disease genes of population: example of finland leena peltonen department of medical genetics and...
TRANSCRIPT
![Page 1: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/1.jpg)
Disease Genes of Disease Genes of
Population: Example of Population: Example of
FinlandFinlandLeena PeltonenDepartment of Medical Genetics and Molecular MedicineUniversity of Helsinki and National Public Health Institute,
FinlandDepartment of Human Genetics, UCLA,USA
![Page 2: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/2.jpg)
![Page 3: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/3.jpg)
• Founder Effect• Genetic Drift• Isolation• Regional Expansion
• Enrichment of Rare Diseases• Fin-Major mutation• Lack of CF, PKU• Population records since 1634• Epidemiological registers • Inbred training of clinicians • Favorable attitudes by public• Traditions in public health interventions
Finland -Finland -The Promised Land of The Promised Land of
Disease GeneticsDisease Genetics
![Page 4: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/4.jpg)
GRACILE (death in infancy) LAAHD (intrauterine death) FSH-RO (fertility disturbance) EPMR (progressive retardation) PEHO (progressive retardation) TMD (muscle disease) dominant RAPADILINO (growth disturbance with malformations) LCCS (intrauterine death) IOSCA, OHAHA (progressive retardation) CHS (progressive retardation) vLINCL (progressive retardation) HYDROLET (intrauterine death) SALLA (progressive retardation) MKS (intrauterine death) MEB (severe retardation) TCD, CHM (eye disease), X -recessive INCL (progressive retardation) HOGA (eye disease) DTD (growth disturbance) JNCL (progressive retardation) CHH (growth disturbance) MUL (growth disturbance) FAF (eye, nerve and skin disease) dominant USH3 (ear and eye disease) PLOSL (progressive retardation) AGU (progressive retardation) CLD (watery diarrhea) NKH (severe retardation) LPI (metabolic disease) CCD (watery diarrhea) APECED (autoimmune polyendocrinopathy) RESCH, RS (eye disease), X- recessive PME (neurological disease) SMB12 (anemia) CNA2 (eye disease) CNF (kidney disease)56... 58... 60... 62... 64... 66... 68... 70... 72... 74... 76... 78... 80... 82... 84 ...86... 88... 90... 92... 94... 96... 98
The Disease The Disease Genome of FinnsGenome of Finns
Gene cloned -Mutation known
Localizationknown
No localization
![Page 5: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/5.jpg)
FinnishDisease
Database
1980: 60 patients born annually, regional differences
![Page 6: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/6.jpg)
Clinical Picture highly variableClinical Picture highly variable
Severe or Progressive Mental Retardation: INCL, vLINCL, JNCL, AGU, SALLA,
Intrauterine Death or Death in InfancyGRACILE, LCCS, HYDROLET, MECKEL,
Cong.nefrosis
Problems Later in Life
Dementia (PLO-SL), Autoimmune disease (APECED)
Eye or ear disease, Fertility disturbanceGrowth disturbance, Metabolic diseaseMuscle disease, Watery diarrhea
![Page 7: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/7.jpg)
Congenital Congenital NephrosisNephrosis
• BirthPlaces of GreatGrandParents• Fin-major 78 %• Fin-minor 16 %• Incidence 1:8000• Carrier Frequency 1:45
![Page 8: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/8.jpg)
SALLA diseaseSALLA disease
•BirthPlaces of GreatGrandParents• Fin-Major 95 %• Incidence 1:40 000• Carrier Frequency 1:100 much higher in Salla
![Page 9: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/9.jpg)
• Small Number of Founders• No Immigration• Isolation
– Geographical– Linguistic, cultural
• Rapid Expansion
Population HistoryPopulation History
![Page 10: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/10.jpg)
Expansion• 18th century - population 250 000• Today - population 5.1 million
LateSettlement
Late Settlement• 16th century• multiple bottle necks
Early Settlement • 2000 years ago• South and Coast
EarlySettlement
![Page 11: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/11.jpg)
Benefits of the limited number of ancestral disease chromosomes
in disease gene hunt A sparse marker map sufficient to detect the
disease locus Association studies or “homozygosity scanning” of
affecteds only can be used instead of linkage analyses
More cost-effective disease gene mapping and identification
![Page 12: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/12.jpg)
More cost/time-effective?
Mixed populations
• 15 families with two affected children genotyped
• 400 markers for linkage analyses
30 000 genotypes
Isolates
• 5 affected individuals genotyped
• 200 markers scanned for allele sharing
1000 genotypes
![Page 13: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/13.jpg)
Genome Project and Identification of Genome Project and Identification of Disease GenesDisease Genes
Linkage 5 Mb
Linkage disequilibrium 2 Mb
Shared haplotype 0.1Mb
Regional candidate genes (5-10)
Mutated gene(s)
![Page 14: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/14.jpg)
PLOPLOPolycystic
Lipomembranous
Osteodysplasia
Sclerosing
Leucoencephalopathy
Progressive presenile dementia Bone cysts Recessive, age of onset 20-40
![Page 15: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/15.jpg)
• Frontally accentuated loss of myelin• Astrocytic gliosis• Enlarged ventricles• Calcifications and atrophy of basal ganglia• Atrophy of corpus callosum• Activation of microglia• Vascular alterations
Neuropathological findings
![Page 16: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/16.jpg)
Clinical phenotype described 1961 (Nasu and Hakola) Histopathology defined 1973-89 Assignment of disease locus by genome-wide scan to 19q13 to 153 kb region 1998 (Pekkarinen et al.) Gene identified 1999 (Paloneva et al.)
Short History of PLO SL
![Page 17: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/17.jpg)
DAP 12DAP 12 NK cell membrane protein
Crucial role in NK-cell activation and NK-cell-mediated lysis
Transmits activating signals via association with activating receptors recognizing MHC class 1 molecules
![Page 18: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/18.jpg)
CTGCAACCTCTGCCTCCCAGGTTCAAGCGATTCTCCTGCC..//.. CTCCACCTCCCAGGTTCAAGCGATTCTCTTGCCTGAGCCT
DA
P12
exo
ns
1-4
DA
P12
exo
n 5
cen.tel.
PLOSLFin 5’ breakpoint PLOSLFin 3’ breakpoint
TGGCATGATCTTGGCTCACTGCAACCTCTGCCTCCCAGGTTCAAGCGATTCTCTTGCCTGAGCCTCCCGAGTAGCTGGAACTA
PLOSLFin breakpoint region
PLOSLFin mutant allele:
Control sequence:
Intron 4
PLOSLFin deletion
![Page 19: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/19.jpg)
![Page 20: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/20.jpg)
PLO patientsPLO patients
Both Finnish and Japanese mutations represent functional ‘knock-out’s for DAP12
No abnormality in the number or cytotoxic activity of NK cells
No clinical problems arising from defective NK cell function
![Page 21: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/21.jpg)
PLO shows locus heterogeneity
Some families don’t show linkage to chromosome 19 and have no mutations of DAP 12
What are the mutated gene(s) ?
![Page 22: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/22.jpg)
Chromosome 19 haplotypes for Norwegian PLO-SL family
Am. J. Hum. Genet. 62:362-372 Pekkarinen et. al.
![Page 23: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/23.jpg)
IJBCB, Kerry S. Campbell et. al., 1999
![Page 24: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/24.jpg)
Genes of DAP12-ligands
Protein /gene Chr Haplotype segregation
KIR2DS2 19 - MDL-1 7 - TREM-1 6 + TREM-2 6 + NKG2C/CD94 12 - SIRP-BETA-1 20 - CD49 12 - SYK 9 - ZAP70 2 -
![Page 25: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/25.jpg)
Sequence analyses of TREM 2
Norwegian family: a Lys to Arg
Swedish family: Trp to STOP
US family: Asp to Gly
Bolivian family: Trp to STOP
Italian family: Splicing donator mutation
![Page 26: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/26.jpg)
DAP 12 and TREM 2
• Mutations in two separate subunits of multi-subunit receptor signaling complex result in the same human disease
• Relationship of functional defect with dementia and bone cysts??
![Page 27: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/27.jpg)
Molecular pathogenesis of PLO?
Monoblaststem cells Monocyte
activation•Activated macrophage
•Microglia (CNS)
•Osteoclast (bone)
bone marrow blood tissues
-cells with functional defect represent the same lineage
Macrophage
differentiation
![Page 28: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/28.jpg)
APECED 82% AGU 98% CNF 78% INCL 98% PME 96% Diatrophic dysplasia 90% Salla Disease 94%
APECED 82% AGU 98% CNF 78% INCL 98% PME 96% Diatrophic dysplasia 90% Salla Disease 94%
Coverage of One Major Mutation
Coverage of One Major Mutation
![Page 29: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/29.jpg)
HTIFin carrier
1ATz-allele
carrier
HFEC282Y
carrier
1AT z-allele/CNFmajor/LCHADG1528C
carrier
DTDFin/LPIFin
carrier
GJB235G carrier
Finland ArrayFinland Array
![Page 30: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/30.jpg)
DNA-Chip for population screening
2400 DNA-samples analyzed for 31 disease mutations on the chip
Prevalence of recessive mutations
Regional variations
Feasibility for large screening programs
![Page 31: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/31.jpg)
TC TT
X= (signal A1) (signalA1+A2)
Y= LOG (signal A1+A2)
SNP genotyping
Genotype-calling software developed by Juha Saharinen
![Page 32: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/32.jpg)
Carrier Frequencies
early settlement
Helsinki
late settlement
![Page 33: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/33.jpg)
Carrier Frequencies
All 1:2,6
All 1:3,6
All Mutations 1:3
![Page 34: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/34.jpg)
AGUDiastrophic dysplasia
"Old" Finnish Mutations
Early Late Helsinki0
1
2
Congenital nephrosis
0
2
4
AGU, DD % CNF %
![Page 35: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/35.jpg)
Early Late Helsinki0
1
2
3
4
5
6
INCLvLINCLBatten
2
1
0
INCL % vLINCL, Batten
NCL-diseases
![Page 36: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/36.jpg)
0
1000
2000
3000
4000
5000
6000
7000
8000
9000
1996 1997 1998 1999 2000 2001 2002
KPL
TMK
Diagnostic DNA tests in the University of Helsinki laboratory
![Page 37: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/37.jpg)
Genome Studies
Accurate diagnosis / carrier detection of rare diseases (1500 currently)
New metabolic pathways, critical for human cells and tissues, identified
New molecular classification of diseases
Avenues for drug development
![Page 38: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/38.jpg)
Where we fall short
We are not competent to infer from the accumulated genome information
• Physiological function of molecules• Understanding how molecules work together
We are unaware of the biochemical function of most proteins
We lack the knowledge of most interactions between cellular components
![Page 39: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/39.jpg)
Function of the proteins
• Three dimensional structure of 1540 human proteins determined experimentally (www.rcsb.org.pdb)
• The function of 6000 human proteins is known
![Page 40: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/40.jpg)
Ultimately it should be possible
• Examine individual’s genetic make-up at any position of the sequence
• Deduce functional consequences
• Make a well-informed choice of medical actions
![Page 41: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/41.jpg)
Slowly discovering functional information of the genome
• Alternative splicing produces cell or tissue specific products
• Multiple promoters confer diversity of substrate specificity or inducible response
• Only 2/3 of the genes have canonical structure with ORF
• New classes of RNA genes• Genome landscape complexities
![Page 42: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/42.jpg)
Treatment and Cure
Drug discovery : target identification
Biology-based stratification of diseases and syndromes
Better targeted treatment trials
Prevention versus treatment
![Page 43: Disease Genes of Population: Example of Finland Leena Peltonen Department of Medical Genetics and Molecular Medicine University of Helsinki and National](https://reader031.vdocuments.mx/reader031/viewer/2022032802/56649de95503460f94ae3dfb/html5/thumbnails/43.jpg)
”W e finished the genome map but we don't know how to fold it””W e finished the genome map but we don't know how to fold it”