medicago truncatula shows distinct patterns of mycorrhiza-related gene expression after inoculation...
TRANSCRIPT
Planta (2008) 227:671–680
DOI 10.1007/s00425-007-0649-1ORIGINAL PAPER
Medicago truncatula shows distinct patterns of mycorrhiza-related gene expression after inoculation with three diVerent arbuscular mycorrhizal fungi
Nadja Feddermann · Thomas Boller · Peter Salzer · Sara Elfstrand · Andres Wiemken · Malin Elfstrand
Received: 4 June 2007 / Accepted: 9 October 2007 / Published online: 27 October 2007© Springer-Verlag 2007
Abstract DiVerent arbuscular mycorrhizal fungi (AMF)alter growth and nutrition of a given plant diVerently. Plantgene expression patterns in response to fungal colonizationshow a certain overlap when colonized by fungi of theGlomeraceae. However, little is known of plant responses tofungi of diVerent fungal taxa, e.g. the Gigasporaceae. Wetherefore compared the impact of colonization by threetaxonomically diVerent AMF species (Glomus intraradices,Glomus mosseae and Scutellospora castanea) on Medicagotruncatula at the physiological and transcriptional levelusing quantitative-PCR. Each AMF developed a species-typical colonization pattern, with a colonization degree of60% for G. intraradices and 30% for G. mosseae. Both spe-cies developed appressoria, intraradical hyphae, arbusculesand vesicles. S. castanea showed a colonization degree of10% and developed appressoria, intraradical hyphae, arbus-cules and arbusculate coils. All AMF enhanced the plantbiomass accumulation and nutritional status although not incorrelation with the colonization degree. The expression of10 mycorrhiza-speciWc or mycorrhiza-associated plantgenes could be separated into two clusters. The Wrst cluster,
containing arbuscule-induced genes, was highly induced ininteractions with G. intraradices and G. mosseae but alsoslightly induced by S. castanea. The second cluster of genescontained genes that were induced primarily by S. castanea.In conclusion, genes that respond to colonization by fungiof the genus Glomus also respond to Scutellospora. How-ever, there is also a group of genes that is signiWcantlyinduced only by Scutellospora and not by Glomus species inthis study. Our data indicate that genes may be diVerentiallyregulated in response to the diVerent AM fungi.
Keywords Arbuscule-induced gene expression · Glomus · Medicago truncatula · Quantitative PCR · Scutellospora · Symbiosis-induced
AbbreviationsAM Arbuscular mycorrhizaAMF Arbuscular mycorrhizal fungusG. GlomusGi G. intraradicesGi. GigasporaGm G. mosseaeS. ScutellosporaSc S. castaneaP PhosphorusN Nitrogen
Introduction
Arbuscular mycorrhiza (AM) is a symbiotic associationthat is formed between fungi of Glomeromycota (Schüssleret al. 2001) and the roots of more than 80% of the terrestrialplants. The primary beneWt for symbiotic plants is animproved nutrition and the arbuscular mycorrhizal fungi
N. Feddermann · T. Boller · P. Salzer · A. WiemkenBotanical Institute of Basel University, Hebelstrasse 1, 4056 Basel, Switzerland
Present Address:N. Feddermann · M. Elfstrand (&)Department of Forest Mycology and Pathology, Swedish University of Agricultural Sciences, P.O. Box 7026, 75007 Uppsala, Swedene-mail: [email protected]
S. ElfstrandDepartment of Crop Production Ecology, Swedish University of Agricultural Sciences, P.O. Box 7043, 75007 Uppsala, Sweden
123
672 Planta (2008) 227:671–680
(AMF) provide plants with nutrients, in particular phospho-rus (P) (Smith and Read 1997). Colonization of plant rootsby AMF involves a complex network of signal perception,ampliWcation, and transduction in the host plant root (Harri-son 1999). One well-studied feature of this interaction is ahighly branched fungal structure formed inside root corticalcells, called the arbuscule. Within the plant root, the devel-opment of arbuscules is associated with AM-speciWc geneexpression in the root cortex. Non-targeted gene isolationapproaches and microarray experiments have identiWedseveral plant genes that are expressed in roots in an AM-speciWc or AM-associated manner, some of which werepreviously unknown genes (Liu et al. 2003; Wulf et al.2003; Grunwald et al. 2004; Hohnjec et al. 2005). A com-mon basis of many recent studies of AM-associated geneexpression has been the model plant species Medicagotruncatula, but the AMF species have varied between stud-ies. Salzer et al. (2000) and Wulf et al. (2003), among oth-ers, used Glomus intraradices; Harrison (1996), Chiouet al. (2001) and Liu et al. (2003) used G. versiforme; andGrunwald et al. (2004) used G. mosseae.
Burleigh et al. (2002) and Smith et al. (2004) showedthat diVerent AMF species could have diVerent impacts onplant nutrition and growth. Their studies showed that inseveral plant/fungus combinations, the fungal P contribu-tion was not related to the extent of colonization or to plantgrowth and not even to the plants P responses. Burleighet al. (2002) also showed that diVerent AMF speciesaVected plant gene expression diVerently; known P starva-tion genes (MtPT2 and Mt4) were highly induced in thenon-mycorrhizal control under a P-starvation regime, butthe expression of these genes varied in response to AMFcolonization. Plants inoculated with G. mosseae showedlowest transcript levels while plants colonized by Gigas-pora rosea had transcript levels similar to the non-mycor-rhizal control plants. Based on this and also on studies byGao et al. (2001), Hart and Reader (2002), Smith et al.(2004) and Munkvold et al. (2004) the idea of a functionaldiversity among the mycorrhizal associations was put for-ward. Within the diVerent AM-symbioses there are twomajor classes of morphology that range in a continuumfrom classic Arum-type with intraradical hyphae and arbus-cules formed in cortical cells to Paris-type with arbusculatecoils and hyphal coils in cortical cells (Dickson 2004). Thetypes of morphology are dependent on the particular com-binations of host and fungus and Gao et al. (2004) showedthat in tomato the Paris-type of AM, formed by Scutellos-pora calospora, lead to a strong induction of defense-related genes while the Arum-type of AM, formed by, forinstance G. intraradices, did not. Both G. intraradices andG. mosseae are known to form Arum-type AM in Medicago(Burleigh et al. 2002; Smith et al. 2004), whereas individ-ual species of the Gigasporaceae seem to form Arum-type
AM in some situations and arbusculate coils and hyphalcoils in other situations (Dickson 2004).
One important question is whether functional and struc-tural diversity are reXected in the expression proWles ofAM-associated genes. There is some overlap in the expres-sion proWles of AM-associated genes in M. truncatula rootscolonized by G. mosseae and G. intraradices (Hohnjecet al. 2005), which may indicate some overlap in function.To determine whether this applies to interactions with AMFtaxa outside of the Glomeraceae, we set up an experimentto compare the expression of 16 previously identiWed AM-speciWc or AM-associated genes related to diVerent aspectsof the mycorrhization process, especially on the cytologicaland nutritional level. First, we chose genes coding for prod-ucts involved in plant metabolism or tissue organization;second, genes with products that function at deWned stepsof mycorrhiza formation, like the arbuscule-speciWc phos-phate transporter gene MtPt4 (Harrison et al. 2002), andWnally AM-associated genes without obvious relationshipto mycorrhization, like the gene encoding narbonin, a puta-tive storage protein. Expression of the selected genes wasanalyzed in interactions between M. truncatula and threefungal species with a diVerent taxonomic status, namely G.intraradices and G. mosseae, two species of Glomus groupA belonging to the Glomeraceae, and Scutellospora casta-nea, belonging to the distantly related Gigasporaceae(Redecker 2002).
Materials and methods
Plant growth conditions and sampling
Medicago truncatula cv. Jemalong A17 seeds (originallyprovided by T. Huguet, CNRS-INRA Castanet-Tolosan,France) were released from their seedpods and treated for8 min in concentrated sulphuric acid. After germination onwater agar for 1 week, seedlings were transferred into potsWlled with 700 ml autoclaved TerraGreen (Lobbe Umwelt-technik, Iserlohn, Germany) and grown in a climate cham-ber (Microclima 1750, Snijders ScientiWc B.V., Tilburg,The Netherlands) under 18 h light with 410 mol m¡2 s¡1
and 22°C and 6 h dark and 18°C. Humidity was kept con-stant at 65%. Once per week plants were watered, and onceper week additionally fertilized with B & D medium(Broughton and John 1979) containing 0.5 mM of phos-phate (provided as KH2PO4) and 2 mM of nitrate (providedas KNO3). After 5 weeks, single plantlets were transferredinto pots containing 700 ml autoclaved TerraGreen forinoculation with 10 ml of soil-based inoculum. Fungalinoculum consisted of spores, hyphae and root fragments ofeither Glomus mosseae ISCB13 (Biengen, Germany; Oehlet al. 2003), G. intraradices Schenk and Smith (Ontario,
123
Planta (2008) 227:671–680 673
Canada; DAOM 197198) or Scutellospora castaneaBEG01 (unknown location, France; http://www.kent.ac.uk/bio/beg). The inoculum was prepared as described in Oehlet al. (2003) and propagated with Plantago lanceolata andHieratium pilosella as host plants. Plantlets that were usedas non-mycorrhizal control plants were inoculated similarlywith 10 ml of an autoclaved 1:1:1 mixture of the three inoc-ula. Control plants and inoculated plants were placed nextto each other and treated identically, they were monitoredduring growth and watered and fertilized as stated above.There were Wve or six pots for each of the three combina-tions of M. truncatula and diVerent AMF fungi, represent-ing biological replicates that were harvested and processedseparately.
Ten weeks after inoculation, plants were removed fromtheir pots, rinsed and freed from the surrounding TerraGreen and dried slightly with paper towels. Roots werethen cut into 1 cm pieces with a scalpel blade and batchesof randomly sampled root pieces from one plant were fro-zen in liquid nitrogen immediately. During sampling, theplants were separated into shoots and roots and these wereweighed directly afterwards to determine fresh weights.Portions of the plant material were dried in paper bags for3 days at 80°C in an oven and the ratios of fresh weight todry weight of these fractions were used to calculate the dryweight for each individual plant. AMF colonization and theinternal structures were determined after clearing of rootsin 10% KOH and subsequent Trypan Blue staining (Phillipsand Hayman 1970) of one random fraction of the 1 cm rootsegments. Using a variation of the gridline intersectionmethod as described in Giovannetti and Mosse (1980), thetotal root length colonization as well as intraradical struc-tures were calculated from their presence in longitudinalmicroscopic intersections using a 20£ magniWcation in aZeiss Axioplan microscope (Carl Zeiss AG, Feldbach,Switzerland). For each biological replicate, a minimum of300 mm of root segments was analyzed.
Phosphate and nitrogen content
Samples of dried plant material were ground in a ball mill(MM 2224, Retsch, Haan, Germany), set at half power, insteel containers for 45 s. For nitrogen (N) measurements,2 mg of the ground material were weighed into tin capsulesand measured in an automated nitrogen and carbon ana-lyzer mass spectrometer (http://www.sercongroup.com/index.htm). Measurements were done in triplicate for eachindividual plant.
Phosphate content was determined essentially asdescribed by Ohnishi and Gall (1978) and Watanabe andOlsen (1965) but with some modiWcations; 100 mg grounddry plant material were ashed at 600°C for 12 h, redis-solved in 0.5 M NaOH and neutralized with 0.5 M HCl.
Colorimetric measurements were done in a Spectrophotom-eter (Anthos reader 2001, Anthos Labtec Instruments; Salz-burg, Austria) with 1.6% polyvinylpyrrolidone, 2.64 mMNa2EDTA, 60 mM hydroxylamine, 20 mM H2SO4 and0.88% ammonium-heptamolybdate.
RNA preparation, reverse transcription and quantitative PCR
Total RNA was extracted from 100 mg frozen material withthe NucleoSpin RNA Plant kit (Machery and Nagel, Oens-ingen, Switzerland) according to the manufacturers’instructions and eluted in RNAse free water. A DNAse Itreatment step was included in the RNA extraction process,as recommended by the manufacturer. RNA concentrationwas quantiWed spectrophotomatrically from absorption val-ues at A260 and A280 (Shimadzu UV-160, Shimadzu Sch-weiz, Reinach, Switzerland). When necessary, RNAsamples were concentrated by precipitation with ethanoland sodium acetate after elution. One microgram of RNAwas used to prepare cDNA with oligo (dT)15 primers for15 min at 42°C, using the Reverse Transcription System(Promega, Wallisellen, Switzerland). Kanamycin positivecontrol RNA (Promega) was used as a control for veriWca-tion of the reverse transcription. After reverse transcriptionthe samples were diluted with water up to 100 �l and storedat 4°C until use in real-time PCR (qPCR). PCR Primers arelisted in Table 1.
qPCR was performed in 25 �l reaction volume using1 �l of the template cDNA on a Gene Amp 5700 SequenceDetection System with Power SYBR Green PCR Master-mix (both Applied Biosystems). The M. truncatula ubiqui-tin gene was used for normalization of gene expression.This gene is well validated in our system and showed a uni-form expression throughout the course of the experiment(Salzer et al. 2004; Elfstrand et al. 2005). Each treatmentincluded at least Wve biological replicates, representingindividual plants.
Statistical analysis
Results were analyzed by the Mann–Whitney U test, Spear-mans rank correlation coeYcient and linear regression anal-ysis in the Graph Pad Prism® statistics program (GraphPadSoftware Inc., San Diego, CA, USA).
Results
Physiological data
Ten weeks after inoculation, all three AMF strains hadformed well-developed mycorrhizae with M. truncatula,
123
674 Planta (2008) 227:671–680
but the degree of AMF colonization, measured by the grid-line intersection method, diVered: It was 58.2% forG. intraradices 23.2%, for G. mosseae and 10.4% forS. castanea (Fig. 1). The colonization frequencies of thethree fungi all diVered signiWcantly from each other(P < 0.01). No colonization was found in mock-inoculatedcontrol plants.
The colonization patterns of the three AMF diVered in aspecies-dependent manner. For example, the number ofappressoria per successful entry into the roots was diVerentin the three fungi. G. intraradices was most successful inentering the roots (Fig. 1a, d) whereas G. mosseae formedmore appressorium-like structures that did not lead to intra-radical infections or penetration after attachment to the rootsurface (Fig. 1b, e). In S. castanea similar structures(Fig. 1c, f) were much more common than in G. intrara-dices (P = 0.0173) and G. mosseae (P = 0.026). The fungalprogression within the cortex also diVered amongst thetaxa. The two Glomus species developed a similar pattern,with G. intraradices showing many arbuscules, groups ofvesicles and thin intraradical hyphae (Fig. 1a). G. mosseaedeveloped less arbuscules and somewhat thicker hyphaeand only rarely produced vesicles (Fig. 1b). There wereconsiderable diVerences in the colonization patterns of
S. castanea compared to the two Glomus species. S. castaneadeveloped highly curled and thick intracellular hyphalstructures (coils) as well as arbuscules (Fig. 1e).
Plants that had not been inoculated by AMF grew moreslowly and remained smaller compared to inoculated plants(data not shown). They developed less secondary and ter-tiary branches and leaves of smaller area (data not shown).Consequently these plants developed less biomass, as mea-sured by plant dry weight (Fig. 2a). Non-inoculated plantsalso had fewer Xowers and seedpods compared to theAMF-inoculated plants; in some cases the plant did notXower at all during the experiment.
Shoot dry weight (P = 0.0424), and shoot total P content(P = 0.0194) correlated with the degree of root colonization.However, S. castanea-inoculated plants, with the lowestdegree of colonization, received almost as much P and N as thehighly colonized G. intraradices plants, and no signiWcantdiVerences could be detected in the shoot P and N contentbetween plants colonized by the three AMF species (Fig. 2).
Expression of AM-associated genes, as analyzed by qPCR
MtBcp1 (TC88539), Mtchit3-3 (AY238969) and MtPt4(AY116210) were signiWcantly induced by all three AMF
Table 1 Primers used in the qPCR experiment
CCR cinnamoyl-Co-enzyme A reductase, FK fructokinase, Kan kanamycin positive control, MCA malonyl-Co-enzyme A: acyl carrier proteintransacylase, MtBcp1 blue copper protein, Mtchit, chitinase; MtGst1 glutathione S-transferase, MtPt4 phosphate transporter, MtSt1 sucrosetransporter, MtSucS1 sucrose synthase, MtUbi ubiquitin, Pyr DH pyruvate dehydrogenase E1 alpha subunit
Gene Forward primer Reverse primer
Control genes
Kan GGACGGCGGCTTTGTTG CTGCGTTGTCGGGAAGATG
MtUbi GTGAAGACCTTGACCGGCAAAAC GGTGAAGCGTGGACTCTTTCTGG
Group 1
MtGst1 GGAGACAATGTGGTTGTTTTGG GGTTGGAAGACCAAACCTGA
MtPt4 ACGTTCTTGGTGACGGAAAC AGTTCTTGAGTCCTGGCGAA
MtBcp1 GCAAGGCACAATGTTTTCAA TTGCCATGACAACTCCAAAC
Mtchit3-3 CCTTGTCAATACAATCCTGGTG GCAGAACCTTTAATAGCTGG
Group 2
CCR AGGCTGTGCCGGTGTTATAC CTGCTTCCTTTGCAACCTTC
MtSucS1 TTCTACCCTGAAATCGAAGAGC TCTCCGGCAACAACAACA
Mtchit3-4 CCCTGATGCATTTATGAAC CATATTTGGAAGAACCTTTAATAACTGG
MtSt1 CATATGCCAGGTTGCAGTAGC GAGCTGCAGAACGAATCTCC
Pyr DH AAGGTCAGAGAAGTGGCGAA TGGGATCCCTACCAGCATAG
Narbonin TGCCATTGCGATGACATAAT GGAGCAATGGACACCAGTTT
Non-regulated genes
MCA TGGAAGCCAAAGCAAAGTCT TCCAGGTCCCAATTCATAGC
GH3 GAAATGGACCGTCGTCAGTT GACGTGCCACTAACCCACTT
Mtchit5 GGGTTGATGGTGGAATGGCG GATCCGGTCTCCTTGTCATAC
Mtchit3-1 CCTGGTGCTTGTAACTTTGTTTC GGTGAAGGCTTAACAATAGGCAGC
Mtchit4 GGTGATGCATATTGTGGCACAGGG GCAGCAGCAACCTCACGTTTGGAG
FK TCCAAGTGCTGACATGCTTC AGGGTAGGCGAAGGTTAGGA
123
Planta (2008) 227:671–680 675
(Table 2). MtGst1 (AY134608) showed strong and signiW-cant induction only after G. intraradices colonization(Table 2). These genes are all known to be arbuscule-spe-ciWcally induced and are referred to as “Group 1” genesfrom now on.
A relatively large set of genes, including MtSucS1(AJ131964), Mtchit3-4 (AY238970), MtSt1 (TC87421),narbonin (TC77154), pyruvate dehydrogenase E1 alphasubunit (TC77795) and cinnamoyl Co-enzyme A reductase(TC77268), responded to AMF colonization but the induc-tion of these genes was only statistically signiWcant in rootsof S. castanea colonized plants (Table 2). These genes arereferred to as “Group 2” genes. The expression levels of
genes in this group did not show any correlation with thedegree of AMF colonization.
Transcripts of genes included as control genes did notshow signiWcant changes in expression in mycorrhizal roots.For example, the pathogen-inducible Mtchit4 (AY490790)and the early nodulin gene Mtchit5 (AJ515476) (Table 2)were not signiWcantly induced after inoculation with any ofthe AMF. Additionally, GH3 (TC77465), malonyl Co-enzyme A:acyl carrier protein transacylase (TC77871),(Table 2) were not signiWcantly regulated in colonizedroots. The transcript levels of the class III chitinase geneMtchit3-1 (AY294484) and fructokinase (TC76829) geneshowed no statistically signiWcant changes after mycorrhizal
Fig. 1 Mycorrhizal structures in roots of M. truncatula after 10 weeks of symbiotic growth. a–c Typical views of root sam-ples after staining with Trypan Blue; fungal structures appear in dark blue. a G. intraradices typically grows with thin and straight hyphae in the root cortex (black arrowheads). Arbuscules (white arrowhead) are penetrat-ing into neighboring host cells. b G. mosseae exhibits the same basic growth pattern as G. intra-radices, but has slightly thicker hyphae (black arrowheads). c S. castanea typically grows with thick and short, curved hyphae along the innermost layers of cortical root cells (black arrowheads). Hyphal coils (grey arrowhead) and arbuscules (white arrowhead) are formed in the subtending cells. d–f Degree of colonization (white bar, scale on the left-hand side) and relative frequency of intraradical structures (grey bars, scale on the right-hand side). M. trunca-tula roots were analyzed 10 weeks after inoculation with G. intraradices (d), G. mosseae (e) or S. castanea (f), using the gridline intersection method. Bars represent SE (n ¸ 5)
123
676 Planta (2008) 227:671–680
colonization (Table 2). However, there was a near signiW-cant trend towards repression of these genes in roots colo-nized by G. intraradices and G. mosseae.
A correlation analysis was done for the expression dataof each gene and the physiological parameters measured,weighing each biological replicate equally. In such an anal-ysis, the expression of MtPt4, MtBcp1 and MtGst1 corre-lated to the degree of root colonization (Table 3). Apartfrom being related to the root colonization, the expressionof the genes in group 1 was also correlated with the shoot Pcontent (Table 3). Furthermore, the expression levels ofsome genes correlated to shoot nutrient contents; Mtchit3-4correlated to the shoot P content (Table 3), cinnamoyl Co-enzyme A reductase, MtSucS1, MtSt1, and narbonin corre-lated to shoot N content (Table 3).
Discussion
In this study we present a comparison of AM-associatedgene expression in M. truncatula plant roots after 10 weeksof colonization by G. intraradices, G. mosseae and S. cas-tanea. Each of the AMF species developed individual, typi-cal colonization patterns. While the two Glomus speciesformed a classical Arum-type of mycorrhiza with arbus-cules and vesicles in the root cortex (Dickson 2004), S. cas-tanea formed both arbuscules and typical hyphal coilswithin the cortex cells. These Paris-type associated struc-tures have been observed before, and are typically found inAM formed between fungi of the Gigasporaceae and diVer-ent plant species, for instance tomato, potato and M. trun-catula (Burleigh et al. 2002; Karandashov et al. 2004; Gaoet al. 2004) and would be classiWed as an intermediate typeof morphology in the framework presented by Dickson(2004).
Although the overall degree of colonization varied fromca. 10 to 60% after 10 weeks depending on the colonizingAMF species, the growth response and phosphate gain ofthe plants did not diVer signiWcantly between the treat-ments. Despite its lower degree of root colonization, S. cas-tanea (10% colonization) was as eYcient as G. intraradices(60% colonization) in stimulating growth of the host plantand providing mineral nutrients. Previously, Burleigh et al.(2002), Hart and Reader (2002), and Smith et al. (2004)showed that some AMF species with a relatively lowdegree of root colonization but with a larger soil myceliumsupport the plant with a similar eYciency as a species witha high intraradical colonization. Similarly, our data indicatethat the functionality of AM fungi is not only determinedby the degree of fungal colonization or the number of
Fig. 2 M. truncatula shoot growth and nutrient uptake is increased af-ter inoculation with arbuscular mycorrhizal fungi. Biomass (a), shootnitrogen (b) and phosphorus (c) content in M. truncatula plants colo-nized by diVerent mycorrhizal fungi, as compared to non-mycorrhizalcontrol plants. Bars represent SE (n ¸ 5). Asterisks in the graphs indi-cate statistically signiWcant diVerences by the Mann–Whitney U test
�
123
Planta (2008) 227:671–680 677
arbuscules formed. This leads to the question whether AMFspecies with such diVerent colonization patterns but similarfunctionality cause similar induction patterns of AM-asso-ciated genes.
One fraction of the genes we analyzed was not signiW-cantly inXuenced by any of the AMF species. Some of thenon-regulated genes have been shown to be either up-regu-lated in other studies, like GH3, or down-regulated, forinstance malonyl Co-enzyme A:acyl carrier protein transac-ylase (Hohnjec et al. 2005). The chitinase genes Mtchit4, amarker for the induction of plant defence responses (Salzeret al. 2004), and Mtchit5 that is a nodule-speciWc gene clas-siWed as an early nodulin (Salzer et al. 2004) were bothexpressed at very low levels in M. truncatula roots andshowed no induction after AMF colonization. These obser-vations suggest that, although it is likely that other microor-ganisms were present in the systems after 10 weeks ofcultivation, they did not greatly inXuence the gene expres-sion patterns in our analysis. However, most of the genesthat we analyzed showed signiWcant induction after AMFcolonization. Statistical analysis of gene expression in colo-nized roots showed that the genes that were induced aftercolonization by AMF could be separated into two clusters.
The Wrst group of genes consisted of known arbuscule-induced genes (MtBcp1, MtPt4, Mtchit3-3 and MtGst1)with relatively high induction by both Glomus species.They more or less corresponded to the genes that were
selected as being expressed at deWned steps of mycorrhizaformation. MtBcp1 (Küster et al. 2004; Hohnjec et al.2005), MtPt4 (Harrison et al. 2002) and Mtchit3-3 (Bona-nomi et al. 2001; Elfstrand et al. 2005) showed similarexpression patterns; these genes were signiWcantly inducedin interactions with all AMF but their relative expressionlevels were higher after colonization with both Glomus spe-cies than with S. castanea. As we found more arbusculesand intraradical hyphae in roots colonized by the two Glo-mus species, it is likely that the expression of these genes isassociated with this higher frequency of intraradical fungalstructures. We found that MtPt4 transcripts were induced inplants colonized with any of the three tested AMF species(Table 2), its expression correlated with the abundance ofarbuscules (data not shown). However, it was relativelyhighly induced in S. castanea AM despite the relatively lowabundance of arbuscules in this interaction. A functionalhomologue to MtPt4, the phosphate transporter StPt3, hasbeen shown to be active not only in cells containing arbus-cules but also in cells containing only thick coiled hyphaeafter colonization by Gi. margarita (Karandashov et al.2004). Together with the observation by Harrison et al.(2002) that the MtPt4 protein accumulates after coloniza-tion with Gi. rosea, this provides support for the functionalsimilarity between MtPt4 and StPt3. The induction patternof MtGst1 (Wulf et al. 2003) was remarkable in our studyas it was highly induced by G. intraradices but not by
Table 2 Expression levels of the selected genes in M. trunca-tula roots colonized by three diVerent AMF, normalized to the basal gene expression in control roots
Gene name Predicted expression patterna
Relative expressionb
G. intraradices G. mosseae S. castanea
Group 1
MtGst1 Arbuscule induced 205.7c (58.3) 1.8c (0.8) 7.0c (2.0)
MtPt4 Arbuscule induced 86.4c (31.7) 41.7c (32.3) 11.9c (2.6)
MtBcp1 Arbuscule induced 8.3c (4.1) 12.1c (10.1) 3.1c (1.2)
Mtchit3-3 Arbuscule induced 3.9c (2.8) 4.5c (2.7) 2.9c (0.7)
Group 2
Cinnamoyl Co-enzymeA 3.5 (1.2 ) 1.7 (0.9) 3.1c (0.2)
MtSucS1 Symbiosis induced 2.9 (0.9) 1.8 (0.2) 6.5c (0.5)
Mtchit3-4 Symbiosis induced 1.7 (0.7) 1.6 (0.5) 3.7c (0.6)
MtSt1 Arbuscule induced 1.4 (0.4) 0.6 (0.2) 5.3c (0.6)
Pyruvate dehydrogenase E1 alpha subunit
1.2 (0.4) 0.4 (0.1) 2.4c (0.3)
Narbonin Symbiosis induced 1.1 (0.4) 1.6 (0.6) 7.4c (1.9)
Non-regulated genes
Malonyl Co-enzymeA 2.2 (0.9) 0.2 (0.1) 4.7 (1.2)
GH3 Auxin responsive 1.0 (0.5) 1.1 (0.4) 4.0 (1.1)
Mtchit5 Early nodulin 0.6 (0.2) 0.4 (0.1) 1.6 (0.7)
Mtchit3-1 Pathogen induced 0.4 (0.1) 0.1 (0.0) 1.0 (0.1)
Mtchit4 Pathogen induced 0.2 (0.1) 1.6 (0.7) 2.7 (0.8)
Fructokinase 0.3 (0.1) 0.1 (0.1) 0.8 (0.2)
a Expression pattern predicted from literature (Hohnjec et al. 2005; Harrison 1999; Salzer et al. 2000) and database searchesb Expression relative the non inoculated control, shown as a mean value of a minimum of Wve independent biological replicates, the standard error is shown in bracketsc SigniWcantly induced P < 0.05 (Mann–Whitney U test) compared to the non inoculated material
123
678 Planta (2008) 227:671–680
G. mosseae. This gene has previously been found to behighly induced in M. truncatula roots colonized byG. intraradices as well as G. mosseae (Hohnjec et al.2005). A possible explanation for the discrepancy betweenthese results and ours may be that root colonization needsto reach a certain threshold before this gene will be highlyinduced.
The induction of the genes in group 2 was only statisti-cally signiWcant in S. castanea colonized roots. This groupis more complex than the Wrst one. It is dominated by genesthat are known to be induced by symbiotic bacteria andfungi and contains MtSucS1 (Hohnjec et al. 1999; Hohnjecet al. 2003), narbonin (Hohnjec et al. 2005), Mtchit3-4(Salzer et al. 2000) and MtSt1 (Harrison 1996). Thesegenes are all known to be induced by AMF belonging toGlomus group A but are mainly AM-associated without adirect aYliation to intraradical structures, such as the nar-bonin gene. Some of the genes in this cluster are alsoinvolved in the plant cell metabolism and tissue organiza-tion, for instance a component of plants’ secondary metabo-lism is cinnamoyl co-enzyme A reductase (CCR), which
plays a key role in lignin production (Boerjan et al. 2003).After 10 weeks, our material had developed a more pro-gressed symbiotic stage than what is presented in mostother studies. The secondary metabolism changes as the tis-sue ages, consequently expression of genes associated withthe secondary metabolism are likely to change as well.Whereas Hohnjec and co-workers (2005) found the CCRgene to be down regulated after G. intraradices and G.mosseae colonization, we did not see any down regulation.This could be attributed to the diVerences in age and sec-ondary wall formation between our respective materials. Itis also possible that the induction we saw after S. castaneacolonization was a response to changes in the root metabo-lism caused by the presence of S. castanea.
A recent gene expression study on plants interactingwith AMF of diVerent taxonomic groups showed a partialoverlap in the gene expression patterns after colonization offungi of the Glomeraceae and Gigasporaceae (Liu et al.2007). However, up to now the number of studies investi-gating AM with non-Glomus fungi is limited and geneexpression patterns in cells harboring coils are poorly stud-ied compared to cells harboring arbuscules. Inconsistenciesbetween studies may depend on the choice of genes to ana-lyze. For instance, Massoumou et al. (2007) studied 14 can-didate genes, including several defense-related genes, aftercolonization of M. truncatula with AMF of the Glomera-ceae and the Gigasporaceae and did not observe similaritiesto our Wndings. This can be most likely attributed to thecomposition of the two sets of genes. Another possibleexplanation, although less likely, is that the intraradicalgrowth patterns of S. castanea diVered between our studies.It has indeed been reported that another member of theGigasporaceae, Gi. rosea, can form both the Arum-type(Burleigh et al. 2002) as well as the Paris-type AM (Smithet al. 2004) in M. truncatula. However, this remains a spec-ulation, as Massoumou et al. (2007) did not report the mor-phological status of their material. Our observation that S.castanea induced mycorrhiza-associated genes diVerentlycompared to species of the genus Glomus agrees withresults presented by Gao and co-workers (2004) where S.calospora was associated with a stronger induction ofdefense-related genes in tomato than G. intraradices. Whilethe latter forms the Arum-type AM within root cortex cells,S. calospora forms the Paris-type AM similar to the coloni-zation type that we have observed from S. castanea in M.truncatula (Fig. 1). This indicates that Arum- and Paris-forming AMF species inXuence plant gene expressiondiVerently and it is possibly related to diVerences in the col-onization process; AMF with an Arum-type of colonizationshow more intercellular growth while a Paris-type of AMis associated with intracellular growth and develops coilsand arbusculate coils in addition to arbuscules (Dickson2004).
Table 3 Correlation analysis of the selected mycorrhiza regulatedgenes to root colonization, shoot P and N contents in M. truncatularoots colonized by three diVerent AMF
SigniWcant correlation P < 0.05, Spearmans rank correlationcoeYcient
NS not signiWcant
Gene name Root colonization
Shoot phosphate content
Shoot nitrogen content
Group 1
MtGst1 0.0012 0.0001 NS
MtPt4 0.0001 0.0001 NS
MtBcp1 0.0010 0.0004 NS
Mtchit3-3 NS 0.0459 NS
Group 2
Cinnamyl Co-enzyme A NS NS 0.0278
MtSucS1 NS NS 0.001
MtChit3-4 NS 0.0211 NS
MtSt1 NS NS 0.0200
Pyruvate dehydrogenase E1 alpha subunit
NS NS NS
Narbonin NS NS 0.0161
Non-regulated genes
Malonyl Co-enzymeA NS NS NS
GH3 NS NS NS
Mtchit5 NS NS NS
Mtchit3-1 NS NS NS
Mtchit4 NS NS NS
Fructokinase NS NS NS
123
Planta (2008) 227:671–680 679
Together with an up to 4.5 times higher shoot biomass incolonized plants (Fig. 2a) there was an increased net con-tent of shoot P in these plants. However, the amount of Pper DW, representing the shoot P concentration, wasreduced in the colonized plants, due to an increased growthand dilution of the nutrients. The genes belonging to thearbuscule-induced group of genes generally showed signiW-cant correlations to the root colonization and to the shoot Pcontent but not to the root P content (data not shown). Theexpression of MtPt4 in AMF colonized roots is known to bemore inXuenced by the Pi status of the shoot than by theexternal or local Pi concentration in the root (Burleigh andHarrison, 1999). It is possible that this may be the case forall members of this cluster, since the total P uptake in allplants were signiWcantly higher than in the control roots butdid not diVer between the mycorrhizal plants. The relation-ship between gene expression and physiological parametersin the group 2 genes is less clear than among group 1. Theexpression of the majority of these genes was also related toimproved mineral nutrition and within this cluster the rela-tions to shoot N content were more pronounced than in thearbuscule-induced genes. This suggests that genes withinthe two groups may respond to diVerent physiological stim-uli. The morphological diVerences, e.g. the arbuscule fre-quencies, between the AM formed by the diVerent fungi islikely to explain, at least partly, the diVerences in expres-sion pattern between the two groups of genes. Takentogether with previously published data, our results suggestthat AM-induced or AM-associated genes are regulateddiVerentially in response to diVerent AMF species, indicat-ing that induction occurs by separate mechanisms and pos-sibly by diVerent signal transduction pathways. It alsosuggests that physiological parameters and colonizationmorphotypes both have an impact on mycorrhiza-relatedgene expression and that changes in any of the parameterscould inXuence the other. Therefore, more emphasis oncharacterization of the mycorrhizal material will berequired in future studies in order to align diVerent studies.
Acknowledgments We would like to thank Kurt Ineichen (Univer-sity of Basel, Basel, Switzerland) for maintaining and providing thefungal inoculum and Dr. Petra M. A. Fransson and Dr. Andrew F. S.Taylor (Swedish University of Agricultural Sciences, Department ofForest Mycology and Pathology, Uppsala, Sweden) for reading andcommenting on the manuscript. M.E. is Wnanced by a grant from theSwedish Research Council for Environment, Agricultural Sciences andSpatial Planning. Work at the University of Basel was supported bygrants of the Swiss National Science Foundation to T.B. and A.W.
References
Boerjan W, Ralph J, Baucher M (2003) Lignin biosynthesis. Annu RevPlant Biol 54:519–546
Bonanomi A, Wiemken A, Boller T, Salzer P (2001) Local inductionof a mycorrhiza-speciWc class III chitinase gene in cortical root
cells of Medicago truncatula containing developing or mature ar-buscules. Plant Biol 3:194–199
Broughton WJ, John CK (1979) Rhizobia in tropical legumes III.Experimentation and supply in Malaysia 1927–1976. In: Brough-ton WJ, John CK, Lim B, Rajova C (eds) Soil microbiology andplant nutrition, University of Malaysia, Kuala Lumpur pp 113–136
Burleigh SH, Harrison MJ (1999) The down-regulation of Mt4-likegenes by phosphate fertilization occurs systemically and involvesphosphate translocation to the shoots. Plant Physiol 119:241–248
Burleigh SH, Cavagnaro T, Jakobsen I (2002) Functional diversity ofarbuscular mycorrhizas extends to the expression of plant genesinvolved in P nutrition. J Exp Bot 53:1593–1601
Chiou TJ, Liu H, Harrison MJ (2001) The spatial expression patternsof a phosphate transporter (MtPT1) from Medicago truncatulaindicate a role in phosphate transport at the root/soil interface.Plant J 25:281–293
Dickson S (2004) The Arum-Paris continuum of mycorrhizal symbio-ses. New Phytol 163:187–200
Elfstrand M, Feddermann N, Ineichen K, Nagaraj VJ, Wiemken A,Boller T, Salzer P (2005) Ectopic expression of the mycorrhiza-speciWc chitinase gene Mtchit3–3 in Medicago truncatula root-or-gan cultures stimulates spore germination of glomalean fungi.New Phytol 167:557–570
Gao LL, Delp G, Smith SE (2001) Colonization patterns in a mycor-rhiza-defective mutant tomato vary with diVerent arbuscular-mycorrhizal fungi. New Phytol 151:477–491
Gao LL, Knogge W, Delp G, Smith FA, Smith SE (2004) Expressionpatterns of defense-related genes in diVerent types of arbuscularmycorrhizal development in wild-type and mycorrhiza-defectivemutant tomato. Mol Plant Microbe Interact 17:1103–1113
Giovannetti M, Mosse B (1980) An evaluation of techniques for mea-suring vesicular arbuscular mycorrhizal infection in roots. NewPhytol 84:489–500
Grunwald U, Nyamsuren O, Tarnasloukht M, Lapopin L, Becker A,Mann P, Gianinazzi-Pearson V, Krajinski F, Franken P (2004)IdentiWcation of mycorrhiza-regulated genes with arbuscule devel-opment-related expression proWle. Plant Mol Biol 55:553–566
Harrison MJ (1996) A sugar transporter from Medicago truncatula:Altered expression pattern in roots during vesicular-arbuscular(VA) mycorrhizal associations. Plant J 9:491–503
Harrison MJ (1999) Molecular and cellular aspects of the arbuscularmycorrhizal symbiosis. Annu Rev Plant Physiol Plant Mol Biol50:361–389
Harrison MJ, Dewbre GR, Liu JY (2002) A phosphate transporter fromMedicago truncatula involved in the acquisiton of phosphate re-leased by arbuscular mycorrhizal fungi. Plant Cell 14:2413–2429
Hart MM, Reader RJ (2002) Host plant beneWt from association witharbuscular mycorrhizal fungi: variation due to diVerences in sizeof mycelium. Biol Fertil Soils 36:357–366
Hohnjec N, Becker JD, Pühler A, Perlick AM, Küster H (1999) Geno-mic organization and expression properties of the MtSucS1 gene,which encodes a nodule-enhanced sucrose synthase in the modellegume Medicago truncatula. Mol Gen Genet 261:514–522
Hohnjec N, Perlick AM, Pühler A, Küster H (2003) The Medicagotruncatula sucrose synthase gene MtSucS1 is activated both in theinfected region of root nodules and in the cortex of roots colo-nized by arbuscular mycorrhizal fungi. Mol Plant Microbe Inter-act 16:903–915
Hohnjec N, Vieweg ME, Pühler A, Becker A, Küster H (2005) Over-laps in the transcriptional proWles of Medicago truncatula rootsinoculated with two diVerent Glomus fungi provide insights intothe genetic program activated during arbuscular mycorrhiza.Plant Physiol 137:1283–1301
Karandashov V, Nagy R, Wegmüller S, Amrhein N, Bucher M (2004)Evolutionary conservation of a phosphate transporter in the arbuscu-lar mycorrhizal symbiosis. Proc Natl Acad Sci USA 101:6285–6290
123
680 Planta (2008) 227:671–680
Küster H, Hohnjec N, Krajinski F, El Yahyaoui F, Manthey K, GouzyJ, Dondrup M, Meyer F, Kalinowski J, Brechenmacher L, vanTuinen D, Gianinazzi-Pearson V, Pühler A, Gamas P, Becker A(2004) Construction and validation of cDNA-based Mt6k-RITmacro- and microarrays to explore root endosymbioses in themodel legume Medicago truncatula. J Biotechnol 108:95–113
Liu JY, Blaylock LA, Endre G, Cho J, Town CD, VandenBosch KA,Harrison MJ (2003) Transcript proWling coupled with spatialexpression analyses reveals genes involved in distinct develop-mental stages of an arbuscular mycorrhizal symbiosis. Plant Cell15:2106–2123
Liu J, Maldonado-Mendoza I, Lopez-Meyer M, Cheung F, Town CD,Harrison MJ (2007) Arbuscular mycorrhizal symbiosis is accom-panied by local and systemic alterations in gene expression and anincrease in disease resistance in the shoots. Plant J 50:529–544
Massoumou M, van Tuinen D, Chatagnier O, Arnould C, Brechenm-acher L, Sanchez L, Selim S, Gianinazzi S, Gianinazzi-Pearson V(2007) Medicago truncatula gene responses speciWc to arbuscularmycorrhiza interactions with diVerent species and genera ofGlomeromycota. Mycorrhiza 17:223–234
Munkvold L, Kjoller R, Vestberg M, Rosendahl S, Jakobsen I (2004)High functional diversity within species of arbuscular mycorrhi-zal fungi. New Phytol 164:357–364
Oehl F, Sieverding E, Ineichen K, Mäder P, Boller T, Wiemken A(2003) Impact of land use intensity on the species diversity of ar-buscular mycorrhizal fungi in agroecosystems of Central Europe.Appl Environ Microbiol 69:2816–2824
Ohnishi ST, Gall RS (1978) Characterization of the catalyzed phos-phate assay. Anal Biochem 88:347–356
Phillips JM, Hayman DS (1970) Improved procedures for clearingroots and staining parasitic and vesicular-arbuscular mycorrhizal
fungi for rapid assessment of infection. Trans Br Mycol Soc55:158–161
Redecker D (2002) Molecular identiWcation and phylogeny of arbus-cular mycorrhizal fungi. Plant Soil 244:67–73
Salzer P, Bonanomi A, Beyer K, Vögeli-Lange R, Aeschbacher RA,Lange J, Wiemken A, Kim D, Cook DR, Boller T (2000) DiVer-ential expression of eight chitinase genes in Medicago truncatularoots during mycorrhiza formation, nodulation, and pathogeninfection. Mol Plant Microbe Interact 13:763–777
Salzer P, Feddermann N, Wiemken A, Boller T, Staehelin C (2004)Sinorhizobium meliloti-induced chitinase gene expression inMedicago truncatula ecotype R108-1: a comparison betweensymbiosis-speciWc class V and defence-related class IV chitinas-es. Planta 219:626–638
Schüssler A, Schwarzott D, Walker C (2001) A new fungal phylum,the Glomeromycota: phylogeny and evolution. Mycol Res105:1413–1421
Smith SA, Read DJ (1997) Mycorrhizal symbiosis. Academic, San Di-ego
Smith SE, Smith FA, Jakobsen I (2004) Functional diversity in arbus-cular mycorrhizal (AM) symbioses: the contribution of themycorrhizal P uptake pathway is not correlated with mycorrhizalresponses in growth and total P uptake. New Phytol 162:511–524
Watanabe FS, Olsen RS (1965) Test of an ascorbic acid method fordetermining phosphorus in water and NaHCO3 extracts from soil.Soil Sci Soc of Am Proc 29:677–678
Wulf A, Manthey K, Doll J, Perlick AM, Linke B, Bekel T, Meyer F,Franken P, Küster H, Krajinski F (2003) Transcriptional changesin response to arbuscular mycorrhiza development in the modelplant Medicago truncatula. Mol Plant Microbe Interact 16:306–314
123