General and Comparative Endocrinology 168 (2010) 55–70

Contents lists available at ScienceDirect

General and Comparative Endocrinology

journal homepage: www.elsevier .com/locate /ygcen

Leptin and leptin receptor genes in Atlantic salmon: Cloning, phylogeny,tissue distribution and expression correlated to long-term feeding status

Ivar Rønnestad a,*, Tom Ole Nilsen a, Koji Murashita a,b, Anna Rita Angotzi a, Anne-Grethe Gamst Moen a,Sigurd O. Stefansson a, Peter Kling c, Björn Thrandur Björnsson c, Tadahide Kurokawa b

a Department of Biology, University of Bergen, N-5020 Bergen, Norwayb Tohoku National Fisheries Res Institute, Fisheries Res Agency, Shinhama 3-27-5, Shiogama, Miyagi 985-0001, Japanc Fish Endocrinology Laboratory, Department of Zoology/Zoophysiology, University of Gothenburg, S-40530 Göteborg, Sweden

a r t i c l e i n f o a b s t r a c t

Article history:Received 17 April 2009Revised 29 March 2010Accepted 14 April 2010Available online 18 April 2010

Keywords:CytokineHormoneLeptinLeptin receptorcDNATeleostParalogues, Salmo salarTissue distributionFeed restrictionRationed feedingAdiposity

0016-6480/$ - see front matter � 2010 Elsevier Inc. Adoi:10.1016/j.ygcen.2010.04.010

Abbreviations: aa, amino acids; EF1a, elongationbinding domain; Lep, leptin; LepR, leptin receptor; ORrapid amplification of cDNA ends.

* Corresponding author. Tel.: +47 55 58 35 86; fax:E-mail address: ivar.ronnestad@bio.uib.no (I. Rønn

The present study reports the complete coding sequences for two paralogues for leptin (sLepA1 and sLep-A2) and leptin receptor (sLepR) in Atlantic salmon. The deduced 171-amino acid (aa) sequence of sLepA1and 175 aa sequence for sLepA2 shows 71.6% identity to each other and clusters phylogenetically withteleost Lep type A, with 22.4% and 24.1% identity to human Lep. Both sLep proteins are predicted to con-sist of four helixes showing strong conservation of tertiary structure with other vertebrates. The highestmRNA levels for sLepA1 in fed fish (satiation ration = 100%) were observed in the brain, white muscle,liver, and ovaries. In most tissues sLepA2 generally had a lower expression than sLepA1 except for thegastrointestinal tract (stomach and mid-gut) and kidney. Only one leptin receptor ortholog was identifiedand it shares 24.2% aa sequence similarity with human LepR, with stretches of highest sequence similar-ity corresponding to domains considered important for LepR signaling. The sLepR was abundantlyexpressed in the ovary, and was also high in the brain, pituitary, eye, gill, skin, visceral adipose tissue,belly flap, red muscle, kidney, and testis. Fish reared on a rationed feeding regime (60% of satiation)for 10 months grew less than control (100%) and tended to have a lower sLepA1 mRNA expression inthe fat-depositing tissues visceral adipose tissue (p < 0.05) and white muscle (n.s.). sLepA2 mRNA levelswas very low in these tissues and feeding regime tended to affect its expression in an opposite manner.Expression in liver differed from that of the other tissues with a higher sLepA2 mRNA in the feed-rationedgroup (p < 0.01). Plasma levels of sLep did not differ between fish fed restricted and full feeding regimes.No difference in brain sLepR mRNA levels was observed between fish fed reduced and full feedingregimes. This study in part supports that sLepA1 is involved in signaling the energy status in fat-depos-iting tissues in line with the mammalian model, whereas sLepA2 may possibly play important roles in thedigestive tract and liver. At present, data on Lep in teleosts are too scarce to allow generalization abouthow the Lep system is influenced by tissue-specific energy status and, in turn, may regulate functionsrelated to feed intake, growth, and adiposity in fish. In tetraploid species like Atlantic salmon, differentLep paralogues seems to serve different physiological roles.

� 2010 Elsevier Inc. All rights reserved.

1. Introduction

Leptin (Lep), a 16-kDa protein hormone, is a member of the class-Ihelical cytokine that is produced primarily by adipose tissues inmammals. Following the first discovery in mouse (Zhang et al.,1994) mammalian Lep has been extensively explored and demon-strated to be a central link between adiposity, appetite, and energyhomeostasis in several species (e.g. Altmann and Von Borell, 2007;

ll rights reserved.

factor 1 alpha; LBD, leptin-F, open reading frame; RACE,

+47 55 58 96 67.estad).

Morris and Rui, 2009; Spady et al., 2009; Vishesh and Arora, 2008).In addition, Lep is involved in regulation of a wide range of processesin mammals, such as reproduction, hematopoiesis, immune re-sponse, and bone formation (Ahima and Flier, 2000; Friedman,2002). In teleosts, Lep was first identified in pufferfish, Takifugu rubr-ipes (Kurokawa et al., 2005). Phylogenetic analysis revealed thatamino acid conservation with other vertebrate Lep orthologs waslow, with only 13.2% sequence identity between pufferfish and hu-man Lep (Kurokawa et al., 2005). Subsequent identification of Lepin other teleosts including common carp, Cyprinus carpio; grass carp,Ctenopharyngodon idella, medaka, Oryzias latipes; zebrafish, Daniorerio; rainbow trout, Oncorhynchus mykiss; Arctic charr, Salvelinusalpinus and Atlantic salmon, Salmo salar (the present study) confirms

56 I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70

low amino acid identity with mammalian Lep (Huising et al., 2006;Kurokawa et al., 2005, 2008; Frøiland et al., 2010; Li et al., 2010).However, the available data indicate that the three-dimensionalstructure of the predicted Lep protein is well conserved amongmammals and teleosts.

The differences among mammalian and fish Lep orthologs haveled researchers to raise questions whether Lep function is conservedor reflect differential roles in regulation of energy metabolism and/or other physiological functions, and also whether there is a funda-mental difference between ectothermic and endothermic verte-brates. Studies have revealed that liver, rather than adipose tissue,is the major Lep-expressing tissue in pufferfish (Kurokawa et al.,2005), common carp (Huising et al., 2006), and rainbow trout(Murashita et al., 2008). In other non-amniotic vertebrates such asthe tiger salamander, Ambystoma tigrinum, and the frog, Xenopus lae-vis, Lep mRNA is highly expressed in tissues such as skin and testis(Boswell et al., 2006; Crespi and Denver, 2006). Hepatic Lep expres-sion in carp increases after feeding but does not change during long-term fasting which questions a possible link between Lep expressionand energy status in teleosts (Huising et al., 2006). In contrast, injec-tion of species specific recombinant Lep in rainbow trout has ananorexigenic effect (Murashita et al., 2008) in line with findings inpost-metamorphic frog (Crespi and Denver, 2006). On the otherhand, plasma Lep levels are elevated during fasting in rainbow trout(Kling et al., 2009). At present, the available information suggestsmultiple functions of Lep in ancestral vertebrates, although thereis no clear understanding on the role of Lep in energy homeostasiscomparable to that in humans.

The physiological actions of Lep are mediated by membrane-associated Lep receptors (LepR). Mammalian LepR is known tohave at least six isoforms (Zabeau et al., 2003). The Lep effects onfood intake, glucose metabolism, and weight gain are reportedlylinked to binding of Lep to the extracellular domain of the longform of the LepR (Bates et al., 2005). In teleosts, the gene for LepRhas been identified in marine medaka, O. melastigma (Wong et al.,2007) pufferfish (Kurokawa et al., 2008), but no information cur-rently exists in salmonids.

The target species of the present study, the Atlantic salmon, is amajor aquaculture species, and has been extensively investigatedin order to understand processes associated with growth, feed in-take, energy homeostasis, and adiposity. The endocrine regulationof these processes is known to be complex, involving multiple hor-mones such as growth hormone, insulin-like growth factor I, insulin,ghrelin, thyroid hormones, and androgens, but to date, limited infor-mation on the role of Lep is available for this species. Previous studieshave indicated that Atlantic salmon has a lipostatic regulation offeed intake where adiposity has a regulatory role governing appetite(Johansen et al., 2001, 2002) although a comprehensive understand-ing of the endocrine control of lipid homeostasis is still lacking (Lea-ver et al., 2008). The main aim of the present study was therefore toobtain full-length mRNA sequences for Atlantic salmon orthologs ofsLep and sLepR. The sequence information was then used to estab-lish methods for quantifying mRNA levels, and elucidating the tissuedistribution of mRNA of sLep and sLepR. As an initial step towardsunderstanding the biological roles of Lep in Atlantic salmon, effectsof feeding status on plasma levels of sLep, and mRNA levels of sLepand sLepR in selected organs were examined in two groups of fishwhich had been either fed to satiation (control group), or fed 60% ra-tion (rationed group) for several months.

2. Materials and methods

2.1. Animals and tissue sampling

Except for assessment of restricted feeding, all materials forcDNA cloning and analysis of tissue distribution was based on

Atlantic salmon (AquaGen breed http://www.aquagen.no/; juve-nile post-smolts: 45–350 g) reared at the Bergen High-TechnologyCentre (Bergen, Norway) in 1 m2 indoor tanks (500 L rearing vol-ume) supplied with a continuous water flow (2.5 L min�1, 8 �C)and fed a commercial pellet diet (Ewos, Bergen, Norway) in excessfor 12 h during the photo phase. At sampling, fish were randomlycollected by dipnet and killed with an overdose of MS-222 (3-ami-nobenzoic acid ethyl ester; Sigma, St. Louis, MO), and tissues werecollected and stored in RNAlater (Ambion, Austin, TX, USA) at�20 �C until RNA isolations and further analyses.

For evaluation of long-term effects of rationed feeding, Atlanticsalmon (AquaGen strain) was sub-sampled from a large-scaleexperiment (N = 3200) conducted at the Institute of Marine Re-search Aquaculture Research Station at Matre (80 km north of Ber-gen, Norway) from October 2006 until August 2007. The fish(average initial weight 849 ± 70 g) were kept in four sea cages(5 � 5 � 5 m). Two groups were established: a control group(100%) which was fed a commercial diet to satiation (Biomar Clas-sic Diet; Biomar, Bergen, Norway) 7 days a week with feeding lev-els adjusted to fish size and temperature, and a rationed groupwhich was fed 60% of the control group. This was obtained by feed-ing the same amount of food per day, but only 4 days a week (Mon-days, Tuesdays, Thursdays, and Fridays).

At sampling, rationed and control fish were randomly dipnettedout of the cages and anesthetized (MS-222). Fish fork length andwet weight was recorded to nearest mm and g, before 4 ml ofblood was drawn from the caudal vein using a 5 ml heparinizedsyringe fitted with a 21G needle. After centrifugation (3000g;5 min) the obtained plasma was frozen at �80 �C. The genderwas determined for each fish and only immature males (n = 6 fromeach group) were included in the present set of analysis. Tissuesamples were collected and flash-frozen in liquid N2 and storedat �80 �C until subsequent analysis of mRNA expression.

2.2. Leptin

2.2.1. Cloning of salmon leptin A1 (sLepA1)Total RNA was prepared from liver of ad libitum fed post-smolt

Atlantic salmon (350 g) according to Kurokawa et al. (2003),whereas genomic DNA was extracted using Tri reagent as outlinedby Chomczynski (1993).

For amplification of 50 ends of salmon sLepA1 cDNA, RACE PCRwas performed according to Kurokawa et al. (2003). Because ESTdata (GenBank Accession No. BI468126) included a partial se-quence of salmon sLepA1 mRNA; the primers for 50 RACE were de-signed in the EST sequence (SMA5a, SMA5b, sLepA1 Rv1, andsLepA1 Rv2; Table 1). Based on the full cDNA sequences of sLepA1(GenBank Accession No. FJ830677) obtained by RACE PCR, sLepA1Fw1, and sLepA1 Rv3 primers were designed for subsequent clon-ing in order to obtain more information about the sLepA1 gene. APCR (50 ll) consisting of 50 ng gDNA, 200 nM forward and reverseprimers, 1.25 mM dNTPs, 1.5 mM MgCl2, and 2 U/ll Taq polymer-ase (Promega, Madison, WI, USA) and thermal conditions of3 min at 94 �C, then 35 cycles of 94 �C for 45 s, 60 �C for 30 s,72 �C for 40 s and final extension at 72 �C for 10 min was per-formed. The PCR products were separated by 1% agarose gel elec-trophoresis, bands extracted using QIAEX II Gel Extraction Kit(QIAGEN, Hilden, Germany) and PCR fragments cloned into apCR4-TOPO sequencing vector (Invitrogen, Carlsbad, CA, USA) fol-lowing the manufacture’s instructions. Plasmids were transformedinto One Shot TOP10 chemically competent Escherichia coli andgrown on ampicillin LB-agar plates. Colonies containing insertswere cultured overnight, purified using QIAGEN Mini Plasmid Kitand sequenced in both directions using Big-Dye Ver. 3.1 and ABI3700 automated sequencer (Applied Biosystems, Inc., Foster City,CA, USA) at the University of Bergen.

Table 1Nucleotide sequences used in 50 RACE PCR, RT-PCR, genome Walker and qPCR assays for sLepA1 and sLepA2, LepR and the internal reference gene EF1a.

Name Sequence (50–30) Use

SMA5a GCAGTGGTATCAACGCAGAGTGGCCA Lep 50 RACESMA5b GGTATCAACGCAGAGTGGCCATTACG Lep 50 RACEsLepA1 Fw1 GGCCCATTCAACCAAACTACA Lep intron cloningsLepA1 Fw2 GGTGATTAGGATCAATAAGCTGGATAT Lep RT-PCRsLep A1 Fw3 CCGCCAGCAGAAACAGACA Lep qPCR TaqMansLep A1 Rv1 TTAGTAACAGTAATTCAGCTGATC Lep 50 RACE outersLep A1 Rv2 CGCCTCTGACAGCCGTCCCTCTCCTGTC Lep 50 RACE innersLep A1 Rv3 GTTAATCATAGTTCAGTTACTCAGTGACAGTC Lep intron cloningsLep A1 Rv4 CCCACACTCAGACCATACTTCCT Lep RT-PCRsLep A1 Rv5 CCCACACTCAGACCATACTTCCT Lep qPCR TaqMansLep A1 Pr TAGTGTCTTTCAGCGCCTCT Lep qPCR TaqMan probesLep A2g Fw CTACTGATCTTCCTAGACATGGCGGACCT Lep Genome WalkersLep A2g Rv AGATAGGAGAGGGTGGGTTGGAGGA Lep Genome WalkersLep A2 Fw TGCCCTCCTACAGGAATACCTGTGCTATT Lep2 RT-PCRsLep A2 Rv TAATTCTGCTTGCTCCAGAGGACTGTT Lep2 RT-PCRsLep A2q Fw TGGGAATCAAAAAGCTCCCTTCCTCTT Lep qPCR Syber greensLep A2q Rv TGCAGGAGACCAGCCTATAGGAGGC Lep qPCR Syber greensLepR Fw1 TCCCTGAGARAGTGGTGG LepR first PCRsLepR Fw2 CTGCAGACTGAGTCGTGGGCTGAGGTCC LepR 30 RACE outersLepR Fw3 GAACCAGATGTGTGTGGGGTGTACAATG LepR 30 RACE innersLepR Fw4 ATCCGTTGAGTCCATCCCTTTGCTC LepR qPCR SYBRsLepR Fw5 GTATACTAAAGTCTTTAGGGGGGGTGATGC LepR RT-PCRsLepR Rv1 GTGSWTRCAGCGBACCTG LepR first PCRsLepR Rv2 GCATTCACCCTGAGGTCATTGAACACGC LepR 50 RACE outersLepR Rv3 CAATAGACGGTCACGCTGTCTCCAAAGC LepR 50 RACE innersLepR Rv4 CAGCTGGTGGGCGCTGTCCTGTGC LepR qPCR SYBRsLepR Rv5 CAGCTGGTGGGCGCTGTCCTGTGC LepR RT-PCRsEF1a Fw1 AGGAGGCTGCTGAGATGGGT EF1a RT-PCRsEF1a Fw2 CCCCTCCAGGACGTTTACAA A EF1a qPCR TaqMansEF1a Fw3 GAGAACCATTGAGAAGTTCGAGAAG EF1a qPCR SYBRsEF1a Rv1 TGAAGCCGACGTTGTCACC EF1a RT-PCRsEF1a Rv2 CACACGGCCCACAGGTACA EF1a qPCR SYBRsEF1a Rv3 GCACCCAGGCATACTTGAAAG EF1a qPCR TaqMansEF1a Pr ATCGGTGGTATTGGAAC EF1a qPCR TaqMan probe

I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70 57

2.2.2. Cloning of salmon leptin A2 (sLepA2)The Canadian salmon EST database (http://snoopy.che.uvic.ca/)

was explored for protein homologs of sLepA1 using TBLASTN tool.A sequence fragment of sLepA2 was identified and subsequentlyextended by a salmon genome Walker library (Genome WalkerUniversal Kit, Clontech) using specific forward and reverse primersnamed sLepA2g Fw and sLepA2g Rw, respectively. Thermal PCRconditions were 5 min at 94 �C, then 30 cycles of 94 �C for 25 s,58 �C for 30 s, 68 �C for 90 s and final extension at 68 �C for7 min. The ORF and partial sequences of 50 and 30 UTRs for sLepA2(GenBank Accession No. GU584004) were obtained by RT-PCRusing cDNA synthesized from total RNA prepared from liver of adlibitum fed post-smolt Atlantic salmon (primers used: sLepA2 Fwand sLepA2 Rw; see Table 1). PCR products were analyzed on aga-rose gels, cloned and sequenced as described above (Section 2.2.1).

2.2.3. Structural analysis of leptin and phylogenySecondary and tertiary protein structures were estimated by the

ProModII program at the SWISS-MODEL automated protein model-ing server (http://www.expasy.org/swissmod/SWISS-MODEL.html)based upon human Lep (1AX8.pdb) Protein Data Bank (PDB) struc-ture file to compare structural similarities of human and Atlanticsalmon sLepA1 and sLepA2.

To reveal the evolutionary relationships between all known lep-tin orthologs, including the newly identified ones in Atlantic sal-mon, molecular phylogenetics was performed with theconstruction of Neighbor-Joining (NJ) tree using the complete cod-ing sequences of leptin proteins. Multiple alignments were per-formed using CLUSTAL X V1.81 program (Thompson et al., 1997),whereas the NJ tree was constructed using NJplotWIN95 (Perriereand Gouy, 1996).

2.2.4. Tissue distribution and expression of leptin paraloguesTissue distribution of sLepA1 and sLepA2 mRNA was examined

in a range of tissues including brain, pituitary, eye, gill, liver, stom-ach, pyloric caeca, mid-gut, heart, visceral adipose tissue, belly flap(a lipid-rich tissue along the mid-ventral section of the abdomen,Nanton et al., 2007), skin, anterior epaxial white muscle, anteriorepaxial red muscle, and gonads (immature). Total RNA was pre-pared from four male and four female juveniles (350 g) fed ad libi-tum according to Chomczynski (1993). Total RNA was quantifiedspectrophotometrically and integrity checked by 1% agarose form-aldehyde gel electrophoresis. Total RNA was subjected to DNasetreatment (Turbo DNase, Ambion, Inc., Austin, TX, USA) and cDNAreversely transcribed using 5 lg total RNA and oligo(dT) in con-junction with the SuperScript III First-Strand Synthesis Systemfor RT-PCR Kit (Invitrogen) following the manufacturer’sinstructions.

Real-time quantitative PCR (qPCR) of sLepA1 and sLepA2 wereperformed on the ABI prism 7000 detection system platform (Ap-plied Biosystems) using TaqMan (ABI) and SYBR Green (QuantiTecSYBR Green PCR Kit (QIAGEN GmbH, Germany) assays for sLepA1and sLepA2, respectively. Final volume reactions (25 ll) containedcDNA synthesized from an equivalent of 125 ng of total RNA. Forthe TaqMan assay, 900 nM forward and reverse primers, 200 nMprobe and 12.5 ll TaqMan Universal PCR Master Mix containingAmpErase� uracil N-glycosylase were used. Alternatively, for theSYBR Green assay, 400 nM of each primer and 12.5 ll of SYBRGreen Universal Master Mix was applied. The thermal cycling pro-tocol consisted of 2 min at 50 �C, 10 min at 95 �C, followed by 50cycles at 95 �C for 15 s and 60 �C for 1 min. The following primersand FAM labeled MGB probes were used; sLepA1 Fw3 and sLep Rv5primers and sLepA1 Pr probe; sEF1a Fw2 and sEF1a Rv2 primersand sEF1a Pr probe; sLepA2q Fw and sLepA2q Rv (Table 1).

58 I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70

Melt curve analysis verified that the qPCR primers generatedone single product and no primer-dimer artifacts. The specificityof single target amplification of sLepA1 and sLepA2 was confirmedby separating the qPCR products in 1.2% of agarose gel electropho-resis followed by cloning and sequencing of the purified fragments,whereas the EF1a qPCR assay has already been validated by Olsviket al. (2005). Omission of reverse transcriptase in the RT reactionresulted in no signal or a shift in Ct values of P8 cycles, which con-firms that interference from residual DNA in RNA samples afterDNase treatment was negligible. For each assay, triplicate twofoldcDNA dilution series made from total RNA (range: 1.25 lg to 39 ng)from the different tissues investigated in the present study wereused to determine amplification efficiencies (E) calculated as theslope from the plot of log RNA concentration versus threshold cycle(Ct) values using the following formula: E = 10(�1/slope). This effi-ciency was used to correct for difference in amplification efficiencywhen calculating gene expression according to Pfaffl et al. (2004).Expression is presented as relative to EF1a as a normalization gene(Olsvik et al., 2005).

2.2.5. Plasma leptin levelsPlasma sLep levels were measured with a radioimmunoassay

according to Kling et al. (2009). The assay is based on a 14-aminoacid long sequence, identical between sLepA1 and rainbow troutleptin and polyclonal antibodies raised in rabbit against the anti-gen. The limit of detection of the assay is 300 pM, and intra- andinterassay coefficients of variation are 8.4% and 13%, respectively.

2.3. Leptin receptor

2.3.1. Cloning of salmon leptin receptorFor cDNA cloning and qPCR analysis of tissue distribution of the

sLepR, Atlantic salmon post-smolts were used (Section 2.2.1.).Total RNA was isolated from salmon pituitary using TRI reagent

(Sigma, St. Louis, MO, USA) according to the manufacturer’s instruc-tions. The isolated total RNA was treated with DNase using TurboDNase (Ambion). First-strand cDNA of pituitary was synthesizedfrom the total RNA using oligo(dT) primer with SuperScript IIIFirst-Strand Synthesis System for RT-PCR Kit (Invitrogen). The cDNAfragment of salmon LepR was obtained by PCR using the first-strandcDNA of pituitary as a template. Degenerate primers were designedbased on conserved nucleotide sequences of LepRs available in theGenBank database (sLepR Fw1 and sLepR Rv1; Table 1). The PCRproducts were analyzed on agarose gels, cloned and sequenced asdescribed above (Section 2.2.1). In order to obtain the full-length sal-mon LepR sequence, 30 and 50 rapid amplification of cDNA ends(RACE) PCRs were performed with a SMART RACE cDNA Construc-tion Kit (BD Biosciences Clonetech) using the DNase treated pituitarytotal RNA. Primers for RACE PCR were designed from the cloned PCRfragments (50 RACE outer, sLepR Rv2; 50 RACE inner, sLepR Rv3; 30

RACE outer, sLepR Fw2; 30 RACE inner, sLepR Fw3; Table 1) and theRACE products were analyzed on agarose gel electrophoresis, clonedand sequenced as described above (Section 2.2.1).

2.3.2. Structural analysis of leptin receptorThe cleavage site of the signal peptide was estimated using Sig-

nalP Ver. 3.0 program (http://www.cbs.dtu.dk/services/SignalP/). Aphylogenetic tree based on the amino acid sequences was con-structed by the neighbor-joining method of the CLUSTAL W(http://www.ch.embnet.org/software/ClustalW.html) (Thompsonet al., 1994) and MEGA 3.1 program (http://www.megasoft-ware.net/index.html) (Kumar et al., 2004).

2.3.3. Tissue distribution and expression of leptin receptorThe tissue expression of sLepR was assessed in the same fish as

the leptin paralogues and was based on the four male and four fe-

male fish described above (see Section 2.2.4). The tissue distribu-tion of sLepR mRNA were analyzed by qPCR using SYBR Greenassays (Chromo 4 System, Bio-Rad Laboratories, Inc., CA, USA)according to the manufacturer’s instructions. Primer set for theqPCR and RT-PCR of LepR were designed in the obtained nucleotidesequence (sLepR Fw4 and sLepR Rv4 for qPCR, sLepR Fw5 andsLepR Rv5 for RT-PCR; Table 1). The qPCR parameters were 40 cy-cles at 95 �C for 30 s, 60 �C for 30 s and 72 �C for 30 s. Atlantic sal-mon EF1a was also amplified as an internal standard (primer setfor EF1a, sEF1a Fw3, and sEF1a Rv3; Table 1).

2.4. Statistical analyses

Comparison of mRNA levels between feed-restricted and con-trol fish was tested using unpaired t-test (GraphPad Prism Ver.5.02, GraphPad Software, San Diego, CA, USA). Homogeneity ofvariances and normality of distributions were tested using Le-vene’s F-test and Shapiro–Wilk W-test, respectively (Zar, 1996).When necessary, data were log-transformed to better fit the para-metric assumptions of the t-test. Differences between groups wereconsidered to be significant if p < 0.05 and data are presented asmeans ± standard error of the mean (SEM).

3. Results

3.1. Leptin

3.1.1. Cloning, 3D structure, and phylogeny of salmon leptinparalogues

Full cDNA sequence of sLepA1 (GenBank Accession No.FJ830677) was obtained by 30 and 50 RACE PCR. The coding se-quence was determined to be 657 bp comprising two exons of162 and 495 bp, respectively, and with an open reading frame cod-ing for a 171-amino acid protein (Fig. 1A). One intron of 155 bp wasidentified. The signal peptide comprised of 21 aa (Fig. 1B). Genomicand cDNA cloning data describe an ORF of sLepA2 coding for 175 aabased on two exons of 150 and 378 bp and encompassing an intronof 149 bp (Fig. 2A and B). In addition, we were also able to identify50 and 30 UTRs fragments 185 bp and 557 bp long, respectively(GenBank Accession No. GU584004; Fig. 2A).

The sLep proteins were estimated to comprise four helixes; athree-dimensional (3D) structural modeling predicts strong con-servation of tertiary structure between the sLep paralogues, otherteleost orthologs and human Lep (Fig. 3). Both salmon Lep hastwo cysteine residues creating the disulfide bond that is conservedin all leptin orthologs described to date (Figs. 1B and 2B) and iscritical for maintaining the 3D structure.

The present findings confirm the previous analysis by Kurokawaand Murashita (2009) that the deduced amino acid sequence ofsLep show low identity to mammalian Lep (Fig. 4 and Table 2):22.4% and 24.1% to human Lep, for sLepA1 and sLepA2, respec-tively. The two sLep paralogues, which both cluster within the tel-eost leptin A clade have 71.6% aa identity. Within salmonids, thereis a 95.3% and 72.9% identity with rainbow trout Lep and sLepA1and sLepA2, respectively. For Arctic charr Lep, the identities tothe salmon paralogues are 74.1% and 94.7% (Table 2). For other tel-eost leptins, the aa identities are lower and typically below 30%.The highest identity is observed in common carp leptins with25–29% (Table 2). The lowest identity of leptins clustered withinthe LepA clade is to Japanese medaka, with 16.7% and 17.8% forsLepA1 and sLepA2, respectively. For the teleost leptin B clade,the identities with sLep are even lower, and Japanese medaka LepBshows 14.1% and 17.7%, aa identity with sLepA1 and sLepA2,respectively.

Fig. 1. Salmon leptin A1 (sLepA1) nucleotide sequence and predicted amino acid sequence (GenBank Accession No. FJ830677). (A) Gene structure. The boxes represent codingexons. Numbers show the base pairs (nt) and amino acids (aa). (B) The mRNA has an ORF which results in a protein sequence of 171 aa. Comparative analysis with genomicdata shows the location of an intron (155 bp, in gray letters). The predicted intron splice donor sequences (gt and ag) are indicated by lower case italics. The cleavage site ofthe signal peptide (broken line) is estimated using the SignalP Ver. 3.0 program. The two cysteine residues are circled.

I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70 59

3.1.2. Tissue expression of salmon leptinThe sLepA1 and sLepA2 gene was expressed in a range of tis-

sues and organs although at very low levels. For sLepA1, thehighest mRNA levels were observed in the brain, whereas whitemuscle, liver, and ovaries also had relatively high expression(Fig. 5). Medium levels where found in eye, gill, skin, and bellyflap. The mRNA levels for sLepA2 were lower than for sLepA1in most tissues, except for stomach, mid-gut, and kidney. Inaddition to these tissues, sLepA2 was also expressed at moderatelevels in gill, white muscle, and ovaries (Fig. 5). In the other tis-sues, sLepA2 expression was very low. A database survey alsoindicates the presence of sLepA2 in thymus of salmon (GenBankAccession No. EG785678), but this tissue was not included in thepresent study.

3.2. The leptin receptor

3.2.1. Cloning and phylogeny of salmon leptin receptor (sLepR)One sequence was obtained from 50 RACE PCR, whereas four dif-

ferent length sequences were obtained form 30 RACE PCR (Fig. 6).The five sequences seem to be splicing variants. In this study, wefocused the longest form (sLepR), as it is the only form to includeboth transmembrane and intracellular segments which are essen-tial for signal transduction. The sLepR cDNA (GenBank AccessionNo. AB489201) contained a 3441 bp open reading frame with apredicted 1146-aa long protein, a 221-bp 50-untranslated region(UTR) and a 733-bp 30 UTR (Fig. 7). The deduced amino acid se-quence of mature sLepR has 32.5–42.6% identity with other fishLepR (Fig. 8 and Table 3). In contrast, the identities of sLepR with

Fig. 2. Salmon leptin A2 (sLepA2) nucleotide sequence and predicted amino acid sequence (GenBank Accession No. GU584004). (A) Gene structure. The boxes representcoding exons. Numbers show the base pairs (nt) and amino acids (aa). (B) The mRNA has an ORF which results in a protein sequence of 175 aa. Comparative analysis withgenomic data shows the location of an intron (149 bp, in gray letters). The predicted intron splice donor sequences (gt and ag) are indicated by lower case italics. The cleavagesite of the signal peptide (broken line) is estimated using the SignalP Ver. 3.0 program. The two cysteine residues are circled.

60 I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70

LepR of human (24.2%), chicken (23.5%) and X. tropicalis (22.9%) arelower than that of fish LepR. The sLepR protein is predicted to pos-sess a 27-amino acid signal peptide, a 786-aa extracellular seg-ment, a 23-aa single transmembrane domain and a 337-amino

acid intracellular segment (Fig. 7). The sLepR includes all function-ally important domains conserved among vertebrate LepRs. Thisincludes three fibronectin type III (FN III) domains, the immuno-globulin (Ig) C2-like domain, a pair of repeated tryptophan/serine

Fig. 3. Ribbon diagrams of orthologs of salmon leptin (sLepA1 and sLepA2) tertiary protein structures, modeled using the ProModII program at the SWISS-MODEL automatedprotein modeling server, based on human leptin (1AX8.pdb) Protein Data Bank structure file. The sLep proteins are estimated to comprise four helixes; three-dimensional(3D) structural modeling predicts strong conservation of tertiary structure between both forms of sLep and also to human leptin (hLep).

I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70 61

motifs (WSXWS) at an extracellular segment, two JAK2-bindingmotif boxes, and a STAT-binding domain at an intracellular seg-ment (Fig. 7). The Lep-binding domain (LBD) of the sLepR is esti-mated to be from the amino acid residues 398–605 (Fig. 9). TheLBD in sLepR shares aa sequence identity with the binding domainof torafugu (47.1%), marine medaka (36.3%), zebrafish (31.4%), X.tropicalis (31.2%), chicken (28.9%), and human (31.2%) (Fig. 9 andTable 3).

3.2.2. Tissue expression of salmon leptin receptorThe tissue expression pattern of sLepR (long type specific) was

analyzed with qPCR (Fig. 10). The sLepR mRNA was abundantly ex-pressed in the ovary and showed low expression in liver, pyloriccaeca, and mid-gut. The rest of the tissues had moderate sLepRmRNA levels (Fig. 10).

3.3. Effect of long-term rationed feeding on leptin

Long-term rationed feeding for 10 months resulted in a signifi-cantly lower body mass (67% of control) and length (88% of control)compared to fully fed fish (Table 4). There were tissue-specific dif-ferences in response to restricted feeding (Fig. 11). Of the lipid-containing tissues that were analyzed visceral adipose tissue sLep-A1 expression was significantly lower in the rationed group(p < 0.05), and in white muscle a similar tendency was observed(p = 0.06). Hepatic and belly flap sLepA1 mRNA expression wasnot significantly affected by feeding regime. Expression of sLepA2in the lipid-containing tissues was in general much lower than thatobserved for sLepA1, and there were no significant differences be-tween rationed and fully fed fish in adipose tissue and muscle.There were higher expression levels in the belly flap in the rationedfeeding fish, but it should be noted that both groups had extremely

low belly flap sLepA2 mRNA levels. In contrast, liver sLepA2 mRNAlevels were similar to sLepA1, and the sLepA2 mRNA levels in ra-tioned fish were significantly higher than in the controls(p < 0.01). There was a tendency towards a lower sLepR expressionin the brain of rationed fish, although this difference was not sig-nificant. There was no difference in plasma sLep levels betweenthe two groups of fish.

4. Discussion

4.1. Structure and phylogeny of salmon leptin and leptin receptor

The present study reports the complete coding sequences fortwo paralogues of leptin, sLepA1 and sLepA2, as well and the leptinreceptor (sLepR), in Atlantic salmon. The data analysis demon-strates that the two mature forms of Lep both cluster with theavailable LepA in teleosts and further form a separate clade to-gether with other salmonids, i.e. rainbow trout and Arctic charr(Fig. 4). The similarity with sLepA1 was higher (95.3%) with rain-bow trout Lep than with sLepA2 (71.6%) which had a higher simi-larity with Arctic charr Lep (94.7%). A comparative interpretation oforthologs of Lep in salmonids requires further studies to identify ifthere are paralogous genes not yet identified in these species, com-bined with tissue distribution and physiological functions of Lep.

Paralogous genes are frequently found in teleosts, due to awhole-genome duplication that occurred early in the teleost line-age (Jaillon et al., 2004). An additional genome duplication eventoccurred later in certain teleost lineages resulting in tetraploid spe-cies, including Atlantic salmon and other salmonids, which thusare likely to have multiple gene copies (Kurokawa and Murashita,2009). Earlier findings have shown that fish possess two maintypes of Lep genes (A and B type) with low interspecies aa identity,

Fig. 4. Evolutionary relationships among vertebrate leptins as inferred from NJ analysis, after CLUSTAL W sequence alignments of full-length peptide sequences. One hundredbootstrap replicates were used to test the reliability of each branch. Scale bar indicates the substitution rate per residue. GenBank accession numbers are shown after thespecies name.

62 I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70

which are derived from the initial whole-genome duplicationevent, and the present study supports earlier reports that addi-tional paralogue copies may occur in fish groups with extra gen-ome duplication (Gorissen et al., 2009; Kurokawa and Murashita,2009; Kurokawa et al., 2005). Both sLep paralogues identified inthe present study cluster with LepA, but the tetraploidity of Atlan-tic salmon suggests that one or more sLepB forms may exist in thisspecies. However, a genomic synteny approach in the tetraploidTakifugu failed to identify more than one Lep gene and it is possiblethat at least Tetradontoidae may lack the LepB type gene (Gorissenet al., 2009; Kurokawa and Murashita, 2009; Kurokawa et al.,2005).

To date, duplicate Lep genes have been described for Atlanticsalmon (this study), Japanese medaka, common carp, and zebrafish(Gorissen et al., 2009; Huising et al., 2006; Kurokawa and Murash-ita, 2009). Huising et al. (2006) found two Lep genes in commoncarp. A phylogenetic study by Kurokawa and Murashita (2009),confirmed by Gorissen et al. (2009) suggests that these are appar-

ently orthologs with the LepA gene and that the common carp pos-sibly also has another yet unidentified LepB type gene. In zebrafishand Japanese medaka, the two identified forms represent the LepAand LepB forms. In order to explore the physiological roles of leptinin teleosts, it is important to get a better understanding of the evo-lutionary and phylogenetic aspects of the different leptinparalogues.

The 3D structural modeling predicts strong conservation of ter-tiary structure between sLep and other leptins identified, includingthat of human, with four distinct helixes (Fig. 3). The two charac-teristic cysteine residues in both sLepA1 and sLepA2 (Figs. 1 and2) predict the formation of a disulfide bond in Lep, which is prere-quisite for this 3D configuration and bioactivity of human Lep(Rock et al., 1996; Zhang et al., 1997). The importance of the con-served tertiary structure of Lep is most likely explained by require-ments for specific LepR-binding affinity and is constrained by thestructure of the receptor binding pocket (Crespi and Denver,2006). In line with this, it has been shown that despite the low

Table 2Amino acid sequence identities of the Atlantic salmon leptin A1/A2 (sLepA1/A2)compared with leptin of various vertebrates. The identities are compared with themature form.

Species Accession no. Amino acid identities of the leptin (%)

Vs sLepA1 Vs sLepA2

Atlantic salmon A1 FJ830677 100 71.6Atlantic salmon A2 GU584004 71.6 100Rainbow trout BAG09232 95.3 72.9Arctic charr BAH83535 74.1 94.7Common carp 1 AJ868357 27.5 29.0Common carp 2 AJ868356 25.0 28.3Zebrafish A AM920658 25.6 25.8Zebrafish B AM901009 16.8 19.6Grass carp ACF23048 24.6 27.3Japanese medaka A AB193548 16.7 17.8Japanese medaka B AB457589 14.1 17.7Torafugu AB193547 16.1 19.0Green pufferfish AB193549 18.0 20.3Xenopus laevis AAX77665 23.7 25.8Tiger salamander AAY68417 20.5 22.5Mouse NM_008493 24.3 24.8Cattle NM_173928 24.3 25.4Human NM_000230 22.4 24.1

I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70 63

aa sequence identity to mammalian Leps, the frog Lep activatesboth mouse and frog LepR in vitro (Crespi and Denver, 2006). Fur-

Br Pi Ey Gi Sk He St Pc0

20

40

60

80

100

120

140

160

180200

300

400

500sLepA1

sLepA2

sLep

mR

NA

leve

ls *1

000

(rela

tive

units

)

Fig. 5. Tissue expression of leptin paralogues (sLepA1 and sLepA2) mRNA normalized wit(n = 4 for testis and ovary, n = 7–8 for other tissues). Br, brain; Pi, pituitary; Ey, eye; Gi, gilBf, belly flap; Wm, white muscle; Rm, red muscle; Ki, kidney; Li, liver; Te, testis; Ov, ov

3’-RACE5’-RACE

ATGLong type

Short type

Fig. 6. Salmon leptin receptor (sLepR). Schematic diagram of mRNA sequences identifiedThe long type includes transmembrane and intracellular segment coding region.

ther, both frog and human Leps exhibit similar potencies on mouseand frog LepRs when tested in transfection assays, and human andfrog Leps have similar anorectic potencies in juvenile frog (Crespiand Denver, 2006). Conserved structural constraints due torequirements for Lep–LepR-binding affinity may also explain someof the results from studies on teleosts using heterologous, mam-malian Lep. The observed effects of such studies include anorecticeffects on feed intake of goldfish (Volkoff et al., 2003), enhancedgonadotropin release in rainbow trout (Weil et al., 2003) and seabass (Peyon et al., 2001), and also modified lipid metabolism byincreasing intracellular fatty acid-binding protein in green sunfish(Londraville and Duvall, 2002).

The predicted sLepR shares only 24.2% amino acid sequencesimilarity with human LepR, but the sLepR gene structure is similarto that in mammals, and a phylogenetic analysis clearly places thesalmon gene within the cluster of teleost LepR genes (Fig. 8). Thestretches of highest sequence similarity correspond to functionallyimportant domains that are known to be important for LepR sig-naling (Fig. 9 and Table 3). The sequences of the correspondingLBD, and TMB, show some conservation with that of torafugu(47.1%), medaka (36.3%), zebrafish (31.4%), X. tropicalis (31.2%),chicken (28.9%), and human (31.2%). In mammals, alternativesplicing at the 30 end of the gene transcript results in at least sixdistinct mRNA transcripts that produce a variety of LepR proteinisoforms (Zabeau et al., 2003). This study detected the five isoforms

Mg Ad BF Wm Rm Ki Li Te Ov

h EF1a expression in juvenile Atlantic salmon post-smolts. Error bars represent SEMl; Sk, skin; He, heart; St, stomach; Pc, pyloric caeca; Mg, mid-gut; Ad, adipose tissue;ary.

Transmembrane segment

Stop codon

in Atlantic salmon. The same pattern/color indicates same sequence coding region.

Fig. 7. Salmon leptin receptor (sLepR) nucleotide sequence and predicted amino acid sequence (GenBank Accession No. AB489201). The cleavage site of the signal peptide(broken line) is estimated using the SignalP Ver. 3.0 program. Underlined amino acid sequences denote conserved domains (FN III domains and Ig C2-like domain). The leptin-binding domain is shaded. The conserved motifs for LepR (WSXWS repeated tryptophan/serine motifs, JAK2-binding motif boxes and STAT-binding motif box) are boxed.Double underline indicates the transmembrane domain.

64 I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70

that have differences in 30 end of the mRNA sequence (Fig. 6). Ofthese, only the longest form conserved all functionally importantdomains (such as three FN III domains, the Ig C2-like domain, a pair

of WSXWS motifs, two JAK2-binding motif boxes, and a STAT-bind-ing domain, Fig. 7), while the other four forms have only the intra-cellular region. The long form of mammalian LepR has a function

Fig. 7 (continued)

Sheep (NP_001009763)

Cattle (NP_001012285)

Pig (NP_001019758)

Dog (NP_001019805)

Human (AAA93015)

Rat (BAA12698)

Mouse (CAM20702)

Duck (ACF17729)

Chicken (BAA94292)

X. tropicalis (NP_001037866)

Zebrafish (AAY16198)

Atlantic salmon (AB489201)

Torafugu (BAG67079)

Marine medaka (ABC86922)

Japanese medaka (AB457590)

Mammalian

Avian

Amphibian

Teleostean

Fig. 8. Phylogenetic analysis of leptin receptor (LepR) amino acid sequences. The scale bar indicates the substitution rate per residue. Numbers at nodes indicate thebootstrap value, as percentages, obtained for 1000 replicates. GenBank accession numbers are indicated after the species name, with Atlantic salmon in bold.

I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70 65

for full signal transduction through the JAK/STAT pathways,whereas the shorter forms exhibit partial or no signaling capabili-ties (Baumann et al., 1996; Tartaglia, 1997). The biological impor-tance of long form LepR through via the JAK/STAT pathway in

maintaining body weight and energy homeostasis has been defin-itively demonstrated (Bates et al., 2003). This is the first report thatplural LepR transcripts have been detected in any ectothermspecies.

Table 3Amino acid sequence identities of the salmon leptin receptor (sLepR) with LepR of various vertebrates. Comparison is performed with four domains including the mature form(excluding signal peptide), extracellular domain (ECD), intracellular domain (ICD), and leptin-binding domain (LBD) of LepR.

Species Accession no. Amino acid identities of the LepR (%)

Mature ECD ICD LBD

Atlantic salmon AB489201 100 100 100 100Torafugu BAG67079 42.6 43.9 38.3 47.1Marine medaka ABC8692 37.5 38.6 28.2 36.3Zebrafish AAY16198 32.5 33.6 38.5 31.4X. tropicalis NP_001037866 22.9 23.8 22.2 31.2Duck ACF17729 25.0 26.6 22.8 29.8Chicken BAA94292 23.5 25.3 22.8 28.9Mouse CAM20702 23.7 24.2 23.0 32.7Rat BAA12698 23.3 23.9 22.1 31.7Pig NP_001019758 24.9 25.0 23.6 31.7Cattle NP_001012285 24.6 24.8 23.7 31.7Dog NP_001019805 25.7 25.9 23.4 30.3Human AAA93015 24.2 24.4 23.6 31.2

Fig. 9. Alignment of amino acid sequences of sLepR leptin-binding domain in various vertebrates. GenBank Accession Nos.: human, AAA93015; Duck, ACF17729; X. tropicalis,NP_001037866; Atlantic salmon, AB489201; Torafugu, BAG67079; Marine medaka, ABC86922; zebrafish, AAY16198.

66 I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70

In the present study, only one copy of the LepR gene has beenidentified in Atlantic salmon, which is also the case for the otherteleost species investigated; medaka, zebrafish, torafugu, and mar-ine medaka (Kurokawa and Murashita, 2009; Kurokawa et al.,2008). Based on a genomic synteny approach in the Takifugu gen-ome (Kurokawa et al., 2008), it was suggested that teleosts gener-ally only have one LepR gene, but tetraploid species such assalmonids and common carp may have two LepR genes. Thus, fur-ther studies should be undertaken to identify a potential secondgene and other types of mRNA transcripts for sLepR in Atlanticsalmon.

4.2. Tissue expression of salmon leptin and leptin receptor

The tissue expression pattern for the two sLep paralogue genesin Atlantic salmon differs substantially. In general, sLepA1 has a

higher expression in tissues typically associated with lipid storage,while sLep A2 has a higher expression in the gastrointestinal tract(Fig. 5). However, the highest expression of sLepA1 mRNA is ob-served in the brain. Other tissues with high expression of sLepA1are white muscle, liver, ovaries and the lipid-containing tissuesalong the mid-ventral abdominal section, the belly flap (Fig. 5). Ex-cept for stomach and mid-gut, the only tissue where sLepA2 has ahigher expression is the kidney. Although there are differences inthe relative sLepA1 and sLepA2 mRNA expression between tissuesand organs analyzed in both juvenile post-smolts (45–350 g; Fig. 5)and the control group (100%) of large, non-mature salmon(5415 ± 473 g; Fig. 11), the expression patterns are similar.

The tissue-specific expression of sLepA2 and sLepA1 indicatessome similarities, but also differences, in Lep function betweenmammals and teleosts, as well as among teleosts. The expressionof sLep in tissues such as brain, eye, gill, skin, heart, and kidney

sLep

R m

RN

A le

vels

(rel

ativ

e un

its)

Tissues

0

0.5

1

1.5

2

2.5

3

3.5

Br Pi Ey Gi Sk He St Pc Mg Ad Bf Wm Rm Ki Li Te Ov

sLep

R m

RN

A le

vels

(rel

ativ

e un

its)

Tissues

0

0.5

1

1.5

2

2.5

3

3.5

Br Pi Ey Gi Sk He St Pc Mg Ad Bf Wm Rm Ki Li Te Ov

Fig. 10. Tissue distribution of the leptin receptor (sLepR) in Atlantic salmon juvenile post-smolts as relative expression levels. After standardization with the EF1a gene, sLepRmRNA levels were normalized as the average of brain LepR levels = 1. Error bars represent standard error of the mean (n = 4 for testis and ovary, n = 7–8 for other tissues). Br,brain; Ey, eye; Pi, pituitary; Gi, gill; Li, liver; Pc, pyloric caeca; Mg, mid-gut; He, heart; Ki, kidney; Ad, adipose tissue; Bf, belly flap; Sk, skin; Wm, white muscle; Rm, redmuscle; Te, testis; Ov, ovary.

Table 4Effect of rationed feeding for 10 months on size in Atlantic salmon reared at Instituteof Marine Research Station at Matre, Norway. The sampled fish from each group wererepresentative non-maturing males (n = 6 for each group) sampled in August 2007.

60% (rationed feeding) 100% (control)

Weight (g) 3614 ± 356 5415 ± 473*

Length (cm) 67.0 ± 2.2 76.5 ± 1.4**

*p < 0.05, **p < 0.01, significant differences between treatments.

I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70 67

indicates that sLep has multiple roles, not necessarily only linkedto regulation of energy homeostasis. In mammals, the primarysites of Lep expression are liver and adipose tissue (Crespi andDenver, 2006). The high Lep expression in adipose tissue in mam-mals reflects the role of Lep in energy homeostasis where Lep ismainly produced and secreted into circulation from adipocytes,signaling body lipid reserves (Lee and Fried, 2009). Atlantic salmonalso has significant sLepA1 mRNA levels in fatty tissues, includingbelly flap, white muscle, and visceral adipose tissue, although theirrelative expression levels vary (Figs. 5 and 11).

In striped bass, Morone saxatilis, the fat content of the belly flapcan be used for estimating whole-body proximate composition,and a linear relationship has been demonstrated between belly flaplipid and total lipid composition, as well as with whole-body en-ergy (Jacobs et al., 2008). While the belly flap is anatomically a partof the muscle tissue (Zhou et al., 1995), its lipid levels can be >10-fold higher than that of other white muscle (Nanton et al., 2007).Myosepta are a major tissue component around the belly flapand their volume proportion decreases sharply from this ventralarea through to the flank region (Zhou et al., 1995). In contrast,the visceral fat in Atlantic salmon consists almost entirely of adipo-cytes (Nanton et al., 2007) and it was therefore unexpected thatsLep expression in this tissue is apparently lower than in muscle,where there are less adipocytes (Figs. 5 and 11). Carp has also beenshown to have low Lep mRNA levels in the visceral adipose tissue(Huising et al., 2006). Whether this reflects that there are tissue-specific differences in the characteristics of adipocytes remains tobe investigated.

The role of the liver in storage and allocation of energy differsamong teleosts. Some species such as the Atlantic cod, Gadus mor-hua, deposit excess energy to a large extent as fat in a relativelylarge liver, attaining a liver-somatic index (LSI) of 12% (Hansenet al., 2008), whereas Atlantic salmon, as other salmonids typicallyhas an LSI of 1–2% (Hemre et al., 2005). Thus, salmonids use the

liver only to a minor extent for energy storage, mostly glycogen,and rather deposit fat in muscle, where fat content can reach 15–20% (refs), as well as in visceral fat. Still, the liver showed signifi-cant levels of sLepA1 expression and comparative to that of whitemuscle, although the expression response during reduced feedingwas different between these tissues (see below). A high hepaticexpression of LepA paralogues has also been seen in pufferfish(Kurokawa et al., 2005), common carp (Huising et al., 2006), Japa-nese medaka (Kurokawa and Murashita, 2009), and zebrafish (Gor-issen et al., 2009). The cellular localization of hepatic sLepA1 andA2 is not known, but in situ hybridization analysis in pufferfishdemonstrated that the hepatocytes contained abundant oil drop-lets and positive signals for pLep were detected in the hepatocytecytoplasma (Kurokawa et al., 2005). This indicates that at least insome teleosts liver expression of Lep is linked to energy metabo-lism of the hepatocytes.

The identification of Lep gene expression in the gastrointestinaltract of Atlantic salmon is in agreement with results on mammals.In mammals, Lep is produced in the stomach and released into thegastric juice following a meal (Bado et al., 1998; Guilmeau et al.,2003). Subsequently, Lep is transported anterograde with thechyme into the gut, reaching brush border LepRs on the apical sideof the enterocytes (Buyse et al., 2001; Guilmeau et al., 2003). There,Lep directly affects intestinal absorption of peptides by inducingtranslocation of an intracellular preformed pool of a peptide trans-porter, PepT1, to the apical enterocyte membrane (Buyse et al.,2001). This suggests that Lep may act in regulating the absorptivecapacity for nutrients in intestine, thereby indirectly also affectingthe energy homeostasis. In mammals, there are also chronic andsystemic effects of Lep on the GI tract that involves basolateral Lep-Rs on the enterocytes (Barrenetxe et al., 2002). In the presentstudy, Lep mRNA expression was found in the stomach, as wellas expression of the LepR in the intestine. Thus, the present datamake it plausible that Lep is involved in signaling in the GI tractsimilar to that in mammals. A peptide transporter PepT1 has re-cently been identified in all post-gastric segments of the Atlanticsalmon intestine (Rønnestad et al., 2010). The paralogue mainlyassociated with the GI tract in salmon is sLepA2, while sLepA1has a very low expression in this organ, suggesting that the twosLep paralogues have acquired different physiological functionsin Atlantic salmon.

The relatively ubiquitous expression of sLepR in salmon tissuessupports diverse roles of Lep in teleosts. In mammals, Lep has beenimplicated in the regulation of a wide range of physiological

Belly Flap

60 % 100 %0.000

0.005

0.010

2

3

4 sLepA1sLepA2

sLep

mR

NA

leve

ls *

1000

(rel

ative

uni

ts)

Visceral adipose tissue

60 % 100 %0

5

10

15

20

25

sLep

mR

NA

leve

ls *

1000

(rel

ative

uni

ts)

Liver

60 % 100 %0

5

10

15

20

25

sLep

mR

NA

leve

ls *

1000

(rel

ative

uni

ts)

White muscle

60 % 100 %0

1

2

330

40

50

60

70

sLep

mR

NA

leve

ls *

1000

(rel

ative

uni

ts)

sLepR Brain

60 % 100 %0

50

100

150

200

sLep

mR

NA

leve

ls *

1000

(rel

ative

uni

ts)

Circulating levels

60 % 100 %0

200

400

600

800

1000

Seru

m s

Lep

(pM

)

*

**

*

Fig. 11. Effect of rationed feeding to Atlantic salmon on sLepA1 and A2 expression in selected tissues, leptin receptor (sLepR) expression in the brain and serum levels of sLep.Data for non-maturing males 3614 ± 356 g (feed-restricted group) and 5415 ± 473 g (control group) sampled in August 2007. mRNA levels were normalized with EF1a.*p < 0.05, **p < 0.01, significant differences between treatments. Data presented as means and SEM (n = 6).

68 I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70

systems independent of its endocrine role in energy balance, e.g.the reproductive, thyroid, growth and adrenal axes, and in the GItract (Ahima et al., 2000). In salmon, several tissues such as thegills express both the sLep and the sLepR genes (Figs. 5 and 10),pointing to possible paracrine sLep functions. The branchial sLepRexpression in Atlantic salmon is in agreement with data on marinemedaka (Wong et al., 2007) where LepR expression is responsive tohypoxia. The LepR hypoxia response in medaka is, however, notlimited to the gills, but occurs also in such tissues as liver and heartsuggesting a broader metabolic and signaling effect (Wong et al.,2007).

The expression of sLepR and also sLepA1 and sLepA2 in theAtlantic salmon ovary and testis points to possible interactions be-tween sLep and reproductive physiology at the level of the gonad.In mammals, LepR is expressed in both theca and granulosa cells inaddition to expression in specific testis cells (Quintero and Cortez,2008; Ruiz-Cortes et al., 2000). The present study did not focus onsexual differences and a potential role of Lep in reproduction, beinglimited to juvenile males. However, further experiments of matu-rational and gender differences are in progress in our laboratories.

In mammals, the brain is one of the main sites of LepR expres-sion (Ahima et al., 2000), where Lep exerts effects on the neuropep-

tide system in the hypothalamus, which determines hunger andenergy expenditure. Also, the pituitary gland is a target for endo-crine action of Lep in mammals, as shown by a high LepR expres-sion (Morash et al., 1999). Both these organs have high levels ofLepR expression also in salmon (Fig. 7). The high sLepA1 expressionin the brain is at present not understood, but could be linked withthe high fat content in nervous tissues.

4.3. Effects of rationed feeding

The main aim of the present study was to obtain full-lengthmRNA sequences for Atlantic salmon orthologs of sLep and sLepRand to elucidate the phylogeny as well as the tissue distributionof mRNA of these genes. However, as an initial step towards under-standing the biological roles of Lep in Atlantic salmon, long-termeffects of feeding status were examined. Rationed feeding (60% offull ration for 10 months) resulted in a significantly lower growth,and the results suggest that this led to lower sLepA1 mRNA expres-sion in the main lipid-storing tissues. The difference was largest invisceral fat, but a tendency was also seen in white muscle. Takentogether, these findings suggest a possible link between sLepA1expression and energy status in Atlantic salmon in line with the

I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70 69

mammalian model. sLepA2 has a very low expression and showslittle changes in these tissues, which does not support a similarrole for this paralogue. The effects observed in the liver were differ-ent to those of the other tissues assessed, and sLepA2 mRNA levelswere higher in the rationed group. The role of sLepA2 in the liverand its involvement in signaling of energy levels are at presentnot fully understood.

In mammals, the actions of Lep are both short- and long-term.Short-term postprandial increase in plasma Lep levels inhibits foodintake, whereas long-term energy status is communicated to thebrain based on the daily mean plasma Lep levels (Crespi and Den-ver, 2006). In the present study, there were no observed differencesin plasma sLep levels, despite differences in growth rate and differ-ences in sLepA1 and A2 expression, following a 10-month acclima-tion of Atlantic salmon to feed restriction. In contrast, plasma Leplevels increase during 3-week fasting of rainbow trout (Kling et al.,2009). This indicates potential differences in responses of the lep-tin system to long-term and short-term changes in nutritional sta-tus. In carp, where the liver has been identified as the main site ofLep expression, expression levels were not affected by 6-day or 6-week fasting, whereas a short-term, transient postprandial in-crease in hepatic LepA1 and LepA2 expression was found (Huisinget al., 2006). (In their original paper, Huising et al. (2006) termedthese two genes leptin I and II; but in their recent phylogeneticanalysis (Gorissen et al., 2009), they was renamed as leptin A1,and leptin A2 which fits well with our analysis; Fig. 4.) In zebrafish,hepatic LepA expression is high and not affected by 2-week fasting,while LepB, which is expressed at lower levels, is down-regulatedduring fasting (Gorissen et al., 2009).

Plasma levels of sLep in the present study were quantified witha homologous radioimmunoassay (RIA) which is based on a 14-aalong sequence of the mature sLepA1 (LSEALKDTTRKYGL) which isidentical to rainbow trout Lep, but differs from sLepA2 in the posi-tions labeled (S/E; T/S; T/V; Y/F) (Kling et al., 2009). At present, it isnot known if this RIA method, based on polyclonal antibodies, willquantify both forms and with equal efficiency. However, the assayhas been shown to exhibit measuring parallelism for a range of fishspecies, including Arctic char, Atlantic cod and turbot, suggestingthat the established RIA may quantify the sum of both paraloguesforms of sLep.

Central effects of plasma Lep on energy homeostasis will actthrough the LepR in the brain. In salmon with rationed feeding,the sLepR expression in the brain tended to be lower than in fullyfed fish (n.s.), suggesting that regulation of the LepR expressionlevels at the level of the brain may form a part of the regulatorysystem for Lep on energy homeostasis.

At present, data on Lep expression and function in teleosts arestill too scarce to allow generalization of how the Lep system isinfluenced by tissue-specific energy status and, in turn, may regu-late functions related to feed intake, growth, and adiposity in fish.In Atlantic salmon, the sLepA1 paralogue presently provides thebest correlation between energy status and sLep mRNA expressionin key tissues, supporting that it may act as an adiposity signal. ThesLepA2 may have an important role in the digestive tract, similar tothat found in mammals, but the high Lep expression in liver, bothin Atlantic salmon and other fish species, needs to be addressedfurther.

Acknowledgments

We thank Valentina Tronci, Margrethe Emblemsvåg, and Dr.Ann-Elise O. Jordal for technical assistance. This work has beensupported by Research Council of Norway Grant #172548/S40(I.R. and S.O.S.), a Research Fellowship of the Japan Society forthe Promotion of Science for Young Scientists to K.M. and in partby ‘‘the promotion of basic research activities for innovative biosci-

ences” of Bio-Oriented Technology Advancement Institution(BRAIN), Japan to T.K. The research leading to these results has re-ceived funding from the European Community’s Seventh Frame-work Programme (FP7/2007-2013) under Grant Agreement No.222719—LIFECYCLE (I.R., S.O.S., B.Th.B.).

References

Ahima, R.S., Flier, J.S., 2000. Leptin. Annu. Rev. Physiol. 62, 413–437.Ahima, R.S., Saper, C.B., Flier, J.S., Elmquist, J.K., 2000. Leptin regulation of

neuroendocrine systems. Front. Neuroendocrinol. 21, 263–307.Altmann, M., Von Borell, E., 2007. Leptin as an indicator for carcass composition in

farm animals. Anim. Sci. J. 78, 449–459.Bado, A., Levasseur, S., Attoub, S., Kermorgant, S., Laigneau, J.P., Bortoluzzi, M.N.,

Moizo, L., Lehy, T., Guerre-Millo, M., Le Marchand-Brustel, Y., Lewin, M.J.M.,1998. The stomach is a source of leptin. Nature 394, 790–793.

Barrenetxe, J., Villaro, A.C., Guembe, L., Pascual, I., Munoz-Navas, M., Barber, A.,Lostao, M.P., 2002. Distribution of the long leptin receptor isoform in brushborder, basolateral membrane, and cytoplasm of enterocytes. Gut 50, 797–802.

Bates, S.H., Stearns, W.H., Dundon, T.A., Schubert, M., Tso, A.W.K., Wang, Y.P., Banks,A.S., Lavery, H.J., Haq, A.K., Maratos-Flier, E., Neel, B.G., Schwartz, M.W., Myers,M.G., 2003. STAT3 signalling is required for leptin regulation of energy balancebut not reproduction. Nature 421, 856–859.

Bates, S.H., Kulkarni, R.N., Seifert, M., Myers, M.G., 2005. Roles for leptin receptor/STAT3-dependent and -independent signals in the regulation of glucosehomeostasis. Cell Metab. 1, 169–178.

Baumann, H., Morella, K.K., White, D.W., Dembski, M., Bailon, P.S., Kim, H.K., Lai, C.F.,Tartaglia, L.A., 1996. The full-length leptin receptor has signaling capabilities ofinterleukin 6-type cytokine receptors. Proc. Natl. Acad. Sci. USA 93, 8374–8378.

Boswell, T., Dunn, I.C., Wilson, P.W., Joseph, N., Burt, D.W., Sharp, P.J., 2006.Identification of a non-mammalian leptin-like gene: characterization andexpression in the tiger salamander (Ambystoma tigrinum). Gen. Comp.Endocrinol. 146, 157–166.

Buyse, M., Berlioz, F., Guilmeau, S., Tsocas, A., Voisin, T., Peranzi, G., Merlin, D.,Laburthe, M., Lewin, M.J.M., Roze, C., Bado, A., 2001. PepT1-mediated epithelialtransport of dipeptides and cephalexin is enhanced by luminal leptin in thesmall intestine. J. Clin. Invest. 108, 1483–1494.

Chomczynski, P., 1993. A reagent for the single-step simultaneous isolation of RNA,DNA and proteins from cell and tissue samples. Biotechniques 15 (532–533),536–537.

Crespi, E.J., Denver, R.J., 2006. Leptin (ob gene) of the South African clawed frogXenopus laevis. Proc. Natl. Acad. Sci. USA 103, 10092–10097.

Friedman, J.M., 2002. The function of leptin in nutrition: weight, and physiology.Nutr. Rev. 60, S1–S14.

Frøiland, E., Murashita, K., Jørgensen, E.H., Kurokawa, T., 2010. Leptin and ghrelin inanadromous Arctic charr: Cloning and change in expressions during a seasonalfeeding cycle. Gen. Comp. Endocrinol. 165, 136–143.

Gorissen, M., Bernier, N., Nabuurs, S., Flik, G., Huising, M., 2009. Two divergentleptin paralogues in zebrafish (Danio rerio) that originate early in teleosteanevolution. J. Endocrinol. 201, 329–339.

Guilmeau, S., Buyse, M., Tsocas, A., Laigneau, J.P., Bado, A., 2003. Duodenal leptinstimulates cholecystokinin secretion—evidence of a positive leptin–cholecystokinin feedback loop. Diabetes 52, 1664–1672.

Hansen, J.O., Berge, G.M., Hillestad, M., Krogdahl, A., Galloway, T.F., Holm, H., Holm,J., Ruyter, B., 2008. Apparent digestion and apparent retention of lipid and fattyacids in Atlantic cod (Gadus morhua) fed increasing dietary lipid levels.Aquaculture 284, 159–166.

Hemre, G.I., Sanden, M., Bakke-Mckellep, A.M., Sagstad, A., Krogdahl, A., 2005.Growth, feed utilization and health of Atlantic salmon Salmo salar L. fedgenetically modified compared to non-modified commercial hybrid soybeans.Aquacult. Nutr. 11, 157–167.

Huising, M.O., Geven, E.J.W., Kruiswijk, C.P., Nabuurs, S.B., Stolte, E.H., Spanings,F.A.T., Verburg-Van Kemenade, B.M.L., Flik, G., 2006. Increased leptin expressionin common carp (Cyprinus carpio) after food intake but not after fasting orfeeding to satiation. Endocrinology 147, 5786–5797.

Jacobs, J.M., Rhodes, M.R., Martin, B., McIntosh, D., Van Heukelem, W.F., Harrell,R.M., 2008. Tissue-specific sampling for the estimation of striped bass whole-body proximate composition. Trans. Am. Fish. Soc. 137, 386–392.

Jaillon, O., Aury, J.M., Brunet, F., Petit, J.L., Stange-Thomann, N., Mauceli, E., Bouneau,L., Fischer, C., Ozouf-Costaz, C., Bernot, A., Nicaud, S., Jaffe, D., Fisher, S., Lutfalla,G., Dossat, C., Segurens, B., Dasilva, C., Salanoubat, M., Levy, M., Boudet, N.,Castellano, S., Anthouard, R., Jubin, C., Castelli, V., Katinka, M., Vacherie, B.,Biemont, C., Skalli, Z., Cattolico, L., Poulain, J., de Berardinis, V., Cruaud, C.,Duprat, S., Brottier, P., Coutanceau, J.P., Gouzy, J., Parra, G., Lardier, G., Chapple,C., McKernan, K.J., McEwan, P., Bosak, S., Kellis, M., Volff, J.N., Guigo, R., Zody,M.C., Mesirov, J., Lindblad-Toh, K., Birren, B., Nusbaum, C., Kahn, D., Robinson-Rechavi, M., Laudet, V., Schachter, V., Quetier, F., Saurin, W., Scarpelli, C.,Wincker, P., Lander, E.S., Weissenbach, J., Crollius, H.R., 2004. Genomeduplication in the teleost fish Tetraodon nigroviridis reveals the earlyvertebrate proto-karyotype. Nature 431, 946–957.

Johansen, S.J.S., Ekli, M., Stangnes, B., Jobling, M., 2001. Weight gain and lipiddeposition in Atlantic salmon, Salmo salar, during compensatory growth:evidence for lipostatic regulation? Aquacult. Res. 32, 963–974.

70 I. Rønnestad et al. / General and Comparative Endocrinology 168 (2010) 55–70

Johansen, S.J.S., Ekli, M., Jobling, M., 2002. Is there lipostatic regulation of feed intakein Atlantic salmon Salmo salar L.? Aquacult. Res. 33, 515–524.

Kling, P., Rønnestad, I., Stefansson, S.O., Murashita, K., Kurokawa, T., Bjornsson, B.T.,2009. A homologous salmonid leptin radioimmunoassay indicates elevatedplasma leptin levels during fasting of rainbow trout. Gen. Comp. Endocrinol.162, 307–312.

Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecularevolutionary genetics analysis and sequence alignment. Brief. Bioinform. 5,150–163.

Kurokawa, T., Murashita, K., 2009. Genomic characterization of multiple leptingenes and a leptin receptor gene in the Japanese medaka, Oryzias latipes. Gen.Comp. Endocrinol. 161, 229–237.

Kurokawa, T., Suzuki, T., Hashimoto, H., 2003. Identification of gastrin and multiplecholecystokinin genes in teleost. Peptides 24, 227–235.

Kurokawa, T., Uji, S., Suzuki, T., 2005. Identification of cDNA coding for a homologueto mammalian leptin from pufferfish, Takifugu rubripes. Peptides 26, 745–750.

Kurokawa, T., Murashita, K., Suzuki, T., Uji, S., 2008. Genomic characterization andtissue distribution of leptin receptor and leptin receptor overlapping transcriptgenes in the pufferfish, Takifugu rubripes. Gen. Comp. Endocrinol. 158, 108–114.

Leaver, M.J., Bautista, J.M., Bjornsson, B.T., Jonsson, E., Krey, G., Tocher, D.R.,Torstensen, B.E., 2008. Towards fish lipid nutrigenomics: current state andprospects for fin-fish aquaculture. Rev. Fish. Sci. 16, 73–94.

Lee, M.J., Fried, S.K., 2009. Integration of hormonal and nutrient signals that regulateleptin synthesis and secretion. Am. J. Physiol. Endocrinol. Metab. 296, E1230–E1238.

Li, G.-G., Liang, X.-F., Xie, Q., Li, G., Yu, Y., Lai, K., 2010. Gene structure, recombinantexpression and functional characterization of grass carp leptin. Gen. Comp.Endocrinol. 166, 117–127.

Londraville, R.L., Duvall, C.S., 2002. Murine leptin injections increase intracellularfatty acid-binding protein in green sunfish (Lepomis cyanellus). Gen. Comp.Endocrinol. 129, 56–62.

Morash, B., Li, A., Murphy, P.R., Wilkinson, M., Ur, E., 1999. Leptin gene expression inthe brain and pituitary gland. Endocrinology 140, 5995–5998.

Morris, D.L., Rui, L.Y., 2009. Recent advances in understanding leptin signaling andleptin resistance. Am. J. Physiol. Endocrinol. Metab. 297, E1247–E1259.

Murashita, K., Uji, S., Yamamoto, T., Rønnestad, I., Kurokawa, T., 2008. Production ofrecombinant leptin and its effects on food intake in rainbow trout(Oncorhynchus mykiss). Comp. Biochem. Physiol. B: Biochem. Mol. Biol. 150,377–384.

Nanton, D.A., Vegusdal, A., Rora, A.M.B., Ruyter, B., Baeverfjord, G., Torstensen, B.E.,2007. Muscle lipid storage pattern, composition, and adipocyte distribution indifferent parts of Atlantic salmon (Salmo salar) fed fish oil and vegetable oil.Aquaculture 265, 230–243.

Olsvik, P.A., Lie, K.K., Jordal, A.E.O., Nilsen, T.O., Hordvik, I., 2005. Evaluation ofpotential reference genes in real-time RT-PCR studies of Atlantic salmon. BMCMol. Biol. 6.

Perriere, G., Gouy, M., 1996. WWW-Query: An on-line retrieval system for biologicalsequence banks. Biochimie. 78, 364–369.

Peyon, P., Zanuy, S., Carrillo, M., 2001. Action of leptin on in vitro luteinizinghormone release in the European sea bass (Dicentrarchus labrax). Biol. Reprod.65, 1573–1578.

Pfaffl, M.W., Tichopad, A., Prgomet, C., Neuvians, T.P., 2004. Determination of stablehousekeeping genes, differentially regulated target genes and sample integrity:BestKeeper – Excel-based tool using pair-wise correlations. Biotech. Lett. 26,509–515.

Quintero, J.C., Cortez, Z.T.R., 2008. Effects of the leptin in the onset of puberty inanimal males. Rev. Colomb Cienc. Pecu. 21, 97–108.

Rock, F.L., Altmann, S.W., vanHeek, M., Kastelein, R.A., Bazan, J.F., 1996. The leptinhaemopoietic cytokine fold is stabilized by an intrachain disulfide bond. Horm.Metab. Res. 28, 649–652.

Rønnestad, I., Murashita, K., Kottra, G., Jordal, A.-E., Narawane, S., Jolly, C., Daniel, H.,Verri, T., 2010. Molecular cloning and functional expression of atlantic Salmonpeptide transporter 1 in Xenopus oocytes reveals efficient intestinal uptake oflysine-containing and other bioactive di- and tripeptides in teleost fish. J. Nutr.140, 893–900.

Ruiz-Cortes, Z.T., Men, T., Palin, M.F., Downey, B.R., Lacroix, D.A., Murphy, B.D., 2000.Porcine leptin receptor: molecular structure and expression in the ovary. Mol.Reprod. Dev. 56, 465–474.

Spady, T.J., Harlow, H.J., Butterstein, G., Durrant, B., 2009. Leptin as a surrogateindicator of body fat in the American black bear. Ursus 20, 120–130.

Tartaglia, L.A., 1997. The leptin receptor. J. Biol. Chem. 272, 6093–6096.Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W: improving the

sensitivity of progressive multiple sequence alignment through sequenceweighting, position-specific gap penalties and weight matrix choice. NucleicAcids Res. 22, 4673–4680.

Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.G., 1997. TheCLUSTAL_X windows interface: flexible strategies for multiple sequencealignment aided by quality analysis tools. Nucleic Acids Res. 25, 4876–4882.

Vishesh, A., Arora, S., 2008. Leptin and its metabolic interactions—an update.Diabetes Obes. Metab. 10, 973–993.

Volkoff, H., Eykelbosh, A.J., Peter, R.E., 2003. Role of leptin in the control of feeding ofgoldfish Carassius auratus: interactions with cholecystokinin, neuropeptide Yand orexin A, and modulation by fasting. Brain Res. 972, 90–109.

Weil, C., Le Bail, P.Y., Sabin, N., Le Gac, F., 2003. In vitro action of leptin on FSH andLH production in rainbow trout (Onchorynchus mykiss) at different stages of thesexual cycle. Gen. Comp. Endocrinol. 130, 2–12.

Wong, M.M.L., Yu, R.M.K., Ng, P.K.S., Law, S.H.W., Tsang, A.K.C., Kong, R.Y.C., 2007.Characterization of a hypoxia-responsive leptin receptor (omLepR(L)) cDNAfrom the marine medaka (Oryzias melastigma). Mar. Pollut. Bull. 54, 797–803.

Zabeau, L., Lavens, D., Peelman, F., Eyckerman, S., Vandekerckhove, J., Tavernier, J.,2003. The ins and outs of leptin receptor activation. FEBS Lett. 546, 45–50.

Zar, J.H., 1996. Biostatistical Analysis. Prentice Hall, NJ, USA.Zhang, Y.Y., Proenca, R., Maffei, M., Barone, M., Leopold, L., Friedman, J.M., 1994.

Positional cloning of the mouse obese gene and its human homolog. Nature 372,425–432.

Zhang, F.M., Basinski, M.B., Beals, J.M., Briggs, S.L., Churgay, L.M., Clawson, D.K.,DiMarchi, R.D., Furman, T.C., Hale, J.E., Hsiung, H.M., Schoner, B.E., Smith, D.P.,Zhang, X.Y., Wery, J.P., Schevitz, R.W., 1997. Crystal structure of the obeseprotein leptin-E100. Nature 387, 206–209.

Zhou, S.Y., Ackman, R.G., Morrison, C., 1995. Storage of lipids in the myosepta ofAtlantic salmon (Salmo salar). Fish Physiol. Biochem. 14, 171–178.