Research

© The Authors (2009) New Phytologist (2009) 184: 85–98 85Journal compilation © New Phytologist (2009) www.newphytologist.org 85

Blackwell Publishing LtdOxford, UKNPHNew Phytologist0028-646X1469-8137© The Authors (2009). Journal compilation © New Phytologist (2009)291510.1111/j.1469-8137.2009.02915.xJune 20090085???98???Original ArticleXX XX

Cloning and characterization of small RNAs from Medicago truncatula reveals four novel legume-specific microRNA families

Guru Jagadeeswaran1*, Yun Zheng2*, Yong-Fang Li1, Lata I. Shukla1, Jessica Matts1, Peter Hoyt1, Simone L. Macmil3, Graham B. Wiley3, Bruce A. Roe3, Weixiong Zhang2,4 and Ramanjulu Sunkar1

1Department of Biochemistry and Molecular Biology, Oklahoma State University, Stillwater, OK 74078, USA; 2Department of Computer Science and

Engineering, Washington University in St Louis, St Louis, MO 63130, USA; 3Department of Chemistry and Biochemistry, University of Oklahoma, 101 David

L. Boren Boulevard, Norman, OK 73019, USA; 4Department of Genetics, Washington University School of Medicine, St Louis, MO 63110, USA

Summary

• MicroRNAs (miRNAs) and small-interfering RNAs (siRNAs) have emerged asimportant regulators of gene expression in higher eukaryotes. Recent studies indicatethat genomes in higher plants encode lineage-specific and species-specific miRNAsin addition to the well-conserved miRNAs. Leguminous plants are grown throughoutthe world for food and forage production. To date the lack of genomic sequencedata has prevented systematic examination of small RNAs in leguminous plants.Medicago truncatula, a diploid plant with a near-completely sequenced genome hasrecently emerged as an important model legume.• We sequenced a small RNA library generated from M. truncatula to identify notonly conserved miRNAs but also novel small RNAs, if any.• Eight novel small RNAs were identified, of which four (miR1507, miR2118,miR2119 and miR2199) are annotated as legume-specific miRNAs because these areconserved in related legumes. Three novel transcripts encoding TIR-NBS-LRR proteinsare validated as targets for one of the novel miRNA, miR2118. Small RNA sequenceanalysis coupled with the small RNA blot analysis, confirmed the expression ofaround 20 conserved miRNA families in M. truncatula. Fifteen transcripts havebeen validated as targets for conserved miRNAs. We also characterized Tas3-siRNAbiogenesis in M. truncatula and validated three auxin response factor (ARF) transcriptsthat are targeted by tasiRNAs.• These findings indicate that M. truncatula and possibly other related legumeshave complex mechanisms of gene regulation involving specific and common smallRNAs operating post-transcriptionally.

Author for correspondence:Ramanjulu SunkarTel: +1 405 744 8496Email: ramanjulu.sunkar@okstate.edu

Received: 20 February 2009Accepted: 22 April 2009

New Phytologist (2009) 184: 85–98doi: 10.1111/j.1469-8137.2009.02915.x

Key words: legumes, Medicago truncatula, microRNAs, post-transcriptional gene regulation, trans-acting siRNAs.

Introduction

There are two major classes of endogenous small RNAs inplants: microRNAs (miRNAs) and small-interfering RNAs(siRNAs). Based on their origin, biogenesis, and potentialtargets, endogenous plant siRNAs are further divided intotrans-acting siRNAs (tasiRNAs), natural antisense transcript-derived siRNAs (nat-siRNAs) and repeat-associated siRNAs(rasiRNAs) (Vaucheret, 2006).

The miRNAs are c. 21-nt long noncoding RNAs, whichresult from processing of imperfectly folded hairpin-like single-stranded RNAs by the Dicer-Like1complex (Jones-Rhoadeset al., 2006; Ramachandran & Chen, 2008). The 21- to 24-ntsiRNAs are processed by the other members of the Dicerfamily of proteins (DCL2, DCL3 and DCL4) from long, per-fectly paired double-stranded RNAs (dsRNAs). The dsRNAsresult from the transcription of inverted repeats, or convergenttranscription of sense–antisense gene pairs or due to activityof RNA-dependent RNA polymerases (RDRs) on aberranttranscripts (Allen et al., 2005; Vaucheret, 2006).*These authors contributed equally to this work.

New Phytologist (2009) 184: 85–98 © The Authors (2009)www.newphytologist.org Journal compilation © New Phytologist (2009)

Research86

Gene silencing occurs in both plants and animals whenendonuclease complexes are guided by small RNAs to targetRNAs (Bartel, 2004). The target genes are repressed post-transcriptionally when miRNAs direct cleavage of targetmRNAs or prevent protein production (Jones-Rhoades et al.,2006; Mallory & Vaucheret, 2006; Brodersen et al., 2008).Endogenous siRNAs are capable of regulating gene expressionat either transcriptional (heterochromatic siRNAs) or post-transcriptional levels (tasiRNAs and nat-siRNAs) (Arazi et al.,2005; Vaucheret, 2006).

Identification of small RNAs and their target messengerRNAs are essential for understanding small RNA-mediatedgene regulation of development and stress responses (Araziet al., 2005; Jones-Rhoades et al., 2006; Sunkar et al., 2007).Accurate annotation of small RNAs into miRNAs, tasiRNAs,nat-siRNAs and rasiRNAs requires genome sequence infor-mation. As a result, plants with sequenced genomes such asArabidopsis, rice (Oryza sativa), Populus and Physcomitrella, arethe most intensively investigated plant systems for the discoveryof small RNAs (Jones-Rhoades & Bartel, 2004; Arazi et al.,2005; C. Lu et al., 2005; Rajagopalan et al., 2006; Barakat et al.,2007; S. Lu et al., 2008). The common themes emerging fromthese studies are that c. 20 miRNA families are highly conservedacross monocots and dicots, but plants also express lineage-specific and species-specific miRNAs (Arazi et al., 2005;Sunkar et al., 2005; Lu et al., 2006; Talmor-Neiman et al.,2006a; Axtell et al., 2007; Fattash et al., 2007; C. Lu et al.,2008; Moxon et al., 2008; Sunkar & Jagadeeswaran, 2008).Conserved miRNAs appear to have conserved biologicalfunctions whereas lineage-specific miRNAs and species-specific miRNAs may have lineage-specific and species-specificroles, respectively. This observation means cataloging of smallRNAs is required to accurately trace the evolution of lineage-specific and species-specific miRNAs in plants.

Currently, leguminous plants account for one-third of theworld’s primary crop production and are critical to meet largequantities of food and feed demands by humans and animals(Benedito et al., 2008). Legumes are also an interesting groupof plants because they can fix atmospheric nitrogen. However,most cultivated legumes are polyploid with complex genomesand are therefore not amenable for genomic studies (Beneditoet al., 2008). Most cultivated legumes are also resistant tocommon genetic manipulation tools such as transformation.Medicago truncatula, however, possesses a simple diploidgenome, and is relatively easy to transform (Trinh et al., 1998;Chabaud et al., 2003; Crane et al., 2006). As a result,sequencing of the M. truncatula genome is nearly complete,and it has become a model legume for functional genomicsresearch (Benedito et al., 2008). Sequence conservation hasallowed scientists to predict miRNAs in the legumes, M. trun-catula and soybean (Glycine max) (Zhang et al., 2006; Sunkar& Jagadeeswaran, 2008). Recently, sequencing a small RNAlibrary from soybean identified three novel miRNAs (Subra-manian et al., 2008). Complete genome information is needed

to facilitate confident annotation of these and other smallRNAs as miRNAs or siRNAs in soybean (Subramanian et al.,2008).The near-complete genome sequence of M. truncatulawill allow more accurate characterization of small RNAs.

In the present study, we have sequenced a M. truncatulasmall RNA library and identified 20 conserved miRNAfamilies. More importantly, eight novel small RNAs have beenidentified in M. truncatula. Four of these are annotated aslegume-specific miRNAs because these miRNAs and theirhairpin structures are conserved in related legumes. Theremaining four appear to be candidates for M. truncatula-specific miRNAs. Three novel transcripts encoding TIR-NBS-LRR disease-resistance proteins are validated as targetsfor the novel miRNA, miR2118 in M. truncatula. We alsovalidated one representative target for most of the conservedmiRNA families using the 5′-rapid amplification of cDNAends (RACE) assay. Biogenesis and target gene validationswere also determined for TAS3-siRNAs.

Materials and Methods

Cloning of M. truncatula small RNAs

Total RNA was isolated from the frozen seedlings and flowerswith TRIzol (Invitrogen) according to the manufacturer’sinstructions. Cloning of the miRNAs was performed asdescribed (Sunkar et al., 2008). The final PCR product wassequenced using a 454 sequencer (Roche) at the University ofOklahoma, USA.

Plant materials and growth conditions

Medicago truncatula Gaertner cv. Jemalong plants were grownin a controlled growth chamber (22–24°C) with a 16-hphotoperiod and 300 µmol m–2 s–1 light intensity. Tissuesamples from different organs were harvested and flash frozenand stored at −80°C. For stress treatments, 3-wk-old seedlingsgrown on hydroponic cultures were transferred to the samemedium without sulfate, or phosphate or copper. Root andshoot tissues were harvested separately and stored.

Method for identifying new candidate miRNAs

Our computational methods for analysing 454 small RNAlibraries was reported previously (Sunkar et al., 2008). Briefly,all small RNA reads without perfect matches to the mostproximal 11 nt of both adaptor sequences were first removed.Reads corresponding to repeats were removed using theeinverted and etandem programs in the emboss (2000)package, respectively. The unique small RNAs were aligned torepbase (version 13.04, obtained from http://www.girinst.org)and known noncoding RNAs (rRNAs, tRNAs, snRNAs,snoRNAs, etc., obtained from http://www.sanger.ac.uk/Software/Rfam/ftp.shtml) with National Center for Biotechnology

© The Authors (2009) New Phytologist (2009) 184: 85–98Journal compilation © New Phytologist (2009) www.newphytologist.org

Research 87

Information (NCBI) blastn. Then the small RNAs weremapped to the reported miRNAs in the miRBase (version 11,obtained from http://microrna.sanger.ac.uk/sequences/ftp.shtml).Small RNAs that matched known miRNAs of M. truncatulaor other plant species resulted in identification of conservedmiRNA homologs in M. truncatula. The unique small RNAs werealigned to the genome sequence of M. truncatula (downloadedfrom (http://www.medicago.org/genome/downloads/Mt2/,release 2.0), and for those sequences that matched with thegenome, the fold-back structures were predicted using thernafold program (Hofacker, 2003). This resulted in identifica-tion of 41 small RNAs with 145 loci. Most nonconserved andspecies-specific miRNAs have single locus in Arabidopsis andrice (S. Lu et al., 2008; Fahlgren et al., 2006), and we appliedthis feature in our analysis. This resulted in identification of 21candidate sequences. Out of these, only five were considered forfurther analysis, because these could be detected using smallRNA blot analysis. The unique small RNAs that could not bemapped to the available M. truncatula genome were queriedagainst the expressed sequences tag (EST) database of the NCBIto find homologs in other plants, including legumes. Surprisingly,three of the unique small RNAs that could not be mapped tothe M. truncatula genome, were found to have perfect matcheswith the ESTs from M. truncatula and other related legumes.Fold-back structures could be predicted for these ESTs. Thisresulted in identification of novel legume-specific miRNAs.

miRNA target prediction and validation

The known M. truncatula open reading frames (ORFs),downloaded from the Medicago Genome Annotation Database,were used for miRNA target predictions. For selecting putativemiRNA–target pairs, only three mismatches were allowedbetween a mRNA target and miRNA in our prediction(Rhoades et al., 2002; Jones-Rhoades & Bartel, 2004). Amodified 5′-RACE assay was performed using the GeneRacerKit (Invitrogen) to validate the predicted targets. Briefly, theRNA was ligated with a 5′ RNA adapter and a reversetranscription was performed. The resulting cDNA was used astemplate for PCR amplification with GeneRacer 5′ primerand a gene-specific primer. A second nested PCR was performedusing nested primers (GeneRacer 5′ nested primer and a gene-specific nested primer). The amplified products were gelpurified, cloned and sequenced. Gene specific primers usedare provided as in the Supplementary Information, Table S3.

Identification of TASi locus and tasiRNAs in M. truncatula

To predict TAS genes and tasiRNAs in M. truncatula, weexamined Hitsensor scores (Zheng & Zhang, 2008) andinter-site distances of miR390 binding sites of ArabidopsisTAS3 genes. AtTAS3 genes have two Hitsensor sites for miR390(of which the 5′ site with critical mismatches in position

10–11), with Hitsensor scores from 200 to 300. Based onthese distances (228 nt for AtTAS3a, 201 nt for AtTAS3b and181 nt for AtTAS3c) we examined 250 nt upstream and 250 ntdownstream from M. truncatula unique RNA reads usingHitsensor to identify possible binding sites of miR390.Sequences without two miR390-binding sites were removed.

Small RNA blot analysis

Total RNA was isolated from different tissues of M. truncatulawith TRIzol reagent following the manufacturer’s instructions(Invitrogen). Low-molecular-weight (LMW) RNA was isolatedfrom total RNA using polyethylene glycol (PEG) precipitation.Twenty micrograms of LMW RNA was used for detection ofmiRNAs or candidate miRNAs, whereas 50 µg was used fordetection of miRNA*. Small RNA blot analysis was performedas previously reported (Sunkar et al., 2008).

Results

Sequence analysis and annotation

To identify miRNAs and other endogenous small RNAsexpressed in M. truncatula seedlings, we generated andsequenced a small RNA library using pooled RNA isolatedfrom seedlings and flowers. After removal of the 5′ and 3′adapter sequences, a total of 26 656 raw sequence readsranging in size between 18 nt and 26 nt were obtained. Ofthese, 22 353 reads could be mapped to the existing M. trun-catula genome, and the remaining sequences (c. 4237) thatcould not be mapped thus, were discarded. Of the 22 353genome-matched reads, redundant sequences were noted andonly unique sequences were used for further analysis. SmallRNAs matching the rRNA, tRNA, snRNA and snoRNAsfrom these unique sequences were removed as reportedpreviously (Sunkar et al., 2008).

The cloning frequency of different sized (18–26 nt) smallRNAs revealed two predominant sizes: 21 nt and 24 nt, whichis consistent with previous reports (Lu et al., 2005, 2006;Sunkar et al., 2005; Fahlgren et al., 2007). Small RNAs of the24-nt size class represented the largest category of sequencereads (9333 of 22 353 reads, 42%). Most 24 nt sequencesappeared only once in our sequence reads suggesting the 24 ntsmall RNAs are extremely diverse in M. truncatula. Similarresults were found in Arabidopsis and rice (Lu et al., 2006;Nobuta et al., 2007). This study focuses on the 21-nt size classof small RNAs, representing miRNAs and tasiRNAs.

Identification of four novel legume-specific miRNAs

Annotating novel miRNAs generally requires the dcl1 knockoutmutant (Ambros et al., 2003). In addition, studies usingArabidopsis showed that dcl4 may also process certain miRNAprecursors (Rajagopalan et al., 2006), suggesting both the

New Phytologist (2009) 184: 85–98 © The Authors (2009)www.newphytologist.org Journal compilation © New Phytologist (2009)

Research88

dcl1 and dcl4 knockout mutants are needed for confidentannotation of novel species-specific miRNAs in plants. In theabsence of these genetic tools, it was recently suggested thatsequencing of a miRNA* is required for annotating a smallRNA as a new miRNA in plants (Meyers et al., 2008). Inaddition, showing conservation as determined by bioinfor-matics or experimentation (e.g. small RNA blot analysis) streng-thens confidence in annotating novel small RNAs as miRNAs(Meyers et al., 2008). Using these guidelines, we assigned asmall RNA as a novel miRNA if: (1) a miRNA* is detectedusing small RNA blot analysis; (2) its conservation is confirmedby using bioinformatics (small RNA sequence as well aspredicted fold-back structure for the precursor sequence isconserved in related plant species); and (3), if the small RNAcould be detected in M. truncatula and other related legumesusing small RNA blot analysis. These criteria identified foursmall RNAs (miR2118, miR2199, miR1507 and miR2119)as novel miRNA families in M. truncatula (Table 1, Fig. 1).To strengthen our annotation assignments, we analysed theexpression of these M. truncatula miRNA* sequences usingsmall RNA blots. The antisense probes corresponding to thepredicted miRNA* gave discrete bands suggesting that themiRNA* sequence accumulates to detectable levels (Fig. 2b).Attempts to hybridize the same blots with antisense probesfrom precursor sequences flanking the mature miRNA showedno signal (data not shown). These findings suggest that onlythe miRNA and miRNA* are excised from their precursors ofthese four novel small RNAs in M. truncatula.

Our sequence analysis resulted in identification of 21 can-didate sequences, based on the genome matching and fold-back structure predictions. Of these, only five were consideredfor further analysis based on accumulations detected usingsmall RNA blot analysis. Among these, miR1507 is conservedin related legumes and thus is annotated as a legume-specificmiRNA, whereas the remaining four are regarded as candidateM. truncatula-specific miRNAs. The fully sequenced M. trun-catula genome is currently unavailable for analysis. We suspectedthat some of the unique small RNAs without matches to the

available genome of M. truncatula could still be miRNAs;these unique small RNAs were searched against the ESTresources at NCBI to identify their precursors. Three of theunique small RNAs that could not be mapped to theM. truncatula genome, had perfect or nearly perfect matches(one or two mismatches) with the ESTs from M. truncatulaand other related legumes. The blast analysis identifiedmiR2118 homologues in soybean, pea (Phaseolus vulgaris)and black-eyed pea (Vigna unguiculata). Similarly, homologsfor miR1507 and miR2199 are found in peanut (Arachishypogaea) and Lotus japonicus, respectively (Table 1, Fig. 1).Another small RNA (miR2119) is conserved in soybean(Table 1, Fig. 1). Fold-back structures could be predictedusing the genomic or EST sequences surrounding the novelsmall RNAs in the above mentioned leguminous plant species(Fig. 1). We then analysed the expression of these novel miRNAsin related legumes such as soybean, chickpea (Cicer arietinum),peanut, black-eyed pea along with the Arabidopsis and rice(Fig. 2a). miR2118 and miR2199 could be detected in all fivelegumes tested (Fig. 2a), whereas miR1507 and miR2119could be detected in three legumes of the five tested (Fig. 2a).None of these four small RNA sequences exist in completelysequenced genomes of Arabidopsis, rice, Populus or Phys-comitrella. Accordingly, we annotated these four novel smallRNAs (miR2118, miR2199, miR1507 and miR2119) aslegume-specific miRNAs based on detection of miRNA andmiRNA* and conservation of small RNA sequence as well astheir fold-back structure. These criteria have been used tocategorize small RNA as a novel miRNA (Sunkar et al., 2005,2008; S. Lu et al., 2008). From the data, this study has providedcompelling evidence for annotation of four novel small RNAsas legume-specific miRNAs. One identified based on matchingwith the M. truncatula genome and the other three matchingwith the EST resources.

The remaining four novel small RNA homologs(sRNA7556, sRNA19284, sRNA15993 and sRNA21166)were not found in any other plant species (Table 1). Fold-backstructures are predicted for their precursor sequences (see the

Table 1 Identified novel small RNAs (four legume-specific and four candidate miRNAs) in Medicago truncatula

sRNA_id Sequence (cloning frequency)Detected using blot analysis Conservation

miR2118 UUACCGAUUCCACCCAUUCCUA (3) + Soybean, Chickpea, Peanut, Phaseolus, Vigna

miR2199 UGAUACACUAGCACGGGUCAC (1) + Lotus japonicusmiR1507 CCUCGUUCCAUACAUCAUCUA (1) + PeanutmiR2119 UCAAAGGGAGUUGUAGGGGAA (1) + SoybeansRNA15993 (candidate) UAGAGUCACAUGGUCGGUAUCCC (2) +sRNA7556 (candidate) AGAUCGGUUGAUAGAGGAGGA (1) +sRNA19284 (candidate) UAGGUUUGAGAAAAUGGGCAG (1) +sRNA21166 (candidate) AUGAUGUAAGGGAUGAUGCAAAU (1) +

The annotation of legume-specific miRNAs was based on the detection of miRNA and miRNA* as well as their conservation in related legumes.

© The Authors (2009) New Phytologist (2009) 184: 85–98Journal compilation © New Phytologist (2009) www.newphytologist.org

Research 89

Supporting Information, Fig. S1) and some of them could bedetected using small RNA blot analysis (Fig. 3). However,these characteristics do not meet the criteria to annotate themas Medicago-specific miRNAs without cloning miRNA*sequence (Meyers et al., 2008). Thus, these four small RNAsare regarded as candidate miRNAs in M. truncatula. Recently,one of these novel small RNAs (sRNA19284) was alsosequenced by another group (Szittya et al., 2008) and classi-fied as a potential new miRNA in M. truncatula, supportingour current results.

Interestingly, more than 20 Toll/Interleukin 1 Receptor-nucleotide binding site-leucine-rich repeat (TIR-NBS-LRR)genes have been predicted as targets for the novel legume-specific miRNA, miR2118 in M. truncatula (Table S1).However, at least two TIR-NBS-LRR genes in M. truncatulado not possess complementary sites for the miR2118 (TableS1). The TIR-NBS-LRR gene family is highly conserved amonghigher plants and homologs of this gene family possesses the

complementary site for miR2118 in Arabidopsis and rice,but miR2118 homologs are absent in Arabidopsis, rice andPopulus. Using 5′-RACE assays, three predicted targets(AC202360_18.1, AC203224_17.1 and AC143338_38.2)belonging to the TIR-NBS-LRR gene family have beenvalidated as genuine targets for miRNA, miR2118 (Fig. 2b).

Identification of conserved miRNAs from M. truncatula

Higher plants have at least c. 20 conserved miRNA families,and the latest miRBase release (11.0, September, 2008) lists30 miRNAs belonging to nine conserved miRNA families inM. truncatula. Our small RNA sequence analysis identifiedmiRNAs belonging to 13 conserved miRNA families, whichincludes nine families reported in the miRBase (Table 2). Todetect the expression of the remaining conserved miRNAfamilies (miR162, miR393, miR394, miR395, miR397,miR398 and miR399), we performed small RNA blot analysis

Fig. 1 Predicted fold-back structures for the legume-specific miRNAs identified in this study. (a) miR2118, (b) miR2199, (c) miR1507 and (d) miR2119. Ah, Arachis hypogaea; Gm, Glycine max; Lj, Lotus japonicus; Mt, Medicago truncatula; Pv, Phaseolus vulgaris; Vu, Vigna unguiculata.

New Phytologist (2009) 184: 85–98 © The Authors (2009)www.newphytologist.org Journal compilation © New Phytologist (2009)

Research90

using labeled antisense oligos. These experiments confirmedthe expression of miR162, miR393 and miR398 in diversetissues (Fig. 4). The other four miRNA families (miR395,miR399 and miR397/398) are induced specifically undersulfate- or phosphate- or copper-deprived conditions, respec-tively (Chiou, 2007; Sunkar et al., 2007) and could not bedetected using RNA isolated from the M. truncatula seedlingsgrown hydroponically with optimal levels of nutrients. Usingsmall RNA blot analysis, miR395, miR398 and miR399 weredetected in M. truncatula seedlings grown hydroponically butwithout sulfate or copper or phosphate respectively (Fig. 5a–c).We also detected miR397 and miR408 (data not shown) inseedlings grown on medium without copper (Fig. 5c). Whenthe miRNA sequences in our library (Table 2) are combinedwith the miRNA families detected in Figs 4 and 5, weconfirmed the expression of 20 conserved miRNA families inM. truncatula. While our manuscript was in review, tworecent reports identified the conserved miRNAs in M. truncatula(Szittya et al., 2008; Zhou et al., 2008). Using bioinformatics,Zhou et al. (2008) reported the identification of 11 conserved

miRNA families, whereas using an experimental approachSzittya et al. (2008) reported the identification of c. 20conserved miRNA families in M. truncatula. However, thesereports do not analyse the expression patterns of conservedmiRNAs in different tissues or in response to limitingnutrient (sulfate or phosphate or copper) availability.

The frequency of conserved miRNAs varied between 1 and734 reads in our library (Table 2). The miR172 family is themost abundant, represented by 734 reads, of which miR172balone accounted for 444 (c. 60% of 734) reads. The secondmost-abundant miRNA family was miR159, represented by234 reads (Table 2). A very high count of miR172 reads wasexpected, because miR172 regulates the AP2 transcriptionfactor implicated in flower development (Aukerman & Sakai,2003; Chen, 2004), and our library was generated usingpooled RNA isolated from M. truncatula seedlings andflowers. However, tissue-specific expression analysis indicatedthat miR172 is abundant in leaves, stem, root and flowers(Fig. 4). These results suggest that miR172 has developmentalregulatory roles, in addition to roles in flower development.

Fig. 2 Characterization of four novel legume-specific miRNAs in Medicago truncatula. (a) Expression analysis of four novel miRNAs (miR2118, miR2199, miR1507 and miR2119) in related legumes along with Arabidopsis and rice using 20 µg of low molecular weight RNA. Blots were stripped and rehybridized with the indicated miRNA probes. The U6 probe served as a loading control. (b) Detection of miRNA* sequence for the four of the novel miRNAs (miR2118, miR2199, miR1507 and miR2119) using 50 µg of low molecular weight RNA for small RNA blot analysis. Small RNA blots from Medicago samples were hybridized with antisense probes of predicted miRNA star sequence. The U6 probe served as a loading control. (c) Validation of three targets for the newly identified miRNA, miR2118, by modified rapid amplification of cDNA ends (RACE) assays in Medicago truncatula. The mRNA target (top) and its corresponding miRNA (bottom) are shown in each alignment; matches are indicated with straight lines, mismatches with colons and G–U wobbles represented with a circle. Arrows show the site of cleavage and the fraction of cloned products that terminated at the miRNA complementary sites is indicated above.

© The Authors (2009) New Phytologist (2009) 184: 85–98Journal compilation © New Phytologist (2009) www.newphytologist.org

Research 91

Sequenced small RNA libraries often contained miR*sequences, although at much lower abundance comparedwith miRNA (Lu et al., 2006; Rajagopalan et al., 2006). Notall conserved miRNAs were detected at high abundance inthis library. Many conserved miRNA family members(miR160a, miR164b, miR167a, miR167b and miR167c)were represented by single reads (Table 2). Only miR396,miR160, miR169 and miR171 had their miR* sequences inour library.

Expression analyses of conserved miRNAs in M. truncatula

Understanding the temporal and/or spatial expression of amiRNA is an important initial step in probing its functionalrole in any organism. Many small RNAs are expressed only incertain tissues or cell types (Chen, 2004; Sunkar & Zhu,2004; Combier et al., 2006; Boualem et al., 2008). Here, wedetermined the expression patterns of miRNAs from diversetissues of M. truncatula, such as leaves (young and old), stems,roots, flowers and in 3-wk-old seedlings (Fig. 4). Mostlyindependent blots were used for each probe, thus the expres-sion levels of each microRNA was monitored unambiguously.

Although most miRNAs were abundantly expressed inM. truncatula leaves, considerable variation in their abundance

Table 2 Identified conserved miRNAs in Medicago truncatula using cloning approach and small RNA blot analysis

miRNA miRNA sequenceCloning frequency

Validated by small RNA blot analysis Validated targets

Validated target gene family

miR156/157 UGACAGAAGAGAGAGAGCACA 14 +miR159 UUGACAGAAGAUAGAGAGCAC 234 +miR160 UGCCUGGCUCCCUGUAUGCCA 4 + BQ148941, ES612384 Auxin response factorsmiR162 UCGAUAAACCUCUGCAUCCAG – + AC150443_32.2 Dicer Like-1miR164 UGGAGAAGCAGGGCACGUGCA 2 + AC203553_1.1 NAC domain proteinmiR165/166 UCGGACCAGGCUUCAUCCCCC 5 +miR167 UGAAGCUGCCAGCAUGAUCUA 8 + AC144478_44.4,

CU326393_14.1Auxin Response Factor

miR168 UCGCUUGGUGCAGGUCGGGAA 5 + AW773594.1 Argonaute-1miR169 CAGCCAAGGAUGACUUGCCGA 25 +miR-170/171 UGAUUGAGCCGUGUCAAUAUC 2 + AC121238_43.2 Scarecrow-like

transcription factor miR172 AGAAUCUUGAUGAUGCUGCAU 734 + AL383429 AP2 domain

transcription factor miR319 UUGGACUGAAGGGAGCUCCC 30 –miR390 AAGCUCAGGAGGGAUAGCGCC 2 + Noncoding RNA TAS3 pre-transcriptmiR393 UCCAAAGGGAUCGCAUUGAUCC – + AC133780_22.2 F-box proteinmiR395 AUGAAGUGUUUGGGGGAACUC – + AC146721_16.4 ATP sulfurylasemiR396 UUCCACAGCUUUCUUGAACUU 6 –miR397 UCAUUGAGUGCAGCGUUGAUG – + AC203224_21.1,

AC135467_30.2Copper-resistance protein

miR398 UGUGUUCUCAGGUCACCCCUU – +miR399a UGCCAAAGGAGAUUUGCCCAG – + AC159143_20.4 Ubiquitin-conjugating

enzyme (E2 ligase)miR408 AUGCACUGCCUCUUCCCUGGC – + BG583436

Fig. 3 Detection of novel candidate miRNAs in Medicago truncatula. Expression analysis of newly identified candidate miRNAs in roots and shoots of M. truncatula. Blots were stripped and rehybridized with the indicated miRNA probes. The U6 probe served as a loading control.

New Phytologist (2009) 184: 85–98 © The Authors (2009)www.newphytologist.org Journal compilation © New Phytologist (2009)

Research92

was noticeable. The exceptions to higher levels of expressionin leaf tissues were miR160, miR168, miR170, miR390 andmiR398, which showed reduced levels in leaves (Fig. 4).Similarly, flower tissue expressed all miRNAs tested with notableexceptions being miR156 and miR393, where expression wasthe least compared with other tissues analysed (Fig. 4). Bycontrast, miR169, miR170 and miR398 showed elevatedexpression in flowers. miR169, was distinctly abundant inflower tissue, while other organs showed only a faint expres-sion. Both miR393 and miR398 had relatively low expressionin the M. truncatula stem, whereas the other miRNAs showed

strong expression (Fig. 4). Abundant expression of miR159,miR166 and miR167 was observed in roots (Fig. 4).

The spatial expression pattern of miR398 differed greatlybetween M. truncatula and Arabidopsis. In Arabidopsis, miR398is expressed abundantly in leaves (cauline and rosette) but notin inflorescence (Jones-Rhoades & Bartel, 2004; Sunkar &Zhu, 2004; Sunkar et al., 2006). By contrast, miR398 inM. truncatula was expressed abundantly in flowers but only atlower levels in leaves (Fig. 4). These findings indicate that theexpression patterns of conserved miRNAs vary greatly acrossplant species.

Fig. 4 Expression analysis of conserved miRNAs in different tissues of the Medicago truncatula. Small RNA blots of low molecular weight RNA isolated from different tissues as indicated. The blots were probed with 32P-end-labelled oligonucleotides complementary to the miRNAs. Individual blots were used for each probe except for miR162, which was stripped and rehybridized with miR164; U6 served as a loading control.

Fig. 5 Characterization of nutrient deprivation-induced miRNAs in Medicago truncatula. (a–c) Small RNA blots of low molecular weight RNA isolated from M. truncatula seedlings grown on hydroponic medium were grown continuously on the same medium (control) or transferred to medium lacking the indicated nutrient (a), sulfate, (b) phosphate and (c) copper. The blots were probed with 32P-end-labelled oligonucleotides complementary to the miRNAs. The blots were stripped and re-probed with U6, which served as a loading control.

© The Authors (2009) New Phytologist (2009) 184: 85–98Journal compilation © New Phytologist (2009) www.newphytologist.org

Research 93

Characterization of nutrient deprivation-induced miRNAs in M. truncatula

Studies show that miR395, miR399 and miR398 are inducedin response to sulfate, phosphate and copper deficiency,respectively, in Arabidopsis (Sunkar et al., 2007). Copperdeprivation has been also shown to induce the expression ofmiR397 and miR408 in Arabidopsis and Brassica (Yamasakiet al., 2007; Abdel-Ghany & Pilon, 2008; Buhtz et al., 2008)To compare these data with miR395, miR397, miR398,miR399 and miR408 in M. truncatula, 3-wk-old seedlingsgrown on optimal hydroponic medium were transferred toidentical medium lacking sulfate or phosphate or copper.miR395 was upregulated in shoots and roots, with theupregulation being very strong in roots of M. truncatulaseedlings grown on the medium without sulfate (Fig. 5a).Similarly, miR399 was induced when grown on medium with-out phosphate (Fig. 5b). As shown in Fig. 5c, miR398 wasupregulated both in shoots and roots of M. truncatula grownon medium without copper, with the accumulation greater inroots than shoots. A similar pattern of induction was observedfor miR397 in M. truncatula seedlings grown on copper-deficientmedium (Fig. 5c).

miRNA target validations

Plant miRNAs and their targets are highly complementary(18–21 nt), which facilitates target prediction with the use ofblastn search or patscan search (Rhoades et al., 2002; Jones-Rhoades & Bartel, 2004). To predict miRNA-targeting mRNAsin M. truncatula, we downloaded the currently annotatedcoding sequences from the Medicago genome project (http://www.medicago.org/genome/downloads/Mt2/) and usedmiRNA sequences to search complimentary mRNA sequencesas suggested previously (Rhoades et al., 2002; Jones-Rhoades& Bartel, 2004). This analysis has identified c. 92 transcriptsas potential targets in M. truncatula (Table S2). To date, onlyfour mRNAs have been validated as genuine targets of miRNAsin M. truncatula (Combier et al., 2006; Boualem et al., 2008).The miR169-guided cleaved fragments were detected for theMtHAP2-1 transcript (Combier et al., 2006). Similarly,miR166-guided cleaved fragments were found for threetranscripts, MtCNA1, MtCNA2 and MtHB-8 in M. truncatula(Boualem et al., 2008). In this study, a total of 15 mRNAs(representing at least one target for most of the conservedmiRNA families) were confirmed as targets in M. truncatula(Table 2, Fig. 6). Most of the cleaved fragments were mappedexactly at the predicted cleavage sites (between nucleotides 10and 11 from the 5′ end). Some validated targets were cleavedat a slightly different position possibly owing to variations (5′or 3′ shifts) in mature miRNA species. ATP sulfurylases,UBC-like-E2-ligase and plantacyanin are predicted targets formiR395, miR399 and miR408, respectively (Table 2). Ourattempts to validate these transcripts as miRNA targets were

unsuccessful using the Medicago seedlings grown on controlmedium. However, miRNA-directed cleaved fragments forthese transcripts could be detected in seedlings grown onmedium without sulfate or phosphate or copper. This can beattributed to nutrient-specific induced transcription of themiRNAs targeting these transcripts (Fig. 6). In Arabidopsisand rice, UBC transcript in its 5′-UTR (untranslated region)possesses four or five complementary sites of miR399 (Fujiiet al., 2005; Bari et al., 2006). In M. truncatula, miR399 hasfive target sites located in the 5′-UTR of UBC and four ofthem were found to be cleaved (Fig. 6). These target validationsare consistent with those of most conserved miRNA targets inArabidopsis, rice and Populus (Jones-Rhoades et al., 2006).

Identification and characterization of TAS3-tasiRNAs in M. truncatula

The tasiRNAs (trans-acting siRNAs) are a class of endogenous21 nt siRNAs that downregulate target mRNAs at the post-transcriptional level, as do miRNAs (Peragine et al., 2004;Vazquez et al., 2004; Allen et al., 2005). They have beenshown to regulate vegetative phase changes in Arabidopsis(Peragine et al., 2004; Vazquez et al., 2004; Allen et al., 2005;Gasciolli et al., 2005; Xie et al., 2005; Yoshikawa et al., 2005)and in moss (Arazi et al., 2005; Talmor-Neiman et al., 2006b).An initial DCL1-dependent, miRNA-guided cleavage oftasiRNA primary transcript defines the 5′ or 3′ end of thetranscript to be converted into dsRNAs by RDR, and sets thephase for accurate formation of 21 nt tasiRNA by DCL4 inArabidopsis (Peragine et al., 2004; Vazquez et al., 2004; Allenet al., 2005; Axtell et al., 2006). Thus, two DCLs, DCL1 andDCL4 and an RDR are required for tasiRNA biogenesis. InArabidopsis, three miRNAs – miR173 miR390 and miR828– have been found to target primary tasiRNA transcripts(Allen et al., 2005; Rajagopalan et al., 2006). Of these, onlymiR390 is conserved from moss to higher plants and miR828appears to be conserved between Arabidopsis and Populus,whereas miR173 homologs have not been found outsideArabidopsis. Since not all Arabidopsis miRNAs that targettasiRNA primary transcripts are conserved, predicting com-putationally how many miRNAs target tasiRNA precursorsand how many tasiRNA loci exist in M. truncatula is difficult.Only sequencing can help identify tasiRNAs more confidently.

To identify tasiRNA loci and tasiRNAs in Medicago, wesearched for clusters of small RNAs that can be mapped to onelocus but surrounded by two miR390 target sites. Thisresulted in identification of one authentic tasiRNA locus inMedicago (MtTAS3a) (Fig. 7a). In addition to the conserveddual miR390 target sites on the tasiRNA precursor, this tran-script has another conserved region, which may be processedinto a tas3-siRNAs, and are complementary to auxin responsefactor (ARF) homologs in M. truncatula (Fig. 7a–c). MtTAS3-tasiRNAs were in phase with the 3′ target site (Fig. 7a) asfound in Arabidopsis and rice (Allen et al., 2005; Liu et al.,

New Phytologist (2009) 184: 85–98 © The Authors (2009)www.newphytologist.org Journal compilation © New Phytologist (2009)

Research94

2007). In Arabidopsis, only the 3′ target site, not the 5′ targetsite, is subjected to miR390-guided cleavage (Axtell et al.,2006; Howell et al., 2007). To verify whether the interactionbetween Medicago miR390 and the MtTAS3 precursor issimilar to what was observed in Arabidopsis, 5′-RACE assaywas performed to detect cleavage events at the 5′ and 3′ targetsites on the TAS3 precursor. We failed to detect the cleavageat the 5′ target site and these results are consistent with theprevious suggestion that miR390 is unable to guide for acleavage because of mismatches between 9 nt and 11 nt fromthe 5′ end of the miR390 (Axtell et al., 2006). Surprisingly,only a small fraction of clones (3/40) confirmed the cleavageat the 3′ target site using RNA isolated from seedlings.Instead, the sequenced PCR product corresponding to the 3′site mostly yielded a cleavage site 33 nt upstream from the

predicted site (Fig. 7a). In Arabidopsis, detection of a cleavageat 33 nt upstream from the predicted site on TAS3 precursorwas reported as a major cleavage event, although a minorcleavage event was also found at the predicted site (Allen et al.,2005). The upstream cleavage event in Arabidopsis has beenattributed to the existence of a hypothetical siRNA (–D2)generated from the TAS3 precursor (Allen et al., 2005),although the accumulation of such a siRNA has not beenexamined. Because a similar cleavage event was also found inthis study, we tested for the accumulation of the hypothetical–D2 siRNA using a small RNA blot and an antisense probecorresponding to the cleaved site. This analysis confirmed theaccumulation of –D2 siRNA (Fig. 7d). Accumulation ofsense (+D2) siRNA could not be detected using a comple-mentary probe, suggesting that –D2 siRNA corresponding to

Fig. 6 Validation of conserved miRNA targets in Medicago truncatula. Detection of miRNA-guided cleavage sites on target transcripts using modified rapid amplification of cDNA ends (RACE) assays in M. truncatula. Partial mRNA sequences from target genes were aligned with the miRNAs. In each alignment, the straight lines represent perfect matches, colons represent mismatches and circles represent G–U wobbles. The fraction of cloned products that terminated at the predicted cleavage site is indicated.

© The Authors (2009) New Phytologist (2009) 184: 85–98Journal compilation © New Phytologist (2009) www.newphytologist.org

Research 95

the cleaved site has the ability to direct cleavage of TAS3precursor.

Cleavage at the 3′ target site on the TAS3 precursor is essentialto generate 21 nt phased, two tandemly arranged conservedTAS3 siRNAs targeting auxin response factor (ARF)-like genesin plants (Allen et al., 2005; Axtell et al., 2006). However, acleavage exactly 33 nt upstream from the 3′ target site onTAS3 precursor was observed in this study and in the study ofAllen et al. (2005). This cleavage would generate siRNAscompletely out of phase such that instead of generating activeTAS3-tasiRNAs, the TAS3 precursor is degraded. A consistentcleavage in two different plant species (M. truncatula andArabidopsis) further strengthens the proposal suggested by

Allen et al. (2005) that the siRNAs generated from the samelocus will degrade the TAS3 precursor.

The expression of TAS3-siRNAs in different tissues ofM. truncatula was confirmed using a small RNA blot analysis(Fig. 7c). TAS3-siRNAs target three ARF genes (ARF2, ARF3and ARF4 ) in Arabidopsis (Allen et al., 2005; Williams et al.,2005) and five ARF genes (four ARF3 homologs and oneARF2 homolog) in rice (Liu et al., 2007). Our computationalprediction found four ARF genes as the targets of MtTAS3-siRNAs (AC150891_17.2; AC152176_68.2; AC158497_40.2and AC126794_50.2) in M. truncatula (Fig. 7e). Of thesefour genes, three (AC150891_17.2; AC152176_68.2 andAC158497_40.2) are close relatives of Arabidopsis ARF3.

Fig. 7 Tas3-siRNA biogenesis, expression analysis and validation of its targets in Medicago truncatula. (a) Nucleotide sequence of MtTAS3 locus. The 5′ and 3′ miR390 target sites are shown as alignments and the predicted cleavage site at the 3′ target site is shown with red arrow. Predicted Dicer processing sites are shown with blue lines. MtTAs3 siRNAs that are complementary to the auxin response factors are indicated with letters (+7TAS3 and +8TAS3). Detected miR390-guided cleavage fragments of the MtTAS3a precursor in M. truncatula are shown with a blue arrow. Detected –D2 siRNA-guided cleavage fragments of the MtTAS3a precursor in M. truncatula are shown with a red arrow. The fraction of cloned products that terminated at the cleaved site is indicated. (b) Sequence alignment of the TAS3 siRNAs from Arabidopsis, rice and M. truncatula. (c) Expression analysis of TAS3 (+8 TAS3) siRNAs in M. truncatula. (d) Expression analysis of –D2 siRNAs in M. truncatula. (e) Detection of TAS3-siRNA-guided cleavage sites on three target transcripts by modified rapid amplification of cDNA ends (RACE) assay in M. truncatula. Partial mRNA sequences from target genes were aligned with the TAS3 siRNA. The fraction of cloned products that terminated at the predicted cleavage site is indicated.

New Phytologist (2009) 184: 85–98 © The Authors (2009)www.newphytologist.org Journal compilation © New Phytologist (2009)

Research96

These three genes have two MtTAS3-siRNA complementarysites in their ORFs. Another gene, AC126794_50.2, is ahomolog of the Arabidopsis ARF2 gene and it harbors only oneTAS3-siRNA complementary site in its ORF. To verifywhether MtTAS3-siRNAs directs cleavage of their targetgenes in M. truncatula, we used 5′-RACE assay to map thecleavage sites on four ARF3-like genes (Fig. 7e). This analysisconfirmed two cleavages at the predicted sites on two ARF3-like genes (AC152176_68.2 and AC158497_40.2) whileonly one cleavage at the 5′ target site was found forAC150891_17.2. In order to confirm the cleavages at twodifferent sites on the same target gene (AC152176_68.2 andAC158497_40.2), we designed two independent primersdownstream from each of the predicted target site (Table S3).We were unable to confirm the predicted cleavage site onARF2-like gene because the mRNA could not be amplifiedusing RNA isolated from the seedlings. Nonetheless, theseobservations confirm that the MtTAS3-siRNAs are processedand can regulate multiple (3) ARF genes in M. truncatula.

Discussion

The present study has characterized eight novel small RNAsin M. truncatula (Table 1). Of these, four are annotated aslegume-specific miRNAs, because both miRNA and miRNA*are detected. These miRNA sequences and predicted fold-backstructures are conserved in leguminous plants, but thesesequences are absent in the completely sequenced genomes ofArabidopsis, rice or Populus. This was further confirmed usingsmall RNA blot analysis (Fig. 2). The remaining four novelsmall RNAs could be detected using small RNA blot analysisand consequently annotated as candidate miRNAs in M. trun-catula but their confident annotation as miRNAs or siRNAsrequires deep sequencing. We have predicted more than 20target transcripts encoding TIR1-NBS-LRR disease resistanceproteins as targets for one of the newly identified legume-specific miRNA (miR2118) and validated three of them inM. truncatula.

In M. truncatula, TIR-NBS-LRR genes exist in an exten-sive cluster of R gene loci on the top arm of M. truncatulachromosome 4 (Ameline-Torregrosa et al., 2008). Recently,Yang et al. (2008) cloned RCT1 that encodes a TIR-NBS-LRR type R protein conferring broad-spectrum anthracnoseresistance when transferred into the susceptible alfalfa lines.Interestingly, we validated RCT1 transcript (AC202360_18.1)as a target for one of the legume-specific miRNAs (i.e.miR2118). In addition to the RCT1, we validated two othermembers (AC203224_17 and AC143338_38) of the TIR-NBS-LRR gene family as targets for the same miRNA(miR2118). We predicted c. 20 genes belonging to this genefamily as potential targets for this miRNA in M. truncatula(Table S1). However, at least two genes belonging to this genefamily are unlikely to be targeted by miR2118 (Table S1),despite the fact that the peptide sequence corresponding to

the target site in all these proteins is highly conserved. A searchof public databases showed a near-perfect target site in TIR-NBS-LRR genes of several other plant genomes includingArabidopsis and rice, but not the miR2118 homolog. BecausemiR2118 targets transcripts encoding TIR1-NBS-LRR pro-teins implicated in disease resistance, it will be interesting tosee whether the expression of miR2118 is regulated duringpathogen infection. Our experimental validation of threeTIR-NBS-LRR genes as genuine targets and our predictionthat 20 other related genes are potential targets of miR2118provide opportunities to explore miRNA-mediated plantdefense responses in Medicago and other legumes.

The miRNA-dependent tasiRNA pathway is a plant-specific RNA silencing pathway that mimics the miRNApathway for mRNA regulation. miR390 is conserved in allhigher plants and in primitive land plants such as Physcomitrellaand Selaginella (Arazi et al., 2005; Axtell et al., 2006, 2007).In Arabidopsis, miR390-guided cleavage occurs only at the 3′target site of the TAS3 precursor while the 5′ target site isresistant to cleavage but is important for binding to thetasiRNA precursor transcript (Axtell et al., 2006; Howellet al., 2007). This characteristic feature is attributed tomismatches at nucleotides 9–12 from the 5′ end of the miRNA.These mismatches are conserved in the TAS3-primary tran-script of M. truncatula and may be critical for the generationof TAS3-siRNAs in this species.

The Arabidopsis TAS3 is expressed on the adaxial side ofearly leaf primordia (Adenot et al., 2006; Garcia et al., 2006),which possibly regulates the expression of ARF3 and ARF4in the adaxial domain and determines the dorso-ventral leafpolarity (Garcia et al., 2006). A similar role has been reported forTAS3-tasiRNAs in maize that target ARF3 and ARF4 orthologs(Nogueira et al., 2007). The observation that M. truncatulamiR390 targets TAS3 tasi-precursors and that the TAS3-tasiRNAs derived from these precursors in turn target four ofthe ARFs (three validated in this study) suggests that theTAS3-siRNA pathway indeed plays important regulatoryroles in M. truncatula. Future experiments will address thefunctional aspects of TAS3-siRNA-guided ARF regulation inM. truncatula and other legumes.

In summary, with a sequencing-depth of 26 656 reads thepresent study has uncovered the existence of four legume-specific miRNAs and four candidate miRNAs in M. truncatula.By applying more robust deep sequencing technologies suchas Sequencing-By-Synthesis (Illumina, Haywood, CA, USA),there is ample scope for the discovery of several additionalnovel miRNAs. Indeed, while our manuscript was underreview Szittya et al., reported eight new miRNA familiesin M. truncatula by using a deep sequencing approach (Szittyaet al., 2008). Interestingly, despite examining approx. 4 millionreads there are only two small RNAs (one legume-specificmiRNA (miR1507) and one candidate miRNA (sRNA19284))that overlap between the study of Szittya et al. (2008) andthis study. This suggests the identification of miRNAs in

© The Authors (2009) New Phytologist (2009) 184: 85–98Journal compilation © New Phytologist (2009) www.newphytologist.org

Research 97

M. truncatula is far from being saturated. Importantly, wehave uncovered legume-specific miRNAs in this study whichare not found in the deeply sequenced library (Szittya et al.,2008). Thus our study has complimented the publishedreport (Szittya et al., 2008). Identification of small RNAs andtheir target genes is a highly useful resource for the largecommunity of researchers working on gene regulation inM. truncatula and other legume crops. Further work is requiredto identify a near-complete set of miRNAs and other novelsmall RNAs in M. truncatula.

Acknowledgements

Support for this research was provided by the OklahomaAgricultural Experiment Station to R.S., and by the NationalScience Foundation grants IIS-0535257 and DBI-0743797,a grant from the Alzheimer’s Association and a grant fromMonsanto to W.Z. We thank Drs Rao Uppalapati and KiranMysore (Samuel Roberts Noble Foundation, Ardmore) forproviding us some of the tissues used in small RNA blot analysis.L.S. was a recipient of a BOYSCAST fellowship from theDepartment of Science and Technology, Government of India.

References

Abdel-Ghany SE, Pilon M. 2008. MicroRNA-mediated systemic down-regulation of copper protein expression in response to low copper availability in arabidopsis. Journal of Biological Chemistry 283: 15932–15945.

Adenot X, Elmayan T, Lauressergues D, Boutet S, Bouche N, Gasciolli V, Vaucheret H. 2006. DRB4-dependent TAS3 trans-acting siRNAs control leaf morphology through AGO7. Current Biology 16: 927–932.

Allen E, Xie ZX, Gustafson AM, Carrington JC. 2005. microRNA-directed phasing during trans-acting siRNA biogenesis in plants. Cell 121: 207–221.

Ambros V, Bartel B, Bartel DP, Burge CB, Carrington JC, Chen X, Dreyfuss G, Eddy SR, Griffiths-Jones S, Marshall M et al. 2003. A uniform system for microRNA annotation. RNA 9: 277–279.

Ameline-Torregrosa C, Wang BB, O’Bleness MS, Deshpande S, Zhu H, Roe B, Young ND, Cannon SB. 2008. Identification and characterization of nucleotide-binding site-leucine-rich repeat genes in the model plant Medicago truncatula. Plant Physiology 146: 5–21.

Arazi T, Talmor-Neiman M, Stav R, Riese M, Huijser P, Baulcombe DC. 2005. Cloning and characterization of micro-RNAs from moss. Plant Journal 43: 837–848.

Aukerman MJ, Sakai H. 2003. Regulation of flowering time and floral organ identity by a microRNA and its APETALA2-like target genes. Plant Cell 15: 2730–2741.

Axtell MJ, Jan C, Rajagopalan R, Bartel DP. 2006. A two-hit trigger for siRNA biogenesis in plants. Cell 127: 565–577.

Axtell MJ, Snyder JA, Bartell DP. 2007. Common functions for diverse small RNAs of land plants. Plant Cell 19: 1750–1769.

Barakat A, Wall PK, Diloreto S, Depamphilis CW, Carlson JE. 2007. Conservation and divergence of microRNAs in Populus. BMC Genomics 8: 481.

Bari R, Pant BD, Stitt M, Scheible WR. 2006. PHO2, microRNA399, and PHR1 define a phosphate-signaling pathway in plants. Plant Physiology 141: 988–999.

Bartel DP. 2004. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell 116: 281–297.

Benedito VA, Torres-Jerez I, Murray JD, Andriankaja A, Allen S, Kakar K, Wandrey M, Verdier J, Zuber H, Ott T et al. 2008. A gene expression atlas of the model legume Medicago truncatula. Plant Journal 55: 504–513.

Boualem A, Laporte P, Jovanovic M, Laffont C, Plet J, Combier JP, Niebel A, Crespi M, Frugier F. 2008. MicroRNA166 controls root and nodule development in Medicago truncatula. Plant Journal 54: 876–887.

Brodersen P, Sakvarelidze-Achard L, Bruun-Rasmussen M, Dunoyer P, Yamamoto YY, Sieburth L, Voinnet O. 2008. Widespread translational inhibition by plant miRNAs and siRNAs. Science 320: 1185–1190.

Buhtz A, Springer F, Chappell L, Baulcombe DC, Kehr J. 2008. Identification and characterization of small RNAs from the phloem of Brassica napus. Plant Journal 53: 739–749.

Chabaud M, de Carvalho-Niebel F, Barker DG. 2003. Efficient transformation of Medicago truncatula cv. Jemalong using the hypervirulent Agrobacterium tumefaciens strain AGL1. Plant Cell Reports 22: 46–51.

Chen XM. 2004. A microRNA as a translational repressor of APETALA2 in Arabidopsis flower development. Science 303: 2022–2025.

Chiou TJ. 2007. The role of microRNAs in sensing nutrient stress. Plant, Cell & Environment 30: 323–332.

Combier JP, Frugier F, de Billy F, Boualem A, El-Yahyaoui F, Moreau S, Vernie T, Ott T, Gamas P, Crespi M et al. 2006. MtHAP2-1 is a key transcriptional regulator of symbiotic nodule development regulated by microRNA169 in Medicago truncatula. Genes & Development 20: 3084–3088.

Crane C, Dixon RA, Wang ZY. 2006. Medicago truncatula transformation using root explants. Methods in Molecular Biology 343: 137–142.

Fahlgren N, Howell MD, Kasschau KD, Chapman EJ, Sullivan CM, Cumbie JS, Givan SA, Law TF, Grant SR, Dangl JL et al. 2007. High-throughput sequencing of Arabidopsis microRNAs: evidence for frequent birth and death of MIRNA genes. PLoS ONE 2: e219.

Fahlgren N, Montgomery TA, Howell MD, Allen E, Dvorak SK, Alexander AL, Carrington JC. 2006. Regulation of AUXIN RESPONSE FACTOR3 by TAS3 ta-siRNA affects developmental timing and patterning in Arabidopsis. Current Biology 16: 939–944.

Fattash I, Voss B, Reski R, Hess WR, Frank W. 2007. Evidence for the rapid expansion of microRNA-mediated regulation in early land plant evolution. BMC Plant Biology 7: 13.

Fujii H, Chiou TJ, Lin SI, Aung K, Zhu JK. 2005. A miRNA involved in phosphate-starvation response in Arabidopsis. Current Biology 15: 2038–2043.

Garcia D, Collier SA, Byrne ME, Martienssen RA. 2006. Specification of leaf polarity in Arabidopsis via the trans-acting siRNA pathway. Current Biology 16: 933–938.

Gasciolli V, Mallory AC, Bartel DP, Vaucheret H. 2005. Partially redundant functions of Arabidopsis DICER-like enzymes and a role for DCL4 in producing trans-acting siRNAs. Current Biology 15: 1494–1500.

Hofacker IL. 2003. Vienna RNA secondary structure server. Nucleic Acids Research 31: 3429–3431.

Howell MD, Fahlgren N, Chapman EJ, Cumbie JS, Sullivan CM, Givan SA, Kasschau KD, Carrington JC. 2007. Genome-wide analysis of the RNA-DEPENDENT RNA POLYMERASE6/DICER-LIKE4 pathway in Arabidopsis reveals dependency on miRNA- and tasiRNA-directed targeting. Plant Cell 19: 926–942.

Jones-Rhoades MW, Bartel DP. 2004. Computational identification of plant microRNAs and their targets, including a stress-induced miRNA. Molecular Cell 14: 787–799.

Jones-Rhoades MW, Bartel DP, Bartel B. 2006. MicroRNAs and their regulatory roles in plants. Annual Review of Plant Biology 57: 19–53.

Liu B, Chen Z, Song X, Liu C, Cui X, Zhao X, Fang J, Xu W, Zhang H, Wang X et al. 2007. Oryza sativa dicer-like4 reveals a key role for small interfering RNA silencing in plant development. Plant Cell 19: 2705–2718.

Lu C, Jeong DH, Kulkarni K, Pillay M, Nobuta K, German R, Thatcher SR, Maher C, Zhang L, Ware D et al. 2008. Genome-wide analysis for discovery of rice microRNAs reveals natural antisense

New Phytologist (2009) 184: 85–98 © The Authors (2009)www.newphytologist.org Journal compilation © New Phytologist (2009)

Research98

microRNAs (nat-miRNAs). Proceedings of the National Academy of Sciences, USA 105: 4951–4956.

Lu C, Kulkarni K, Souret FF, MuthuValliappan R, Tej SS, Poethig RS, Henderson IR, Jacobsen SE, Wang WZ, Green PJ et al. 2006. MicroRNAs and other small RNAs enriched in the Arabidopsis RNA-dependent RNA polymerase-2 mutant. Genome Research 16: 1276–1288.

Lu C, Tej SS, Luo SJ, Haudenschild CD, Meyers BC, Green PJ. 2005. Elucidation of the small RNA component of the transcriptome. Science 309: 1567–1569.

Lu S, Sun YH, Chiang VL. 2008. Stress-responsive microRNAs in Populus. Plant Journal 55: 131–151.

Mallory AC, Vaucheret H. 2006. Functions of microRNAs and related small RNAs in plants. Nature Genetics 38: S31–36.

Meyers BC, Axtell MJ, Bartel B, Bartel DP, Baulcombe D, Bowman JL, Cao X, Carrington JC, Chen X, Green PJ et al. 2008. Criteria for annotation of plant microRNAs. Plant Cell 20: 3186–3190.

Moxon S, Jing R, Szittya G, Schwach F, Rusholme Pilcher RL, Moulton V, Dalmay T. 2008. Deep sequencing of tomato short RNAs identifies microRNAs targeting genes involved in fruit ripening. Genome Research 18: 1602–1609.

Nobuta K, Venu RC, Lu C, Belo A, Vemaraju K, Kulkarni K, Wang W, Pillay M, Green PJ, Wang GL et al. 2007. An expression atlas of rice mRNAs and small RNAs. Nature Biotechnology 25: 473–477.

Nogueira FT, Madi S, Chitwood DH, Juarez MT, Timmermans MC. 2007. Two small regulatory RNAs establish opposing fates of a developmental axis. Genes & Development 21: 750–755.

Peragine A, Yoshikawa M, Wu G, Albrecht HL, Poethig RS. 2004. SGS3 and SGS2/SDE1/RDR6 are required for juvenile development and the production of trans-acting siRNAs in Arabidopsis. Genes & Development 18: 2368–2379.

Rajagopalan R, Vaucheret H, Trejo J, Bartel DP. 2006. A diverse and evolutionarily fluid set of microRNAs in Arabidopsis thaliana. Genes & Development 20: 3407–3425.

Ramachandran V, Chen X. 2008. Small RNA metabolism in Arabidopsis. Trends in Plant Science 13: 368–374.

Rhoades MW, Reinhart BJ, Lim LP, Burge CB, Bartel B, Bartel DP. 2002. Prediction of plant microRNA targets. Cell 110: 513–520.

Subramanian S, Fu Y, Sunkar R, Barbazuk WB, Zhu JK, Yu O. 2008. Novel and nodulation-regulated microRNAs in soybean roots. BMC Genomics 9: 160.

Sunkar R, Jagadeeswaran G. 2008. In silico identification of conserved microRNAs in large number of diverse plant species. BMC Plant Biology 8: 37.

Sunkar R, Zhu JK. 2004. Novel and stress-regulated microRNAs and other small RNAs from Arabidopsis. Plant Cell 16: 2001–2019.

Sunkar R, Chinnusamy V, Zhu JH, Zhu JK. 2007. Small RNAs as big players in plant abiotic stress responses and nutrient deprivation. Trends in Plant Science 12: 301–309.

Sunkar R, Girke T, Jain PK, Zhu JK. 2005. Cloning and characterization of microRNAs from rice. Plant Cell 17: 1397–1411.

Sunkar R, Kapoor A, Zhu JK. 2006. Posttranscriptional induction of two Cu/Zn superoxide dismutase genes in Arabidopsis is mediated by downregulation of miR398 and important for oxidative stress tolerance. Plant Cell 18: 2415–2415.

Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK. 2008. Identification of novel and candidate miRNAs in rice by high throughput sequencing. BMC Plant Biology 8: 25.

Szittya G, Moxon S, Santos DM, Jing R, Fevereiro MP, Moulton V, Dalmay T. 2008. High-throughput sequencing of Medicago truncatula short RNAs identifies eight new miRNA families. BMC Genomics 9: 593.

Talmor-Neiman M, Stav R, Frank W, Voss B, Arazi T. 2006a. Novel micro-RNAs and intermediates of micro-RNA biogenesis from moss. Plant Journal 47: 25–37.

Talmor-Neiman M, Stav R, Klipcan L, Buxdorf K, Baulcombe DC,

Arazi T. 2006b. Identification of trans-acting siRNAs in moss and an RNA-dependent RNA polymerase required for their biogenesis. Plant Journal 48: 511–521.

Trinh TH, Ratet P, Kondorosi E, Durand P, Kamate K, Bauer P, Kondorosi A. 1998. Rapid and efficient transformation of diploid Medicago truncatula and Medicago sativa ssp. falcata lines improved in somatic embryogenesis. Plant Cell Reports 17: 345–355.

Vaucheret H. 2006. Post-transcriptional small RNA pathways in plants: mechanisms and regulations. Genes & Development 20: 759–771.

Vazquez F, Vaucheret H, Rajagopalan R, Lepers C, Gasciolli V, Mallory AC, Hilbert JL, Bartel DP, Crete P. 2004. Endogenous trans-acting siRNAs regulate the accumulation of Arabidopsis mRNAs. Molecular Cell 16: 69–79.

Williams L, Carles CC, Osmont KS, Fletcher JC. 2005. A database analysis method identifies an endogenous trans-acting short-interfering RNA that targets the Arabidopsis ARF2, ARF3, and ARF4 genes. Proceedings of the National Academy of Sciences, USA 102: 9703–9708.

Xie ZX, Allen E, Wilken A, Carrington JC. 2005. DICER-LIKE 4 functions in trans-acting small interfering RNA biogenesis and vegetative phase change in Arabidopsis thaliana. Proceedings of the National Academy of Sciences, USA 102: 12984–12989.

Yamasaki H, Abdel-Ghany SE, Cohu CM, Kobayashi Y, Shikanai T, Pilon M. 2007. Regulation of copper homeostasis by micro-RNA in Arabidopsis. Journal of Biological Chemistry 282: 16369–16378.

Yang S, Gao M, Xu C, Gao J, Deshpande S, Lin S, Roe BA, Zhu H. 2008. Alfalfa benefits from Medicago truncatula: the RCT1 gene from M. truncatula confers broad-spectrum resistance to anthracnose in alfalfa. Proceedings of the National Academy of Sciences, USA 105: 12164–12169.

Yoshikawa M, Peragine A, Park MY, Poethig RS. 2005. A pathway for the biogenesis of trans-acting siRNAs in Arabidopsis. Genes & Development 19: 2164–2175.

Zhang BH, Pan XP, Cannon CH, Cobb GP, Anderson TA. 2006. Conservation and divergence of plant microRNA genes. Plant Journal 46: 243–259.

Zheng Y, Zhang W. 2008. Animal microRNA target prediction by incorporating diverse sequence-specific determinants. http://www.cse.wustl.edu/~zhang/

Zhou ZS, Huang SQ, Yang ZM. 2008. Bioinformatic identification and expression analysis of new microRNAs from Medicago truncatula. Biochemical and Biophysical Research Communications 374: 538–542.

Supporting Information

Additional supporting information may be found in theonline version of this article.

Fig. S1 Predicted fold-back structures for the newly identi-fied candidate miRNAs in Medicago truncatula.

Table S1 miR2118 complementary sites in the mRNA targetsin Medicago truncatula, Arabidopsis and rice

Table S2 Predicted miRNA targets in Medicago truncatula

Table S3 Primers used for rapid amplification of cDNA ends(RACE) assay for validating targets

Please note: Wiley-Blackwell are not responsible for the contentor functionality of any supporting information supplied bythe authors. Any queries (other than missing material) shouldbe directed to the New Phytologist Central Office.