sintesis proteica código genético y traducción sintesis de

of 10/10
1 SINTESIS PROTEICA SINTESIS PROTEICA código genético y traducción código genético y traducción Código Genético Características del Código Genético Síntesis proteica El mecanismo de la traducción Antibióticos y traducción 2 SINTESIS DE PROTEINAS SINTESIS DE PROTEINAS El orden de los aminoácidos en la cadena proteica (secuencia) está determinado por la secuencia (orden) de nucleótidos El orden de los aminoácidos en la cadena proteica (secuencia) determina la función de la nueva proteína Es necesario un código bilingüe para pasar la información de la secuencia de bases a aminoácidos (código genético) La síntesis proteica ocurre de modo semejante en todas las células Tres tipos de RNA desempeñan un papel cooperativo mRNA transportador de la información rRNA asociado a proteínas forma el ribosoma tRNA portadores de aminoácidos, lectores del mensaje 3 Reglas de síntesis de moléculas informativas Reglas de síntesis de moléculas informativas Acidos nucleicos y proteínas Formados por un número limitado de subunidades Las unidades son agregadas secuencialmente formando cadenas lineales Cada cadena tiene un punto de inicio, avanza en una única dirección y tiene un punto de finalización Los productos de la síntesis primaria son modificados previamente a cumplir su función 4 Elementos fundamentales a resolver en la síntesis proteica 1. Pasaje de la información 2. El mecanismo enzimático Información (ADN) 4 bases Efector (proteína) 20 Aminoácidos Grupos de bases pueden simbolizar cada aminoácido Intermediario (ARN) 4 bases El problema de la información El problema de la información

Post on 02-Oct-2021

5 views

Category:

Documents

0 download

Embed Size (px)

TRANSCRIPT

Microsoft PowerPoint - C6_05-Traduccion.pptCódigo Genético
Antibióticos y traducción
SINTESIS DE PROTEINASSINTESIS DE PROTEINAS
El orden de los aminoácidos en la cadena proteica (secuencia) está determinado por la secuencia (orden) de nucleótidos
El orden de los aminoácidos en la cadena proteica (secuencia) determina la función de la nueva proteína
Es necesario un código bilingüe para pasar la información de la secuencia de bases a aminoácidos (código genético)
La síntesis proteica ocurre de modo semejante en todas las células
Tres tipos de RNA desempeñan un papel cooperativo
mRNA transportador de la información rRNA asociado a proteínas forma el
ribosoma tRNA portadores de aminoácidos, lectores
del mensaje
Reglas de síntesis de moléculas informativasReglas de síntesis de moléculas informativas
Acidos nucleicos y proteínas
Las unidades son agregadas secuencialmente formando cadenas lineales
Cada cadena tiene un punto de inicio, avanza en una única dirección y tiene un punto de finalización
Los productos de la síntesis primaria son modificados previamente a cumplir su función
4
1. Pasaje de la información 2. El mecanismo enzimático
Información
(ADN)
Intermediario
(ARN)
5
Hay 4 bases en el ARN (U, C, A, G) y deben especificar 20 aminoácidos.
Cuantas bases = 1
Un código en dobletes especifica 4X4 =16 Aas.
Un código en tripletes especifica 4 x 4 x 4 = 64 Aas.
1 Base? 2 Bases? 3 Bases? 4 Bases?...
4 < 20: No alcanza
1 2 3 4 1 2 3 4
5 6 7 8
9 10 11 12
13 14 15 16
1 2 3 4
5 6 7 8
9 10 11 12
13 14 15 etc...
U GC A U
U
G
C
A
U
G
C
A
U
G
C
A
U
C
A
mRNAG C CA C CG AGA A AA AA A AA AU U U U U U U U UC CC CC CC C
CC C CGG G G G G
G
G
El problema del pasaje de información El problema del pasaje de información
6
19681968
Marshal Marshal NirenbergNirenberg..
El código genético El código genético
7
8
El código genético no es solapado pero puede leerse en tres marcos diferentes de lectura
Sólo uno de estos marcos es el correcto para dar lugar a una proteína dada
Marcos de lecturaMarcos de lectura
9
10
• No ambiguo (cada codón especifica sólo un aminoácido)
• Redundante (distintos codones para un aminoácido)
existen codones sinónimos
familias de codones:
Degenerado (codones sinónimos pueden ser leídos por un mismo anticodón)
11
Reconocimiento Reconocimiento codóncodón--anticodónanticodón
12
Apareamientos de base no standard ocurren entre la tercera posición del codón y la primera del anticodón
El balanceoEl balanceo
13
Cambios en una secuencia de ADN Cambios en una secuencia de ADN que codifica para una proteína... que codifica para una proteína...
......CCGCGTCAGACCGAAATTAACGCGCCGCGTCAGACCGAAATTAACGCG......
CCGCGUCAGACCGAAAUUAACGCGCCGCGUCAGACCGAAAUUAACGCG
P R Q T E I N AP R Q T E I N A
14
......CCGCGTCAGACCGACCGCGTCAGACCGAGGATTAACGCGATTAACGCG......
CCGCGUCAGACCGACCGCGUCAGACCGAGGAUUAACGCGAUUAACGCG
P R Q T E I N AP R Q T E I N A
15
......CCGCGTCAGACCGCCGCGTCAGACCGCCAATTAACGCGAATTAACGCG......
CCGCGUCAGACCGCCGCGUCAGACCGCCAAUUAACGCGAAUUAACGCG
P R Q T P R Q T AA I N AI N A
Tienen diferentes efectos: Tienen diferentes efectos: 2. cambio de sentido2. cambio de sentido
16
......CCGCGTCAGACCCCGCGTCAGACCTTAAATTAACGCGAAATTAACGCG......
CCGCGUCAGACCCCGCGUCAGACCUUAAAUUAACGCGAAAUUAACGCG
Tienen diferentes efectos: Tienen diferentes efectos: 3. sin sentido3. sin sentido
17
Tienen diferentes efectos: Tienen diferentes efectos: 4. Inserción y corrimiento del marco de lectura4. Inserción y corrimiento del marco de lectura
......CCGCGTCAGACCGAACCGCGTCAGACCGAAAATTTTAAAACGCGAACGCG......
CCGCGUCAGACCGAACCGCGUCAGACCGAAAAUUUUAAAACGCGAACGCG
P R Q T E I P R Q T E I K RK R
18
Tienen diferentes efectos: Tienen diferentes efectos: 5. 5. DelecciónDelección y corrimiento del marco de lecturay corrimiento del marco de lectura
......CCGCGTCAGACCGAACCGCGTCAGACCGAAAATTACGCGTTACGCG......
CCGCGUCAGACCGAACCGCGUCAGACCGAAAAUUACGCGUUACGCG
P R Q T E I P R Q T E I T RT R
AAA
19
La traducción es un proceso de decodificación La traducción es un proceso de decodificación en dos pasos: en dos pasos: 1 Cargado de los 1 Cargado de los ARNtARNt
20
La traducción es un proceso de decodificación La traducción es un proceso de decodificación en dos pasos: en dos pasos: 2 Reconocimiento 2 Reconocimiento codóncodón--anticodónanticodón
21
anticodón
brazo aceptor
• Estas enzimas reconocen el Aa correcto y el ARNt correcto
GLn-tRNA Aminoacil-tRNA-sintetasa
(tipo I)
Requerimientos
Cargado de los Cargado de los ARNtARNt
23
Requerimientos
Requerimientos
Cargado de los Cargado de los ARNtARNt
Reacción en dos pasos:
1. La enzima une al Aa consumiendo 1 ATP
2. La enzima une al ARNt y le transfiere el Aa
24
Ribosomas
Plataforma donde se realiza la síntesis proteica
Subunidad mayor: 3 ARNr y 49 proteínas Subunidad menor: 1 ARNr y 33 proteínas
25
26
Ribosoma de T.termophilus
Iniciación Iniciación traduccionaltraduccional procariotasprocariotas
Reunir los elementos necesarios Reconocer el sitio de inicio (AUG) Proveer sitios para que se inicie la elongación
28
29
•Requerimientos
mRNA tRNA met codón de iniciación 2 subunidades ribosomales Factores de iniciación (IF-1, IF-2, IF-3) GTP, Mg 2+
•Requerimientos
mRNA tRNA met codón de iniciación 2 subunidades ribosomales Factores de iniciación (IF-1, IF-2, IF-3) GTP, Mg 2+
30
Ribosoma completo (complejo de iniciacion) Aa-tRNAs especificados por cada codon Factores de elongacion (EF-Tu, EF-Ts, EF-G) Actividad peptidil-transferasa (23s) GTP, Mg 2+
Requerimientos
Ribosoma completo (complejo de iniciacion) Aa-tRNAs especificados por cada codon Factores de elongacion (EF-Tu, EF-Ts, EF-G) Actividad peptidil-transferasa (23s) GTP, Mg 2+
•Agregado secuencial de Aa por una actividad peptidil transferasa •Traslocación
Durante la elongación cada Aa-tRNA pasa por tres sitios en enl ribosoma
32
La elongación eucariota es similar La elongación eucariota es similar a la bacterianaa la bacteriana
33
• Reacción central de la síntesis proteica • La actividad peptidil-transferasa está en
el rRNA 23S • El centro catalítico es altamente
conservado • La traslocación ocurre luego de la
formación del enlace peptídico
34
Requerimientos
codón de terminación factores de liberación (RF 1 , RF 2 , RF 3 ) ATP
Requerimientos
codón de terminación factores de liberación (RF 1 , RF 2 , RF 3 ) ATP
TerminaciónTerminación
• Proceso similar en procariotas y eucariotas
• Depende de factores que reconocen codón stop y de hidrólisis de peptidil-tRNA
35
Acoplamiento TranscripciónAcoplamiento Transcripción--traducción en procariotastraducción en procariotas
La traducción en bacterias se inicia sobre transcriptos que aun no terminaron su síntesis. Esta coordinación entre ambos procesos permite una regulación más precisa de la síntesis proteica bacteriana
36
La traducción simultánea por múltiples ribosomas y su rápido reciclado incrementa la eficiencia de la síntesis proteica.
PoliribosomasPoliribosomas
37
38
entre ribosomas procariotas y eucariotas
• Actúan a diferente nivel en la síntesis proteica
Inhibidores de la iniciación
Unión irreversible a rRNA16S, bloqueo en complejo 30S- mRNA-tRNA
Antibióticos y síntesis proteicaAntibióticos y síntesis proteica
InhibidoresInhibidores de la de la ElongaciónElongación Tetraciclinas: tetraciclina, minociclina
Unión reversible a la subunidad 30S, inhibe la unión del Aa-tRNA
Cloramfenicol: Unión a subunidad 50s, inhibe la actividad peptidi transferasa.
Macrolidas: eritromicina, claritromicina
Inhibe la translocación.
40
El El PapelPapel de la de la hidrólisishidrólisis de GTP de GTP
• se hidrolizan 2GTPs por cada aminoácido incorporado
• La hidrólisis promueve cambios conformacionales esenciales
• Se gastan 4 enlaces fosfato de alta energía por aminoácido incorporado:
CARGADO del ARNt-Aa con su aminoácido 1ATP (2 enlaces) / Aa 2N
TRADUCCION a. Iniciación 1GTP 1 b. Elongación 2 GTP / Aa 2(N-1) c. Terminación 1 GTP 1
____ Gasto Total: 4 N *