$FFHSWHG�0DQXVFULSW

3URWR]RDQ�*UD]LQJ�5HGXFHV�WKH�&XUUHQW�2XWSXW�RI�0LFURELDO�)XHO�&HOOV

'DZQ�(��+ROPHV��.HOO\�3��1HYLQ��2RQD�/��6QRH\HQERV�:HVW��7UHYRU�/�:RRGDUG��-XVWLQ�1��6WULFNODQG��'HUHN�5��/RYOH\

3,,� 6��������������������'2,� KWWS���G[�GRL�RUJ���������M�ELRUWHFK������������5HIHUHQFH� %,7(������

7R�DSSHDU�LQ� Bioresource Technology

5HFHLYHG�'DWH� ���$SULO�����5HYLVHG�'DWH� ��-XQH�����$FFHSWHG�'DWH� ���-XQH�����

3OHDVH�FLWH�WKLV�DUWLFOH�DV��+ROPHV��'�(���1HYLQ��.�3���6QRH\HQERV�:HVW��2�/���:RRGDUG��7�/���6WULFNODQG��-�1��/RYOH\��'�5���3URWR]RDQ�*UD]LQJ�5HGXFHV�WKH�&XUUHQW�2XWSXW�RI�0LFURELDO�)XHO�&HOOV��Bioresource Technology��������GRL��KWWS���G[�GRL�RUJ���������M�ELRUWHFK������������

7KLV�LV�D�3')�ILOH�RI�DQ�XQHGLWHG�PDQXVFULSW�WKDW�KDV�EHHQ�DFFHSWHG�IRU�SXEOLFDWLRQ��$V�D�VHUYLFH�WR�RXU�FXVWRPHUVZH�DUH�SURYLGLQJ�WKLV�HDUO\�YHUVLRQ�RI�WKH�PDQXVFULSW��7KH�PDQXVFULSW�ZLOO�XQGHUJR�FRS\HGLWLQJ��W\SHVHWWLQJ��DQGUHYLHZ�RI�WKH�UHVXOWLQJ�SURRI�EHIRUH�LW�LV�SXEOLVKHG�LQ�LWV�ILQDO�IRUP��3OHDVH�QRWH�WKDW�GXULQJ�WKH�SURGXFWLRQ�SURFHVVHUURUV�PD\�EH�GLVFRYHUHG�ZKLFK�FRXOG�DIIHFW�WKH�FRQWHQW��DQG�DOO�OHJDO�GLVFODLPHUV�WKDW�DSSO\�WR�WKH�MRXUQDO�SHUWDLQ�

Protozoan Grazing Reduces the Current Output of Microbial Fuel Cells

Dawn E. Holmes1,2*, Kelly P. Nevin1, Oona L. Snoeyenbos-West1, Trevor L. Woodard1,

Justin N. Strickland1, and Derek R. Lovley1

1Department of Microbiology, University of Massachusetts, Amherst, MA

2Department of Physical and Biological Sciences, Western New England University,

Springfield, MA

Keywords: sediment fuel cell, anaerobic protozoa, Geobacteraceae

Running Title: Grazing of anode biofilms by anaerobic protozoa

* Corresponding author:

Dawn E. Holmes

Department of Microbiology

203N Morrill Science Center IVN,

University of Massachusetts Amherst; Amherst, MA 01003

TEL: 413 577-2439, FAX: 413 577-4660

Email: dholmes@microbio.umass.edu

Abstract

Several experiments were conducted to determine whether protozoan grazing can reduce

current output from sediment microbial fuel cells. When marine sediments were amended

with eukaryotic inhibitors, the power output from the fuel cells increased 2 to 5-fold.

Quantitative PCR showed that Geobacteraceae sequences were 120 times more abundant

on anodes from treated fuel cells compared to untreated fuel cells, and that Spirotrichea

sequences in untreated fuel cells were 200 times more abundant on anode surfaces than in

the surrounding sediments. Defined studies with current-producing biofilms of Geobacter

sulfurreducens and pure cultures of protozoa demonstrated that protozoa that were

effective in consuming G. sulfurreducens reduced current production up to 91% when

added to G. sulfurreducens fuel cells. These results suggest that anode biofilms are an

attractive food source for protozoa and that protozoan grazing can be an important factor

limiting the current output of sediment microbial fuel cells.

1. Introduction

Although many applications have been proposed for microbial fuel cells,

powering electronic monitoring devices with energy harvested from marine sediments is

one of the few applications that appear to be currently practical (Franks & Nevin, 2010;

Logan, 2009). However, the output of sediment fuel cells is relatively low (4-55 mW/m2)

(Girguis et al., 2010), which has led to many investigations designed to identify factors

limiting current production in order to develop strategies to increase current output and

expand the types of devices that can be powered with sediment fuel cells.

One strategy to enhance power output is to increase the anode surface area

available for microbial colonization. Unfortunately, studies have shown that as the

surface area is increased the power output may not scale linearly (Ewing et al., 2014) and

large surface anodes are unwieldy and difficult to deploy. Another approach is to

increase the supply of electron donor to anode microbes. Current output can be directly

related to the rate that fermentable organic matter is degraded within sediments

(Wardman et al., 2014; Williams et al., 2010), which can be increased with the addition

of particulate organic matter (i.e. cellulose, chitin, or algal biomass) that can be

fermented to electron donors that will support current production (Cui et al., 2014;

Rashid et al., 2013; Rezaei et al., 2009). However, the technical difficulty of amending

sediments with organic material, especially in deep environments, as well as the need for

repeated additions of the organics for long-term deployments, limits the applicability of

this approach. Another approach is to provide electron donors for current production

within the anode itself (Nevin et al., 2011), but this strategy is not applicable for the

multi-year operation desired for many applications of sediment fuel cells.

A proven strategy for increasing current densities in laboratory studies is to

colonize anodes with those microorganisms that have the most effective current

production capabilities. Characteristics that confer high current densities include the

ability to directly transfer electrons to electrodes and the formation of electrically

conductive biofilms that permit cells that are part of the anode biofilm but not in direct

contact with anodes to contribute to current production (Lovley, 2012). To date, the

combination of these characteristics has only been documented in members of the

Geobacteraceae (Malvankar & Lovley, 2014). The common predominance of

Geobacteraceae on anodes harvesting current from sediments and other environments

suggests that microorganisms with these favorable characteristics already have a

competitive advantage in colonizing anodes in many instances (Lovley, 2012). In

laboratory studies it is possible to genetically engineer microorganisms with improved

current capabilities (Leang et al., 2013), but the feasibility of preemptively colonizing

anodes of sediment fuel cells with engineered microbes has not been intensively

investigated.

In open environments, such as sediments, there may be factors other than

substrate availability limiting the growth of Geobacteraceae in anode biofilms. For

example, when the growth of Geobacter species in the subsurface was stimulated with

the addition of high concentrations of electron donor in the form of acetate, a bloom of

protozoa accompanied increases in Geobacter growth and substantially lowered the

accumulation of Geobacter biomass below that expected in the absence of protozoan

grazing (Holmes et al., 2013). An anode biofilm also represents a substantial enrichment

of Geobacteraceae likely to enhance grazing opportunities for protozoa. Amoeboid

protozoa have been shown to consume bacteria within a biofilm at rates of 1465 bacteria

h-1 (Rogerson et al., 1996) and mixed cultures of amoeba and flagellates can consume 55-

75% of the cells comprising a biofilm (Zubkov & Sleigh, 1999). Here we report on

sediment and defined culture studies that suggest that protozoan grazing on anode

biofilms may be an important factor limiting the current output of sediment microbial

fuel cells.

2. Materials and Methods

2.1 Sediment microbial fuel cells

Marine sediments and overlying water were separately collected from The Great

Sippewisset Marsh (West Falmouth, MA) as previously described (Holmes et al., 2004)

at a depth of 0.5 m in canning jars that were filled to the top and then sealed. Water from

the sampling site was also collected in plastic containers as previously described (Holmes

et al., 2004). Six1-L glass beakers were filled ! full with anoxic sediment and then the

beakers were completely filled with water from the site. Prior to fuel cell construction,

three of the sediments were amended with 200 mg/L each of the eukaryotic inhibitors

cycloheximide and colchicine. This concentration of inhibitors was selected because it

has previously been shown to inhibit protozoan growth in sediment microcosms (Holmes

et al., 2014; Schwarz & Frenzel, 2005). In order to ensure that the eukaryotic inhibitors

could not act as electron shuttles, current generated by G. sulfurreducens in two-

chambered ‘H-type’ fuel cells with acetate (10 mM) provided as an electron donor in the

presence of both inhibitors was monitored (Fig. 1). These pure culture studies showed

that similar current outputs were obtained by G. sulfurreducens grown in the presence or

absence of inhibitors, indicating that they could not act as shuttles. Power generated by

sediment fuel cells constructed with autoclaved sediments in the presence and absence of

inhibitors was also monitored to ensure that the inhibitors did not have an abiotic impact

on current produced by sediment fuel cells (Supplementary Fig. 1).

As previously described (Holmes et al., 2004), graphite (grade G10, Graphite

Engineering and Sales, Greenville, MI) anodes (3.9 cm x 3.9 cm x 0.3 cm) were placed 2-

5 cm below the sediment surface, and electrically connected to cathodes, constructed of

the same size and material, that were suspended in overlying seawater, which was

continuously bubbled with air. A resistor of 560 ohms was included in the circuit

between the anode and cathode. Current and voltage measurements were collected with a

Keithley model 2000 multimeter (Keithley Instruments, Cleveland, OH). Current

produced by all 6 fuel cells was monitored for 43 days at an incubation temperature of 18

°C.

2.2 Defined Culture Studies

Trepomonas agilis strain RCP-1 (ATCC 50286), Breviata anathema (ATCC

50338), and Hexamita inflata strain AZ-4 (ATCC 50268) were purchased from the

American Type Culture Collection (ATCC). Heteromita strain DH-1 was isolated from

sediments collected from a uranium-contaminated aquifer located in Rifle, Colorado and

has 18S rRNA and ß-tubulin gene sequences that are 97% and 92% identical to the

flagellate, Heteromita globosa (D. Holmes et al., manuscript in preparation). Geobacter

sulfurreducens was obtained from our laboratory culture collection.

Strict anaerobic culturing and sampling techniques were used throughout (Balch

et al., 1979). All protozoan cultures were grown anaerobically with G. sulfurreducens

provided as the food source. B. anathema was maintained on medium containing a 1:3

mixture of simplified ATCC medium 1171 (mucin, Tween-80, and rice starch were

omitted) and standard ATCC medium 802 (Sonneborn’s Paramecium medium); T. agilis

was maintained on ATCC 1171 TYGM-9 medium; H. inflata was maintained on ATCC

1773 Hexamita medium; and Heteromita strain DH-1 was maintained on ciliate mineral

medium consisting of (per liter distilled water): 0.125 g K2HPO4, 0.025 g NH4Cl, 0.4 g

NaCl, 0.2 g MgCl2·6H2O, 0.15 g KCl and 0.25 g CaCl2·2H2O, and 1% wheat starch

(Sigma-Aldrich).

For batch culture grazing studies, G. sulfurreducens strain PCAT (ATCC51573)

was grown in a bicarbonate-buffered freshwater medium (Lovley & Phillips, 1988) with

fumarate (40 mM) provided as the electron acceptor and H2 as the electron donor at 22°C

in the dark under N2-CO2 (80:20). Once cells reached stationary phase (OD600nm of ~0.8),

protozoa were added to the medium. G. sulfurreducens cells were counted with acridine

orange staining and epifluorescence microscopy as previously described (Hobbie et al.,

1977). Cells were diluted 100-fold, fixed with a 10% glutaraldehyde solution, and stained

with acridine orange (0.01% final concentration). One milliliter of this stained sample

was then concentrated with a vacuum pump (pressure was ca. 150 mm Hg) onto a 0.2 µm

pore-size polycarbonate membrane filter (Millipore) and visualized by fluorescence

microscopy on a Nikon Eclipse E600 microscope.

G. sulfurreducens was cultured and grown in two-chambered ‘H-type’ fuel cells

with graphite anodes poised at +300 mV versus Ag/AgCl, as previously described (Nevin

et al., 2009) with continuous gassing with H2 as the electron donor (H2/CO2/N2 7:20:73).

Anaerobically grown protozoan cultures (50 ml at a concentration of ~1 x 104 cells/ml)

were concentrated by centrifugation at 2000 x g for 15 minutes, resuspended in 5 ml of

bicarbonate-buffered freshwater medium (Lovley & Phillips, 1988), and added to the

anode chamber of fuel cells once current had stabilized (0.7-1.0 mAmps). After a 5-day

exposure to protozoan grazing by strain DH-1, biofilms were visualized with confocal

scanning laser microscopy using LIVE/ DEAD BacLight viability stain, as previously

described (Nevin et al., 2008). Percent reduction in current output from protozoan

grazing was determined with the following calculation:

(1 – ) x 100%.

2.3 Analysis of bacterial and protozoan communities associated with sediment fuel

cells

The composition of the microbial community found on anode biofilms and

surrounding sediments was determined as previously described (Holmes et al., 2004).

Sediments (0.5 g) or the top millimeter of the anode scraped off with a sterile razor blade

were resuspended in 1 ml TE/sucrose buffer (10 mM Tris-HCl, 1 mM EDTA, 6.7%

sucrose; pH 8.0). Sodium dodecyl sulfate (SDS 0.5% final concentration), proteinase K

(0.1 mg/mL), and lysozyme (1 mg/mL final concentration) were then added and samples

were incubated at 37 °C for 30 minutes. Lysing matrix E (MP BioMedical) was added to

the tubes and they were placed in a FastPrep-24 bead-beater (MP BioMedical) for 60 sec

at 5.5 m/s. Tubes were then centrifuged at 13,200 rpm for 15 minutes and supernatant

was collected for DNA extraction with the FastDNA SPIN Kit for Soil (MP

Biomedicals).

Several previously described primer pairs were used for amplification of 16S

rRNA, and ß-tubulin gene fragments from genomic DNA. Gene fragments from the 16S

rRNA gene were amplified with 8F (Eden et al., 1991) and 519R (Lane et al., 1985); and

BT107F and BT261R (Baker et al., 2004) was used to amplify the ß-tubulin gene.

A 50 µl PCR reaction consisted of the following solutions: 10 µl Q buffer

(Qiagen), 0.4 mM of each dNTP, 1.5 mM MgCl2, 0.2 µM of each primer, 5 µg bovine

serum albumin (BSA), 2.5 U Taq DNA polymerase (Qiagen) and 10 ng of PCR template.

Amplification was performed with a minicycler PTC 200 (MJ Research) starting with 5

min at 94°C, followed by 35 cycles consisting of denaturation (30 s at 94°C), annealing

(45 s at 55-60°C), extension (45 s at 72°C), and a final extension at 72°C for 10 min.

After PCR amplification of these gene fragments, PCR products were purified

with the Gel Extraction Kit (Qiagen), and cloned into the TOPO TA cloning vector,

version M (Invitrogen, Carlsbad, CA). One hundred plasmid inserts from each of these

clone libraries were sequenced with the M13F primer at the University of Massachusetts

Sequencing Facility.

2.4 Quantitative PCR

All quantitative PCR (qPCR) primers were designed according to the

manufacturer’s specifications (Applied Biosystems) and had amplicon sizes ranging

from100-200 bp. Copies of the ß-tubulin gene from strain DH-1 were quantified on the

anode surface and the surrounding medium from the G. sulfurreducens H-cell with the

following primer set: DH1-374f (5’ GATGTGCACCTTCTCCGTTT 3’) and DH1-494r

(5’ ATCGATCACCATCACCTCGT 3’). Geobacteraceae 16S rRNA and Spirotrichea ß-

tubulin gene copies were amplified from the anode surface and surrounding sediments of

a marine sediment fuel cell with Geobacteraceae 494f and Geobacteraceae 1050r

(Holmes et al., 2004) and Spirotrichea-13f (5’ GGCGGGGGAAAGGAACTAA 3’) and

Spirotrichea-127r (5’ TTGACCCATTTGGTCTCTGCT 3’).

Quantitative PCR amplification and detection were performed with the 7500 Real

Time PCR System (Applied Biosystems) using genomic DNA extracted from H-cells and

marine sediment fuel cells. All qPCR assays were run in triplicate. Each reaction mixture

consisted of a total volume of 25 µL and contained 1.5 µL of the appropriate primers

(stock concentrations, 1.5 µM), 5 ng cDNA, and 12.5 µL Power SYBR Green PCR

Master Mix (Applied Biosystems). Standard curves covering 8 orders of magnitude were

constructed with serial dilutions of known amounts of DNA quantified with a NanoDrop

ND-1000 spectrophotometer at an absorbance of 260 nm. Gene copy numbers and qPCR

efficiencies (95% to 99%) were calculated from appropriate standard curves.

Optimal thermal cycling parameters consisted of an activation step at 50°C for 2

min, an initial 10 min denaturation step at 95°C followed by 50 cycles of 95°C for 15 s

and 60°C for 1 min. After 50 cycles of PCR amplification, dissociation curves were made

for all qPCR products by increasing the temperature from 60°C to 95°C at a ramp rate of

2%. The curves all yielded a single predominant peak, further supporting the specificity

of the qPCR primer pairs.

2.5 Phylogenetic analysis

16S rRNA and ß-tubulin sequences were assembled with Geneious 5.6 and

compared to GenBank nucleotide and protein databases with the blastn and blastx

algorithms. Alignments were made in ClustalX before phylogenetic trees were

constructed with Mega v6. The maximum likelihood algorithm with the Nearest-

Neighbor Interchange was used to construct all phylogenetic trees. All evolutionary

distances were computed with the Tamura-Nei substitution model with 100 bootstrap

replicates.

The nucleotide sequences of 18S rRNA, ß-tubulin from strain DH1 and 16S

rRNA and ß-tubulin sequences from marine sediment fuel cells have been deposited in

the GenBank database under accession numbers KR047867-KR047883.

3. Results and Discussion

3.1 Impact of protozoan grazing on marine sediment fuel cells.

In order to evaluate the impact that protozoan grazing might have on current

output of microbial fuel cells, current production was monitored in marine sediment fuel

cells constructed with sediments treated with or without the eukaryotic inhibitors

cycloheximide and colchicine (Fig. 2). There was variability in the current output in both

treatments, which is typical of sediment microbial fuel cells (Reimers et al., 2001; Tender

et al., 2002). During the first 5 days of the experiment, current generated by treated fuel

cells was lower than untreated fuel cells. In this initial phase of anode colonization

sulfide produced at distance from the anode is likely to be a more important electron

donor for current until a current-producing biofilm is established. It is possible that H2S

generated by sulfate reducing protozoan symbionts (Edgcomb et al., 2011) can transfer

electrons to the electrode and generate some current. When inhibitors are added, both the

protozoa and their symbionts are destroyed and this abiotic effect is no longer observed,

however further investigation into this possibility is required.

After this initial lag, fuel cells made with sediments treated with eukaryotic

inhibitors typically produced substantially more current than those with anodes

suspended in untreated sediments. Whereas power densities from untreated sediments

were comparable to those previously reported in fuel cells assembled with these same

sediments and averaged 0.022 Watts per m2 of electrode surface area (Bond et al., 2002),

power densities generated by fuel cells constructed with treated sediments were 2 to 5-

fold higher and averaged 0.046 W/m2 (Fig. 2). In fact, at the end of the incubation period

the sediment fuel cells with anodes in the sediments treated with eukaryotic inhibitors

produced current that was 4.5-fold higher than the microbial fuel cells with untreated

sediments and the overall area of the power density plot from the treated fuel cells was

2.11 times greater than that from untreated controls.

Bacterial communities found on fuel cell anodes from both sediment types were

similar to previously reported studies (Bond et al., 2002; Holmes et al., 2004) with a

predominance of Geobacteraceae species; accounting for 72% and 61% of the 16S rRNA

gene sequences recovered from anodes of the inhibitor-treated sediments and controls,

respectively (Fig. 3A). The majority of Geobacteraceae 16S rRNA gene sequences (56%

and 55% on treated and untreated anodes) were most similar to Desulfuromusa

succinoxidans (98% sequence identity).

In addition to the specific enrichment of Geobacteraceae species on the current-

harvesting electrodes, there was a specific enrichment of protozoa associated with the

anodes in untreated sediments (Fig. 3B). ß-tubulin sequences from the ciliate class

Spirotrichea accounted for 65% of the protozoan population and 87% of these

Spirotrichea sequences were most similar to Euplotes raikovi (91% nucleotide identity).

In contrast, only 20% and 4% of the sequences amplified from surrounding sediments

clustered within the class Spirotrichea and the genus Euplotes. As expected, no protozoa

were detected on electrodes in the sediments that were amended with eukaryotic

inhibitors.

Quantitative PCR with specific primers for Spirotrichea ß-tubulin and

Geobacteraceae 16S rRNA genes demonstrated that, in the untreated sediments,

Spirotrichea and Geobacteraceae were 2 orders of magnitude higher on the anode surface

than in the sediments surrounding the anodes. Although 16S rRNA library analyses

indicated that the proportion of Geobacteraceae found on treated and untreated anodes

was similar, qPCR showed that Geobacteraceae were significantly (124 times) more

abundant on treated anodes.

Previous studies have shown that Euplotes species are bacteriovorous (Turley et

al., 1986). Thus, the specific association of Euplotes in anode biofilms and the increased

current output from sediments treated with eukaryotic inhibitors are consistent with the

hypothesis that protozoan grazing of anode biofilms can reduce the current output of

sediment fuel cells.

3.2 Studies with Defined Cultures

In order to further evaluate whether protozoan grazing might limit the output of

sediment fuel cells, studies were conducted with G. sulfurreducens, which typically

serves as the model organism in studies on current production by Geobacteraceae (Lovley,

2012). H2 served as the electron donor to prevent potential inhibition of grazing with an

organic carbon source.

Trepomonas agilis, Hexamita inflata, and Breviata anathema were chosen as

potential G. sulfurreducens grazers because they are related to protozoa previously

detected in Geobacter-enriched groundwater (Holmes et al., 2013) and Heteromita strain

DH-1 is a protozoan isolate from those groundwaters (D.E. Holmes et al. manuscript in

preparation). Heteromita strain DH-1 grazed G. sulfurreducens most heavily, but T. agilis

and H. inflata were also effective grazers (Fig. 4). Grazing rates of B. anathema were

much slower.

When the protozoa that were effective in grazing G. sulfurreducens were added to

anode chambers that contained pre-established current-producing biofilms, there was a

substantial reduction in current (Fig. 5). The lowest current outputs were achieved in the

presence of strain DH-1, which was the most effective predator of G. sulfurreducens in

batch culture studies. Grazing by DH-1 resulted in a 91% reduction in current output

(0.861 mA prior to inoculation compared to 0.0719 mA after 5 days of grazing). In

contrast, there was no impact on current output in the presence of B. anathema, consistent

with batch culture studies that showed this species was an ineffective grazer of G.

sulfurreducens. The addition of a heat-killed mixed culture of T. agilis, H. inflata, and

strain DH-1 cells also had no impact on current production.

In order to determine whether Heteromita strain DH-1, the most effective G.

sulfurreducens grazer, was specifically associated with the anode, as would be expected

if it was actively grazing on the biofilm, cells were quantified with qPCR primers

targeting the strain DH-1 ß-tubulin gene. Heteromita strain DH-1 ß-tubulin genes in

DNA extracted from the anode biofilms (6.41 x 104 ± 5220; n=3) were 10-fold more

abundant than in the surrounding medium (8.2 x 103 ± 1909).

Imaging the anode biofilms with confocal scanning laser microscopy revealed that

the presence of Heteromita strain DH-1 substantially decreased the abundance of G.

sulfurreducens on the anode. Biofilms found on anodes in control fuel cells were much

thicker than biofilms exposed to protozoan grazing; 24 ±10 µm compared to 5 ± 4 µm. In

addition, protozoan cells were apparent in large areas of grazing within the strain I

inoculated biofilm.

3.3 Implications

The results suggest that protozoan grazing may be an important factor limiting the

current output of sediment fuel cells. The pure culture studies demonstrated that protozoa

effective in grazing on G. sulfurreducens reduced anode biofilm thickness and current

output. Thus, the elimination of protozoan grazing is the most likely explanation for the

increased current output when the sediments were treated with eukaryotic inhibitors.

These results suggest that even if factors such as low electron donor availability that limit

current production of sediment fuel cells could be overcome, protozoan grazing is likely

to diminish power outputs well below those that can be obtained with pure cultures of

effective current-producing microorganisms unless the grazing can be prevented.

It is not sustainable to amend sediments with eukaryotic inhibitors for routine

deployment of sediment fuel cells. However, the size difference between current-

producing Geobacteraceae (1 x 0.5 µm) and protozoa (most are >5 µm) may make it

feasible to provide a size-exclusion screen that would permit current-producing microbes

to access current-harvesting electrodes while excluding protozoa. Another factor that may

be limiting accumulation of Geobacter biomass during subsurface bioremediation is

phage (Holmes et al., 2015). It would not be surprising if phage also play a role in

limiting biofilm densities on electrodes harvesting current in sediments.

A frequently proposed application for microbial fuel cells other than sediment

fuel cells is anaerobic wastewater treatment with simultaneous current harvesting (Du et

al., 2007; Li et al., 2014). It seems likely that protozoan grazing, and potentially phage,

would be a factor limiting current outputs in these systems. However, further

investigations into this possibility are required.

4. Conclusions

Protozoan grazing appears to have an impact on power output by marine sediment fuel

cells. Addition of eukaryotic inhibitors to marine sediments significantly increased

current. Molecular studies showed that Geobacteraceae were enriched on current-

harvesting anodes recovered from inhibitor treated and untreated sediments and that

anaerobic protozoa from the genus Euplotes were associated with anode biofilms from

untreated fuel cells. Defined studies with Geobacter sulfurreducens showed that protozoa

were able to reduce current production up to 91% and that G. sulfurreducens anode

biofilms grown in the presence of protozoa were 4-fold thinner than biofilms from

protozoan-free controls.

Acknowledgements

This research was supported by Office of Naval Research grant N00014-13-1–0550.

Figure Legends

Fig. 1. Current generated by H cell inoculated with G. sulfurreducens strain PCA

grown with acetate (10 mM) provided as the electron donor in the

presence and absence of Trepomonas and eukaryotic inhibitors

cycloheximide and colchicine.

Fig. 2. Power produced by marine sediment fuel cells assembled with sediment

and water collected from The Great Sippawisset Salt Marsh in the

presence or absence of the eukaryotic inhibitors cycloheximide and

colchicine. Results are the mean and standard error of triplicate fuel cells

for each treatment.

Fig. 3. (A) Distribution of 16S rRNA gene sequences recovered from the surface

of the anode or the surrounding sediments in marine sediment fuel cells in

the presence or absence of the eukaryotic inhibitors. Results are the

average of triplicate fuel cells for each treatment. (B) Distribution of the

protozoan community found on the marine sediment fuel cell anode

surface or in the surrounding sediments as determined by analysis of ß-

tubulin clone libraries. Results are the average of triplicate fuel cells for

each treatment.

Fig. 4. Predation of Geobacter sulfurreducens by various anaerobic protozoan

species (Breviata anathema, Trepomonas agilis, Hexamita inflata, or

Heteromita strain DH-1). Results are the mean and standard deviation for

triplicate cultures.

Fig. 5. Current generated by G. sulfurreducens grown in H-cells (H2 was

provided as the electron donor) prior to addition of protozoa and 5 days

after inoculation. Results are average of triplicate H-cells.

References

(1) Baker, B.J., Lutz, M.A., Dawson, S.C., Bond, P.L., Banfield, J.F. 2004. Metabolically active eukaryotic communities in extremely acidic mine drainage. Appl Environ Microbiol, 70(10), 6264-6271.

(2) Balch, W.E., Fox, G.E., Magrum, L.J., Woese, C.R., Wolfe, R.S. 1979. Methanogens: reevaluation of a unique biological group. Microbiol Rev, 43(2), 260-96.

(3) Bond, D.R., Holmes, D.E., Tender, L.M., Lovley, D.R. 2002. Electrode-reducing microorganisms that harvest energy from marine sediments. Science, 295(5554), 483-485.

(4) Cui, Y.F., Rashid, N., Hu, N.X., Rehman, M.S.U., Han, J.I. 2014. Electricity generation and microalgae cultivation in microbial fuel cell using microalgae-enriched anode and bio-cathode. Energy Conversion and Management, 79, 674-680.

(5) Du, Z.W., Li, H.R., Gu, T.Y. 2007. A state of the art review on microbial fuel cells: A promising technology for wastewater treatment and bioenergy. Biotechnology Advances, 25(5), 464-482.

(6) Eden, P.A., Schmidt, T.M., Blakemore, R.P., Pace, N.R. 1991. Phylogenetic analysis of Aquaspirillum magnetotacticum using polymerase chain reaction amplified 16S ribosomal RNA specific DNA. Int J Syst Bacteriol, 41(2), 324-325.

(7) Edgcomb, V.P., Leadbetter, E.R., Bourland, W., Beaudoin, D., Bernhard, J.M. 2011. Structured multiple endosymbiosis of bacteria and archaea in a ciliate from

marine sulfidic sediments: a survival mechanism in low oxygen, sulfidic sediments? Front Microbiol, 2, 55.

(8) Ewing, T., Ha, P.T., Babauta, J.T., Tang, N.T., Heo, D., Beyenal, H. 2014. Scale-up of sediment microbial fuel cells. Journal of Power Sources, 272, 311-319.

(9) Franks, A.E., Nevin, K.P. 2010. Microbial Fuel Cells, A Current Review. Energies, 3(5), 899-919.

(10) Girguis, P.R., Nielsen, M.E., Reimers, C.E. 2010. Fundamentals of sediment-hosted fuel cells. in: Bioelectrical systems, First Edition, (Ed.) K. Raebey, Springer Verlag Press.

(11) Hobbie, J.E., Daley, R.J., Jasper, S. 1977. Use of Nuclepore Filters for Counting Bacteria by Fluorescence Microscopy. Appl Environ Microbiol, 33(5), 1225-1228.

(12) Holmes, D.E., Bond, D.R., O'Neill, R.A., Reimers, C.E., Tender, L.R., Lovley, D.R. 2004. Microbial communities associated with electrodes harvesting electricity from a variety of aquatic sediments. Microbial Ecology, 48(2), 178-190.

(13) Holmes, D.E., Giloteaux, L., Chaurasia, A.K., Williams, K.H., Luef, B., Wilkins, M.J., Wrighton, K.C., Thompson, C.A., Comolli, L.R., Lovley, D.R. 2015. Evidence of Geobacter-associated phage in a uranium-contaminated aquifer. ISME J, 9(2), 333-46.

(14) Holmes, D.E., Giloteaux, L., Orellana, R., Williams, K.H., Robbins, M.J., Lovley, D.R. 2014. Methane production from protozoan endosymbionts following stimulation of microbial metabolism within subsurface sediments. Frontiers in Microbiology, 5.

(15) Holmes, D.E., Giloteaux, L., Williams, K.H., Wrighton, K.C., Wilkins, M.J., Thompson, C.A., Roper, T.J., Long, P.E., Lovley, D.R. 2013. Enrichment of specific protozoan populations during in situ bioremediation of uranium-contaminated groundwater. ISME J, 7(7), 1286-98.

(16) Lane, D.J., Pace, B., Olsen, G.J., Stahl, D.A., Sogin, M.L., Pace, N.R. 1985. Rapid determination of 16S ribosomal RNA sequences for phylogenetic analyses. P Natl Acad Sci USA, 82(20), 6955-6959.

(17) Leang, C., Malvankar, N.S., Franks, A.E., Nevin, K.P., Lovley, D.R. 2013. Engineering Geobacter sulfurreducens to produce a highly cohesive conductive matrix with enhanced capacity for current production. Energy & Environmental Science, 6(6), 1901-1908.

(18) Li, W.W., Yu, H.Q., He, Z. 2014. Towards sustainable wastewater treatment by using microbial fuel cells-centered technologies. Energy & Environmental Science, 7(3), 911-924.

(19) Logan, B.E. 2009. Exoelectrogenic bacteria that power microbial fuel cells. Nature Reviews Microbiology, 7(5), 375-381.

(20) Lovley, D.R. 2012. Electromicrobiology. Annual Review of Microbiology, Vol 66, 66, 391-409.

(21) Lovley, D.R., Phillips, E.J. 1988. Novel mode of microbial energy metabolism: organic carbon oxidation coupled to dissimilatory reduction of iron or manganese. Appl Environ Microbiol, 54(6), 1472-80.

(22) Malvankar, N.S., Lovley, D.R. 2014. Microbial nanowires for bioenergy applications. Curr Opin Biotechnol, 27, 88-95.

(23) Nevin, K.P., Kim, B.C., Glaven, R.H., Johnson, J.P., Woodard, T.L., Methe, B.A., DiDonato, R.J., Covalla, S.F., Franks, A.E., Liu, A., Lovley, D.R. 2009. Anode Biofilm Transcriptomics Reveals Outer Surface Components Essential for High Density Current Production in Geobacter sulfurreducens Fuel Cells. Plos One, 4(5).

(24) Nevin, K.P., Richter, H., Covalla, S.F., Johnson, J.P., Woodard, T.L., Orloff, A.L., Jia, H., Zhang, M., Lovley, D.R. 2008. Power output and columbic efficiencies from biofilms of Geobacter sulfurreducens comparable to mixed community microbial fuel cells. Environ Microbiol, 10(10), 2505-14.

(25) Nevin, K.P., Zhang, P., Franks, A.E., Woodard, T.L., Lovley, D.R. 2011. Anaerobes unleashed: Aerobic fuel cells of Geobacter sulfurreducens. Journal of Power Sources, 196(18), 7514-7518.

(26) Rashid, N., Rehman, M.S.U., Han, J.I. 2013. Recycling and reuse of spent microalgal biomass for sustainable biofuels. Biochemical Engineering Journal, 75, 101-107.

(27) Reimers, C.E., Tender, L.M., Fertig, S., Wang, W. 2001. Harvesting energy from the marine sediment-water interface. Environmental Science & Technology, 35(1), 192-195.

(28) Rezaei, F., Richard, T.L., Logan, B.E. 2009. Analysis of chitin particle size on maximum power generation, power longevity, and Coulombic efficiency in solid-substrate microbial fuel cells. Journal of Power Sources, 192(2), 304-309.

(29) Rogerson, A., Hannah, F., Gothe, G. 1996. The grazing potential of some unusual marine benthic amoebae feeding on bacteria. European Journal of Protistology, 32(2), 271-279.

(30) Schwarz, M.V.J., Frenzel, P. 2005. Methanogenic symbionts of anaerobic ciliates and their contribution to methanogenesis in an anoxic rice field soil. FEMS Microbiol Ecol, 52(1), 93-99.

(31) Tender, L.M., Reimers, C.E., Stecher, H.A., Holmes, D.E., Bond, D.R., Lowy, D.A., Pilobello, K., Fertig, S.J., Lovley, D.R. 2002. Harnessing microbially generated power on the seafloor. Nature Biotechnology, 20(8), 821-825.

(32) Turley, C., Newell, R., Robins, D. 1986. Survival strategies of two small marine ciliates and their role in regulating bacterial commuinity structure under experimental conditions. Mar Ecol-Progr Ser, 33, 59-70.

(33) Wardman, C., Nevin, K.P., Lovley, D.R. 2014. Real-time monitoring of subsurface microbial metabolism with graphite electrodes. Frontiers in Microbiology, 5.

(34) Williams, K.H., Nevin, K.P., Franks, A., Englert, A., Long, P.E., Lovley, D.R. 2010. Electrode-Based Approach for Monitoring In Situ Microbial Activity During Subsurface Bioremediation. Environmental Science & Technology, 44(1), 47-54.

(35) Zubkov, M.V., Sleigh, M.A. 1999. Growth of amoebae and flagellates on bacteria deposited on filters. Microbial Ecology, 37(2), 107-115.

0.00

2.00

4.00

6.00

8.00

10.0

0

12.0

0

0 50

10

0 15

0 20

0 25

0

Current (mA)

Tim

e (H

ours

Added

 inhibitors,  

Trepomonas,    

and  new

 med

ium  

Fig.  1  

Figu

re 1

-0.0

2 0

0.02

0.04

0.06

0.08

0.1

0.12

0 5

10

15

20

25

30

35

40

45

50

Power  density    (W/m2)  

Tim

e (d

ays)

no e

ukar

yotic

inhi

bito

rs

with

euk

aryo

tic in

hibi

tors

Fig.  2  

Figu

re 2

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

elec

trode

+ in

hibi

tor

sedi

men

t + in

hibi

tor

elec

trode

se

dim

ent

Proportion of bacterial 16S rRNA gene sequences

unclassified

 

betaproteobacteria  

Tenericutes  

Spirochetes  

Planctomycetes  

other  deltaproteobacteria  

Geo

bacteraceae  

gammaproteobacteria  

Firm

icutes  

Fibrobacteres/Acidobacteria  

epsilonproteobacteria  

Cyanobacteria  

Chloroflexi  

Chlamydiae/Verrucomicrobia  

Bacteroidetes/Chlorobi  

alphaproteobacteria  

Actinobacteria  

0%

10%

20%

30%

40%

50%

60%

70%

80%

90%

100%

sedi

men

t bi

ofilm

Percentage of B-tubulin sequences from protozoan taxa

Uro

lept

us

Spum

ella

So

roge

na

Para

phys

omon

as

Oxy

trich

idae

O

ligoh

ymen

opor

ea

Jaco

bida

Eu

plot

es

Eugl

enoz

oa

Col

pone

ma

Cer

cozo

a Fig.  3  

Figu

re 3

1.00

E+04

1.00

E+05

1.00

E+06

1.00

E+07

1.00

E+08

1.00

E+09

1.00

E+10

0 50

10

0 15

0 20

0 25

0

Number  of  G.  sulfurreducens    cells  per  ml  

Tim

e (h

ours

)

control  (no

 protozoa)  

Trep

omon

as  

Breviata  

Hexamita

 DH

-­‐1  

Fig.  4  

Figu

re 4

0

0.2

0.4

0.6

0.8 1

1.2

cont

rol (

dead

pr

otoz

oa)

cont

rol (

no p

roto

zoa)

B

revi

ata

stra

in D

H-1

Tr

epom

onas

H

exam

ita

Current (mA)

Cur

rent

prio

r to

inoc

ulat

ion

with

pro

tozo

a 5

days

afte

r ino

cula

tion

with

pro

tozo

a

Fig.  5  

Figu

re 5

-0.0

2 0

0.02

0.04

0.06

0.08

0.1

0.12

0 6

7 9

14

Power density (W/m2)

Tim

e (d

ays)

kille

d se

dim

ent (

+ in

hibi

tors

) ki

lled

sedi

men

t

Supp

lem

enta

ry F

igur

e 1.

Pow

er o

utpu

t gen

erat

ed b

y se

dim

ent f

uel c

ells

con

stru

cted

with

hea

t ste

riliz

ed S

ippa

wis

set s

alt m

arsh

sedi

men

ts

in th

e pr

esen

ce a

nd a

bsen

ce o

f euk

aryo

tic in

hibi

tors

cyc

lohe

xim

ide

and

colc

hici

ne.

Supp

lem

enta

ry F

igur

e

• Inhibition of eukaryotic grazing increased power output of sediment MFC 2 to 5-fold

• Geobacteraceae and Euplotes were enriched on current-harvesting anodes.

• Anaerobic protozoa prey on G. sulfurreducens in pure culture studies

• Protozoan grazing can reduce current up to 91% in G. sulfurreducens fuel cells

• Anode biofilms are 4-fold thinner in fuel cells with protozoa