of sphingosine has proven highly success-ful [87, 88]. Indeed, the use of anti-α4 integrin mAb, which inhibitsVLA/VCAM1 interaction, or functional antagonists of sphingosine-1-phosphate (S1P) receptors, which prevent lymphocyte exit fromsecondary lymphoid organs into the blood, have produced remark-able therapeutic advances for people with MS [87, 88]. It is rea-sonable to predict that other CNS inflammatory diseases couldbenefit from this therapeutic approach. However, the weak selec-tivity of this approach remains a major downside, putting, interalia, the CNS at risk of opportunistic infections. More selectivestrategies, which interfere with given T-cell subsets, such as Th17or cytotoxic CD8+ T cells, will rely on the growing knowledge onthe molecular cues governing their transmigration into the CNS.This idea is nevertheless dependent upon two key parameters:(i) the identification of selective/preferential pathways for givenT-cell subsets; and (ii) the absence of molecular redundancy fortheir penetration into the CNS. The inhibition of effector T-cellentry to the CNS by the CCR5 antagonist, maraviroc, in patientswith PML-IRIS may be a first encouraging example of a strategythat addresses both parameters [25, 26].

Selective inhibition of given immune molecules has been amajor therapeutic revolution. The use of monoclonal antibod-ies targeting soluble T-cell mediators, in particular cytokines, ortheir receptors is a novel therapeutical approach for patients withCNS inflammatory diseases. mAbs neutralizing IL-17A or GM-CSFhave been tested in small trials with MS patients with sugges-tive efficacy [89, 90]. Blocking IFN-γ in MS, as well as in otherneurological diseases (Table 1) could be another therapeuticalapproach. Indeed, IFN-γ is strongly expressed in active MS lesionsand intravenous injection of recombinant IFN-γ has been shown toincrease MS exacerbation rate [91]. Moreover, the administrationof neutralizing anti-IFN-γ mAb could be used to treat patients withhemophagocytic lymphohistiocytosis [92]. However, the severeopportunistic infections that have been shown to develop mostlyin Asian patients who had been treated with autoantibodies neu-tralizing IFN-γ raise serious concerns for the prolonged use ofthis strategy [93]. The inhibition of key effector molecules withinT cells, such as Granzyme B and IL-17, represents exciting novelstrategies for future development. Pharmacologic inhibitors of

master transcription factors involved in T-cell differentiation arebeing developed. For instance, siRNAs target precise moleculeswithin cells, but their efficient delivery to the desired cell popula-tion in vivo remains a challenge [94]. The use of ‘smart ligands’,such as aptamers targeting a specific surface receptor linked tosiRNA, may help solve this challenge [95].

The ideal goal in the treatment of CNS autoimmune dis-eases would be to precisely neutralize the pathogenic autoreactiveT cells, instead of deleting large proportions of T cells or targetingmolecules needed for a protective immune response. Spectacularresults in preclinical animal models of MS with antigen-specific tol-erance protocols have been presented [96], supporting this ther-apeutic approach. However, this has not yet met clinical expec-tations, possibly due to the ill-defined nature of both the targetautoantigens and the pathogenic lymphocyte subsets. Neverthe-less, innovative antigen-specific strategies, such as myelin peptidecoupled to cells or nanobeads are being followed in MS [97, 98].

Conclusion

In this review, we have focused on the interactions betweenT cells and neurons and their consequences in CNS disease. Inrecent years, the role of T cells in tissue damage (and repair)has been increasingly investigated, given the possible therapeu-tic implications. Nevertheless, the molecular mechanisms throughwhich each T-cell subset mediates neuronal loss or survival remainlargely unclear.

Until now, T-cell-associated CNS diseases, such as MS, aregradually responsive to drugs blocking T-cell entry into the CNS.However, more precise therapeutic approaches blocking specificT-cell functions in the CNS are still needed. The emerging knowl-edge on the genetic bases of CNS inflammatory diseases will, inall likelihood, help design more specific therapies.

Acknowledegment: This work was supported by FAPESP2013/22196-4 (LY), by INSERM, CNRS, Toulouse III University(RL), and grants from ARSEP, ANR T cell-CNS and the EuropeanUnion, FP7-PEOPLE-2012-ITN NeuroKine (RL).

Conflict of interest: The authors declare no financial or commer-cial conflict of interest.

References

1 Bechmann, I., Galea, I. and Perry, V. H., What is the blood-brain barrier

(not)? Trends Immunol. 2007. 28: 5–11.

2 Billingham, R. E. and Boswell, T., Studies on the problem of corneal

homografts. Proc. R Soc. Lond. B Biol. Sci. 1953. 141: 392–406.



3 Chitnis, T., Imitola, J., Wang, Y., Elyaman, W., Chawla, P., Sharuk,

M., Raddassi, K. et al., Elevated neuronal expression of CD200 pro-

tects Wlds mice from inflammation-mediated neurodegeneration. Am.

J. Pathol. 2007. 170: 1695–1712.

4 Ransohoff, R. M. and Engelhardt, B., The anatomical and cellular basis of

immune surveillance in the central nervous system. Nat. Rev. Immunol.

2012. 12: 623–635.

5 Louveau, A., Smirnov, I., Keyes, T. J., Eccles, J. D., Rouhani, S. J., Peske,

J. D., Derecki, N. C. et al., Structural and functional features of central

nervous system lymphatic vessels. Nature 2015. 523: 337–341.

6 Aspelund, A., Antila, S., Proulx, S. T., Karlsen, T. V., Karaman, S., Det-

mar, M., Wiig, H. et al., A dural lymphatic vascular system that drains

brain interstitial fluid and macromolecules. J. Exp. Med. 2015. 212: 991–

999.

7 Liblau, R. S., Gonzalez-Dunia, D., Wiendl, H. and Zipp, F., Neurons as

targets for T cells in the nervous system. Trends Neurosci. 2013. 36: 315–

324.

8 Waisman, A., Liblau, R. S. and Becher, B., Innate and adaptive immune

responses in the CNS. Lancet Neurol. 2015. 14: 945–955.

9 Mahad, D. H., Trapp, B. D. and Lassmann, H., Pathological mechanisms

in progressive multiple sclerosis. Lancet Neurol. 2015. 14: 183–193.

10 McConnell, M. J., Huang, Y. H., Datwani, A. and Shatz, C. J., H2-K(b)

and H2-D(b) regulate cerebellar long-term depression and limit motor

learning. Proc. Natl. Acad. Sci. USA 2009. 106: 6784–6789.

11 Needleman, L. A., Liu, X. B., El-Sabeawy, F., Jones, E. G. and McAllister,

A. K., MHC class I molecules are present both pre- and postsynaptically

in the visual cortex during postnatal development and in adulthood. Proc.

Natl. Acad. Sci. USA 2010. 107: 16999–17004.

12 Joly, E. and Oldstone, M. B., Neuronal cells are deficient in loading pep-

tides onto MHC class I molecules. Neuron 1992. 8: 1185–1190.

13 Hoftberger, R., Aboul-Enein, F., Brueck, W., Lucchinetti, C., Rodriguez,

M., Schmidbauer, M., Jellinger, K. et al., Expression of major histocom-

patibility complex class I molecules on the different cell types in multiple

sclerosis lesions. Brain Pathol. 2004. 14: 43–50.

14 Cebrian, C., Zucca, F. A., Mauri, P., Steinbeck, J. A., Studer, L., Scherzer, C.

R., Kanter, E. et al., MHC-I expression renders catecholaminergic neurons

susceptible to T-cell-mediated degeneration. Nat. Commun. 2014. 5: 3633.

15 Chevalier, G., Suberbielle, E., Monnet, C., Duplan, V., Martin-Blondel, G.,

Farrugia, F., Le Masson, G., Liblau, R. et al., Neurons are MHC class I-

dependent targets for CD8 T cells upon neurotropic viral infection. PLoS

Pathog. 2011. 7: e1002393.

16 Engelhardt, B. and Ransohoff, R. M., Capture, crawl, cross: the T cell code

to breach the blood-brain barriers. Trends Immunol. 2012. 33: 579–589.

17 Yednock, T. A., Cannon, C., Fritz, L. C., Sanchez-Madrid, F., Steinman, L.

and Karin, N., Prevention of experimental autoimmune encephalomyeli-

tis by antibodies against alpha 4 beta 1 integrin. Nature 1992. 356: 63–66.

18 Young, K. G., Maclean, S., Dudani, R., Krishnan, L. and Sad, S., CD8+T cells primed in the periphery provide time-bound immune-surveillance

to the central nervous system. J. Immunol. 2011. 187: 1192–1200.

19 Ifergan, I., Kebir, H., Alvarez, J. I., Marceau, G., Bernard, M., Bourbon-

niere, L., Poirier, J. et al., Central nervous system recruitment of effector

memory CD8+ T lymphocytes during neuroinflammation is dependent

on alpha4 integrin. Brain 2011. 134: 3560–3577.

20 Glatigny, S., Duhen, R., Oukka, M. and Bettelli, E., Cutting edge: loss of

alpha4 integrin expression differentially affects the homing of Th1 and

Th17 cells. J. Immunol. 2011. 187: 6176–6179.

21 Schneider-Hohendorf, T., Rossaint, J., Mohan, H., Boning, D., Breuer, J.,

Kuhlmann, T., Gross, C. C. et al., VLA-4 blockade promotes differential

routes into human CNS involving PSGL-1 rolling of T cells and MCAM-

adhesion of TH17 cells. J. Exp. Med. 2014. 211: 1833–1846.

22 Rothhammer, V., Heink, S., Petermann, F., Srivastava, R., Claussen, M. C.,

Hemmer, B. and Korn, T., Th17 lymphocytes traffic to the central nervous

system independently of alpha4 integrin expression during EAE. J. Exp.

Med. 2011. 208: 2465–2476.

23 Reboldi, A., Coisne, C., Baumjohann, D., Benvenuto, F., Bottinelli, D.,

Lira, S., Uccelli, A. et al., C-C chemokine receptor 6-regulated entry of

TH-17 cells into the CNS through the choroid plexus is required for the

initiation of EAE. Nat. Immunol. 2009. 10: 514–523.

24 Glatigny, S., Duhen, R., Arbelaez, C., Kumari, S. and Bettelli, E., Integrin

alpha L controls the homing of regulatory T cells during CNS autoimmu-

nity in the absence of integrin alpha 4. Sci. Rep. 2015. 5: 7834.

25 Martin-Blondel, G., Bauer, J., Uro-Coste, E., Biotti, D., Averseng-

Peaureaux, D., Fabre, N., Dumas, H. et al., Therapeutic use of CCR5 antag-

onists is supported by strong expression of CCR5 on CD8(+) T cells in

progressive multifocal leukoencephalopathy-associated immune recon-

stitution inflammatory syndrome. Acta Neuropathol. 2015. 129: 463–465.

26 Giacomini, P. S., Rozenberg, A., Metz, I., Araujo, D., Arbour, N., Bar-Or, A.

and Maraviroc in Multiple Sclerosis-Associated, P. M. L. I. G., Maraviroc

and JC virus-associated immune reconstitution inflammatory syndrome.

N. Engl. J. Med. 2014. 370: 486–488.

27 Glass, W. G., McDermott, D. H., Lim, J. K., Lekhong, S., Yu, S. F., Frank,

W. A., Pape, J. et al., CCR5 deficiency increases risk of symptomatic West

Nile virus infection. J. Exp. Med. 2006. 203: 35–40.

28 Hammarberg, H., Lidman, O., Lundberg, C., Eltayeb, S. Y., Gielen,

A. W., Muhallab, S., Svenningsson, A. et al., Neuroprotection by

encephalomyelitis: rescue of mechanically injured neurons and neu-

rotrophin production by CNS-infiltrating T and natural killer cells. J. Neu-

rosci. 2000. 20: 5283–5291.

29 Fargali, S., Sadahiro, M., Jiang, C., Frick, A. L., Indall, T., Cogliani, V.,

Welagen, J. et al., Role of neurotrophins in the development and function

of neural circuits that regulate energy homeostasis. J. Mol. Neurosci. 2012.

48: 654–659.

30 Kerschensteiner, M., Gallmeier, E., Behrens, L., Leal, V. V., Misgeld, T.,

Klinkert, W. E., Kolbeck, R. et al., Activated human T cells, B cells, and

monocytes produce brain-derived neurotrophic factor in vitro and in

inflammatory brain lesions: a neuroprotective role of inflammation? J.

Exp. Med. 1999. 189: 865–870.

31 Flugel, A., Schwaiger, F. W., Neumann, H., Medana, I., Willem, M., Wek-

erle, H., Kreutzberg, G. W. et al., Neuronal FasL induces cell death of

encephalitogenic T lymphocytes. Brain Pathol. 2000. 10: 353–364.

32 Liu, Y., Teige, I., Birnir, B. and Issazadeh-Navikas, S., Neuron-mediated

generation of regulatory T cells from encephalitogenic T cells suppresses

EAE. Nat. Med. 2006. 12: 518–525.

33 Cautain, B., Damoiseaux, J., Bernard, I., van Straaten, H., van Breda

Vriesman, P., Boneu, B., Druet, P. et al., Essential role of TGF-beta in

the natural resistance to experimental allergic encephalomyelitis in rats.

Eur. J. Immunol. 2001. 31: 1132–1140.

34 McGeachy, M. J., Stephens, L. A. and Anderton, S. M., Natural recov-

ery and protection from autoimmune encephalomyelitis: contribution

of CD4+CD25+ regulatory cells within the central nervous system. J.

Immunol. 2005. 175: 3025–3032.

35 Korn, T., Reddy, J., Gao, W., Bettelli, E., Awasthi, A., Petersen, T. R.,

Backstrom, B. T. et al., Myelin-specific regulatory T cells accumulate in

the CNS but fail to control autoimmune inflammation. Nat. Med. 2007.

13: 423–431.

36 Liu, Y., Carlsson, R., Comabella, M., Wang, J., Kosicki, M., Carrion, B.,

Hasan, M. et al., FoxA1 directs the lineage and immunosuppressive



properties of a novel regulatory T cell population in EAE and MS. Nat.

Med. 2014. 20: 272–282.

37 Lee, Y. H., Ishida, Y., Rifa’i, M., Shi, Z., Isobe, K. and Suzuki, H., Essential

role of CD8+CD122+ regulatory T cells in the recovery from experimental

autoimmune encephalomyelitis. J. Immunol. 2008. 180: 825–832.

38 Walsh, J. T., Hendrix, S., Boato, F., Smirnov, I., Zheng, J., Lukens, J. R.,

Gadani, S. et al., MHCII-independent CD4+ T cells protect injured CNS

neurons via IL-4. J. Clin. Invest. 2015. 125: 699–714.

39 Raposo, C., Graubardt, N., Cohen, M., Eitan, C., London, A., Berkutzki,

T. and Schwartz, M., CNS repair requires both effector and regulatory

T cells with distinct temporal and spatial profiles. J. Neurosci. 2014. 34:

10141–10155.

40 Kunis, G., Baruch, K., Miller, O. and Schwartz, M., Immunization with a

myelin-derived antigen activates the brain’s choroid plexus for recruit-

ment of immunoregulatory cells to the CNS and attenuates disease pro-

gression in a mouse model of ALS. J. Neurosci. 2015. 35: 6381–6393.

41 Endo, F., Komine, O., Fujimori-Tonou, N., Katsuno, M., Jin, S., Watanabe,

S., Sobue, G. et al., Astrocyte-derived TGF-beta1 accelerates disease pro-

gression in ALS mice by interfering with the neuroprotective functions

of microglia and T cells. Cell Rep. 2015. 11: 592–604.

42 Stevens, J. G., Wagner, E. K., Devi-Rao, G. B., Cook, M. L. and Feldman, L.

T., RNA complementary to a herpesvirus alpha gene mRNA is prominent

in latently infected neurons. Science 1987. 235: 1056–1059.

43 Theil, D., Derfuss, T., Paripovic, I., Herberger, S., Meinl, E., Schueler,

O., Strupp, M. et al., Latent herpesvirus infection in human trigeminal

ganglia causes chronic immune response. Am. J. Pathol. 2003. 163: 2179–

2184.

44 van Velzen, M., Jing, L., Osterhaus, A. D., Sette, A., Koelle, D. M. and

Verjans, G. M., Local CD4 and CD8 T-cell reactivity to HSV-1 anti-

gens documents broad viral protein expression and immune compe-

tence in latently infected human trigeminal ganglia. PLoS Pathog. 2013. 9:

e1003547.

45 Knickelbein, J. E., Khanna, K. M., Yee, M. B., Baty, C. J., Kinchington, P.

R. and Hendricks, R. L., Noncytotoxic lytic granule-mediated CD8+ T cell

inhibition of HSV-1 reactivation from neuronal latency. Science 2008. 322:

268–271.

46 Shrestha, B. and Diamond, M. S., Role of CD8+ T cells in control of West

Nile virus infection. J. Virol. 2004. 78: 8312–8321.

47 Shrestha, B. and Diamond, M. S., Fas ligand interactions contribute to

CD8+ T-cell-mediated control of West Nile virus infection in the central

nervous system. J. Virol. 2007. 81: 11749–11757.

48 Shrestha, B., Pinto, A. K., Green, S., Bosch, I. and Diamond, M. S., CD8+T cells use TRAIL to restrict West Nile virus pathogenesis by controlling

infection in neurons. J. Virol. 2012. 86: 8937–8948.

49 Zhang, B., Chan, Y. K., Lu, B., Diamond, M. S. and Klein, R. S., CXCR3

mediates region-specific antiviral T cell trafficking within the central

nervous system during West Nile virus encephalitis. J. Immunol. 2008.

180: 2641–2649.

50 Kreutzfeldt, M., Bergthaler, A., Fernandez, M., Bruck, W., Steinbach, K.,

Vorm, M., Coras, R. et al., Neuroprotective intervention by interferon-

gamma blockade prevents CD8+ T cell-mediated dendrite and synapse

loss. J. Exp. Med. 2013. 210: 2087–2103.

51 Mizuno, T., Zhang, G., Takeuchi, H., Kawanokuchi, J., Wang, J., Sonobe,

Y., Jin, S. et al., Interferon-gamma directly induces neurotoxicity through

a neuron specific, calcium-permeable complex of IFN-gamma receptor

and AMPA GluR1 receptor. FASEB J. 2008. 22: 1797–1806.

52 Steinman, L., Conflicting consequences of immunity to cancer versus

autoimmunity to neurons: insights from paraneoplastic disease. Eur. J.

Immunol. 2014. 44: 3201–3205.

53 Blachere, N. E., Orange, D. E., Santomasso, B. D., Doerner, J., Foo, P.

K., Herre, M., Fak, J. et al., T cells targeting a neuronal paraneoplastic

antigen mediate tumor rejection and trigger CNS autoimmunity with

humoral activation. Eur. J. Immunol. 2014. 44: 3240–3251.

54 Peterson, J. W., Bo, L., Mork, S., Chang, A. and Trapp, B. D., Transected

neurites, apoptotic neurons, and reduced inflammation in cortical mul-

tiple sclerosis lesions. Ann. Neurol. 2001. 50: 389–400.

55 Albert, M. L., Darnell, J. C., Bender, A., Francisco, L. M., Bhardwaj, N.

and Darnell, R. B., Tumor-specific killer cells in paraneoplastic cerebellar

degeneration. Nat. Med. 1998. 4: 1321–1324.

56 International Multiple Sclerosis Genetics, C., Beecham, A. H., Patsopou-

los, N. A., Xifara, D. K., Davis, M. F., Kemppinen, A., Cotsapas, C. et al.,

Analysis of immune-related loci identifies 48 new susceptibility variants

for multiple sclerosis. Nat. Genet. 2013. 45: 1353–1360.

57 Ascherio, A., Munger, K. L. and Lunemann, J. D., The initiation and pre-

vention of multiple sclerosis. Nat. Rev. Neurol. 2012. 8: 602–612.

58 Schirmer, L., Antel, J. P., Bruck, W. and Stadelmann, C., Axonal loss and

neurofilament phosphorylation changes accompany lesion development

and clinical progression in multiple sclerosis. Brain Pathol. 2011. 21: 428–

440.

59 Ben-Nun, A., Kaushansky, N., Kawakami, N., Krishnamoorthy, G., Berer,

K., Liblau, R., Hohlfeld, R. et al., From classic to spontaneous and human-

ized models of multiple sclerosis: impact on understanding pathogenesis

and drug development. J. Autoimmun. 2014. 54: 33–50.

60 Lucchinetti, C. F., Popescu, B. F., Bunyan, R. F., Moll, N. M., Roemer,

S. F., Lassmann, H., Bruck, W. et al., Inflammatory cortical demyeli-

nation in early multiple sclerosis. N. Engl. J. Med. 2011. 365: 2188–

2197.

61 Babbe, H., Roers, A., Waisman, A., Lassmann, H., Goebels, N., Hohlfeld,

R., Friese, M. et al., Clonal expansions of CD8(+) T cells dominate the

T cell infiltrate in active multiple sclerosis lesions as shown by microma-

nipulation and single cell polymerase chain reaction. J. Exp. Med. 2000.

192: 393–404.

62 Kostic, M., Dzopalic, T., Zivanovic, S., Zivkovic, N., Cvetanovic, A., Sto-

janovic, I., Vojinovic, S. et al., IL-17 and glutamate excitotoxicity in

the pathogenesis of multiple sclerosis. Scand. J. Immunol. 2014. 79: 181–

186.

63 Tzartos, J. S., Friese, M. A., Craner, M. J., Palace, J., Newcombe, J., Esiri, M.

M. and Fugger, L., Interleukin-17 production in central nervous system-

infiltrating T cells and glial cells is associated with active disease in mul-

tiple sclerosis. Am. J. Pathol. 2008. 172: 146–155.

64 Siffrin, V., Radbruch, H., Glumm, R., Niesner, R., Paterka, M., Herz, J.,

Leuenberger, T. et al., In vivo imaging of partially reversible th17 cell-

induced neuronal dysfunction in the course of encephalomyelitis. Immu-

nity 2010. 33: 424–436.

65 Aktas, O., Smorodchenko, A., Brocke, S., Infante-Duarte, C., Schulze Top-

phoff, U., Vogt, J., Prozorovski, T. et al., Neuronal damage in autoimmune

neuroinflammation mediated by the death ligand TRAIL. Neuron 2005. 46:

421–432.

66 Saxena, A., Martin-Blondel, G., Mars, L. T. and Liblau, R. S., Role of CD8

T cell subsets in the pathogenesis of multiple sclerosis. FEBS Lett. 2011.

585: 3758–3763.

67 Huseby, E. S., Liggitt, D., Brabb, T., Schnabel, B., Ohlen, C. and Goverman,

J., A pathogenic role for myelin-specific CD8(+) T cells in a model for

multiple sclerosis. J. Exp. Med. 2001. 194: 669–676.

68 Friese, M. A., Jakobsen, K. B., Friis, L., Etzensperger, R., Craner, M. J.,

McMahon, R. M., Jensen, L. T. et al., Opposing effects of HLA class I

molecules in tuning autoreactive CD8+ T cells in multiple sclerosis. Nat.

Med. 2008. 14: 1227–1235.



69 Sorbara, C. D., Wagner, N. E., Ladwig, A., Nikic, I., Merkler, D., Kleele,

T., Marinkovic, P. et al., Pervasive axonal transport deficits in multiple

sclerosis models. Neuron 2014. 84: 1183–1190.

70 Darnell, J. C., Albert, M. L. and Darnell, R. B., Cdr2, a target antigen

of naturally occuring human tumor immunity, is widely expressed in

gynecological tumors. Cancer Res. 2000. 60: 2136–2139.

71 Verschuuren, J., Chuang, L., Rosenblum, M. K., Lieberman, F., Pryor,

A., Posner, J. B. and Dalmau, J., Inflammatory infiltrates and complete

absence of Purkinje cells in anti-Yo-associated paraneoplastic cerebellar

degeneration. Acta Neuropathol. 1996. 91: 519–525.

72 Dalmau, J. and Rosenfeld, M. R., Paraneoplastic syndromes of the CNS.

Lancet Neurol. 2008. 7: 327–340.

73 Schubert, M., Panja, D., Haugen, M., Bramham, C. R. and Vedeler, C. A.,

Paraneoplastic CDR2 and CDR2L antibodies affect Purkinje cell calcium

homeostasis. Acta Neuropathol. 2014. 128: 835–852.

74 Giometto, B., Grisold, W., Vitaliani, R., Graus, F., Honnorat, J., Bertolini,

G. and Euronetwork, P. N. S., Paraneoplastic neurologic syndrome in

the PNS Euronetwork database: a European study from 20 centers. Arch.

Neurol. 2010. 67: 330–335.

75 Aye, M. M., Kasai, T., Tashiro, Y., Xing, H. Q., Shirahama, H., Mitsuda,

M., Suetsugu, T. et al., CD8 positive T-cell infiltration in the dentate

nucleus of paraneoplastic cerebellar degeneration. J. Neuroimmunol. 2009.

208: 136–140.

76 Albert, M. L., Austin, L. M. and Darnell, R. B., Detection and treatment of

activated T cells in the cerebrospinal fluid of patients with paraneoplastic

cerebellar degeneration. Ann. Neurol. 2000. 47: 9–17.

77 Brochard, V., Combadiere, B., Prigent, A., Laouar, Y., Perrin, A., Beray-

Berthat, V., Bonduelle, O. et al., Infiltration of CD4+ lymphocytes into the

brain contributes to neurodegeneration in a mouse model of Parkinson

disease. J. Clin. Invest. 2009. 119: 182–192.

78 Biber, K., Owens, T. and Boddeke, E., What is microglia neurotoxicity

(Not)? Glia 2014. 62: 841–854.

79 Cohen, J. A., Coles, A. J., Arnold, D. L., Confavreux, C., Fox, E. J., Hartung,

H. P., Havrdova, E. et al., Alemtuzumab versus interferon beta 1a as first-

line treatment for patients with relapsing-remitting multiple sclerosis: a

randomised controlled phase 3 trial. Lancet 2012. 380: 1819–1828.

80 Coles, A. J., Twyman, C. L., Arnold, D. L., Cohen, J. A., Confavreux, C.,

Fox, E. J., Hartung, H. P. et al., Alemtuzumab for patients with relapsing

multiple sclerosis after disease-modifying therapy: a randomised con-

trolled phase 3 trial. Lancet 2012. 380: 1829–1839.

81 Hill-Cawthorne, G. A., Button, T., Tuohy, O., Jones, J. L., May, K., Somer-

field, J., Green, A. et al., Long term lymphocyte reconstitution after alem-

tuzumab treatment of multiple sclerosis. J. Neurol. Neurosurg. Psychiatry

2012. 83: 298–304.

82 Zhang, X., Tao, Y., Chopra, M., Ahn, M., Marcus, K. L., Choudhary,

N., Zhu, H. et al., Differential reconstitution of T cell subsets follow-

ing immunodepleting treatment with alemtuzumab (anti-CD52 mono-

clonal antibody) in patients with relapsing-remitting multiple sclerosis.

J. Immunol. 2013. 191: 5867–5874.

83 Jones, J. L., Anderson, J. M., Phuah, C. L., Fox, E. J., Selmaj, K., Margolin,

D., Lake, S. L. et al., Improvement in disability after alemtuzumab treat-

ment of multiple sclerosis is associated with neuroprotective autoimmu-

nity. Brain 2010. 133: 2232–2247.

84 Pfender, N. and Martin, R., Daclizumab (anti-CD25) in multiple sclerosis.

Exp. Neurol. 2014. 262 Pt A: 44–51.

85 Gold, R., Giovannoni, G., Selmaj, K., Havrdova, E., Montalban, X.,

Radue, E. W., Stefoski, D. et al., Daclizumab high-yield process in

relapsing-remitting multiple sclerosis (SELECT): a randomised, double-

blind, placebo-controlled trial. Lancet 2013. 381: 2167–2175.

86 Bielekova, B., Catalfamo, M., Reichert-Scrivner, S., Packer, A., Cerna, M.,

Waldmann, T. A., McFarland, H. et al., Regulatory CD56(bright) natural

killer cells mediate immunomodulatory effects of IL-2Ralpha-targeted

therapy (daclizumab) in multiple sclerosis. Proc. Natl. Acad. Sci. USA 2006.

103: 5941–5946.

87 Polman, C. H., O’Connor, P. W., Havrdova, E., Hutchinson, M., Kappos,

L., Miller, D. H., Phillips, J. T. et al., A randomized, placebo-controlled

trial of natalizumab for relapsing multiple sclerosis. N. Engl. J. Med. 2006.

354: 899–910.

88 Kappos, L., Radue, E. W., O’Connor, P., Polman, C., Hohlfeld, R., Cal-

abresi, P., Selmaj, K. et al., A placebo-controlled trial of oral fingolimod

in relapsing multiple sclerosis. N. Engl. J. Med. 2010. 362: 387–401.

89 Constantinescu CS, A. A., Fryze, W. Safety and pharmacokinetics of

MOR103, a human antibody to granulocyte-macrophage colonystimu-

lating factor, in patients with multiple sclerosis ACTRIMS-ECTRIMS 2014,

pp Abstract FC 2.4.

90 Havrdova, E., Belova, A., Goloborodko, A., Tisserant, A., Jones, I., Garren,

H. and Johns, D., Positive proof of concept of AIN457, an antibody against

interleukin-17A, in relapsing-remitting multiple sclerosis Actrims. Multi-

ple Scler. J. 2012, 18: 513–513.

91 Panitch, H. S., Hirsch, R. L., Haley, A. S. and Johnson, K. P., Exacerbations

of multiple sclerosis in patients treated with gamma interferon. Lancet

1987. 1: 893–895.

92 Agency, E. M., Public summary of opinion on orphan designation: Recom-

binant human anti-interferon gamma monoclonal antibody for the

treatment of haemophagocytic lymphohistiocytosis European Medicines

Agency. European Medicines Agency, Committee for Orphan Medicinal

Products, London, United Kingdom 2010.

93 Browne, S. K., Burbelo, P. D., Chetchotisakd, P., Suputtamongkol, Y.,

Kiertiburanakul, S., Shaw, P. A., Kirk, J. L. et al., Adult-onset immunod-

eficiency in Thailand and Taiwan. N. Engl. J. Med. 2012. 367: 725–734.

94 Keefe, A. D., Pai, S. and Ellington, A., Aptamers as therapeutics. Nat. Rev.

Drug Discov. 2010. 9: 537–550.

95 Wang, C. W., Chung, W. H., Cheng, Y. F., Ying, N. W., Peck, K., Chen,

Y. T. and Hung, S. I., A new nucleic acid-based agent inhibits cytotoxic

T lymphocyte-mediated immune disorders. J. Allergy Clin. Immunol. 2013.

132: 713–722 e711.

96 Anderton, S., Burkhart, C., Metzler, B. and Wraith, D., Mechanisms of

central and peripheral T-cell tolerance: lessons from experimental mod-

els of multiple sclerosis. Immunol. Rev. 1999. 169: 123–137.

97 Lutterotti, A., Yousef, S., Sputtek, A., Sturner, K. H., Stellmann, J. P.,

Breiden, P., Reinhardt, S. et al., Antigen-specific tolerance by autologous

myelin peptide-coupled cells: a phase 1 trial in multiple sclerosis. Sci.

Transl. Med. 2013. 5: 188ra175.

98 Getts, D. R., Shea, L. D., Miller, S. D. and King, N. J., Harnessing nanopar-

ticles for immune modulation. Trends Immunol. 2015. 36: 419–427.

Full correspondence: Proof. Roland Liblau, INSERM U1043 - CNRS UMR5282, Centre de Physiopathologie Toulouse-Purpan, Purpan Hospital,Place du Docteur Baylac TSA 40031, 31059 Toulouse Cedex 9, FranceFax: +33 561 77 21 38e-mail: [email protected]

See all the ECI 2015 Reviews at http://onlinelibrary.wiley.com/journal/10.1002/(ISSN)1521-4141/homepage/eci2015.htm

Received: 27/4/2015Revised: 26/8/2015Accepted: 2/9/2015Accepted article online: 8/9/2015


how anti-tumor immunity leads to autoimmunity in

Documents