lable at ScienceDirect

Journal of Psychiatric Research 60 (2015) 109e116

Contents lists avai

Journal of Psychiatric Research

journal homepage: www.elsevier .com/locate/psychires

Decrease in olfactory and taste receptor expression in the dorsolateralprefrontal cortex in chronic schizophrenia

Bel�en Ansoleaga a, 1, Paula Garcia-Esparcia a, 1, Raquel Pinacho b, c, Josep Maria Haro b, c,Bel�en Ramos b, c, *, Isidre Ferrer a, d, e, **

a Institut de Neuropatologia, IDIBELL-Hospital Universitari de Bellvitge, Hospitalet de Llobregat, Barcelona, Spainb Unitat de Recerca, Parc Sanitari Sant Joan de D�eu, Fundaci�o Sant Joan de D�eu, Universitat de Barcelona, Dr. Antoni Pujadas, 42, 08830,Sant Boi de Llobregat, Barcelona, Spainc Centro de Investigaci�on Biom�edica en Red de Salud Mental, CIBERSAM, Spaind Universitat de Barcelona, Hospitalet de Llobregat, Barcelona, Spaine CIBERNED (Centro de Investigaci�on Biom�edica en Red de Enfermedades Neurodegenerativas), Spain

a r t i c l e i n f o

Article history:Received 3 June 2014Received in revised form20 August 2014Accepted 12 September 2014

Keywords:SchizophreniaPrefrontal cortexOlfactory receptorsTaste receptorsAntipsychotics

* Corresponding author. Unitat de Recerca, ParcFundaci�o Sant Joan de D�eu, Universitat de Barcelona,m�edica en Red de Salud Mental, CIBERSAM, Dr. Antonde Llobregat, Barcelona, Spain. Tel.: þ34 93 600 9452** Corresponding author. Institut de NeuropatologiaHospital Universitari de Bellvitge, Carrer Feixa Llargabregat, Spain. Tel.: þ34 93 260 7452; fax: þ34 93 26

E-mail addresses: bramos@fsjd.org (B. Ramos), 801 These authors have contributed equally to this w

http://dx.doi.org/10.1016/j.jpsychires.2014.09.0120022-3956/© 2014 Elsevier Ltd. All rights reserved.

a b s t r a c t

We have recently identified up- or down-regulation of the olfactory (OR) and taste (TASR) chemore-ceptors in the human cortex in several neurodegenerative diseases, raising the possibility of a generalderegulation of these genes in neuropsychiatric disorders. In this study, we explore the possiblederegulation of OR and TASR gene expression in the dorsolateral prefrontal cortex in schizophrenia. Weused quantitative polymerase chain reaction on extracts from postmortem dorsolateral prefrontal cortexof subjects with chronic schizophrenia (n ¼ 15) compared to control individuals (n ¼ 14). Negativesymptoms were evaluated premortem by the Positive and Negative Syndrome and the Clinical GlobalImpression Schizophrenia Scales. We report that ORs and TASRs are deregulated in the dorsolateralprefrontal cortex in schizophrenia. Seven out of eleven ORs and four out of six TASRs were down-regulated in schizophrenia, the most prominent changes of which were found in genes from the11p15.4 locus. The expression did not associate with negative symptom clinical scores or the duration ofthe illness. However, most ORs and all TASRs inversely associated with the daily chlorpromazine dose.This study identifies for the first time a decrease in brain ORs and TASRs in schizophrenia, a neuro-psychiatric disease not linked to abnormal protein aggregates, suggesting that the deregulation of thesereceptors is associated with altered cognition of these disorders. In addition, the influence of antipsy-chotics on the expression of ORs and TASRs in schizophrenia suggests that these receptors could beinvolved in the mechanism of action or side effects of antipsychotics.

© 2014 Elsevier Ltd. All rights reserved.

1. Introduction

Ectopic expression of olfactory and taste receptors (ORs andTASRs, respectively) has been described in several organs and tis-sues (Behrens and Meyerhof, 2010; Branscomb et al., 2000; De laCruz et al., 2009; Feldmesser et al., 2006; Li, 2013; Parmentier

Sanitari Sant Joan de D�eu,Centro de Investigaci�on Bio-i Pujadas 42, 08830 Sant Boi; fax: þ34 93 600 9771., Servei Anatomia Patol�ogica,sn, 08907 Hospitalet de Llo-0 7503.82ifa@gmail.com (I. Ferrer).ork.

et al., 1992; Vanderhaeghen et al., 1997; Xu et al., 2013;Yamamoto and Ishimaru, 2013; Zhang et al., 2007). Their functionin these locations is not known in most cases but it has been pro-posed that both ORs and TASRs play particular roles in autocrine,paracrine and endocrine signaling (Aggio et al., 2012; Deshpandeet al., 2010; Dreyer, 1998; Fukuda et al., 2004; Griffin et al., 2009;Kang and Koo, 2012; Kinnamon, 2012; Spehr et al., 2003, 2004). Avariety of compounds, mostly of unknown origin and function, canbind to autocrine receptors on the same cell, neighboring cells ordistant cells. More recently, ORs and TASRs, and their down-streameffectors have been identified in the rodent and human brain(Dehkordi et al., 2012; Garcia-Esparcia et al., 2013; Grison et al.,2014; Otaki et al., 2004; Singh et al., 2011), with a widespreaddistribution although with regional variations (Garcia-Esparciaet al., 2013). Moreover, ORs are functionaldat least those

Table 1Demographic, clinical and tissue-related features of cases (n ¼ 29).

Schizophrenia (n ¼ 15) Non-psychiatriccontrols (n ¼ 14)

Statistic p value

Gender Male- 100% (n ¼ 15) Male- 100%(n ¼ 14)

N/A N/A

Age at death 75 ± 11 years 71 ± 8 years 1.09; 27 0.2863PMD 4.6 ± 2.5 h 5.7 ± 1.9 h 1.38; 27 0.1797pH 6.87 ± 0.27 6.74 ± 0.54 0.82; 27 0.4216RIN 7.53 ± 0.63 7.74 ± 0.63 0.86; 27 0.3960Age of onset of

illness26 ± 10 years N/A N/A N/A

Duration ofillness

49 ± 11 years N/A N/A N/A

Daily AP dosea 380.67 ± 361.98 mg/day N/A N/A N/A

Clinical Scales N/A N/A N/APANSS (n ¼ 10)Positive 23.90 ± 7.14Negative 26.60 ± 6.77General 50.50 ± 9.07

CGI-SCH (n ¼ 13)Positive 4.54 ± 2.31Negative 4.92 ± 2.22Depressive 2.23 ± 1.21Cognitive 4.46 ± 1.92

Mean ± standard deviation or relative frequency are shown for each variable; PMD,postmortem delay; RIN, RNA integrity number; AP, antipsychotic; PANSS, Positiveand Negative Syndrome Scale; CGI-SCH, Clinical Global Impression-SchizophreniaScale; N/A, not applicable. All deaths were due to natural causes. T-statistic anddegrees of freedom are shown for parametric variables.

a Last chlorpromazine equivalent dose was calculated based on the electronicrecords of drug prescriptions of the patients.

B. Ansoleaga et al. / Journal of Psychiatric Research 60 (2015) 109e116110

expressed in dopaminergic cultured cellsdin the presence of se-lective odorant molecules (Grison et al., 2014). About 400 ORs anddozens of TASRs are putatively expressed in the brain and ganglia ofthe autonomic nervous system (Glusman et al., 2001; Malnic et al.,2004; Niimura and Nei, 2005; Zhang et al., 2007; Zozulya et al.,2001), suggesting that they have substantial brain functions inphysiological conditions (Barnea et al., 2004; Feinstein et al., 2004;Feinstein and Mombaerts, 2004; Otaki et al., 2004; Weber et al.,2002). Interestingly, ORs and TASRs are deregulated, at least inthe frontal cortex and substantia nigra, in Parkinson's disease, thefrontal cortex and entorhinal cortex in Alzheimer's disease andprogressive supranuclear palsy, and the frontal cortex and cere-bellum in Creutzfeldt-Jakob disease (Ansoleaga et al., 2013; Garcia-Esparcia et al., 2013). Deregulation is not merely result of neuronloss characteristic of these neurodegenerative diseases, as someORs and TASRs are down-regulated or up-regulated in a disease-specific manner (Ansoleaga et al., 2013; Garcia-Esparcia et al.,2013). Moreover, deregulation of ORs has also been found in APP/PS1 transgenic mice bearing the Swedish APP mutation and PS1deletion, which are used as a model for Alzheimer's disease(Ansoleaga et al., 2013). Although all these diseases have disordersin olfaction, mainly characterized by the loss of sense of smell, andin some of them the loss of taste to bitter substances (even thattaste is rarely examined in neurodegenerative diseases), themechanisms leading to loss of olfaction and taste have beenattributed to the presence of abnormal protein deposits in the ol-factory epithelium, olfactory bulb and tract, and to the abnormalinnervation of primary and secondary olfactory and taste centers(Attems et al., 2014; Doty, 2003, 2012).

Schizophrenia (SZ) is a severe mental disorder affecting around0.5e1% of the world adult population (Tandon et al., 2008). Thisdisease constitutes a complex disorder with great variability in themanifestation of positive, negative and cognitive symptoms.Negative symptoms (i.e. lack of volition, poor or absent socialfunctioning, blunted affect) and cognitive impairments (i.e. deficitsin executive functions and working memory) are the core symp-toms of schizophrenia and are the most persistent manifestationsof the disease (Gold, 2004; Stahl and Buckley, 2007; Tandon et al.,2009). The dorsolateral prefrontal cortex (DLPFC) is involvedthese cognitive deficits (Frith and Dolan, 1996; Lewis andMoghaddam, 2006; Teffer and Semendeferi, 2012) and negativesymptoms (Semkovska et al., 2001; Toda and Abi-Dargham, 2007).A dysfunction in this region has beenwidely described in functionaland structural imaging studies and in many molecular reports(English et al., 2011; Goldstein et al., 1999; Konradi, 2005; Wongand Van Tol, 2003).

Altered olfactory functions have been reported in schizophreniaand their origin has been associated with altered secondary olfac-tory centers and also linked to altered olfactory bulb volume(Auster et al., 2014; Cohen et al., 2012; Kayser et al., 2013; Moberget al., 2006; Nguyen et al., 2011, 2010; Rupp, 2010; Schneider et al.,2007). Hypoactivity and hypometabolism in frontal regions hasbeen reported in SZ patients with olfactory agnosia (inability torecognize odors) or during olfactory identification, supporting arole of the frontal lobe in olfactory dysfunction in schizophrenia(Clark et al., 1991; Malaspina et al., 1998). The most severe andconsistent dysfunctions reported in SZ patients were impaired odoridentification and discrimination, implicating prefrontal neuralcompromise, while milder deficits of olfactory acuity or sensitivity,also reported in SZ, reflects a peripheral impairment of the olfac-tory system (Brewer and Pantelis, 2010; Cohen et al., 2012; Moberget al., 1999; Rupp, 2010). In fact, electrical depolarization of theolfactory receptor neurons following stimulation with differentdoses and durations of hydrogen sulfide, a pure olfactory nervestimulant, resulted in altered electric patterns, also supporting a

primary olfactory receptor neuron dysfunction in schizophrenia(Turetsky et al., 2009). Regarding taste perception, there is nogeneral agreement about the nature of taste disorders in schizo-phrenia, at least regarding the inability to taste the bitter chemicalphenylthiocarbamide (Compton et al., 2007, 2013; Moberg et al.,2012; Moberg et al., 2007). Nothing is known about the expres-sion of ORs and TASRs in the brains of patients suffering fromschizophrenia. For this reason, the present study was designed togain information about possible deregulation of OR and TASRexpression in the dorsolateral prefrontal cortex in schizophrenia.

2. Material and methods

2.1. Brain tissue samples

A summary of the demographic, clinical and tissue-relatedfeatures of the samples used for mRNA studies is shown inTable 1. Postmortem human brain tissue from the dorsolateralprefrontal cortex of subjects with chronic schizophrenia (n ¼ 15)and control subjects with no history of psychiatric episodes (n¼ 14)were obtained from the collection of neurologic tissues of ParcSanitari Sant Joan de D�eu (Roca et al., 2008) and the Institute ofNeuropathology Brain Bank (HUB-ICO-IDIBELL Biobank) followingthe guidelines of Spanish legislation and the approval of the localethics committees. The study was approved by the institutionalethics committees. Written informed consent was obtained fromeach subject. We matched schizophrenia and control groups bygender, age, postmortem delay and brain pH. Table 1 shows thedemographic, clinical and tissue-related characteristics of thesamples. Schizophrenia subjects were institutionalized donorswithlong duration of the illness (Table 1) who had no history ofneurological episodes. Experienced clinical examiners interviewedeach donor antemortem to confirm the diagnosis of schizophreniaaccording to the Diagnostic and Statistical Manual of Mental

Table 2TaqMan probes used for the study of expression of olfactory and taste re-ceptors, including probes used for normalization (GUSB).

Probe Sequence

GUSB GCTACTACTTGAAGATGGTGATCGCOR10G8 CACTGTGCTGACGCCCCTTCTCAACOR2D2 GTGAGGCCCCTGCACTATTGATCTTOR2L13 CTCCAAGCCCAGTTACAGCAGAAAGOR2T1 CTGAAGAGGGCCTTGGGGAGGTTCAOR2T33 AACGGTGGCTGGGGACGTGTGTAAAOR4F4 TATACACACTGAGGAACAAAGACATOR51E1 TACGGTTGAGCCTCTACCTGCCTGGOR52H1 GGACACAATGTCTCTCGCACCTTCCOR52L1 CTCAGCAGATCCGCCAGCGAGTGCTOR52M1 ACACTCTGCTGGCCAACTTCTATCTOR6F1 AGCTGTCCACGTCCTGAACACTGTGTAS2R10 ACCACAGCCATCTATCCCTGGGGTCTAS2R13 CACCATTTACTGTGGCCTTCATCTCTAS2R14 TTTGTCCCTGGCAATGTTTCTTCTCTAS2R4 CACCATTTACTGTGGCCTTCATCTCTAS2R5 TTTCTTGTTTCCTCTGGGATGCTGATAS2R50 AGTCCTAGGAGGCTGCGGAATGACC

B. Ansoleaga et al. / Journal of Psychiatric Research 60 (2015) 109e116 111

Disorders IV (DSM-IV) and the International Classification of Dis-eases 10 (ICD-10) criteria. Our study included the followingschizophrenia diagnoses: chronic residual schizophrenia (73.33%,n ¼ 11), chronic paranoid schizophrenia (13.33%, n ¼ 2), chronicdisorganized schizophrenia (6.67%, n ¼ 1) and simple schizo-phrenia (6.67%, n ¼ 1). The last mean daily chlorpromazine equiv-alent dose for the antipsychotic treatment of patients was based onthe electronic records of the last drug prescriptions administeredup to death (Table 1) and was calculated as previously described(Gardner et al., 2010). Five patients were being medicated with firstgeneration antipsychotics (33.33%), seven were medicated withsecond generation antipsychotics (46.67%) and four wereantipsychotic-free (26.67%). Moreover, 86.67% (n ¼ 13) and 66.67%(n ¼ 10) of donor subjects were evaluated antemortem with theClinical Global Impression-Schizophrenia scale (CGI-SCH) and/orwith the Positive and Negative Syndrome Scale (PANSS), respec-tively (Haro et al., 2003; Kay et al., 1987), with an interval of deathto clinical assessment shorter than 48months, with amean value of20.83 months and a standard deviation of 13.70 months. Negativesymptoms are stable over a time period of up to 4 years in chronicschizophrenia, and thesewere used to study the effect of increasingseverity of symptoms (Amador et al., 1999; Arndt et al., 1995; Bordeet al., 1992; Reichenberg et al., 2005; Rey et al., 1994). Our institu-tionalized donors shared the same environment from the time ofclinical evaluation to their death, thereby reducing external vari-ability on the clinical scores.

One hemisphere was immediately cut in coronal sections, 1 cmthick, and selected areas of the encephalon were rapidly dissected,frozen on metal plates over dry ice, placed in individual air-tightplastic bags, numbered with water-resistant ink, and storedat �80 �C. The other hemisphere was fixed by immersion in 4%buffered formalin for 3 weeks for morphological studies. Theneuropathological categorization of associated sporadic Alz-heimer's disease-related changes was performed according to theBraak and Braak nomenclature adapted for paraffin sections (Braaket al., 2006; Braak and Braak, 1991). Alzheimer's disease degreeslower than IV stage were only included in this study and balancedbetween control and schizophrenia groups. A summary of controland schizophrenia cases is shown in Table 1.

Specimens of the dorsolateral prefrontal cortex (Brodmann area9), extending from the pial surface to the white matter and onlyincluding grey matter, were dissected from frozen coronal sectionsthat had been stored at �80 �C. Samples were then immediatelystored at �80 �C. Due to collection methods in each institution, leftdorsolateral prefrontal cortex from schizophrenia subjects waspaired with the contralateral hemisphere from controls.

2.2. RNA purification

Total RNAwas extracted using Trizol reagent (SigmaeAldrich, St.Louis, MO, USA). After extraction, samples were treated withAmbion DNA-free DNase Treatment and Removal for 25 min toavoid extraction and later amplification of genomic DNA. Theconcentration of each sample was measured at 340 nm using aNanoDrop 2000 spectrophotometer (Thermo Scientific, Waltham,MA, USA). RNA integrity was assessed via the RNA integrity number(RIN), which was determined using an Agilent 2100 Bioanalyzer(Agilent, Santa Clara, California, USA). Only samples with RIN (RNAIntegrity Number) over 6.5 were included in the analysis. Mean RINvalues for each group are shown in Table 1.

2.3. Reverse transcription quantitative PCR (RT-qPCR)

Retrotranscription reaction of RNA samples selected based ontheir RIN values was carried out with the High-Capacity cDNA

Archive kit (Applied Biosystems, Foster City, CA, USA) following theguidelines provided by the manufacturer, and using a Gene Amp®

9700 PCR System thermocycler (Applied Biosystems). A reaction forone RNA sample was processed in parallel in the absence of reversetranscriptase to rule out DNA contamination. PCR assays wereconducted in duplicate on cDNA samples obtained from the retro-transcription reaction, diluted 1:5 for mRNA expression studies and1:20 for the laterality study in 384-well optical plates (AppliedBiosystems) using the ABI Prism 7900 HT Sequence DetectionSystem (Applied Biosystems). Parallel amplification reactions werecarried out using 20� TaqMan Gene Expression Assays and 2�TaqMan Universal PCR Master Mix (Applied Biosystems). The Taq-Man probes used in the study are shown in Table 2. The reactionswere performed under following the parameters: 50 �C for 2 min,95 �C for 10 min, 40 cycles at 95 �C for 15 s and 60 �C for 1 min.TaqMan PCR data were captured using the Sequence DetectionSoftware (SDS version 2.2, Applied Biosystems). Subsequently,threshold cycle (CT) data for each sample were analyzed with thedouble delta CT (DDCT) method. First, delta CT (DCT) values werecalculated as the normalized CT values of each target gene inrelation to the endogenous control GUSB (b-Glucuronidase). TBP(TATA-binding protein) was also used as a putative housekeepinggene with suboptimal results and therefore TBP was discarded.Second, DDCT values were obtained from the DCT of each sampleminus the mean DCT of the population of control samples (cali-brator samples). The fold-change was determined using the equa-tion 2�DDCT.

2.4. Statistical analysis

The normality of distribution of fold change values was testedwith the Kolmogorov-Smirnov test. The non-parametric Mann-Whitney test was used to compare control and SZ groups whenthey did not follow a normal distribution, while the unpaired t testwas used for normal variables. Differences between groups wereconsidered statistically significant at *p < 0.05, **p < 0.01 and***p < 0.001. The False Discovery Rate (FDR) with the Benjamini andHochberg method (Benjamini and Hochberg, 1995) was computedfor all the p values resulting from our study. The FRD threshold wasset to 0.1. Bivariate analyses were carried out to detect associationof our variables with potential confounding factors (age, post-mortem delay, pH, and RIN; and in the schizophrenia group, withdaily antipsychotic dose, age of onset of the illness, and duration of

Fig. 1. mRNA expression levels of olfactory receptors (ORs) in the dorsolateral prefrontal cortex in control and schizophrenia cases. Expression values for the distinct probes weredetermined with TaqMan PCR assays and were normalized to GUSB. Mean fold-change values of each group were compared with Student's t test (OR2T33, OR51E1, OR10G8, OR52M1,OR2D2, OR4F4, OR6F1 and OR2T1) or ManneWhitney U test (OR2L13, OR52L1 and OR52H1). Differences were considered statistically significant at *p < 0.05; **p < 0.01; ***p < 0.001.

B. Ansoleaga et al. / Journal of Psychiatric Research 60 (2015) 109e116112

the illness), using Spearman or Pearson correlations for quantita-tive variables, for non-parametric variables and for parametricvariables respectively. Multiple linear regression models with astepwise forward procedure performed after including significantrelated variables were used to adjust significant differences whenneeded. Statistical analysis was performed with GraphPad Prismversion 5.00 and SPSS 19.

3. Results

The schizophrenia group did not show significant differencescompared to the control group in demographic and tissue-relatedvariables (Table 1). We determined the gene expression levels ofolfactory receptors (ORs) and taste receptors (TASRs) in thedorsolateral prefrontal cortex of subjects with chronic SZ (n ¼ 15)and controls (n¼ 14). We used GUSB to normalize the mRNA levels.No differences were observed in GUSB expression between controland SZ groups (Fig. S1).

We observed that seven out of eleven probes analyzed weresignificantly down-regulated in schizophrenia compared to controlcases (Fig. 1). Down-regulation of mRNA levels of OR2T1, OR2T33,OR52H1, OR2D2 and OR10G8 showed a p-value <0.05; expression ofOR51E1 was decreased at p < 0.01; and mRNA levels of OR52L1

Fig. 2. RNA expression levels of taste receptors (TASRs) in the dorsolateral prefrontal cortexPCR assays for the distinct probes and were normalized to GUSB. Mean fold-change valueneWhitney U test (TAS2R4, TAS2R5, TAS2R14 and TAS2R50). Differences were considered st

were down-regulated at p < 0.001 (Fig. 1). In addition, the mostprominent changes in the expression of OR genes were from geneslocated in 11p15.4 locus, while milder changes were observed ingenes located in 1q44 and 11q24.2 loci (Fig. 1).

For TASRs, four out of six probes assayed displayed a significantreduction in mRNA expression in schizophrenia compared to con-trol samples (Fig. 2). TAS2R4 and TAS2R13 showed a decrease inmRNA levels with a p-value <0.05, and TAS2R5 and TAS2R50 with astatistical significance of p < 0.01 (Fig. 2).

Since we were performing multiple comparisons, we correctedthe p values obtained in the control-schizophrenia comparisons fora False Discovery Rate (FDR) of 0.1. All the significant p valuesobserved in our analysis (Figs. 1 and 2) were maintained aftercorrection for an FDR of 0.1 (Table 3).

Association analysis of other variables in the study (age, post-mortem delay, pH and RIN) pointed to an association betweenRIN and OR2T33, TAS2R13 and TAS2R50 mRNA levels (Table 4).Linear regression analysis revealed that the decrease in geneexpression of these genes in SZ subjects remained significant afteradjusting for RIN (OR2T33: b ¼ �0.634, p < 0.016, adjustedR2 ¼ 0.844; TAS2R13: b ¼ �0.555, p < 0.007, adjusted R2 ¼ 0.891;TAS2R50: b ¼ �0.650, p < 0.002, adjusted R2 ¼ 0.886). The SZ groupanalysis showed that daily antipsychotic dose significantly

in control and schizophrenia cases. Expression values were determined with TaqMans of each group were compared with Student's t test (TAS2R10 and TAS2R13) or Man-atistically significant at *p < 0.05; **p < 0.01; ***p < 0.001.

Table 3False discovery rate correction for comparisons between control and SZ groups.

Locus Comparisons Uncorrected p value FDR-adjusted p valuesa

1q44 OR6F1 0.9947 0.9947OR2L13 0.0742 0.0901OR2T1 0.0233 0.0440*OR2T33 0.0394 0.0660*

11p15.4 OR52M1 0.7399 0.7861OR51E1 0.0024 0.0204*OR52L1 0.0003 0.0051*OR52H1 0.0213 0.0440*OR2D2 0.0427 0.0669*

11q24.2 OR10G8 0.0120 0.0340*

15q26.3 OR4F4 0.5639 0.6391

7q31.3-q32 TAS2R4 0.0156 0.0379*TAS2R5 0.0040 0.0227*

12p13 TAS2R10 0.0542 0.0768TAS2R13 0.0115 0.0340*TAS2R14 0.0706 0.0901

12p13.2 TAS2R50 0.0057 0.0243*

FDR. False discovery rate; C, control; SZ, schizophrenia.* Significant p values after adjusting for the FDR are highlighted in bold.

a FDR-adjusted p values were calculated according to Benjamini and Hochbergmethod. The maximum acceptable FDR was set at 0.1, which yielded a p valuethreshold ¼ 0.0647.

B. Ansoleaga et al. / Journal of Psychiatric Research 60 (2015) 109e116 113

correlated with OR2T1, OR252L1, OR2D2, OR10G8, TAS2R5, TAS2R13,and TAS2R50 expression levels, and that age of onset of the illnesssignificantly correlated with OR2T1, OR52L1 and OR10G8 mRNAlevels, while duration of illness had no effect on any receptor mRNA

Table 4Association analysis of other variables in the study.

SZ-C comparison n Age PMD pH RINc

r r r r

OR2T1 27 0.210 �0.041 0.003 0.336OR2T33 23 �0.018 �0.198 0.294 0.541a

OR51E1 21 �0.414 �0.130 �0.067 �0.001OR52L1 25 �0.049 0.072 0.149 0.242OR52H1c 28 0.197 �0.132 0.045 0.129OR2D2 28 0.239 0.043 0.012 0.149OR10G8 23 �0.038 �0.300 0.276 0.219TAS2R4c 28 0.311 �0.050 0.146 0.228TAS2R5 28 0.283 �0.149 0.188 0.254TAS2R13c 28 0.365 �0.056 0.161 0.411b

TAS2R50 28 0.202 �0.005 �0.101 0.402b

SZ cohort n Daily AP dosed Age of onset Duration of illnessc

r r r

OR2T1 13 ¡0.696a 0.609b 0.118OR2T33 12 �0.381 0.342 �0.211OR51E1 10 �0.005 �0.383 0.396OR52L1 13 ¡0.704a 0.725a �0.003OR52H1c 15 �0.285 0.361 0.062OR2D2 15 ¡0.680a 0.193 0.326OR10G8 11 ¡0.630b 0.769a �0.251TAS2R4 15 �0.410 0.158 0.377TAS2R5 15 ¡0.578b 0.290 0.309TAS2R13 15 ¡0.558b 0.445 0.125TAS2R50c 15 ¡0.741a 0.115 0.296

SZ, schizophrenia; C, control; PMD, postmortem delay; RIN, RNA integrity number;AP, antipsychotic. Significant associations are indicated in bold.

a p < 0.01.b p < 0.05.c Pearson's r for parametric variables and r, Spearman's correlation for non-

parametric variables.d Last chlorpromazine equivalent dose was calculated based on the electronic

records of drug prescriptions of the patients.

levels (Table 4). Since 63% of the down-regulated genes in SZshowed an association with antipsychotics, we also analyzed theinfluence of chlorpromazine dose on the six non-significant genes.We found that three of them also showed an association with an-tipsychotics (ORF6F: Pearson r ¼ �0.545, p ¼ 0.0355, n ¼ 15;TAS2R10: Pearson r ¼ �0.629, p ¼ 0.0121, n ¼ 15; TAS2R14: Pearsonr ¼ �0.683, p ¼ 0.0050, n ¼ 15).

We also analyzed whether the expression levels of ORs andTASRs in the SZ group associated with an increasing severity innegative symptoms. We only found that TAS2R4 significantlycorrelated with the CGI2 subscale for negative symptoms (Spear-man's r ¼ 0.672, p ¼ 0.0119, n ¼ 13). However, the significance wasnot maintained after correcting of p value for an FDR of 0.1 (cor-rected p value ¼ 0.4041).

4. Discussion

Several hundred putative OR and TASR genes can be expressedin the brain (Glusman et al., 2001; Malnic et al., 2004; Niimura andNei, 2005; Zhang et al., 2007; Zozulya et al., 2001). A panel of a fewof these genes located mainly in some of the most overrepresentedloci in the genome (Adler et al., 2000; Malnic et al., 2004) wereselected for this study based on practical purposes. The rationale forthe examination of these selected ORs and TASRs was to study theexpression of these same genes in schizophrenia compared toAlzheimer's disease, Parkinson's disease and Creutzfeldt-Jakobdisease, in which these genes have been examined in previousstudies (Ansoleaga et al., 2013; Garcia-Esparcia et al., 2013). Thepresent study reveals that around 65% of the ORs (7/11 genes) andTASRs (4/6 genes) were down-regulated in the dorsolateral pre-frontal cortex in SZ and locus 11p15.4was themost affected for ORs.Not a single gene was up-regulated in the present series. In addi-tion, almost half of OR genes and all the TASR genes were regulatedby antipsychotic treatments, and three genes were influenced bythe age of onset. None of them, however, was associated with theduration of the diseases or the severity in negative symptoms. Thus,this study reveals for the first time an alteration of brain ORs andTASRs in SZ and suggests that many of these changes could besecondary to the antipsychotic treatments.

Previous gene array studies identified two clusters of deregu-lated ORs and TASRs in the cerebral cortex in Parkinson's disease,which were validated by qRT-PCR, demonstrating for the first timederegulation of ORs and TASRs in the cerebral cortex (and sub-stantia nigra) in this disease (Garcia-Esparcia et al., 2013; Grisonet al., 2014). The same genes were analyzed in Alzheimer's dis-ease, Progressive Supranuclear Palsy and Creutzfeldt-Jakob disease,and although with disease-specific patterns, ORs and TASRs werefound to be deregulated in the frontal cortex in these diseases(Ansoleaga et al., 2013). As previously mentioned, a similar set ofORs and TASRs was analyzed for this study in schizophrenia. Twoout of seven down-regulated OR genes in SZ, OR51E1 and OR52L1,were also found to be decreased in frontal cortex area 8 in un-medicated premotor Parkinson's disease subjects and in MM1subtype of Creutzfeldt-Jakob disease, suggesting a possible com-mon disrupted mechanism in the locus 11p15.4 for schizophreniaand both degenerative disorders (Ansoleaga et al., 2013; Garcia-Esparcia et al., 2013). However, no changes or opposite changes infrontal cortex were found in Alzheimer's disease and ProgressiveSupranuclear Palsy for nine of down-regulated OR or TASR genes inSZ, suggesting a different regulatory mechanism of these genes inthese diseases compared to SZ (Ansoleaga et al., 2013). Thus, theseprevious observations indicate disease-specific deregulation of ORsand TASRs in several neurodegenerative diseases with abnormalprotein aggregates. The present findings have shown deregulation(for all of them, down-regulation) of ORs and TASRs in the

B. Ansoleaga et al. / Journal of Psychiatric Research 60 (2015) 109e116114

prefrontal cortex area 9 in schizophrenia. As far as we know, nodeposition of abnormal proteins in neurons and glial cells occurs inschizophrenia and, therefore, the present study is the first identi-fication of altered brain OR and TASR in a neuropsychiatric diseasenot linked to abnormal protein aggregates. Whether deregulationof ORs and TASRs occurs in other major psychiatric disorderswarrants further study.

Preliminary studies have not identified a relationship betweenthe increased methylation status of certain OR promoters andmRNA expression of the corresponding genes in Alzheimer's dis-ease when compared to controls, including OR2G6, OR2T1,OR52M1, OR2A5, OR6F1, OR5B3 and OR52H1 as revealed by Illu-mina Infinium Human Methylation 450K Array analysis (unpub-lished observations), suggesting modulators other than DNAmethylation of OR gene promoters may be putative players in theregulation of OR mRNA expression in Alzheimer's. Similar studieshave not been performed for SZ. Highly conserved sequence motifblocks in promoter regions have been identified in a cluster familyof ORs in the mouse suggesting that similar transcription factorscontrol the expression of these genes (Hoppe et al., 2003). In thisregard, our finding that most of the changes were found in geneslocated in the 11p15.4 locus supports this view of similar tran-scription factors modulating ORs genes. However, further studiesare needed to further explore this possibility for both ORs andTASRs.

There is also a lack of information regarding the possible cause ofdifferential sensitivity of some ORs and TASRs to antipsychotics. Itcould be argued that the availability of transcription factors forinteraction with specific sequences in DNA promoters may modu-late selective OR and TASR mRNA expression in response to anti-psychotics. However, the association of the antipsychotic dose withthe expression of ORs and TASRs in our study was not restricted toone cluster of genes that may share similar DNA regulatory se-quences. An alternative mechanism that could be involved in themodulation of OR and TASR genes by antipsychotics could bemediated by histone modification. Histone deacetylases (HDACs)and HDAC inhibitors regulate antipsychotic responses by acting oncertain specific genes including neurotransmitter receptors (Kuritaet al., 2012; Aoyama et al., 2014). Whether post-translationalmodifications of histone tails affect selective OR and TASR expres-sion is not known andwould need additional experimental support.

Olfactory dysfunctions in schizophrenia have been extensivelyreported, with the identification of odors being the most consistentfindings in these subjects (Brewer and Pantelis, 2010; Cohen et al.,2012; Moberg et al., 1999; Rupp, 2010). These types of alterations ofthe olfactory system have been proposed to be a result of neuronalcircuitry compromise in the prefrontal cortex (Brewer and Pantelis,2010; Moberg et al., 1999; Rupp, 2010). Dopaminergic and gluta-matergic neurotransmission systems are deregulated in this regionand are involved in the physiopathogenic mechanisms of SZ(Kantrowitz and Javitt, 2010; Kienast and Heinz, 2006; Krystal et al.,1994; Semkovska et al., 2001; Toda and Abi-Dargham, 2007), sug-gesting that these pathways maybe related to the altered identifi-cation of odors. However, to the best of our knowledge the directlink between both alterations is unknown so far. Moreover, it couldbe premature to argue that the deregulation of ORs that we foundin the prefrontal cortex maybe linked to the olfactory dysfunctionin SZ and/or could be a central reflection of a general down-regulation of ORs in all cells that express these receptors.

Although ORs and TASRs have been proposed to be good can-didates for high-affinity chemodetectors in cells outside their ownepithelium (Behrens and Meyerhof, 2010; Branscomb et al., 2000;De la Cruz et al., 2009; Feldmesser et al., 2006; Li, 2013;Parmentier et al., 1992; Vanderhaeghen et al., 1997; Xu et al.,2013; Yamamoto and Ishimaru, 2013; Zhang et al., 2007;

Dehkordi et al., 2012; Garcia-Esparcia et al., 2013; Grison et al.,2014; Otaki et al., 2004; Singh et al., 2011), the role of these re-ceptors in brain cells and the nature of the putative ligands areunknown. It has been proposed that small natural molecules pre-sent in the brain, putative exogenous ligands transported into thebrain or local chemicals from neighboring or same cells could bindto these receptors and mediate their effects on brain cells (Garcia-Esparcia et al., 2013; Le Danvic et al., 2009; Li, 2013; Spehr et al.,2004; Wetzel et al., 1999). ORs and TASRs are G protein-coupledreceptors with seven transmembrane domains. Chemicalsinteract with the receptor on the cell surface and initiate a signalingcascade that transduces the chemical energy of ligand binding intoion fluxes and the resulting changes into membrane potential andsignaling cascade activation. Thus, an important role of these re-ceptors in the modulation of neuronal and/or glial functions isexpected. Further studies of the functional implications of ORs andTASRs in brain cells are needed to better understand the possiblerole of these proteins in the pathophysiology of SZ and/or in themechanism of action or side effects of antipsychotics.

The decrease in OR and TASR expression in prefrontal cortex inSZ observed in our study was neither related to the duration of thedisease nor to the degree of severity of negative symptoms, but waslargely influenced by antipsychotic drugs, suggesting that thisderegulation of ORs and TASRs could be secondary to the treatmentand may not be a pathogenic mechanism involved in this disorder.This possibility is more feasible for TASRs since all the genesanalyzed inversely associate with an increasing antipsychotic dose.However, half of the OR genes were not influenced by antipsychotictreatments raising the possibility that this deregulation of ORscould be part of the molecular mechanisms disrupted in schizo-phrenia. Supporting this idea is the fact that the olfactory alter-ations reported in SZ are independent of antipsychotic treatments(Brewer et al., 2001; Kopala et al., 1994; Moberg et al., 1999; Wuet al., 1993). However, further studies should be performed in thisdirection.

The use of human postmortem brain constitutes a useful tool todissect the molecular mechanisms disrupted in psychiatric disor-ders, but has limitations. First, potential confounding factors,including age, gender, postmortem delay, pH, and RIN have to becarefully explored. These factors have been controlled for and theirpotential influence ruled out in our study. Second, the possibleeffect of laterality in our sample cannot be ruled out, since onlycontralateral prefrontal cortexwas available for the non-psychiatriccontrol group. Left schizophrenia prefrontal cortex was comparedto right control prefrontal cortex. In a preliminary analysis, we havefound that OR51E1 and OR52L1 were not significantly differentlyexpressed between human left and right frontal cortex from sameindividuals (Wilcoxon range test: OR51E1: W ¼ 4.000, p ¼ 0.6250,n ¼ 4; OR52L1: W ¼ 0.000, p ¼ 1.0000, n ¼ 3). However, furtheranalysis should be performed to explore the laterality effects on theexpression of ORs and TASRs in the human prefrontal cortex. Third,the study only included men. The olfactory dysfunctions in SZ havebeen reported in both genders (Moberg et al., 1999). Four, the studyhad a limited sample size and elderly subjects, characteristicsinherent to the type of sample available for the study. Therefore,further studies in a larger and younger cohort with equal repre-sentation of both genders and controlling for laterality would be ofinterest.

Taken together, the present results indicate that there is adecrease in the expression of several OR and TASR genes inschizophrenia, and suggest that this deregulation is not dependenton the severity of negative symptoms nor influenced by the dura-tion of the illness, but rather that for many of these genes thesealterations may be due to the treatment of these patients withantipsychotics.

B. Ansoleaga et al. / Journal of Psychiatric Research 60 (2015) 109e116 115

Role of funding source

This studywas funded by the Seventh Framework Programme ofthe European Commission, grant agreement 278486: DEVELAGE toI.F., by Plan Nacional de Investigaci�on BFU2008-01103 (MCINN) toB.R., by Predoctoral Fellowship Program from the Basque Govern-ment to B.A., by Predoctoral Fellowship Program from ISCIII (PFIS)to R.P. and by the Centro de Investigaci�on Biom�edica en Red deSalud Mental (CIBERSAM) to B.R. and J.M.H.

Contributors

Author B. Ansoleaga and P. Garcia-Espacia performed geneexpression analysis and analyzed data. Author R. Pinacho analyzeddata and performed the statistical analysis. Author J.M. Harodesigned and implemented the clinical protocol. Author B. Ramosperformed RNA extractions, designed the study, and co-wrote thefirst draft of the manuscript. Author I. Ferrer, designed the studyand co-wrote the first draft of the manuscript. All authorscontributed to and approved the final manuscript.

Conflict of interest

All authors declare that they have no financial conflicts ofinterest.

Acknowledgements

The authors thank the donors and their families for the donationof their brains, the staff members of the brain banks for theircollaboration, and Dr. Rose for English language correction.

Appendix A. Supplementary data

Supplementary data related to this article can be found at http://dx.doi.org/10.1016/j.jpsychires.2014.09.012.

References

Adler E, Hoon MA, Mueller KL, Chandrashekar J, Ryba NJ, Zuker CS. A novel family ofmammalian taste receptors. Cell 2000;100:693e702.

Aggio JF, Tieu R, Wei A, Derby CD. Oesophageal chemoreceptors of blue crabs,Callinectes sapidus, sense chemical deterrents and can block ingestion of food.J Exp Biol 2012;215:1700e10.

Amador XF, Kirkpatrick B, Buchanan RW, Carpenter WT, Marcinko L, Yale SA. Sta-bility of the diagnosis of deficit syndrome in schizophrenia. Am J Psychiatry1999;156:637e9.

Ansoleaga B, Garcia-Esparcia P, Llorens F, Moreno J, Aso E, Ferrer I. Dysregulation ofbrain olfactory and taste receptors in AD, PSP and CJD, and AD-related model.Neuroscience 2013;248C:369e82.

Aoyama Y, Mouri A, Toriumi K, Koseki T, Narusawa S, Ikawa N, et al. Clozapineameliorates epigenetic and behavioral abnormalities induced by phencyclidinethrough activation of dopamine D1 receptor. Int J Neuropsychopharmacol2014;17:723e37.

Arndt S, Andreasen NC, Flaum M, Miller D, Nopoulos P. A longitudinal study ofsymptom dimensions in schizophrenia. Prediction and patterns of change. ArchGen Psychiatry 1995;52:352e60.

Attems J, Walker L, Jellinger KA. Olfactory bulb involvement in neurodegenerativediseases. Acta Neuropathol 2014;127:459e75.

Auster TL, Cohen AS, Callaway DA, Brown LA. Objective and subjective olfactionacross the schizophrenia spectrum. Psychiatry 2014;77:57e66.

Barnea G, O'Donnell S, Mancia F, Sun X, Nemes A, Mendelsohn M, et al. Odorantreceptors on axon termini in the brain. Science 2004;304:1468.

Behrens M, Meyerhof W. Oral and extraoral bitter taste receptors. Results Probl CellDiffer 2010;52:87e99.

Benjamini Y, Hochberg Y. Controlling the false discovery rate: a practical andpowerful approach to multiple testing. J Roy Stat Soc Ser B 1995;57:289e300.

Borde M, Davis EJ, Sharma LN. The stability of symptoms and syndromes in chronicschizophrenic patients. Indian J Psychiatry 1992;34:133e9.

Braak H, Alafuzoff I, Arzberger T, Kretzschmar H, Del Tredici K. Staging of Alzheimerdisease-associated neurofibrillary pathology using paraffin sections andimmunocytochemistry. Acta Neuropathol 2006;112:389e404.

Braak H, Braak E. Neuropathological stageing of Alzheimer-related changes. ActaNeuropathol 1991;82:239e59.

Branscomb A, Seger J, White RL. Evolution of odorant receptors expressed inmammalian testes. Genetics 2000;156:785e97.

Brewer WJ, Pantelis C. Olfactory sensitivity: functioning in schizophrenia and im-plications for understanding the nature and progression of psychosis. VitamHorm 2010;83:305e29.

Brewer WJ, Pantelis C, Anderson V, Velakoulis D, Singh B, Copolov DL, et al. Stabilityof olfactory identification deficits in neuroleptic-naive patients with first-episode psychosis. Am J Psychiatry 2001;158:107e15.

Clark C, Kopala L, Hurwitz T, Li D. Regional metabolism in microsmic patients withschizophrenia. Can J Psychiatry 1991;36:645e50.

Cohen AS, Brown LA, Auster TL. Olfaction, “olfiction,” and the schizophrenia-spectrum: an updated meta-analysis on identification and acuity. SchizophrRes 2012;135:152e7.

Compton MT, Chien VH, Bollini AM, Walker EF. Lack of support for the inability totaste phenylthiocarbamide as an endophenotypic marker in patients withschizophrenia and their first-degree relatives. Schizophr Res 2007;95:65e9.

Compton MT, Ionescu DF, Broussard B, Cristofaro SL, Johnson S, Haggard PJ, et al. Anexamination of associations between the inability to taste phenylthiocarbamide(PTC) and clinical characteristics and trait markers in first-episode, nonaffectivepsychotic disorders. Psychiatry Res 2013;209:27e31.

De la Cruz O, Blekhman R, Zhang X, Nicolae D, Firestein S, Gilad Y. A signature ofevolutionary constraint on a subset of ectopically expressed olfactory receptorgenes. Mol Biol Evol 2009;26:491e4.

Dehkordi O, Rose JE, Fatemi M, Allard JS, Balan KV, Young JK, et al. Neuronalexpression of bitter taste receptors and downstream signaling molecules in therat brainstem. Brain Res 2012;1475:1e10.

Deshpande DA, Wang WC, McIlmoyle EL, Robinett KS, Schillinger RM, An SS, et al.Bitter taste receptors on airway smooth muscle bronchodilate by localizedcalcium signaling and reverse obstruction. Nat Med 2010;16:1299e304.

Doty R. Handbook of olfaction and gustation. 2003.Doty RL. Olfaction in Parkinson's disease and related disorders. Neurobiol Dis

2012;46:527e52.Dreyer WJ. The area code hypothesis revisited: olfactory receptors and other related

transmembrane receptors may function as the last digits in a cell surface codefor assembling embryos. Proc Natl Acad Sci U S A 1998;95:9072e7.

English JA, Pennington K, Dunn MJ, Cotter DR. The neuroproteomics of schizo-phrenia. Biol Psychiatry 2011;69:163e72.

Feinstein P, Bozza T, Rodriguez I, Vassalli A, Mombaerts P. Axon guidance of mouseolfactory sensory neurons by odorant receptors and the beta2 adrenergic re-ceptor. Cell 2004;117:833e46.

Feinstein P, Mombaerts P. A contextual model for axonal sorting into glomeruli inthe mouse olfactory system. Cell 2004;117:817e31.

Feldmesser E, Olender T, Khen M, Yanai I, Ophir R, Lancet D. Widespread ectopicexpression of olfactory receptor genes. BMC Genomics 2006;7:121.

Frith C, Dolan R. The role of the prefrontal cortex in higher cognitive functions.Brain Res Cogn Brain Res 1996;5:175e81.

Fukuda N, Yomogida K, Okabe M, Touhara K. Functional characterization of a mousetesticular olfactory receptor and its role in chemosensing and in regulation ofsperm motility. J Cell Sci 2004;117:5835e45.

Garcia-Esparcia P, Schluter A, Carmona M, Moreno J, Ansoleaga B, Torrejon-Escribano B, et al. Functional genomics reveals dysregulation of cortical olfac-tory receptors in Parkinson disease: novel putative chemoreceptors in thehuman brain. J Neuropathol Exp Neurol 2013;72:524e39.

Gardner DM, Murphy AL, O'Donnell H, Centorrino F, Baldessarini RJ. Internationalconsensus study of antipsychotic dosing. Am J Psychiatry 2010;167:686e93.

Glusman G, Yanai I, Rubin I, Lancet D. The complete human olfactory subgenome.Genome Res 2001;11:685e702.

Gold JM. Cognitive deficits as treatment targets in schizophrenia. Schizophr Res2004;72:21e8.

Goldstein JM, Goodman JM, Seidman LJ, Kennedy DN, Makris N, Lee H, et al. Corticalabnormalities in schizophrenia identified by structural magnetic resonanceimaging. Arch Gen Psychiatry 1999;56:537e47.

Griffin CA, Kafadar KA, Pavlath GK. MOR23 promotes muscle regeneration andregulates cell adhesion and migration. Dev Cell 2009;17:649e61.

Grison A, Zucchelli S, Urzì A, Zamparo I, Lazarevic D, Pascarella G, et al. Mesence-phalic dopaminergic neurons express a repertoire of olfactory receptors andrespond to odorant-like molecules. BMC Genomics 2014;15:729.

Haro JM, Kamath SA, Ochoa S, Novick D, Rele K, Fargas A, et al. The clinical globalimpression-Schizophrenia scale: a simple instrument to measure the diversityof symptoms present in schizophrenia. Acta Psychiatr Scand Suppl 2003:16e23.

Hoppe R, Frank H, Breer H, Strotmann J. The clustered olfactory receptor gene family262: genomic organization, promotor elements, and interacting transcriptionfactors. Genome Res 2003;13:2674e85.

Kang N, Koo J. Olfactory receptors in non-chemosensory tissues. BMB Rep 2012;45:612e22.

Kantrowitz JT, Javitt DC. N-methyl-d-aspartate (NMDA) receptor dysfunction ordysregulation: the final common pathway on the road to schizophrenia? BrainRes Bull 2010;83:108e21.

Kay SR, Fiszbein A, Opler LA. The positive and negative syndrome scale (PANSS) forschizophrenia. Schizophr Bull 1987;13:261e76.

Kayser J, Tenke CE, Kroppmann CJ, Alschuler DM, Ben-David S, Fekri S, et al.Olfaction in the psychosis prodrome: electrophysiological and behavioralmeasures of odor detection. Int J Psychophysiol 2013;90:190e206.

B. Ansoleaga et al. / Journal of Psychiatric Research 60 (2015) 109e116116

Kienast T, Heinz A. Dopamine and the diseased brain. CNS Neurol Disord DrugTargets 2006;5:109e31.

Kinnamon SC. Taste receptor signalling - from tongues to lungs. Acta Physiol (Oxf)2012;204:158e68.

Konradi C. Gene expression microarray studies in polygenic psychiatric disorders:applications and data analysis. Brain Res Brain Res Rev 2005;50:142e55.

Kopala LC, Good KP, Honer WG. Olfactory hallucinations and olfactory identificationability in patients with schizophrenia and other psychiatric disorders. Schiz-ophr Res 1994;12:205e11.

Krystal JH, Karper LP, Seibyl JP, Freeman GK, Delaney R, Bremner JD, et al. Sub-anesthetic effects of the noncompetitive NMDA antagonist, ketamine, inhumans. Psychotomimetic, perceptual, cognitive, and neuroendocrine re-sponses. Arch Gen Psychiatry 1994;51:199e214.

Kurita M, Holloway T, García-Bea A, Kozlenkov A, Friedman AK, Moreno JL, et al.HDAC2 regulates atypical antipsychotic responses through the modulation ofmGlu2 promoter activity. Nat Neurosci 2012;15:1245e54.

Le Danvic C, Guiraudie-Capraz G, Abderrahmani D, Zanetta JP, Nagnan-LeMeillour P. Natural ligands of porcine olfactory binding proteins. J Chem Ecol2009;35:741e51.

Lewis DA, Moghaddam B. Cognitive dysfunction in schizophrenia: convergence ofgamma-aminobutyric acid and glutamate alterations. Arch Neurol 2006;63:1372e6.

Li F. Taste perception: from the tongue to the testis. Mol Hum Reprod 2013;19:349e60.

Malaspina D, Perera GM, Lignelli A, Marshall RS, Esser PD, Storer S, et al. SPECTimaging of odor identification in schizophrenia. Psychiatry Res 1998;82:53e61.

Malnic B, Godfrey PA, Buck LB. The human olfactory receptor gene family. Proc NatlAcad Sci U S A 2004;101:2584e9.

Moberg PJ, Agrin R, Gur RE, Gur RC, Turetsky BI, Doty RL. Olfactory dysfunction inschizophrenia: a qualitative and quantitative review. Neuro-psychopharmacology 1999;21:325e40.

Moberg PJ, Arnold SE, Doty RL, Gur RE, Balderston CC, Roalf DR, et al. Olfactoryfunctioning in schizophrenia: relationship to clinical, neuropsychological, andvolumetric MRI measures. J Clin Exp Neuropsychol 2006;28:1444e61.

Moberg PJ, Li M, Kanes SJ, Gur RE, Kamath V, Turetsky BI. Association of schizo-phrenia with the phenylthiocarbamide taste receptor haplotype on chromo-some 7q. Psychiatr Genet 2012;22:286e9.

Moberg PJ, McGue C, Kanes SJ, Roalf DR, Balderston CC, Gur RE, et al. Phenylthio-carbamide (PTC) perception in patients with schizophrenia and first-degreefamily members: relationship to clinical symptomatology and psychophysicalolfactory performance. Schizophr Res 2007;90:221e8.

Nguyen AD, Pelavin PE, Shenton ME, Chilakamarri P, McCarley RW, Nestor PG, et al.Olfactory sulcal depth and olfactory bulb volume in patients with schizo-phrenia: an MRI study. Brain Imaging Behav 2011;5:252e61.

Nguyen AD, Shenton ME, Levitt JJ. Olfactory dysfunction in schizophrenia: a reviewof neuroanatomy and psychophysiological measurements. Harv Rev Psychiatry2010;18:279e92.

Niimura Y, Nei M. Comparative evolutionary analysis of olfactory receptor geneclusters between humans and mice. Gene 2005;346:13e21.

Otaki JM, Yamamoto H, Firestein S. Odorant receptor expression in the mouse ce-rebral cortex. J Neurobiol 2004;58:315e27.

Parmentier M, Libert F, Schurmans S, Schiffmann S, Lefort A, Eggerickx D, et al.Expression of members of the putative olfactory receptor gene family inmammalian germ cells. Nature 1992;355:453e5.

Reichenberg A, Rieckmann N, Harvey PD. Stability in schizophrenia symptoms overtime: findings from the Mount Sinai Pilgrim psychiatric center longitudinalStudy. J Abnorm Psychol 2005;114:363e72.

Rey ER, Bailer J, Brauer W, Handel M, Laubenstein D, Stein A. Stability trends andlongitudinal correlations of negative and positive syndromes within a three-

year follow-up of initially hospitalized schizophrenics. Acta Psychiatr Scand1994;90:405e12.

Roca M, Escanilla A, Monje A, Ba~no V, Planchat L, Costa J, et al. Banco de tejidosneurol�ogicos de Sant Joan de D�eu-Serveis de Salut Mental para la investigaci�onde las enfermedades mentales. La importancia de un programa de donaci�on envida. Psiquiatr Biol�ogica 2008;15:73e9.

Rupp CI. Olfactory function and schizophrenia: an update. Curr Opin Psychiatry2010;23:97e102.

Schneider F, Habel U, Reske M, Toni I, Falkai P, Shah NJ. Neural substrates of ol-factory processing in schizophrenia patients and their healthy relatives. Psy-chiatry Res 2007;155:103e12.

Semkovska M, Bedard MA, Stip E. Hypofrontality and negative symptoms inschizophrenia: synthesis of anatomic and neuropsychological knowledge andecological perspectives. Encephale 2001;27:405e15.

Singh N, Vrontakis M, Parkinson F, Chelikani P. Functional bitter taste receptors areexpressed in brain cells. Biochem Biophys Res Commun 2011;406:146e51.

Spehr M, Gisselmann G, Poplawski A, Riffell JA, Wetzel CH, Zimmer RK, et al.Identification of a testicular odorant receptor mediating human spermchemotaxis. Science 2003;299:2054e8.

Spehr M, Schwane K, Heilmann S, Gisselmann G, Hummel T, Hatt H. Dual capacity ofa human olfactory receptor. Curr Biol 2004;14:R832e3.

Stahl SM, Buckley PF. Negative symptoms of schizophrenia: a problem that will notgo away. Acta Psychiatr Scand 2007;115:4e11.

Tandon R, Keshavan MS, Nasrallah HA. Schizophrenia, “just the facts” what weknow in 2008. 2. Epidemiology and etiology. Schizophr Res 2008;102:1e18.

Tandon R, Nasrallah HA, Keshavan MS. Schizophrenia, “just the facts” 4. Clinicalfeatures and conceptualization. Schizophr Res 2009;110:1e23.

Teffer K, Semendeferi K. Human prefrontal cortex: evolution, development, andpathology. Prog Brain Res 2012;195:191e218.

Toda M, Abi-Dargham A. Dopamine hypothesis of schizophrenia: making sense of itall. Curr Psychiatry Rep 2007;9:329e36.

Turetsky BI, Hahn CG, Arnold SE, Moberg PJ. Olfactory receptor neuron dysfunctionin schizophrenia. Neuropsychopharmacology 2009;34:767e74.

Vanderhaeghen P, Schurmans S, Vassart G, Parmentier M. Molecular cloning andchromosomal mapping of olfactory receptor genes expressed in the male germline: evidence for their wide distribution in the human genome. BiochemBiophys Res Commun 1997;237:283e7.

Weber M, Pehl U, Breer H, Strotmann J. Olfactory receptor expressed in ganglia ofthe autonomic nervous system. J Neurosci Res 2002;68:176e84.

Wetzel CH, Oles M, Wellerdieck C, Kuczkowiak M, Gisselmann G, Hatt H. Specificityand sensitivity of a human olfactory receptor functionally expressed in humanembryonic kidney 293 cells and Xenopus Laevis oocytes. J Neurosci 1999;19:7426e33.

Wong AH, Van Tol HH. Schizophrenia: from phenomenology to neurobiology.Neurosci Biobehav Rev 2003;27:269e306.

Wu J, Buchsbaum MS, Moy K, Denlea N, Kesslak P, Tseng H, et al. Olfactory memoryin unmedicated schizophrenics. Schizophr Res 1993;9:41e7.

Xu J, Cao J, Iguchi N, Riethmacher D, Huang L. Functional characterization of bitter-taste receptors expressed in mammalian testis. Mol Hum Reprod 2013;19:17e28.

Yamamoto K, Ishimaru Y. Oral and extra-oral taste perception. Semin Cell Dev Biol2013;24:240e6.

Zhang X, De la Cruz O, Pinto JM, Nicolae D, Firestein S, Gilad Y. Characterizing theexpression of the human olfactory receptor gene family using a novel DNAmicroarray. Genome Biol 2007;8:R86.

Zozulya S, Echeverri F, Nguyen T. The human olfactory receptor repertoire. GenomeBiol 2001;2. RESEARCH0018.