globin gene family evolution and functional diversification in annelids

Globin gene family evolution and functional diversificationin annelidsXavier Bailly1,*,�, Christine Chabasse1,*, Stephane Hourdez1, Sylvia Dewilde2, Sophie Martial1,Luc Moens2 and Franck Zal1

1 Equipe Ecophysiologie: Adaptation et Evolution Moleculaires, UPMC – CNRS UMR 7144, Station Biologique, BP 74, Roscoff, France

2 Biochemistry Department, University of Antwerp, Belgium

Globins are heme-containing proteins that reversibly

bind oxygen and other gaseous ligands, and are wide-

spread in the three major kingdoms of life [1,2].

Despite the great diversity of their amino-acid

sequences, the basic functional unit is assumed to be a

monomeric globin with a specific and highly conserved

fold referred to as the ‘globin-fold’. On the basis of

this conserved basic structure and its prevalence in

living organisms, it has been suggested that globin

genes evolved from a common ancestral gene which,

after successive duplications and speciation events,

led to the genes that encode the widespread globin

superfamily [1–5].

Three types of globin have been described in anne-

lids: (a) noncirculating intracellular globin [e.g. myo-

globin (Mb) found in the cytoplasm of muscle cells]

[5,6]; (b) circulating intracellular globin [e.g. hemo-

globin (Hb) found in erythrocytes] [7]; (c) extracellu-

lar globin dissolved in circulating fluids [7,8]. These

three types of globin display diversity in sequence,

quaternary structure and functions such as binding

and transport of oxygen and hydrogen sulfide, and

activity of superoxide dismutase and mono-oxygenase

[8].

Annelid noncirculating intracellular globins are gen-

erally encountered as monomers [9,10], and only the

Keywords

annelid; dehaloperoxidase; extracellular

globin; intracellular globin; myoglobin

Correspondence

F. Zal, Equipe Ecophysiologie: Adaptation et

Evolution Moleculaires, UPMC – CNRS

UMR 7144, Station Biologique, BP 74,

29682 Roscoff cedex, France

Fax:. +33 (0) 2 98 29 23 24

Tel: +33 (0) 2 98 29 23 09

E-mail: [email protected]

�Present address

Department of Cell Biology and Comparative

Zoology, Institute of Biology, University of

Copenhagen, Denmark

*These authors contributed equally to this

work

(Received 8 December 2006, revised 12

March 2007, accepted 20 March 2007)

doi:10.1111/j.1742-4658.2007.05799.x

Globins are the most common type of oxygen-binding protein in annelids.

In this paper, we show that circulating intracellular globin (Alvinella pom-

pejana and Glycera dibranchiata), noncirculating intracellular globin (Areni-

cola marina myoglobin) and extracellular globin from various annelids

share a similar gene structure, with two conserved introns at canonical

positions B12.2 and G7.0. Despite sequence divergence between intracellu-

lar and extracellular globins, these data strongly suggest that these three

globin types are derived from a common ancestral globin-like gene and

evolved by duplication events leading to diversification of globin types and

derived functions. A phylogenetic analysis shows a distinct evolutionary

history of annelid extracellular hemoglobins with respect to intracellular

annelid hemoglobins and mollusc and arthropod extracellular hemoglobins.

In addition, dehaloperoxidase (DHP) from the annelid, Amphitrite ornata,

surprisingly exhibits close phylogenetic relationships to some annelid intra-

cellular globins. We have characterized the gene structure of A. ornata

DHP to confirm assumptions about its homology with globins. It appears

that it has the same intron position as in globin genes, suggesting a com-

mon ancestry with globins. In A. ornata, DHP may be a derived globin

with an unusual enzymatic function.

Abbreviations

DHP, dehaloperoxidase; Hb, hemoglobin; HBL-Hb, hexagonal bilayer hemoglobin; Mb, myoglobin; nMb, nerve myoglobin.

FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS 2641

amino-acid sequences from the polychete, Arenicola

marina, [11] and the nucleotide sequence from the

polychete, Aphrodite aculeata, [24] have been obtained

previously. To date, only cDNA and amino-acid

sequences of circulating intracellular Hb belonging to

the marine polychete, Glycera dibranchiata, are known

[12,13]. Annelid extracellular hexagonal bilayer hemo-

globins (HBL-Hbs) are assembled into a large multi-

subunit structure with molecular mass of 3–4 MDa.

Some nucleotide and amino-acid sequences are already

known. Extracellular globin chains are encoded by

genes belonging to a multigenic family, the molecular

phylogeny of which has previously been studied

[15,16]. Only three annelid families are currently

known to express simultaneously the three types of

globin: the Terebellidae, the Alvinellidae and the

Opheliidae [17,18]. The sporadic co-occurrence of the

three globin types may be more common in the annelid

phylum, as they were probably already present in a

common ancestor.

Despite studies on the evolution of noncirculating

intracellular globins (Mbs) [5] and extracellular globins

[16,19,20], the phylogenetic relationships between these

different globins in annelids remain unclear because of

the lack of available sequences.

To understand the emergence and evolution of these

globins, we have sequenced new annelid extracellular

and intracellular globin polypeptides, cDNAs and

genes such as (a) the nucleotide sequences of two extra-

cellular globins from the polychete, Ar. marina, (b) the

nucleotide sequence of an Ar. marina Mb, (c) the

amino-acid and nucleotide sequence of the intracellular

circulating globin of the polychete, Alvinella pompejana,

(d) the nucleotide sequence of the intracellular circula-

ting globin of the polychete, G. dibranchiata, and (e)

the nucleotide sequence of dehaloperoxidase A

(DHPA) of the marine annelid polychete, Amphitrite

ornata. In the light of a molecular phylogeny including

intracellular and extracellular globins of annelids, mol-

luscs and arthropods, we address here a likely evolu-

tionary scenario for the origin of extracellular and

intracellular globins in annelids.

To complete and strengthen the phylogenetic analy-

sis, we also carried out a study on globin gene struc-

ture (intron positions), which provides an obvious

opportunity to explore gene evolution because genes

sharing the same intron positions are thought to be

homologous and closely related. The typical pattern of

two introns ⁄ three exons (with intron positions in B12.2

and G7.0) already found in numerous eukaryotic glo-

bin genes [1] has previously been reported in four

annelid extracellular globin genes from Lumbricus

terrestris [21], Eudystilia vancouverii [22] and Riftia

pachyptila [23]. Apart from the nerve myoglobin

(nMb) of Aph. aculeata in which the first intron is

missing [24], neither intracellular circulating nor non-

circulating globin gene structures are known. For this

survey, we have identified (a) gene structures of the

two new extracellular globins from Ar. marina, (b) the

gene structures of four extracellular globins from the

vestimentiferan, R. pachyptila, (c) the gene structure of

Ar. marina Mb, (d) the gene structure of the new intra-

cellular circulating globin from Al. pompejana, (e) the

gene structure of intracellular circulating globin from

G. dibranchiata, and (f) the gene structure of DHPA

from A. ornata.

Interestingly, blast searches revealed a strong

amino-acid similarity between intracellular Hbs from

Al. pompejana and DHP from A. ornata involved in

halometabolite detoxication (converts halogenated

phenols into quinones in the presence of hydrogen per-

oxide) [25]. These heme-containing enzymes exhibit

conserved distal and proximal histidines found in most

globin sequences [26], and the crystal structure of

native DHP exhibits a typical globin fold [27]. These

data suggest that DHP activity may have arisen by

duplication of a globin gene [27], but do not rule out a

possible evolutionary convergence. In this paper,

we also show that this annelid DHP protein illustrates

an original case of functional diversification from a

globin.

Results

Identification of the A2 and B2 extracellular

globin chains of Ar. marina

Two extracellular globin chains of Ar. marina (acces-

sion numbers AJ880690 and AJ880691 for cDNAs,

Q53I65 and Q53I64 for amino-acid sequences) were

aligned and compared with other globins in the mul-

tiple sequence alignment (Fig. 1 and Table 1). The

sequence of the extracellular globin from Lumbricus

terrestris [28] was used as reference for the helix

assignment (Fig. 1). These two new globin chains pos-

sess the well-conserved globin amino acids, Pro-C2,

Phe-CD1, His-F8 and Trp-H4, as well as the two

cysteines NA2 and H7 known to be involved in the

formation of an intrachain disulfide bridge [29,30].

Strong molecular signatures and phylogenetic analyses

allowed the unambiguous assignment of these two

new globin chains to A2 and B2 extracellular Hb

clusters according to the classification proposed by

Suzuki et al. [31] in which the A and B families are,

respectively, subdivided into A1, A2 and B1, B2 sub-

families.

Functional diversification in annelid globin family X. Bailly et al.

2642 FEBS Journal 274 (2007) 2641–2652 ª 2007 The Authors Journal compilation ª 2007 FEBS

A2 chain

This sequence contains an ORF of 157 codons (inclu-

ding the initiation codon). As in other annelid extracel-

lular globins, residues 1–16 correspond to a signal

peptide. This signal peptide was removed in the align-

ment presented in Fig. 1.

This sequence clearly belongs to the A family, as

evidenced by typical molecular features: Lys-A9,

Trp-B10 and also a deletion of three residues

between the A and B helices, and a deletion of one

residue between the F and G helices. Moreover,

the two residues Gly-Pro (at position A1-A2) indi-

cate that this sequence belongs to the A2 group

(Fig. 1).

B2 chain

This sequence contains an ORF of 165 codons (inclu-

ding the initiation codon). Residues 1–16 correspond

to a signal peptide. This signal peptide is not shown in

the alignment (Fig. 1).

This sequence exhibits amino acids that are typical

of the B family: Asp-A4, Trp-A16, Phe-B10 and Leu-

B13. Furthermore, it shows an insertion of three resi-

dues between the A and B helices, an insertion of one

residue between the F and G helices, and a three-resi-

due motif Pro-Gln-Val at position G17-19. Moreover,

the three-residue motif Thr-Gly-Arg between the A

and B helices indicates that this sequence belongs to

the B2 group (Fig. 1).

Fig. 1. Multiple alignment of annelid DHP,

extracellular and intracellular globins (circula-

ting and noncirculating) amino-acid

sequences. Intracellular globin sequences

are shaded. Positions of intron 1 (B12.2) and

2 (G7.0) are indicated by dashed lines. The

conserved amino-acid residues are indicated

in black. Letters above the sequence indi-

cate the helical designation, based on the

Lumbricus terrestris helical structure [28].

Signal peptides, when present, have been

removed. See Table 2 for abbreviations.

X. Bailly et al. Functional diversification in annelid globin family


Intracellular circulating globin of Al. pompejana

The partial cDNA sequence (accession number

AJ880693) was obtained using degenerate primers

designed from the amino-acid sequence obtained by

Edman degradation. This sequence displays the key

residues as Pro-C2, Phe-CD1, His-F8 and Trp-H4

(Fig. 1). However, as in Ar. marina myoglobin MbIIa

and A. ornata DHP, the conserved Trp-A12 is replaced

by an Ile residue.

Gene structure

Introns were sequenced and characterized for Ar. mar-

ina A2 and B2 extracellular globins (accession numbers

AJ880690 and AJ880691, respectively) and myoglobin

MbIIa (accession number AJ880692), the extracellular

A1, B1a, B1b and B1c globin chains from R. pachypti-

la, intracellular Hb from Al. pompejana, Hb mIV from

G. dibranchiata, and DHPA from A. ornata. Bailly

reported the intron position of R. pachyptila A2 and

B2 [23]. The position and length of each intron are

summarized in Table 2. For all the sequences, the

insertion positions of the two introns correspond to

the usual B12.2 and G7.0 positions previously reported

for many other globin sequences including L. terrestris

[32] and E. vancouverii globins [1,22] (Fig. 1).

The splicing sites have also been analyzed: it was

shown that the 5¢ splice donor is marked by an eight-

nucleotide conserved sequence, the 3¢ acceptor site cor-

responds to a pyrimidine-rich region of 11 nucleotides

followed by (C ⁄T)AG, and the typical branch point

signal corresponds to a five-nucleotide sequence that

functions as a signal for the spliceosome [33,34]. In all

introns, splicing donor and acceptor sequences con-

form to the consensus sequences (Table 2).

Phylogenetic relationships

The Bayesian tree based on annelid globin sequences

only is shown in Fig. 2. The NJ tree shows a similar

topology (data not shown). Two well-supported main

clusters can be identified: one comprises all intracellu-

lar globins and the other all the extracellular globins.

The intracellular cluster includes the nerve myoglobin

(nMb) and all Mbs and intracellular Hbs. The extra-

cellular cluster is divided into two groups: the A and B

families [15], as expected.

Al. pompejana intracellular Hb and A. ornata

DHP are most closely related to each other and obvi-

ously belong to a well-supported intracellular cluster,

distinct from a second cluster of intracellular globins

which includes G. dibranchiata Hb and Aph. aculeata

nMb.

In Fig. 3, which includes annelid, mollusc and arth-

ropod globins, annelid extracellular and intra-

cellular globins do not cluster together, but annelid

Table 1. Globin amino-acid sequences shown in the multiple align-

ment and molecular phylogeny.

Species Abbreviation

Accession

number

Amphitrite ornata DHP-Amph Q9NAV8

Arenicola marina A2a-Area Q53I65

B2-Area Q53I64

MbIa-Are Kleinschmidt [11]

Alvinella pompejana HbInt-Alva Q53I62

Aphrodite aculeata NMb-Aph Q93101

Eudistylia vancouverii A1-Eud Q9BKE9

Glycera dibranchiata mIV-Gly P022 16

P1-Gly P23216

Lamellibrachia sp. A2-Lam P15469

B1-Lam Q7Z1R4

B2-Lam Q86BV3

Lumbricus terrestris A1-LumT P08924

A2-LumT P022 18

B1-LumT P11069

B2-LumT P13579

Ophelia bicornis Mb-Oph Q56JK7

Pheretima hilgendorfi A1-Phehil P83122

Pheretima sieboldi A1-Phesie P11740

Riftia pachyptila A1-Rif Q8IFK4

A2-Rif P80592

B1b-Rif Q8IFK1

B2-Rif Q8IFJ9

Sabella spallanzanii A2-Sab Q9BHK1

B2a-Sab Q9BHK3

Tubifex tubifex A1-Tub P18202

Tylorrhynchus heterochaetus A1-Tyl P02219

A2-Tyl P09966

B2a-Tyl P13578

Buccinum undatum BuccMb Q7M424

Nassarius mutabilis NassaMb P31331

Scapharca inaequivalvis ScaHb1 Q26505

Anadara trapezia HBIaAna P14395

HBIIAna P14394

Barbatia lima BarbHBD Q17157

Biomphalaria glabrata HBD2Biom and

HBD3Biom

Q683R3

Artemia sp. Hb1Art to

HB9Art

Q7M454

E1ART P19363

E7ART P19364

Chironomus thummi thummi B1CHITH P02221

B2CHITH P02222

B6CHITH P02224

B7CHITH P12550

B8CHITH Q23763

B9CHITH P02223

a New sequences presented in this work.



intracellular globins are at the base of a cluster com-

posed of extracellular globins from the insect, Chirono-

mus thummi thummi. The extracellular globin family of

the other arthropod, Artemia salina, surprisingly clus-

ters independently of C. thummi thummi. This topology

illustrates the high level of divergence among extracel-

lular globin families between crustacean and insects in

the Arthropoda phylum, reflecting specific adaptations.

This is particularly obvious when the exon ⁄ intronstructures of arthropod globin genes (summarized in

[35]) are compared, showing the presence of the canon-

ical B12.2 and G7.0 introns position in the Artemia

crustacean and their absence in the Chironomus insects.

Discussion

Annelid globin gene structure

All introns described in this article exhibit the splicing

donor GT and acceptor AG sites (Table 2), whereas in

the L. terrestris B1 globin gene, the donor GT is

replaced by GC [32]. The typical branch point

sequence, involved in spliceosome binding, sometimes

diverges from the standard consensus sequence

(CTRAY), but studies have shown that this consensus

sequence may not reflect the majority of branch point

signals [34].

We used the intron insertion position pattern as ref-

erence in order to follow gene evolution relationships.

We assume that identical intron position between

genes is a strong argument to reject evolutionary

convergence between proteins exhibiting structural

similarity.

We have shown that R. pachyptila and Ar. marina

extracellular globins (A2 and B2), Ar. marina Mb and

Al. pompejana and G. dibranchiata intracellular Hb all

share the same typical two intron ⁄ three exon pattern

(Table 2). These results allow us to rule out the possi-

bility of structural and functional convergence between

circulating and noncirculating intracellular globin and

extracellular globin genes in annelids: these genes prob-

ably evolved from a common globin-like gene ancestor

and did not emerge independently of unrelated genes.

All the annelid intracellular globin gene structures

reported here show the same gene structure, whereas

Aph. aculeata nMb gene lacks the first intron [24]. This

might be explained by the loss of the first intron in the

Aph. aculeata nMb evolutionary lineage [24].

Table 2. Position, length of introns, exon ⁄ intron splice junctions and possible branch points in Ar. marina, Al. pompejana, R. pachyptila, G. di-

branchiata globins and A. ornata globin and DHP genes. Sequences in italic correspond to branch points where the well-conserved C or T or

A is not found. BP, Branch point. The consensus sequences presented are from Mount et al. [33,52].

Consensus Globin ⁄ DHP Intron Position Size (bp)

Splicing donorA ⁄ CAG gt a ⁄ gagt BP ctray

Splicing acceptor

yync ⁄ t ag GG ⁄ T

Ar. marina A2 Intron 1 B12.2 370 GGC gt taagt ⁄ ctgt ag TAIntron 2 G7.0 773 GAT gt aagt ctaaa ctat ag CT

B2 Intron 1 B12.2 487 GGA gt aagt ctaac ttac ag CCIntron 2 G7.0 495 GAC gt aagt ataac ctgc ag GA

R. pachyptila A2 Intron 1 B12.2 495 CCA gt gagt ctaat ttgc ag TGIntron 2 G7.0 639 GAC gt aagc cttat cctc ag AC

B2 Intron 1 B12.2 531 GAC gt aagc cttaa ttgc ag CCIntron 2 G7.0 390 TCT gt gagt ctgac ttgc ag CC

A1 Intron 1 B12.2 505 AAA gt aagt cttat tgac ag CGIntron 2 G7.0 473 GTT gt aagt gtcat ttgc ag GT

B1a Intron 1 B12.2 1183 CGA gt aagt ctcac catc ag GCIntron 2 G7.0 947 GGA gt aagt ctaat tttc ag GC

B1b Intron 1 B12.2 601 GTA gt aagt ctgac tcac ag CAIntron 2 G7.0 655 CAG gt agag ttaat ttgc ag CT

B1c Intron 1 B12.2 1029 CAG gt ttgt ctgac ttgc ag ATIntron 2 G7.0 489 CAG gt aaag ctaac ttgc ag GT

Al. pompejana Hb Intron 1 B12.2 135 GGA gt aagt ctaac accc ag GTIntra Intron 2 G7.0 241 GCT gt aagt ctaac tttc ag GA

Ar. marina Mb Intron 1 B12.2 301 CTT gt aagt ctcaa ccac ag CCIntron 2 G7.0 500 ACT gt aagt ctgac cgcc ag GA

G. dibranchiata mIV Intron 1 B12.2 978 CAA gt aagt ttgat tttc ag GTIntron 2 G7.0 912 GAG gt aggt ataac tttc ag CC

A. ornata DHP Intron 1 B12.2 110 CGC gt aagc ctcat ctgc ag ATIntron 2 G7.0 2424 GAG gt gaat atgac cttc ag AA



Distinct evolutionary history of extracellular

globins with respect to intracellular globins

in annelids

Working in the field of comparative biochemistry and

especially on intracellular hemerythrins and hemo-

globins, Manwell & Baker [36] drew attention to a

neglected problem in annelid globin evolution: ‘The

transition between intracellular and extracellular res-

piratory proteins represents a profound evolutionary

accomplishment. It is much more than placing an

appropriate signal polypeptide portion, labeling a pro-

tein for extracellular export.’

Molecular signatures (Fig. 1) clearly indicate that

circulating and noncirculating intracellular globins

share more common features among them than with

extracellular globins. Phylogenetic analyses (Fig. 2)

show that these intracellular globins cluster independ-

ently of extracellular globins, with high bootstrap

values (NJ method, data not shown). This strongly

suggests that extracellular globin lineages have a dis-

tinct evolutionary history with respect to circulating

and noncirculating intracellular globins. Experiments

performed on the polychete, Travisia japonica, by

Fushitani et al. [37] showed that antibodies against

extracellular globins did not cross-react with intracellu-

lar globins. This supports early or rapid divergence

between intracellular and extracellular globin lineages.

Globins are found in many unicellular organisms

such as archae, eubacteria and lower eukaryota [2,38–

40]. The acquisition of a signal peptide for the secre-

tion of extracellular globins is probably an apomorphic

characteristic in multicellular organisms with respect to

unicellular ones. It has been proposed that the secre-

tory peptide may have been acquired by insertion of

some other secreted protein gene by genetic recombi-

nation [41,42]. Therefore, the secretory peptide found

in all annelid extracellular globins must have been

Fig. 2. Bayesian phylogenetic tree based on

annelid extracellular and intracellular globins

(circulating and noncirculating) and DHP

amino-acid sequences. Posterior probability

values are indicated above the branches.



acquired by the original ancestral globin gene, which

has duplicated to give rise to the extracellular globin

multigenic family in this phylum (it is not parsimoni-

ous to envisage a repeated peptide signal acquisition in

the extracellular globin multigenic family).

Even though acquisition of a signal peptide must have

been a determinant step, other features are specific to

annelid extracellular globins. Extracellular state seems

to correlate with the formation of a high-molecular-

mass complex, limiting the protein’s contribution to the

total colloid osmotic pressure of body fluids (vascular

blood and coelomic fluids) [43] and to minimizing rapid

Hb loss by excretion. It is clear that the evolutionary

elaboration of the HBL-Hb structure simultaneously

involved the possibility for globins and linkers (proteins

involved in the structure of HBL-Hb) to interact and to

bind to dimers or other aggregation states while conser-

ving functionality. Indeed, linkers are thought to result

from duplication of globins and rearrangement of exons

[41]. It has been suggested that these ‘nonoxygen-bind-

ing subunits’ may also intrinsically possess superoxide

dismutase and ⁄or methemoglobin reductase activities

necessary to keep the Hb functional [36]. Evolution of

HBL-Hbs implies the coevolution of extracellular glo-

bins and linkers, which also represents a unique feature

of annelids with respect to other living organisms. Mol-

luscs and arthropods, which also sometimes express

extracellular Hbs, do not exhibit a HBL-Hb quaternary

structure and do not possess linkers. Arthropod extra-

cellular globin sequences also exhibit a signal peptide,

but possess neither internal disulfide bridge nor HBL-

Hb quaternary structure, which suggests a different evo-

lutionary history from extracellular globins in annelids.

In addition, annelid extracellular globins do not cluster

together with arthropod and mollusc extracellular glo-

bins as shown in Fig. 3. To date, it is not possible to

state whether annelid, arthropod and mollusc extracel-

lular globins come from an extracellular globin already

present in a common ancestor before their radiation.

Showing a clear homology between these extracellular

globins would require additional globin sequences.

However, in the Annelida phylum, the HBL-Hb

extracellular globins represent a phylum-specific inno-

vation, and the common gene structure shared between

all annelid globin types attest that extracellular globins

are homologous with the intracellular ones. This rules

out functional and structural convergence occurring by

a gene co-option process.

DHP is a derived globin

A. ornata DHP, Al. pompejana intracellular Hb

and Ar. marina Mb exhibit obvious molecular sig-

natures between each other and with the intracellular

Fig. 3. Bayesian phylogenetic tree based on

annelid, mollusc and arthropod extracellular

and intracellular globins and DHP amino-acid

sequences. Posterior probability values are

indicated above the branches.



monomeric globin N-terminal sequence of the poly-

chete, Enoplobranchus sanguineus [44]. These results,

suggesting a close relationship between DHP and

intracellular globin, are supported by molecular phylo-

genic analyses showing that A. ornata DHP, Al. pom-

pejana intracellular Hb, Ar. marina Mb and Ophelia

bicornis Mb cluster together with high bootstrap

values, with respect to other intracellular globins

(G. dibranchiata and Aph. aculeata nMb) and extra-

cellular globins. Interestingly, we have found that, in

A. ornata, the DHP-encoding gene exhibits the same

gene structure as extracellular globins, Ar. marina Mb

and intracellular globin from Al. pompejana and

G. dibranchiata.

The conserved intron positions between the three

annelid globin types and DHP, the DHP globin fold

and the amino-acid similarities between protein

sequences including globin and DHP allow us to rule

out structurally convergent evolution and indicate the

homology (i.e. common ancestry) of these genes. In

addition, like other typical globins, A. ornata DHP is

able to reversibly bind oxygen. It is found in the oxy-

ferrous (Fe2+) state when natively purified [26] and

also exhibits a globin fold, a heme group and distal

histidine [26,27].

We have confirmed by a molecular genetic approach

that DHP is a globin with a derived function, using

its heme to bind the peroxide ligand in order to cata-

lyze the oxidative dehalogenation of polyhalogenated

phenols.

The DHP function, derived from a canonical globin

structure encoded by a globin-like gene, may have

been an innovation selected after annelid radiation

from an oxygen carrying Hb as an adaptation driven

by selection based on territorial war between annelids

excreting halogenous compounds [25].

A. ornata possesses a monomeric circulating Hb in

its coelomic circulating cells [45], but the amino-acid

sequence is still unknown. It is not possible to state

whether DHP and intracellular Hb of A. ornata are

the same protein. Further molecular studies are needed

to confirm whether they are the same protein with

several functions or the result of gene duplication with

subsequent acquisition of a new function.

Experimental procedures

Collection of biological material

Juvenile specimens of the lugworm, Ar. marina, were collec-

ted at low tide from a sandy shore near Roscoff (Penpoull

Beach), Nord Finistere, France, and kept in local running

sea water for 24 h.

Specimens of Al. pompejana were collected at 2500 m

depth on the East Pacific Rise (9�50¢N at the M-vent site)

by the manned submersible Nautile during the HOPE¢99cruise. Once on board, the animals were kept in chilled sea

water (10 �C) until used for tissue collection (usually less

than 5 h). Tissues were then frozen in liquid nitrogen until

they were used.

Specimens of the hydrothermal vent tube worm,

R. pachyptila, were collected on the EPR (9�50¢N at the

Riftia Field site) at a depth of about 2500 m, during the

French oceanographic cruise HOT 96 and the American

cruise LARVE’99. The worms were sampled using the tele-

manipulated arms of the submersibles Nautile and Alvin,

brought back alive to the surface inside a temperature-insu-

lated basket, and immediately frozen and stored in liquid

nitrogen after their recovery on board.

Specimens of A. ornata were collected at Debidue flats,

in the North Inlet estuary (Georgetown, SC, 33�20¢N,

79�10¢W) and immediately placed in 70% alcohol until used

for DNA extraction.

Specimens of G. dibranchiata were collected in Maine,

USA and immediately preserved in 70% alcohol until used

for DNA extraction.

Preparation of Al. pompejana intracellular Hb

Coelomic fluid was collected by carefully opening the dorsal

body wall in the middle part of the body. The coelomic fluid

was centrifuged at 1000 g for 3 min at 4 �C, and the cells

were washed twice with filtered sea water. After the last cen-

trifugation, three volumes of distilled water were added to

the pellet of cells obtained, inducing cell lysis. The suspension

obtained was then centrifuged at 10 000 g for 5 min at 4 �C.The supernatant, containing the cell extract, was then separ-

ated and frozen in liquid nitrogen. To prevent hydrolysis by

proteases, phenylmethanesulfonyl fluoride was added to a

final concentration of 1 lmolÆL)1 before freezing. Intracellu-

lar Hb was prepared as previously described [18].

Protein sequencing of Al. pompejana intracellular

Hb

Heme was extracted by acid acetone precipitation.

‘De-hemed’ Hb was pyridylethylated as described by Allen

[46] and subsequently dialysed against 0.1% trifluoroacetic

acid. The protein was modified with maleic anhydride and

cleaved with trypsin and CNBr. An Asp-Pro cleavage

was performed as described by Allen [46]. The tryptic

peptides were separated by HPLC on a reversed-phase

Vydac C4 column developed with 0.1% trifluoroacetic

acid ⁄ acetonitrile. The CNBr and Asp-Pro peptides were

separated by SDS ⁄PAGE [47], and subjected to electroblot-

ting. The peptides were sequenced in an ABI 471-B

sequencer (Applied Biosystems, Foster City, CA, USA)



operated as recommended by the manufacturer. The

N-terminal sequence was obtained by subjecting intact Hb

to Edman degradation.

Total RNA extraction and cDNA synthesis

Entire juvenile specimens of Ar. marina and Al. pompejana

were crushed in liquid nitrogen. Total RNA was extracted

using RNAble� buffer (Eurobio, Courtaboeuf, France),

and poly(A) RNA was then isolated using an mRNA Puri-

fication Kit� (Amersham, Little Chalfont, Buckingham-

shire, UK). RT-PCR was carried out using an anchor

5¢-CTCCTCTCCTCTCCTCTTCC(T)17 primer.

Isolation of genomic DNA

Whole specimens of Ar. marina, Al. pompejana, R. pachypti-

la, G. dibranchiata and A. ornata were washed in deionized

water, and then incubated in 700 lL PK Buffer (50 mm

Tris ⁄HCl, 100 mm NaCl, 25 mm EDTA and 1% SDS, pH 8)

with 15 lL Proteinase K (10 lgÆlL)1) at 65 �C for 1 h. The

supernatant was separated by centrifugation at 12 000 g for

5 min at 4 �C, and added to 700 lL phenol. The DNA was

separated by a standard phenol ⁄ chloroform extraction. The

resulting DNA was precipitated with propan-2-ol, kept at

)20 �C overnight, and centrifuged at 12 000 g for 15 min.

The pellet was then washed once with 75% ethanol. Finally,

the DNA pellet was resuspended in 100 lL TE buffer

(10 mm Tris ⁄HCl, 0.1 mm EDTA, pH 8) and stored at 4 �Cuntil used.

Amplification of cDNA and genomic DNA

PCR was carried out in a total volume of 25 lL containing

10–50 ng template cDNA ⁄ gDNA, 100 ng each degenerate

primer, 200 lm dNTPs, 2.5 mm MgCl2 and 1 U DNA

polymerase (Uptima, Interchim, Montlucon, France). PCR

conditions were as follows: an initial denaturation step at

95 �C for 5 min, 35 cycles consisting of denaturation at

95 �C for 30 s, annealing for 30 s, extension at 72 �C for

40 s, and a final elongation step at 72 �C for 10 min. Prim-

ers are given in Table 3.

Cloning and sequencing

The PCR products were cloned using a TOPO�-TA

cloning Kit (Invitrogen, Cergy Pontoise, France). The pos-

itive recombinant clones were isolated, and plasmid DNA

was prepared with the FlexiPrep Kit (Amersham). Purified

plasmids containing the putative globin insert were used in

a dye–primer cycle sequencing reaction, using the primer

T7 and the Big Dye� Terminator V3.1 Cycle Sequencing

kit (Applied Biosystems). PCR products were subsequently

run on a 3100 Genetic Analyser (Applied Biosystems) at

Roscoff Sequencing Core Facility Ouest Genopole�Plateform.

Table 3. Primer sequences used for the PCR amplification. CDS, Coding sequence.

Species Forward (5¢ to 3¢) Reverse (5¢ to 3¢)

Ar. marina A2 CDS GARTGYGGNCCNTTRCARCG CCANGCNTCYTTRTCRAAGCAIntron 1 GTCAGGGACGAGGCCGGA ACTCTCTTGAAGAGAGCCCGIntron 2 GCACGTAGAAAGGCACATCC GCTGGGGGCATACTCCATCA

B2 CDS TGYTGYAGYATHGARGAYCG CANGCNYCNGRRTTRAARCAIntron 1 TTCACTGGTCGCCGTGTCCA TTCTTGGACTCGGGGTCGCIntron 2 AGCACAAGGAGCGTGATGGC TGCTGACCTGGGGCATGAC

R. pachyptila A1 Intron 1 CGGTATCGGTGCTGCCC TGTCTTTGGAGTTGACACTTTCGIntron 2 CCAGGCGACGCTCGATGCTG TGGCACGTCGAAGCAGACG

B1a Intron 1 AGCAAGGAGCAAGCTCT GTGAACAGATTCTTGGCIntron 2 CGTGACGGCGTTACCAAAG AGGCGTCGGGGTTGAATC

B1b Intron 1 GAACAAGTGCGAGTGGAGCT TAAACAACTGTTTAGCCGCIntron 2 GACATCTCGCCAGCCAACA CGACGACCTGAGGAAGCAA

B1c Intron 1 CCTCCAACGGCGGCAAGTTGCC TGAAGAGGTTCTTGGCAGTGGIntron 2 CAGGGTCTGCTCGACTCTCTG CGATAAGCTGAGGCATCACC

Al. pompejana Hb Intra CDS GCNGAYAAYATHGCNGCNGT RTTRTANGCYTGYTCCCANGCIntron 1 GCGGTTAGGGGTGATGTCTC GCGTCTTGAACTTGGGCAGIntron 2 CTGCCCAAGTTCAAGACGC GTTCCCATGCAGCCGAGT

Ar. marina Mb CDS GCNGAYCARATGGCNGCNGTNAA CNCCNGTNGCNGCNGTCCAIntron 1 CATCGCCGCCGTGAAG TGGCAACAGAGCCCAAAGAIntron 2 TGTGGAGAAGGGCGGAGA GGCCAGGAAGGGGACGA

G. dibranchiata mIV Intron 1 GAGAACAGCACCTGAAGCAAA CCATCTGTGCCAACACTTTCIntron 2 GGCACAGATTGGCGTCG AGCAGTGACGCACCCAGA

A. ornata DHP Intron 1 AAGATATTGCCACCCTCCG GGTCAGATTTGCCGACATAGTTIntron 2 CACTCGTCCAGATGAAACAGC CGCGGAGACCAAATTCTTG



Rapid amplification of cDNA ends

cDNA ends were obtained by PCR using the 5¢-RACE and

3¢-RACE kit (Roche, Grenzacherstrasse, Switzerland)

according to the manufacturer’s instructions. Buffer, rea-

gents and other conditions for the nested PCR were as

described by the manufacturer. The RACE products

were purified, cloned with the TOPO-TA cloning kit

(Amersham), and sequenced as described above.

Sequence analyses

Signal peptide

The peptide signal cleavage site was predicted by the

SignalP 3.0 Server [48] (http://www.cbs.dtu.dk/services/

SignalP).

Database analysis

The tblastn and tblastx search algorithms [49] were

employed to search data on the Uniprot database (http://

www.ebi.ac.uk).

Globin multiple alignment

We performed a global multiple alignment including anne-

lid, mollusc and arthropod intracellular and extracellular

globins. We present here only the annelid globin multiple

alignment; the global one including molluscs and arth-

ropods is available on request. All the globin sequences

used in the multiple alignment are listed in Table 1.

Amino-acid sequences were aligned with the program

muscle [50] (http://phylogenomics.berkeley.edu/cgi-bin/

muscle/input_muscle.py) and adjusted manually.

Molecular phylogeny

For the two sets of aligned globins (annelids on one hand

and annelids, molluscs and arthropods on the other), Baye-

sian analysis was carried out using mrbayes 3.1.1 (http://

mrbayes.csit.fsu.edu/index.php) and the JTT transition mat-

rix [51]. Four chains were run simultaneously for 106 gener-

ations, and trees were sampled every 100 generations,

producing a total of 104 trees.

Acknowledgements

We thank Dr Joao Gil for collecting specimens of

G. dibranchiata, and Dr David Lincoln for collecting

specimens of A. ornata. We gratefully acknowledge the

captain and crew of the NO L’Atalante, the pilots and

groups of the French and US submersibles Nautile

and Alvin, respectively. We are also very grateful to

the chief scientists of the HOT’96, LARVE’99 and

HOPE’99 oceanographic cruises. This work was sup-

ported by CNRS, European grant (FEDER no. pres-

age 3814) and the Conseil Regional de Bretagne

(contract no. 809) (FZ). SD is a postdoctoral fellow of

the FWO (Fund for Scientific Research Flanders).

References

1 Hardison R (1998) Hemoglobins from bacteria to man:

evolution of different patterns of gene expression. J Exp

Biol 201, 1099–1117.

2 Vinogradov SN. et al. (2005) Three globin lineages

belonging to two structural classes in genomes from the

three kingdoms of life. Proc Natl Acad Sci USA 102,

11385–11389.

3 Goodman M. et al. (1988) An evolutionary tree for

invertebrate globin sequences. J Mol Evol 27, 236–249.

4 Moens L. et al. (1996) Globins in nonvertebrate species:

dispersal by horizontal gene transfer and evolution of

the structure–function relationships. Mol Biol Evol 13,

324–333.

5 Suzuki T & Imai K (1998) Evolution of myoglobin. Cell

Mol Life Sci 54, 979–1004.

6 Wittenberg JB (1970) Myoglobin-facilitated oxygen dif-

fusion: role of myoglobin in oxygen entry into muscle.

Physiol Rev 50, 559–636.

7 Vinogradov SN, Walz DA, Pohajdak B, Moens L,

Kapp OH, Suzuki T & Trotman CN (1993) Adventi-

tious variability? The amino acid sequences of nonverte-

brate globins. Comp Biochem Physiol B 106, 1–26.

8 Weber RE & Vinogradov SN (2001) Nonvertebrate

hemoglobins: functions and molecular adaptations. Phy-

siol Rev 81, 569–628.

9 Wittenberg BA, Briehl RW & Wittenberg JB (1965)

Haemoglobins of invertebrate tissues. Nerve haemo-

globins of Aphrodite, Aplysia and Halosydna. Biochem

J 96, 363–371.

10 Terwilliger RC, Garlick RL & Terwilliger NB (1980)

Characterization of hemoglobins and myoglobin

of Travisia foetida. Comp Biochem Physiol 66B, 261–266.

11 Kleinschmidt T & Weber RE (1998) Primary structures

of Arenicola marina isomyoglobins: molecular basis for

functional heterogeneity. Biochim Biophys Acta 1383,

55–62.

12 Zafar RS, Chow LH, Stern MS, Scully JS, Sharma PR,

Vinogradov SN & Walz DA (1990) The cDNA

sequences encoding two components of the polymeric

fraction of the intracellular hemoglobin of Glycera

dibranchiata. J Biol Chem 265, 21843–21851.

13 Zafar RS, Chow LH, Stern MS, Vinogradov SN &

Walz DA (1990) The heterogeneity of the polymeric

intracellular hemoglobin of Glycera dibranchiata and the

cDNA-derived amino acid sequence of one component.

Biochim Biophys Acta 1041, 117–122.



14 Seamonds B, Forster RE & Gottlieb AJ (1971)

Heterogeneity of the hemoglobin from the common

bloodworm Glycera dibranchiata. J Biol Chem 246,

1700–1705.

15 Gotoh T, Shishikura F, Snow JW, Ereifej KI,

Vinogradov SN & Walz DA (1987) Two globin strains

in the giant annelid extracellular haemoglobins.

Biochem J 241, 441–445.

16 Bailly X, Jollivet D, Vanin S, Deutsch J, Zal F, Lallier

F & Toulmond A (2002) Evolution of the sulfide-bind-

ing function within the globin multigenic family of the

deep-sea hydrothermal vent tubeworm Riftia pachyptila.

Mol Biol Evol 19, 1421–1433.

17 Weber RE (1978) Respiratory pigments. In Physiology

of Annelids (Mill PJ, ed), pp. 393–446. Academic Press

Inc, New York, NY.

18 Hourdez S, Lallier FH, De Cian MC, Green BN, Weber

RE & Toulmond A (2000) Gas transfer system in

Alvinella pompejana (Annelida polychaeta, Terebellida):

functional properties of intracellular and extracellular

hemoglobins. Physiol Biochem Zool 73, 365–373.

19 Negrisolo E, Pallavicini A, Barbato R, Dewilde S,

Ghiretti-Magaldi A, Moens L & Lanfranchi G (2001)

The evolution of extracellular hemoglobins of annelids,

vestimentiferans, and pogonophorans. J Biol Chem 276,

26391–26397.

20 Gotoh O & Suzuki T (1990) Molecular assembly and

evolution of multi-subunit extracellular annelid hemo-

globins. Zool Sci 7, 1–16.

21 Jhiang SM & Riggs AF (1989) The structure of the gene

encoding chain c of the hemoglobin of the earthworm,

Lumbricus terrestris. J Biol Chem 264, 19003–19008.

22 Dewilde S, Van Hauwaert ML, Vinogradov S, Viers-

traete A, Vanfleteren J & Moens L (2001) Protein and

gene structure of a chlorocruorin chain of Eudistylia

vancouverii. Biochem Biophys Res Commun 281, 18–24.

23 Bailly X (2003) Evolution de la fonction de liaison du

sulfure d’hydrogene par les hemoglobines de Riftia

pachyptila, annelide tubicole des sources hydrothermales

profondes. These de doctorat, Ecole Pratique des

Hautes Etudes et Universite Pierre et Marie Curie, Paris

VI, France.

24 Dewilde S, Blaxter M, Van Hauwaert ML, Vanfleteren J,

Esmans EL, Marden M, Griffon N & Moens L (1996)

Globin and globin gene structure of the nerve myoglobin

of Aphrodite aculeata. J Biol Chem 271, 19865–19870.

25 Chen YP, Woodin SA, Lincoln DE & Lovell CR (1996)

An unusual dehalogenating peroxidase from the marine

terebellid polychaete Amphitrite ornata. J Biol Chem

271, 4609–4612.

26 Roach MP, Chen YP, Woodin SA, Lincoln DE, Lovell

CR & Dawson JH (1997) Notomastus lobatus chloro-

peroxidase and Amphitrite ornata dehaloperoxidase both

contain histidine as their proximal heme iron ligand.

Biochemistry 36, 2197–2202.

27 LaCount MW, Zhang E, Chen YP, Han K, Whitton

MM, Lincoln DE, Woodin SA & Lebioda L (2000) The

crystal structure and amino acid sequence of dehalo-

peroxidase from Amphitrite ornata indicate common

ancestry with globins. J Biol Chem 275, 18712–18716.

28 Strand K, Knapp JE, Bhyravbhatla B & Royer WE Jr

(2004) Crystal structure of the hemoglobin dodecamer

from Lumbricus erythrocruorin: allosteric core of

giant annelid respiratory complexes. J Mol Biol 344,

119–134.

29 Fushitani K, Matsuura MS & Riggs AF (1988) The

amino acid sequences of chains a, b, and c that form

the trimer subunit of the extracellular hemoglobin from

Lumbricus terrestris. J Biol Chem 263, 6502–6517.

30 Suzuki T, Kapp OH & Gotoh T (1988) Novel S-S loops

in the giant hemoglobin of Tylorrhynchus heterochaetus.

J Biol Chem 263, 18524–18529.

31 Suzuki T, Takagi T & Ohta S (1993) N-terminal amino

acid sequences of 440 kDa hemoglobins of the deep-sea

tube worms, Lamellibrachia sp.1, Lamellibrachia sp.2

and slender vestimentifera gen. sp. 1 evolutionary

relationship with annelid hemoglobins. Zool Sci 10,

141–146.

32 Jhiang SM, Garey JR & Riggs AF (1988) Exon-intron

organization in genes of earthworm and vertebrate

globins. Science 240, 334–336.

33 Keller EB & Noon WA (1984) Intron splicing: a con-

served internal signal in introns of animal pre-mRNAs.

Proc Natl Acad Sci USA 81, 7417–7420.

34 Harris NL & Senapathy P (1990) Distribution and con-

sensus of branch point signals in eukaryotic genes: a

computerized statistical analysis. Nucleic Acids Res 18,

3015–3019.

35 Dewilde S, Van Hauwaert M-L, Peeters K, Vanfleteren

J & Moens L (1999) Daphnia pulex didomain hemo-

globin: structure and evolution of polymeric hemo-

globins and their coding genes. Mol Biol Evol 16,

1208–1218.

36 Manwell C & Baker CMA (1988) Magelona haemery-

thrin: tissue specificity, molecular weights and oxygen

equilibria. Comp Biochem Physiol 89B, 453–463.

37 Fushitani K, Ochi O & Morimoto H (1982) Purifica-

tion, characterization, and comparison of extracellular

hemoglobins in coelomic fluid and blood vessel plasma

of Travisia japonica (Polychaeta, Annelid). Comp Bio-

chem Physiol B 72, 267–273.

38 Freitas TA, Hou S, Dioum EM, Saito JA, Newhouse J,

Gonzalez G, Gilles-Gonzalez MA & Alam M (2004)

Ancestral hemoglobins in Archaea. Proc Natl Acad Sci

USA 101, 6675–6680.

39 Zhu H & Riggs AF (1992) Yeast flavohemoglobin is an

ancient protein related to globins and a reductase

family. Proc Natl Acad Sci USA 89, 5015–5019.

40 Andersson JO, Sjogren AM, Davis LA, Embley TM &

Roger AJ (2003) Phylogenetic analyses of diplomonad



genes reveal frequent lateral gene transfers affecting

eukaryotes. Curr Biol 13, 94–104.

41 Riggs AF (1991) Aspects of the origin and evolution of

non-vertebrate hemoglobins. Am Zool 31, 535–545.

42 Williams EJ, Pal C & Hurst LD (2000) The molecular

evolution of signal peptides. Gene 253, 313–322.

43 Toulmond A. (1992) Properties and functions of extra-

cellular heme pigments. In Advances in Comparative and

Environmental Physiology (Mangum CP, ed.), Vol. 13,

pp 231–256. Springer, New York.

44 Weber RE, Mangum C, Steinman H, Bonaventura C,

Sullivan B & Bonaventura J (1977) Hemoglobins of two

terebellid polychaetes: Enoplobranchus sanguineus and

Amphitrite ornata. Comp Biochem Physiol A 56,

179–187.

45 Mangum CP, Woodin BR, Bonaventura C, Sullivan B

& Bonaventura J (1975) The role of coelomic and vas-

cular hemoglobin in the annelid family terebellidae.

Comp Biochem Physiol A 51, 281–294.

46 Allen G (1989) Sequencing of proteins and peptides. In

Laboratory Techniques in Biochemistry and Molecular

Biology (Burdon RH, Van Knippenberg PH, eds), Vol.

9, pp. 73–104. Elsevier North Holland, Amsterdam.

47 Swank RT & Munkres KD (1971) Molecular weight

analysis of oligopeptides by electrophoresis in polyacry-

lamide gel with sodium dodecyl sulfate. Anal Biochem

39, 462–477.

48 Bendtsen JD, Nielsen H, von Heijne G & Brunak S

(2004) Improved prediction of signal peptides: SignalP

3.0. J Mol Biol 340, 783–795.

49 Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang

Z, Miller W & Lipman DJ (1997) Gapped BLAST and

PSI-BLAST: a new generation of protein database

search programs. Nucleic Acids Res 25, 3389–3402.

50 Edgar RC (2004) MUSCLE: multiple sequence align-

ment with high accuracy and high throughput. Nucleic

Acids Res 32, 1792–1797.

51 Jones DT, Taylor WR & Thornton JM (1992) The

rapid generation of mutation data matrices from protein

sequences. Comput Appl Biosci 8, 275–282.

52 Mount SM (1982) A catalogue of splice junction

sequences. Nucleic Acids Res 10, 459–472.



globin gene family evolution and functional diversification in annelids

Documents