LoCloud Micro Services and the Digitisation Workflow

Download LoCloud Micro Services and the Digitisation Workflow

Post on 15-Apr-2017

593 views

Category:

Internet

0 download

TRANSCRIPT

  • XIIth Annual International Conference for Professionals in Cultural HeritageLoCloud Micro Services and the Digitisation Workflow

    Walter Koch (kochw@ait.co.at)AIT-Angewandte Informationstechnik Forschungs GmbH, Graz - AustriaLoCloud is funded by the European Commission's ICT Policy Support Programme

    62.bin

  • 2015-11-08Walter Koch (AIT)*Content

    LoCloud Project (relevant activities)Vocabulary MicroserviceMicroservice used in the OpenUp! ProjectDigitisation Workflow (Books)Digital Curation (Long Term Preservation)

    Walter Koch (AIT)

  • LoCloud Project(relevant activities)2015-11-08Walter Koch (AIT)*

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*locoud.euAbout:LoCloud is a Best Practice Network co-funded under the CIP ICT-PSP programme of the European Commission. LoCloud is supporting small and medium-sized institutions in making their content and metadataavailable to Europeana.Acloud-based technology infrastructure will enablethe aggregation oflocal content, anda number of micro-serviceswill help to reduce technical, semantic and skills barriers and to renderthe content more discoverable and interoperable.

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*Microservices

    Six development teams: AIT, Athena RC, AVINET, IPCHS, UPV/EHU, VUKFCAll the services are implemented on virtual machines in a cloud testlab (using the OpenNebula cloud computing platform) API documentation is available for each serviceEnd-user interfaces are provided for three microservicesEach service has been integrated in MORe

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*LoCloud Microservices

    http://support.locloud.eu/ Cloud-based micro-services for metadata enrichment and capture: Geo-location APIVocabulary serviceHistoric Place Names serviceGeo-coding applicationVocabulary matching service Background linking serviceWikimedia application

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*LoGeo API

    Uses NER-Name Entity RecognitionRecognizes and returns one or more place names candidates accompanied by geographical coordinates.

    GPLIPCHS

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*Vocabulary service

    Based on TemaTresIncorporates 29 standard thesauri allows users to add and create vocabularies, and add terms or translationsadd thesauri terms to all items of a metadata packageIntegrated in MOREExploited by the LoCloud vocabulary matching microservice via its API

    GPLAIT

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*Historic Place Names service

    A semi-automatic historical geo-information management function and web service. Enables local cultural institutions to collaborate in developing the Thesaurus of HPN and enriching ingested metadata.Enables export of selected LoCloud HPN Thesaurus data sets.

    GPLVUKF

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*Geo-coding application

    End-user oriented applicationallows institutions to add geographical locations to existing content in a controlled crowd-sourcing environment and then load the augmented data back into their original production databases.

    GPLAVINET

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*Vocabulary matching service

    Builds on work in the PATHS project (FP7)Automatically assigns relevant concepts and terms to item records Retrieves terms from the Vocabulary service

    UPV/EHUApache License 2.0

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*Background linking service

    Based on work in PATHSFollows the Named Entity Disambiguation approachEnriches items with links to external contextual information in DBpedia and Wikipedia

    Apache License 2.0UPV/EHU

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*Wikimedia application

    A web service that uses a REST interface to communicate with Wikimedia commons The main functionalities are harvesting content form Wikimedia, parsing the harvested content, and identifying useful entities that can be mapped to the ESE or EDM metadata schemas. The mapped ESE / EDM records are then sent to MORe to be delivered to Europeana.

    Wikimedia Commons LicensingAthena RC

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*The LoCloudAggregation Structure

    EnrichmentServicesEuropeana Cloud

    Testlab

    Walter Koch (AIT)

    67.bin

  • 2015-11-08Walter Koch (AIT)*About: MicroserviceWikipedia: https://en.wikipedia.org/wiki/Microservices (2015-09-15)[...] microservices is a software architecture style in which complex applications are composed of small, independent processes communicating with each other using language-agnostic APIs. These services are small, highly decoupled and focus on doing a small task,facilitating a modular approach to system-building.

    Walter Koch (AIT)

    71.bin

  • 2015-11-08Walter Koch (AIT)*Evolution of Architecturespwc: Technology Forecast: Rethinking Integration, Issue 1, 2014, page 3

    Walter Koch (AIT)

    72.bin

    *

  • Vocabulary Microservice2015-11-08Walter Koch (AIT)*

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*http://vocabulary.locloud.eu/Vocabulary Microservices This is the entry page for the LoCloud vocabulary application. LoCloud uses a variety of standard vocabularies during the metadata enrichment process.These vocabularies have been established with the TemaTres tool and are available in the LoCloud cloud testlab.In addition, it is possible to feed the tool with your own vocabularies, establish new vocabularies or add languages to existing vocabularies.

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*Vocabulary WebService20+ Functions, APIParametersExample

    Walter Koch (AIT)

    76.bin

  • 2015-11-08Walter Koch (AIT)*Example: SearchUNESCO-Thesaurushttp://test113.ait.co.at/tematres/unesco/services.php?task=search&arg=peace

    Walter Koch (AIT)

    80.bin

  • 2015-11-08Walter Koch (AIT)*SPARQL-ExampleDISMARC-GenresQuery: "Find all Broader Term for 'Acid JazzSPARQL End Point: http://test113.ait.co.at/tematres/vocab/sparql.php

    QueryResult

    ThesaurusEntry

    Walter Koch (AIT)

    86.bin

    87.bin

    88.bin

  • 2015-11-08Walter Koch (AIT)*Service Call (fetchTopTerms)embedded in a test applicationMicro- ServiceVocabulary Web Service

    Walter Koch (AIT)

    89.bin

  • 2015-11-08Walter Koch (AIT)*Test Application DevelopmentDesigner ViewDevelopment of a Drop Down ListDevelopment of a Drop Down List

    Walter Koch (AIT)

    90.bin

  • 2015-11-08Walter Koch (AIT)*The Test Application:Part of Data EntryPath to the Thesaurus ItemCandidate Term Crowdsourcing activity Next Slide(Vocabulary Management)

    Walter Koch (AIT)

    91.bin

  • Microservice used in the OpenUp! Project (open-up.eu)Common Name Service2015-11-08Walter Koch (AIT)*

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*OpenUp! - Natural HistoryAggregator for EuropeanaMicro Service:Common Name ServiceMicro Service:Common Name Service

    Walter Koch (AIT)

    92.bin

  • 2015-11-08Walter Koch (AIT)*OpenUp!Transformation WorkflowInvoke Micro Service:Common Name Service

    Next Slide

    Walter Koch (AIT)

    93.txtJ`yWB?:B?:B?:B?:B?:B?:B?:B?::72VSNFC>=:5974/C@;NKF:722/*IFAC@;C@;@=8?:@>:@>=?:7>:7=96=96:7=96=9695>95>95>95@93::::::::::::;:8;:8;:8=96=96=96>95>95>95>95>95@939;89;89;89;89;89;89;89;89;89;89;89;89;89;89;89;8?;8?;8?;8?;8?;8?;8?;8?;8=96=96=96=96=96=96=96=96::::::;:8;:8=96>95>95@93B;5@;7@;7?;8=EA>EA>EA>EA>EA>EA@EA@EA@EA@EA@EA@EA@EA@EA@EA@EA@EA@EA@EA@EA@EA@J?=J?=H@>FA>CB@AC@?D@>DB>DB?D@AC@CB@FA>H@>J?=J?=GC@GC@GC@GC@GC@GC@GC@GC@D@=D@=EA>FB?GC@HDAIEBIEBFB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FBAFBAFBAFBAFBAFBAFBAFBAFBAFBAFBAFBAFBAFBAFBAFBAD@=D@=EA>FB?GC@HDAIEBIEBFB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?CCCDCADCADCADCADCADCAFB?FB?FB?FB?GB>GB>GB>GB>GB>CCCDCADCADCADCADCADCAFB?FB?FB?FB?GB>GB>GB>GB>GB>CCACCACCACCACCACCACCACCACCACCACCACCACCACCACCACCAGC@GC@GC@GC@GC@GC@GC@GC@FB?FB?FB?FB?FB?FB?FB?FB?CCCDCADCADCAFB?FB?GB>GB>HC?HC?GC@GC@EDBEDBEDBDDDDE@DE@DE@DE@DE@DE@DE@DE@DE@DE@DE@DE@DE@DE@DE@DE@JC;HD;HD;GD=ED?DE@DDBCEBCEDAEDAEDAEDAEDCEDCEDCEBNF;NEJG@GFADE@BDA>BAAEDCEBDE@FE@JG@MF>KB9IA6GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@FB?=96A=:NJGOKHD@=B>;KGDGC@GC@GC@GD?GD?GD?GD?GD?HE>HE>HE>HE>HE>HEEA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>JFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBH>=G?=BA:7EA>EA>EA>EA>EA>EA>EA>EA>A>9A>9@=8?9EB=C@;A>9?EA>EA>EA>FB?FB?FB?EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>D@=EA>EA>EA>EA>FB?FB?FB?B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;@?=@?=@?=@?=@?=@?=B>;B>;B>;B>;B>;B>;B>;B>;C>:C>:@?=@?=@?=@?=@?=@?=B>;B>;B>;B>;B>;B>;B>;B>;C>:C>:?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;@?=@?=@?=B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;@?=@?=@?=?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;?@;C?6C?6C>8B?8@?:@?:?@;??=>@=>@?;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;@;B?:B?:B?:B?:B?:B?:B?:B?:C@9C@9C@9C@9C@9C@9C@9C@9C?EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>C?;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>EA>FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=D@=JB?HC?GD?CF?AF?>H@>H@>H@@FBCEBDDBECDGCDGCDGCDGCD+;./?25E8;H>PL=PHDAFB?FB?IEBOKHRNKQMJNJGFB?FB?FB?FB?FB?FB?FB?FB?EB=FC>HE@KHCLIDMJELIDLIDNKFMJEKHCHE@FC>DAEA>GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@IEBIEBHDAHDAGC@FB?EA>EA>JFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCGHCJG@JG@JG@JG@JGBHGBHGBGHCGHCFHEFHEDHGDHGDHGDHICIIJB7KB9KDHE>MF>OF=PH=JFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCTPMQMJB>;A=:OKHQMJFB?JGBJGBJGBJGBJGBJGBJGBJGBIF?IF?IF?IF?IF?IF?IF?IF?IEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDKGDHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCGC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@IEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBIEBGC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@JC=HC=GD?ED?CE@@FB>GD=GFACL9AJ7@G5AE6CE8GG=MHBPKHI@CJ?GJ>HJ>LI>OI=QI=SI=SKGDB>;95251.841;74;74952D@=D@=D@=D@=D@=D@=D@=D@=IFAGD?EB=A>9>;6;8396185063.:72A>9GD?JGBIFAFC>DA?:>?:>?:>?:>?:>?:>?:>?:>?:>?:>?:>?:>?:>?:>?:>?:A>9A>9A>9A>9A>9A>9?>9?>9?>:>?:=?;?>:@@:@@:?BF>3E>BA8?:=:7FB?C?;C?7A>7A>7A>7A>7A>7A>7A>7@=8@=8@=8@=8@=8@=8@=8@=8@;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;C?;B>;B>;B>;B>;B>;B>;B>;B>;A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:@;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;B>;@EA>EA>EA>HDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAFB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?FB?GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@GC@HDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDAHDALHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHELHEJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCJFCA=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:A=:C?X#vlc. -+(%e]c\xiv&&&&+v%`Z"z2{,m=]>,w$3ccf,jwv#2,`n}n}yC

  • 2015-11-08Walter Koch (AIT)*OpenUp!Transformation ParametersMicro Service:Common Name ServiceService End Point (Cache)

    Walter Koch (AIT)

    94.txt`yJGHC@B=PRMA?3USG:8,9GD?mjeQNI[XS]ZUQNIC@;A>9JGBROJJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGBJGB89$% HIDAC>/1,JH.E4z{RL|eg|C;nifiXde`;:?tqSQ_zXTbuZk]pcjbJJYUl=9PTR_uC>>RRREEE;;;DDDCCCyyy>>>:::]]]{{{KKK111:::===JJJcccccc;;;111bbbqqquuuaaawwwiiiJJJ111KKK000666bbbyyysssrrrnnnEEE***===LLLhhhkkkvvvzzzHHHzzzmmmmmm}}}CCC:::

  • 2015-11-08Walter Koch (AIT)*Result: OpenUp!Enriched Meta Data SetLatin NameCommon Names

    Walter Koch (AIT)

    95.bin

  • Digitisation Workflow(Books)2015-11-08Walter Koch (AIT)*

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*Bibliotheca Alexandrina

    http://www.bibalex.org Points for MicroService Integration

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*Digital Curation(Long Term Preservation)

    Walter Koch (AIT)

  • 2015-11-08Walter Koch (AIT)*Digital CurationState-of-the-Art Examples (2010)Archivematica

    Linux VM based toolset allows producers and archivists to implement a small scale workflow

    UC3 / CDL Merritt

    Micro-Services specifications implement building blocks for the Digital Curation Lifecycle

    Walter Koch (AIT)

    100.bin

  • 2015-11-08Walter Koch (AIT)*ArchivmaticaMicro ServicesLinux ToolsuiteMicro-Services Categories of Micro-Services

    Walter Koch (AIT)

    101.bin

  • 2015-11-08Walter Koch (AIT)*California Digital LibraryUC3 MerrittCalifornia Digital Library UC Curation CenterIndependant, Interoperable Micro-ServicesComplex curation function through combination of atomistic services

    UC3 Model PhasesMicro-Services Annotation

    Walter Koch (AIT)

    102.bin

  • 2015-11-08Walter Koch (AIT)*Micro-Services(Merritt vs. Archivematica)

    Micro-Services for Pre-Ingest

    Walter Koch (AIT)

    103.bin

  • 2015-11-08Walter Koch (AIT)*High-Level WorkflowOAIS activities providea sound basisArchivematica Use CasesMerritt specificationsMicro-Services are thebuilding blocks

    ProducerOAIS ActivityArchivistMicro-Services

    Walter Koch (AIT)

    104.bin

  • 2015-11-08Walter Koch (AIT)*CDLCuration Micro ServicesAn Emergent Micro-Services Approach to Digital Curation Infrastructure, IPRES 2009https://escholarship.org/uc/item/5313h6k9 UC Curation Center / California Digital Library, merritt: An Emergent Micro-services Approach to Digital Curation Infrastructure; Rev. 0.6, 2010-03-25

    1)Annotation service 2)The Annotation service provides a mechanism by which the consumers of managed digital content can enrich that content through additional description, association, or related content. The service supports the following methods: Annotate Submit.

    Walter Koch (AIT)

    107.bin

    110.bin

  • 2015-11-08Walter Koch (AIT)*Contact

    Walter Koch, kochw@ait.co.at

    http://www.ait.co.at

    Walter Koch (AIT)

    *

Recommended

View more >