upregulation of expression of the reticulocyte homology gene 4 in the plasmodium falciparum clone...

Molecular & Biochemical Parasitology 145 (2006) 205–215

Upregulation of expression of the reticulocyte homology gene 4 in thePlasmodium falciparum clone Dd2 is associated with a switch in

the erythrocyte invasion pathway

Deepak Gaur, Tetsuya Furuya, Jianbing Mu, Lu-bin Jiang,Xin-zhuan Su, Louis H. Miller∗

Laboratory of Malaria and Vector Research (LMVR), National Institutes of Allergy and Infectious Diseases (NIAID), National Institutes of Health (NIH),12735 Twinbrook Parkway, Building Twinbrook III/Room 3E-32D, Bethesda, MD 20892-8132, USA

Received 7 July 2005; received in revised form 23 September 2005; accepted 4 October 2005Available online 25 October 2005

Abstract

ThePlasmodium falciparum clone, Dd2, that requires sialic acid for invasion can switch to a sialic acid independent pathway, Dd2(NM). Toe ites usinga , only twooa ce of theseO riptionu expresw ofP fors tsi©

K

1

rPuafee

a

tes.e bysometion

d ery-asitesnot

sialic

inva-the

-tecyte

0d

lucidate the molecular basis of the switch in invasion phenotype of Dd2 to Dd2(NM), we performed expression profiling of the parasn oligonucleotide microarray and real-time RT-PCR. We found that four genes were upregulated in Dd2(NM) by microarray analysisf which could be confirmed by real time RT-PCR. One gene,PfRH4, is a member of the reticulocyte homology family and the other,PEBL, ispseudogene of the Duffy binding-like family. The two genes are contiguous but transcribed in opposite directions. The DNA sequenRFs, their 5′-intergenic region and a 1.1 kb region 3′ to each ORF are identical between Dd2 and Dd2(NM), suggesting that their transcpregulation relates to transactivating factors. The transcription upregulation of PfRH4 was reflected at the protein level as PfRH4 proteinsionas detected in Dd2(NM) and not in Dd2. Other sialic acid independent and dependent clones ofP. falciparum showed variable transcript levelsfRH4 andPEBL, unrelated to their dependence on sialic acid for invasion, suggesting that differentP. falciparum clones use different receptorsialic acid independent invasion. As Dd2(NM) is a selected subclone of Dd2, the marked upregulation ofPfRH4 expression in Dd2(NM) sugges

ts role in erythrocyte invasion through the sialic acid independent pathway of Dd2(NM).2005 Elsevier B.V. All rights reserved.

eywords: Plasmodium falciparum; Transcription; Erythrocyte invasion; Sialic Acids; Switch in invasion

. Introduction

Plasmodium falciparum exhibits redundancy in parasiteeceptors for invasion of human erythrocytes[1]. This enables. falciparum to invade erythrocytes through multiple pathways,nlikeP. vivax that is totally dependent on the Duffy blood groupntigen for successful invasion. The alternate invasion pathways

or different clones are defined by the ability or inability to invadenzyme treated erythrocytes and for parasite receptors to bindrythrocytes null for specific surface proteins.

Sialic acid residues on the erythrocyte surface play a roles host ligands during erythrocyte invasion byP. falciparum

∗ Corresponding author. Tel.: +1 301 435 2177; fax: +1 301 402 2201.E-mail address: [email protected] (L.H. Miller).

merozoites[2–11]. However, differentP. falciparum clones varyin their dependence on sialic acid for invasion of erythrocyRemoval of sialic acid residues from the erythrocyte surfacneuraminidase treatment drastically reduces invasion byP. falciparum clones, but produces a modest to no reducin invasion by otherP falciparum clones.P. falciparum clonessuch as 3D7, HB3, and 7G8 invade neuraminidase-treatethrocytes and are referred to as sialic acid independent par[10–12]. Other clones such as Dd2, MCamp and FCR3, doinvade neuraminidase-treated erythrocytes and thus areacid dependent parasites[10,11,13,14].

The sialic acid dependent clone Dd2 was selected forsion through a sialic acid independent pathway by growingparasite on neuraminidase-treated erythrocytes[13]. These parasites were named Dd2(NM)[13]. The ability of the Dd2 parasiclone to change its requirement for sialic acid as the erythro

166-6851/$ – see front matter © 2005 Elsevier B.V. All rights reserved.oi:10.1016/j.molbiopara.2005.10.004

206 D. Gaur et al. / Molecular & Biochemical Parasitology 145 (2006) 205–215

ligand for invasion suggested that a switching mechanism wasresponsible for allowing the parasite to invade using a sialicacid independent pathway. The change in invasion phenotypepersists even in the absence of selection pressure, implying thatthe switch has a genetic basis. Changes at the molecular levelsuch as nucleotide substitutions or gene expression differencesmay have occurred during the selection process in response tothe invasion requirement, although the genomes of the two par-asite clones should be the same. The microsatellite fingerprintof Dd2 and Dd2(NM) was identical[13], indicating a similargenotype for both clones.

To elucidate the molecular basis of the switch in invasionphenotype of the Dd2 parasite to Dd2(NM), we performed tran-scription profiling of Dd2 and Dd2(NM), using aP. falciparum-specific DNA microarray and quantitative real-time reverse tran-scription (RT)-PCR. Our studies showed that two genes onchromosome 4,PfRH4 and a pseudogene,PEBL (eba-165), arehighly upregulated in the Dd2(NM) clones when compared toDd2. This report identifies the candidate molecule that may bethe basis for the sialic acid independent invasion pathway of theDd2(NM) parasite clones.

2. Materials and methods

2.1. P. falciparum parasites

D[ troap throc lbu-m MH nd1Tp asd o-t s. Te ocyti cribep

2

prev eat-m itolg en-e werh n. Io tago er-c ent( riedo tifies m.

2.3. cDNA labeling and microarray hybridizations

Fluorescently labeled cDNA was produced from 30�g oftotal RNA in a 30�l labeling reactions containing: 1X RTbuffer, 10 mM DTT, 2�g oligo dT12-20 primer, 3�g randomhexamer (pdN6), 500�M dATP, dCTP, dGTP, 100�M dTTP,20 URNaseOUT recombinant ribonuclease inhibitor, 300 USuperscript II (Invitrogen), 66.7�M dUTP-Cy3 or dUTP-Cy5(Amersham Biosciences, Piscataway, NJ). The reverse transcrip-tion reaction mixture was incubated at 42◦C for 90 min. RNAwas degraded by treatment with 10�l of 1N NaOH and 70◦Cheat for 15 min and then neutralized with 10�l 1N HC1. TheCy3- and Cy5-labeled cDNAs to be hybridized on the same slidewere co-purified by filtering the samples through six successivewashes in TE, pH 8.0 (30 K Vivaspin 500 filter, Vivascience AG,Hannover, Germany).

The hybridizations were done at the NIAID MicroarrayResearch Facility, National Institutes of Health, Bethesda, MD.Hybridizations were performed in cDNA hybridization solution(5× SSC, 0.2% SDS, 25% formamide with 10�g salmon spermDNA) (Invitrogen) using the MicroArray User Interface (MAUI)hybridization system (BioMicro Systems, Salt Lake City, UT).After incubation at 45◦C overnight, the slides were washedtwice with 0.05% SDS in lxSSC followed by two washes of0.1× SSC and scanned with a GenePix 4000B array scanner(Axon Instruments, Union City, CA). Microarray signals frome /Cy3r ltereda andw ionalC

2

firstm firsts r them r theg

dingt andS dw first-s d ina olis,I he).P pli-c atedu riedo ingcf ale

cificc sionnT

P. falciparum clones used in this study were Dd2[13],d2(NM1) [13], Dd2(NM2) [13], 3D7 [15], HB3 [16], FCR3

11] and MCamp[13]. The parasites were cultured in viccording to the methods of Trager and Jensen[17]. Thearasites were grown in a 2% suspension of human 0+ eryytes and RPMI 1640 media supplemented with 0.5% Aax (GIBCO, Life Technologies, Grand Island, NY), 24 mEPES, 360�M hypoxanthine, 24 mM sodium bicarbonate a0�g/ml gentamycin at 37◦C with 5% CO2/5% O2/90% N2.he identity of each parasite clone was confirmed byP. falci-arum rifin repetitive microsatellite (PfRRM) fingerprintingescribed previously[18] and by studying the invasion phen

ypes of the parasites on neuraminidase treated erythrocytenzymatic treatment of the target erythrocytes and erythr

nvasion assays for the parasites were performed as desreviously[19].

.2. RNA preparation

Total RNA was isolated from each parasite as describediously [20]. The parasites were synchronized by sorbitol trents[21] for three generations, followed by a Percoll-sorbradient[22] and further sorbitol treatment for another two grations. For the microarray experiments, the parasitesarvested at the late schizont stage for total RNA preparatione experiment, total RNA was isolated at the trophozoite sf the parasites. 2.5× 109 parasites were purified on 70/40% Poll sorbitol gradient and solubilized in 1 ml of Trizol reagInvitrogen, Carlsbad, CA). Total RNA extraction was carut as described by the manufacturer. The RNA was quanpectrophotometrically by measuring absorbance at 260 n

-

heed

-

ene

d

ach array spot were normalized so that the median Cy5atio was set as 1.0. Data from repeat experiments were find analyzed with GenePix Pro 4.0 (Axon Instruments)eb-based microarray tools (mAdb) developed by the Natancer Institute (http://nciarray.nci.nih.gov/).

.4. Real time RT-PCR

Real time RT-PCR was done by two methods. In theethod, the primers (oligo-dT and random hexamers) for

trand cDNA synthesis were identical to the ones used foicroarray. The second method used specific primers foenes of interest for the first strand cDNA synthesis.

The first strand cDNA synthesis was performed accoro the instructions of the Invitrogen Superscript First Strynthesis System kit (Invitrogen). 5�g of total RNA digesteith DNase I and was reverse transcribed to generatetrand cDNA and quantitative real-time PCR was performeLightcycler real-time detection system (Roche, Indianap

N), using the Fast Start DNA Master SYBR Green I kit (Rocrimers for real-time RT-PCR were designed to produce amons of 90–219 bp, and the quantity of cDNA was calibrsing serial-diluted plasmid DNA. The reactions were carut according to manufacturer’s instructions with the followycling program: 2 min at 94◦C for initial denaturation; 94◦Cor 30 s, 45◦C for 20 s, 60◦C for 30 s for 30 cycles; and a finxtension at 60◦C for 2 min.

The gene specific primers used for the strand speDNA synthesis are as follows. PfRH4 (GenBank acceso. AF420309): RH4-5364F (5′-GATCTTAAATCAGGATC-GC-3′), RH4-5974R (5′-CGGAATCGAATCGTATTATG-3′);

http://nciarray.nci.nih.gov/

D. Gaur et al. / Molecular & Biochemical Parasitology 145 (2006) 205–215 207

PEBL (GenBank accession no. AY032735): PEBL-11045F (5′-GTAGTCATGTAGATCAAGTA-3′), PEBL-11651R (5′-ATTC-CAGTAACTTCCTCACCCT-3′); PF110261 (Plasmodb ID):DG0261-F1 (5′-TATGTGAATGTTTTTATTGC-3′), PF261-3496F (5′-CCTTAGATAGTTTTTAATAC-3′); PF110263 (Plas-modb ID): PF263-2748F (5′-CAAAGGTATCTACAAGGT-AAG-3′), PF263-3174R (5′-CTTTAAATGTCCGATTTATT-3′).

The primers used to produce the amplicons in the realtime PCR reactions are as follows: PfRH4 (RH4-5755F:5′-GTTCTTTTGTAGTTTCTAAC-3′, RH4-5974R: 5′-CGGA-ATCGAATCGTATTATG-3′); PEBL (PEBL-11100F: 5′-GC-AAATGGTAGAGAAGATCC-3′, PEBL-11199R: 5′-GACAT-CTCTTCCAGAACTAC-3′); PF110261 (DG0261F2: 5′-AT-GAAAACAAGGTGTGTTTT-3′, PF261-4290F: 5′-CATCAT-ATATAGGATATCCCC-3′); PF110263 (PF263-2907F: 5′-CC-AGCTTACCATTTCTTGAAG-3′, PF263-3000R: 5′-CACAT-GTAAATACAAATTCCA-3 ′).

The primers used in the RT-PCR reactions to detect senseand antisense transcripts for PfRH4 and PEBL are as fol-lows: PfRh4 (Rh4-5447F: GATAATTCGTTCTTGTGGTAG,Rh4-5911R: CAGTATCTTTTGTACCTCCG); PEBL (PEBL-11100F: GCAAATGGTAGAGAAGATCC, PEBL-11603R:CTACCTCCATTCGACATTTC).

2.5. DNA sequencing

asf35GGATT fore[ ,C y ana comm

g ultyi waa enicrTC teds ereoGT3CAC5CG

TG-3′; SQ22: 5′-AGTTCTTATGTTATAGCATC-3′; SQ23:5′-GATGCTATAACATAAGAACT-3 ′.

The 1.1 kb region 3′ to thePfRH4 andPEBL open readingframes (ORFs) were sequenced by first PCR amplification ofthis region using the following primers: PfRH4 (Rh4-3′F1:5′-CAGATGAATATATATAATGGTC-3 ′; Rh4-3′R8: 5′-GAA-GATTTTAATGACATATG-3′); PEBL (PEBL-3′Fl: 5′-TTAT-TTAGAATACCATGTGG-3′; PEBL-3′R10: 5′-ACTTATTCT-TTTATCTGCAG-3′). Sequencing was performed using the fol-lowing primers: Rh4-3′F5: 5′-GGCCATTTAATTATTCTGTT-3′; Rh4-3′F6: 5′-GTAGAGGAAAACTATAATCT-3 ′; Rh4-3′F7:5′-GGAACACTTCAAAAAAAGTA-3 ′; Rh4-3′F8: 5′-CTG-ACTTGTACATGTGAAAA-3′; Rh4-3′F9: 5′-GAATAGATA-TGGAAAGAATG-3′; Rh4-3′R4: 5′-AGATTATAGTTTTCC-TCTAC-3′; Rh4-3′R5: 5′-TACTTTTTTTGAAGTGTTCC-3′;Rh4-3′R6: 5′-TTTTCACATGTACAAGTCAG-3′; Rh4-3′R7:5′-CATTCTTTCCATATCTATTC-3′; PEBL-3′F2: 5′-GGTTA-CAATTTTGTACCTCA-3′; PEBL-3′F3: 5′-TACCTATATTT-TTAATCAGG-3′; PEBL-3′F4: 5′-GTATTTTAACGTTCAC-TACATG-3′; PEBL-3′F5: 5′-GTCAACATATTTAGAGCACC-3′; PEBL-3′F6: 5′-GAGACATAAACATTTAGACG-3′; PEBL-3′R1: 5′-TGAGGTACAAAATTGTAACC-3′; PEBL-3′R2:5′-CCTGATTAAAAATATAGGTA-3 ′; PEBL-3′R3: 5′-CATG-TAGTGAACGTTAAAATAC-3 ′; PEBL-3′R4: 5′-GGTGCTCT-AAATATGTTGAC-3′; PEBL-3′R5: 5′-CGTCTAAATGTT-TATGTCTC-3′; PEBL-3′R6: 5′-AGCTCCAGAAAAATAA-T

2

i-fiAATA am o,C llyi A)s daysa ionI c-c ndI sda,M

NM)c ed inP tesei uis,M M)c ingc ma)o losem :300d n ofd ack-s -175

Primers for PCR amplification and sequencing areollows: PfRH4 (RH4-F1: 5′-CAAGGAAATGACGCAATTC-′, RH4-R6: 5′-TGAGTATAATCGAACAAGATG-3′; RH4-F6:′-ACAACAAACTACAAATCGG-3 ′, RH4-R11: 5′-CATAT-TCATTAAAATCTTC-3′); PEBL (PEBL-F1: 5′-TGAGAAA-ACCTTGAAGTTG-3′, PEBL-Rl: 5′-TATTATTCTCTGG-AGTTGTTC-3′; PEBL-F6: 5′-CTACGGTATGTAATAAG-CTTG-3′, PEBL-R10: 5′-AATTATCCACATGGTATTCT-3′).he PCR amplification conditions were as described be

23]. After treatment with SAP/Exo l (U.S. Biochemical Corpleveland, OH), the PCR products were sequenced directlnalyzed on an ABI 3730XL automatic sequencer as reended (Applied Biosystems Inc., Foster City, CA).The 1.8 kb intergenic region between thePfRH4 andPEBL

enes had a highly AT-rich sequence that created difficn sequencing. The complete sequencing of this regionccomplished by first PCR amplification of the entire intergegion using the following primers: SQ1: 5′-GAGGGAA-TGCGTCATTTCC-3′, SQ3: 5′-CCAGCTTACATAATGCC-TA-3′. Then we designed several primers that initiaequencing of small stretches of the amplified DNA and wverlapping. These primers are as follows: SQ4: 5′-GAG-AACCCAGAGATATAAA-3 ′; SQ7: 5′-CAAATGTTTGT-CTTAACAA-3′; SQ8: 5′-TCAACTTATAAAAGATCTGG-′; SQ11: 5′-GACTGTAGCCAAATGATGGC-3′; SQ12: 5′-TATGTTATTACAACCTCATC-3′; SQ14: 5′-CAAGAACA-ATATAAGAGAAC-3 ′; SQ15: 5′-GTTCTCTTATATTTGTT-TTG-3′; SQ16: 5′-ATTCTAAGATCCTCCTTTCC-3′; SQ18:′-TAAACCTTACACAAGGGGTGC-3′; SQ19: 5′-GCACC-CTTGTGTAAGGTTTA-3′; SQ20: 5′-CACAAGTTCATAAT-GAATATC-3′; SQ21: 5′-GATATTCCATTATGAACTTG-

d-

s

ACG-3′.

.6. Antisera production and Western blotting

A 783 bp fragment of thePfRh4 gene was ampled using the following primers: 5′-GAGAACGCGTA-TATTCTTAATGCAGATCCTGATTTAAG-3′ and 5′-GAG-GGGCCCATCGTTATAATACATATTAAAAGTATTAATTT-TGTATCG-3′. The PCR product was digested withMlu I andpa I (New England Biolabs, Beverly, MA) and ligated intoodified VR1020 vector (a kind gift from Vical, San DiegA). 500�g of this purified vector was injected intraderma

nto Sprague-Dawley rats (Charles River, Wilmington, Mix times at three-week intervals. Sera were collected 7fter the final injection. The rabbit anti-EBA-175 (Reg

I) antibody was a kind gift of A. Stowers (Malaria Vaine Development Branch, National Institute of Allergy anfectious Diseases, National Institutes of Health, BetheD).Late schizont stage parasites from the Dd2 and Dd2(

lones were saponin lysed and subsequently resuspendBS with 1% NP-40 and protease inhibitors (complete pro

nhibitor cocktail, Roche and 1 mM PMSF, Sigma, St. LoO). Equal amount of extracts from the Dd2 and Dd2(N

lones equivalent to 6× 107 parasites were run under reduconditions (1% SDS, Invitrogen; 2% 2-mercaptoethanol, Sign a 6% Tris-Glycine gel and transferred to a nitrocelluembrane (Invitrogen). The membrane was probed with a 1ilution of primary rat anti-PfRH4 sera and a 1:50,000 dilutioonkey anti-rat secondary antibody conjugated to HRPO (Jon Immunoresearch, West Grove, PA). For detecting EBA


protein expression, the membrane was probed with a 1:1000dilution of primary rabbit antisera and a 1:20,000 dilution ofgoat anti-rabbit secondary antibody conjugated to HRPO (Jack-son Immunoresearch). Bands were visualized using an enhancedchemiluminescence (ECL) kit according to the manufacturer’sinstructions (Pierce, Rockford, IL).

3. Results

The P. falciparum clone Dd2(NM) was derived by grow-ing the parent clone Dd2 in neuraminidase-treated erythro-cytes [13]. One difference in invasion phenotype betweenDd2 and Dd2(NM) is that Dd2(NM) can efficiently invadeneuraminidase-treated erythrocytes; Dd2 is unable to invadeneuraminidase-treated erythrocytes (Fig. 1). Both clones have anidentical rifin microsatellite fingerprint, indicating that they werederived from the same clone (data not shown). To investigate themolecular basis for this difference in the sialic acid independentinvasion phenotype (i.e., able to invade neuraminidase-treatederythrocytes), we performed expression profiling of the late sch-izont stages of the two parasites to search for differences in geneexpression that could account for the different invasion phe-notypes. For a precise comparison ofP. falciparum transcriptsbetween the two clones [Dd2(NM) and Dd2], it was essentialto use highly synchronized parasite cultures (see materials andm d foR exuae

3

ngo eRisa dyr nuala an1 col-l ione es oD r-

F en

ray experiment, total RNA was isolated independently. For thefirst two hybridization experiments, total RNA was preparedfrom synchronized cultures of Dd2(NM1) and Dd2. For the thirdexperiment, total RNA was prepared from synchronized culturesof Dd2(NM2) and Dd2.

We chose to compare transcription in late schizont stages(−44 h of the 48 h cycle) of the two parasite clones becausegenes involved in invasion, such as the Duffy binding-like (DBL)family, are expressed during the late schizont stages of the ery-throcytic life cycle[26]. Genes expressed in the schizont stageof development (EBA-175, BAEBL, JESEBL, AMA-1) serve ascontrols to confirm that each parasite was at a similar stage ofdevelopment at the time of RNA preparation. These four geneswere well expressed in all threeP. falciparum clones [Dd2,Dd2(NM1) and Dd2(NM2)] as displayed by their high inten-sity spot signals and had a mean expression ratio [Dd2(NM1):Dd2 and Dd2(NM2): Dd2] in the range of 0.8–1.4, indicatingequal expression of schizont-encoded genes in the two parasites.

Among all the genes assayed, only four genes (PfRH4, PEBL,PF11 0261 and PF11 0263) were found to be reproduciblyupregulated in Dd2(NM) compared to Dd2 (Fig. 2). Theseupregulated genes were also seen in experiments in which thedyes for cDNA labeling were reversed to avoid selecting geneswith ratios caused by dye biased labeling (data not shown).Another oligonucleotide (Ks2886l) from a putative ABC trans-porter gene (PF11 0466) displayed a consistent upregulation inD eres airs int 17K , sug-gc ciblyu rraye twoo 7-f d toDo tere thet

inD ed ino doa arraycG enD ro-m

zonts stage( rayaa M)(

P the

ethods). The parasites from both clones were harvesteNA extraction at the same late schizont stage of the asrythrocytic cycle.

.1. Microarray analysis

Expression profiling was first performed using a loligonucleotide (70mers) microarray designed by Joseph Dnd coworkers[24,25]. The DNA microarray used in this stuepresents 4488 of the 5409 ORFs that have been mannotated by the malaria genome sequencing consortium315 putative ORFs not part of the manually annotated

ection [24,25]. Three independent microarray hybridizatxperiments were conducted using two independent clond2(NM) [(Dd2(NM1), Dd2(NM2)] and Dd2. In each microa

ig. 1. Comparison of the efficiency of differentP. falciparum clones to invadeuraminidase-treated erythrocytes (RBCs).

rl

i

lyd

f

d2(NM), but the first 43 base pairs of this oligonucleotide weparated from the second 27 base pairs by 122 base phe open reading frame. Two other oligonucleotides (Ksl7l,s225 l) from the same gene displayed an equal expressionesting that the upregulation observed for the Ks2886l oligonu-leotide is an artifact. No gene was found to be reprodupregulated in Dd2 compared to Dd2(NM) in all the microaxperiments. ThePfRH4 gene is represented on the chip byligonucleotides, D66811 and D66812 that displayed a 16–2

old greater expression level in the Dd2(NM) clone compared2 among the three hybridization experiments (Table 1). Theligonucleotide of thePEBL gene displayed a 22-fold greaxpression in the Dd2(NM) clones compared to Dd2 forhree hybridization experiments (Table 1).

The two genesPfRH4 and PEBL that are upregulatedd2(NM) are contiguous on chromosome 4 and transcribpposite directions (Fig. 3). PEBL is located 97 kb from the enf chromosome 4. There are 18 predicted genes betweenPEBLnd the telomere, of which 13 are represented on the microhip and are transcribed similarly in Dd2 and Dd2(NM) (Fig. 3).enes upstream toPfRH4 are also transcribed similarly betwed2 and Dd2(NM). Thus, the upregulation in Dd2(NM) on chosome 4 is localized to the two genes,PfRH4 andPEBL.To determine if the upregulation was specific for the schi

tage, Dd2 and Dd2(NM) were harvested at the trophozoite30 h of the 48 h cycle) for RNA preparation. The microarnalysis of these preparations showed poor expression ofPfRH4ndPEBL in the trophozoite stage for both Dd2 and Dd2(Ndata not shown).

The two other upregulated, genes (PF11 0261 andF11 0263) are on chromosome 11 and are transcribed in


Fig. 2. Scatter plot representing the expression of genes in Dd2(NM) compared to Dd2 as measured by the microarray hybridization analysis. Each oligonucleotide isprinted on the microarray chip in duplicate and thus the hybridization signal for the oligonucleotide produces two spots. The spots that display suchreproducibility arecircled and represent the following genes: Two ohgonucleotides forPfRH4 (1), PEBL (2), PF11 0261 (3), PF110261-antisense (4),PF11 0263 (5), PF110466 (6).The results shown here were reproducible in four independent experiments. Spots (7) represent negative controls with the ohgonucleotides from unrelated plasmidsequences. These were found to be upregulated in Dd2 in only this one microarray experiment.

same orientation. One gene between them on the opposite strandwas not upregulated. These two genes are of unknown function.PF 11 0261 is represented on the chip by two oligonucleotidesKs2918 and Ks29110.

The Ks2918 oligonucleotide showed a 61-fold higherexpression in Dd2(NM) compared to Dd2 (Table 1). The Ks291-10 oligonucleotide corresponds to the antisense sequence of thePF11 0261 gene and displayed a 53-fold higher expression inthe Dd2(NM) clone compared to Dd2 (Table 1). ThePF11 0263

gene is denoted on the chip by the oligonucleotide Ks2915 thatshowed an 18-fold higher expression in Dd2(NM) compared toDd2 (Table 1).

3.2. Real time RT-PCR

To confirm the results of microarray analysis, we performedquantitative real time RT-PCR, using the same total RNA pre-pared for the three microarray experiments. The first strand

Table 1Microarray results for the upregulated genes in Dd2(NM) compared to Dd2

Gene Plasmodb ID Oligo IDa Expression ratiob [Dd2(NM)/Dd2]

Dd2(NM1)/Dd2 Dd2(NM1)/Dd2 Dd2(NM2)/Dd2 Average± S.E.

PfRH4c PFD1150c D66811 22.4 15.7 10.8 16.3± 3.3PfRH4c PFD1150c D66812 19.8 27.3 34.2 27.1± 4.1PEBLc PFD1155w D668110 24.2 9.2 34.8 22.7± 7.4Hypotheticald PF110261 Ks2918 30.6 20.6 134 61.7± 36.2

PF110261 (antisense) Ks29110 39.5 44.5 74.3 52.8± 10.8

Hypotheticald PF110263 Ks2915 22.4 15.7 17.4 18.5± 2.0

a Oligo ID: Oligo ID number assigned for each gene (Bozdech et al., 2003).b Expression ratio is the fold difference in transcript level between Dd2(NM) and Dd2.c Gene present on chromosome 4.d Gene present on chromosome 11.


Fig. 3. Chromosomal location of two upregulated genes,PfRH4 andPEBL, in Dd2(NM). Genes surrounding these two genes in the sub-telomeric 120 kb regionof chromosome 4 were not upregulated. The number in parenthesis is the mean expression ratio between Dd2(NM) and Dd2 for each gene in the three microarrayexperiments. The genes shown in open boxes are represented on the microarray chip, while the five genes shown as boxes with diagonally hatched lines arenotrepresented on the chip. No expression was observed in Dd2 and Dd2(NM) for thePFD1215w, PFD1230c (rifin) andPFD1245c (PfEMP1) genes.

cDNA synthesis for these real time RT-PCR reactions wasprimed using oligo-dT and random hexamers in the same wayas for the microarray experiments. ThePfRH4 transcript wasexpressed 32-fold higher in the Dd2(NM) clone compared toDd2 (Table 2andFig. 4). ThePEBL transcript was expressed12-fold higher in the Dd2(NM) clones compared to Dd2. Thereal time RT-PCR, however, showed an equal expression of thetwo hypothetical genes (PF11 0261 andPF11 0263) betweenthe Dd2(NM) and Dd2 clones. Thus, of the four genes observedby microarray hybridization experiments to be upregulated inthe Dd2(NM) parasite clones, onlyPfRH4 andPEBL were con-firmed by the quantitative real time RT-PCR.

To check for the presence of antisense transcripts, we per-formed strand specific RT-PCRs forPfRH4 and PEBL usingtotal RNA from the Dd2/NM clone (Fig. 5). PEBL andPfRH4are located on the + and− DNA strands, respectively. The strandspecific RT-PCRs detected products amplified from the senseand antisense cDNA for both genes,PfRH4 andPEBL (Fig. 5).However, a much larger amount of sense RNA transcripts thanantisense transcripts were detected for the two genes (Fig. 5).

Due to the presence of antisense transcripts, we performedreal time RT-PCR with strand specific primers that would allow aseparate comparison of sense and antisense transcripts between

the two P. falciparum clones Dd2 and Dd2(NM). Two strandspecific primers for each gene were used to prime first strandcDNA synthesis from sense and antisense transcripts present inthe total RNA isolated from the parasite clones (Fig. 5). ThePfRH4 sense and antisense transcripts were expressed 222-foldand 12-fold higher, respectively, in the Dd2(NM) clones com-pared to Dd2 (Table 3). ThePEBL sense and antisense transcriptswere expressed 111-fold and 19-fold higher, respectively, in theDd2(NM) clones compared to Dd2 (Table 3). The sense and anti-sense transcripts for the two hypothetical genes on chromosome11, PF11 0261 and PF11 0263, were observed to be similarbetween the two parasite clones, Dd2(NM) and Dd2 (Table 3).

3.3. Sequence of PfRH4 and PEBL and their intergenicregions

The two genesPfRH4 and PEBL that are upregulated inDd2(NM) are contiguous on chromosome 4 (1.8 kb apart) andtranscribed in opposite directions (Fig. 3). Both parasite clones,Dd2 and Dd2(NM), had the identical sequence for the two genes,PfRH4 (Genbank accession no. AF420309) andPEBL (Gen-bank accession no. DQ100425). The sequence of intergenicregion between thePfRH4 andPEBL genes was also identical

Table 2C 2 qu

G

M1)/

P , 12)P 11, 8)P (0.8,P (0.8,

A sy(NM) numbers

p ion.

omparison of the transcript levels for the four genes in Dd2(NM) and Dd

ene Expression ratiob [Dd2(NM)/Dd2]

Dd2(NM1)/Dd2 Dd2(/N

fRH4 67 (96, 39) 11 (10EBL 12 (10, 14) 9.5 (F110261 1.3 (2, 0.6) 0.95F110263 0.85 (0.6, 1.1) 0.95

a Oligo-dT and Random hexamers were used to initiate first strand cDNb Expression ratio is the fold difference in transcript level between Dd2arenthesis represent the expression ratio for each individual PCR react

antified by real time RT-PCRa

Dd2 Dd2(NM2)/Dd2 Average± S.E.

19 (17, 22) 32.7± 13.316 (17, 15) 12.5± 1.4

1.1) 1.8 (1.7, 1.9) 1.35± 0.241.1) 1.8 (1.7, 1.9) 1.20± 0.20

nthesis for the real time RT-PCRs.and Dd2. The expression ratios are a mean of two PCR reactions. Thein


Fig. 4. Real time RT-PCR curves comparing transcription ofPfRH4 (A, B) andPEBL (C, D) in Dd2(NM1), Dd2(NM2) and Dd2. Oligo-dT and random hexamerswere used for first strand cDNA synthesis for these real time RT-PCRs. The curves represent the incorporation of the SYBR Green fluorescent dye in the ampliconsfrom each parasite’s cDNA sample. The time difference in dye incorporation or product amplification reflects a difference in transcription for the twogenes betweenthe Dd2(NM) and Dd2 clones.

Fig. 5. Strand Specific RT-PCR to detect antisense transcripts forPfRH4 andPEBL in the Dd2(NM) parasite clone. (A) The diagram shows the location of theprimers used for the RT-PCR reaction. Primers 5364F and 5974R initiated cDNA synthesis from the sense and antisensePfRH4 transcripts, respectively. The primerpct7aa

air (5447F, 5911R) was used to PCR amplify a 464 bp product from the senDNA synthesis from the sense and antisensePEBL transcripts, respectively. Thehe sense and antisense first strand cDNA of PEBL. (B). Lanes 1 and 8 show

and 9 denote the negative control reactions in which the reverse transcriptamount of PCR product from thePfRH4 andPEBL antisense cDNA, respectively.ndPEBL genes, respectively. The plus and minus symbols indicate the prese

se and antisense first strand cDNA of PfRH4. Primers 11651R and 11045F initiateprimer pair (111OOF, 11603R) was used to PCR amplify a 503 bp product froms the PCR product from thePfRH4 andPEBL sense cDNA, respectively. Lanes 2, 4,se (RT) enzyme was not added to the RT-PCR reaction. Lanes 3 and 6 shows a lowerLanes 5 and 10 are the PCR product amplified from genomic DNA for thePfRH4nce or absence of the reverse transcriptase (RT) enzyme in the RT-PCR reactions.


Table 3Comparison of the transcript levels for the four genes in Dd2(NM) and Dd2 quantified by strand specific real time RT-PCR

Gene Expression ratioa [Dd2(NM)/Dd2]

Dd2(NM1)/Dd2 Dd2(NM1)/Dd2 Dd2(NM2)/Dd2 Average

Sense Antisense Sense Antisense Sense Antisense Sense Antisense

PfRH4 285 (256, 315) 11.5 (10, 13) 201 (179, 224) 13.5 (15, 12) 181 (166, 196) 13 (14, 13) 222.6± 22.7 12.8± 0.70PEBL 138 (105, 172) 20 (17, 23) 96 (100, 92) 18 (17, 19) 101 (90, 112) 20 (22, 18) 111.6± 12.4 19.3± 1.05PF110261 1.11 (1.12, 1.10) 0.61 (0.49, 0.74) 1.04 1.10, 0.99) 0.76 (0.69, 0.84) 0.93 (0.97, 0.89) 0.82 (0.81, 0.84) 1.02± 0.03 0.73± 0.05PF110263 1.13 (1.14, 1.13) 0.98 (0.77, 1.19) 1.03 (0.96, 1.10) 1.1 (1.1, 1.2) 1.25 (1.30, 1.20) 0.76 (0.69, 0.84) 1.13± 0.04 0.96± 0.09

a Expression ratio is the fold difference in transcript level between Dd2(NM) and Dd2. The expression ratios are a mean of two PCR reactions. The numbersinparenthesis represent the expression ratio for each individual PCR reaction.

in both parasite clones, Dd2 and Dd2(NM) (Genbank acces-sion no. DQ100425), but differed from the published genomesequence of the 3D7 clone[27]. To check for differences in the3′-untranslated region of each gene between the two parasiteclones, we sequenced 1.1 kb of genomic DNA 3′ to the cod-ing regions of PfRH4 (5.1 kb) and PEBL (4.1 kb) in the Dd2and Dd2(NM) clones. The 1.1 kb sequence on the 3′ side ofeach ORF was identical between the Dd2 and Dd2(NM) clones(Genbank accession no. DQ100425).

3.4. Expression of PfRH4 at the protein level in the Dd2and Dd2(NM) parasite clones

Western blot analysis was done with PfRH4 specific anti-serum to determine if the expression difference of PfRH4between Dd2 and Dd2(NM) at the transcription level would bereflected at the protein level. The antiserum specifically detectedthe expression of the PfRH4 protein in the Dd2(NM) extract; noprotein was detected in the Dd2 extract (Fig. 6). The pre-immunesera from the same rat did not detect any protein in the deter-gent extracts from the two parasite clones (data not shown).The extracts were probed with an anti-EBA175 antibody thatdetected a similar expression of EBA-175 in both the parasiteclones (Fig. 6). This indicates that both the Dd2(NM) and Dd2parasites were harvested at the same stage of development andthat an equal amount of parasite extract was used for the Westernb

3d

P eeno lone( Dd2cw arrae M)t par-a at thl dent er-p ones

on neuraminidase-treated erythrocytes was assayed (Fig. 1) andthe results were similar to previous reports[11,19].PfRH4 is rep-resented by two oligonucleotides, D66812 and D66811, on themicroarray chip and displayed a much higher expression of 35and 12 fold, respectively in Dd2(NM) than Dd2 (Fig. 7), similarto that observed in the previous set of experiments (Table 1). Theexpression ofPfRH4 in the sialic acid independent parasite clone3D7 was eight- and three-fold higher than Dd2 (Fig. 7). However,its expression in the HB3 clone was equal to that of Dd2 (Fig. 7).In the sialic acid dependent clones, FCR3, the expression ofPfRH4 was seven- and two-fold higher than Dd2. Whereas inthe other sialic acid dependent clone, MCamp,PfRH4 was four-and two-fold higher than Dd2 (Fig. 7). The expression ofPEBLamong the four clones compared to Dd2 also showed a similarpattern (Fig. 7). The expression of the specific late schizont stage

F andD ith ana ed bya anti-EBA175 antibody (B) that detected a similar expression of EBA-175 (markedby arrow) in both the parasite clones. Molecular weights (in kDa) are indicatedon the left.

lot analysis.

.5. Expression of PfRH4 and PEBL in other sialic acidependent and independent clones of P. falciparum

To determine if the difference in expression ofPfRH4 andEBL between Dd2(NM) and Dd2 was also observed betwther sialic acid independent (3D7, HB3) and dependent cFCR3, MCamp), we compared their expression with thelone using the oligonucleotide microarray (Fig. 7). As theseere performed at a separate time from the previous microxperiments (Table 1), we repeated the comparison of Dd2(No Dd2. Similar to the Dd2 and Dd2(NM) parasites, the foursite clones were also tightly synchronized and harvested

ate schizont stage for total RNA preparation. The correct iity of the clones was confirmed by rifin microsatellite fingrinting (data not shown). The invasion phenotype of the cl

s

y

e-

ig. 6. Western blot analysis of PfRH4 protein expression in the Dd2d2(NM) clones. Late schizont stage parasite extracts were probed wnti-PfRH4 sera (A) that detected the expression of PfRH4 protein (markrrow) only in Dd2(NM) and not in Dd2. The extracts were probed with an


Fig. 7. Expression ofPfRH4, PEBL, EBA-175, AMA-1 andBAEBL in differentP. falciparum clones including Dd2(NM) compared to Dd2 as measured by microarrayanalysis. The expression of the different parasite clones was compared to the same Dd2 clone and the expression ratio for each gene is represented in the bar graph.There are two oligonucleotides (D66812 and D66811) for PfRH4 on the microarray chip. The bar with the diagonally hatched lines is for D66812; the bar withhorizontal lines is for D66811. The bars and error bars (standard error) represents the data from two independent experiments.

genes (EBA175, BAEBL, AMA-1) was similar between each par-asite clone and Dd2 (Fig. 7), indicating that the parasites wereharvested at the same late schizont stage of development.

4. Discussion

The sialic acid dependent clone, Dd2, when cultured withneuraminidase-treated erythrocytes led to the selection ofDd2(NM), a sialic acid independent clone that could invadeneuraminidase-treated erythrocytes[13]. All sub-clones of Dd2were able to switch to the sialic acid independent phenotype[13,28]. Unlike Dd2, none of the other sialic acid dependentclones (MCamp, FCR3) could be selected to switch their inva-sion phenotype to sialic acid independent invasion[13].

Our study of the differences in gene transcription betweenDd2 and Dd2(NM) has identified parasite molecules that maybe involved in the sialic acid independent invasion pathway. Wefound upregulation of two genes in Dd2(NM) on chromosome4 by microarray analysis and further confirmed by real timeRT-PCR. One of the upregulated genes,PEBL, is a pseudogeneof the Duffy binding-like (DBL) receptor family[29]. The otherupregulated gene,PfRH4, is a member of theP. falciparum retic-ulocyte homologue (PfRH) receptor family, named after the twogenes that encode reticulocyte-binding proteins inP. vivax. ThePfRH family consists of four genes,PfRH1, PfRH2a, PfRH2b,PfRH4 and one pseudogenePfRH3 [14,30–34]. PfRH4 has beend ah o

Dd2 was reflected at the protein level in the fact that PfRH4 pro-tein expression was detected in the Dd2(NM) clone and not inDd2, consistent with its involvement in sialic acid independentinvasion.

The results on the two hypothetical genes (PF11 0261 andPF11 0263) were contradictory, as the microarray hybridizationexperiments for these two genes could not be confirmed by realtime RT-PCR. While it is difficult to explain the discrepancybetween the microarray analysis and real time RT-PCRs, it isclear that microarray results may be artifactual. For example, oneoligonucleotide of an ABC transporter was consistently upreg-ulated and two other oligonucleotides from the same gene werenot upregulated. Thus, upregulation in the microarray resultsmust be confirmed by real time RT-PCR or other methods.

We studied other sialic acid dependent and independentclones to determine if the difference in sialic acid independentinvasion was related to expression ofPfRH4. In the sialic acidindependent clone, HB3, the expression ofPfRH4 was similarto that in the Dd2 clone, implying that HB3 uses a differentparasite receptor to invade through the sialic acid independentpathway. The sialic acid independent clone, 3D7, and the sialicacid dependent clone, FCR3, showed a relatively higher expres-sion ofPfRH4 compared to Dd2. However, the expression levelof PfRH4 in 3D7 and FCR3 was found to be 4–6-fold less com-pared to that observed in Dd2(NM). While 3D7 may be usingPfRH4 to invade through the sialic acid independent pathway,a neu-r

escribed[34], but its function is unknown. The finding ofigher transcriptional level ofPfRH4 in Dd2(NM) compared t

similar level of expression in FCR3 that does not invadeaminidase treated erythrocytes implies that this level ofPfRH4


expression is not sufficient to independently mediate invasionthrough the sialic acid independent pathway. Thus, the foursialic acid independent and dependent clones ofP. falciparumexamined showed no correlation betweenPfRH4 expression andtheir dependence on sialic acids for invasion. On the contrary,the Dd2(NM) parasite clone has been selected from Dd2 andexhibits an extremely high upregulation in expression of thePfRH4 gene at both the transcript and protein levels comparedto the parental clone, which correlates with its ability to invadeerythrocytes through the sialic acid independent pathway.

Many parasite receptors are dependent on sialic acid forbinding erythrocytes. These include EBA-175[35] and PfRH1[14,30]. Some polymorphic variants in the Duffy binding fam-ily of receptor genes,BAEBL and JESEBL, encode proteinsthat have been shown to bind neuraminidase treated erythro-cytes; others require sialic acid as their ligand[36,37]. How-ever,BAEBL andJESEBL are transcribed equally in Dd2 andDd2(NM) and require sialic acid on erythrocytes for binding.Thus, these parasite molecules are not involved in sialic acidindependent invasion of Dd2(NM). Now we have identifiedthe upregulation ofPfRH4 in Dd2(NM) that may permit theDd2(NM) parasite to invade by a sialic acid independent path-way. The molecular mechanism for the sialic acid-independentinvasion in other clones remains a mystery.

The upregulated genes,PfRH4 and PEBL, are contiguouson chromosome 4 and are transcribed in opposite directions( wn.T t it in ribef lyd -la ent nne[ n oP cteds nceb so nss si enced s oftO , thiu evelo asioa olvet

w hilea e-v e ina nt lica n cut reasi

genes. The biological significance of the antisense transcriptsis not well understood, but it may play a role in transcriptionregulation.

Transcription regulation in eukaryotes involves multiple tran-scription factors interacting with the promoter. However, a com-prehensive search indicated a lack of specific transcription fac-tors in the proteome ofP. falciparum [47]. Plasmodium has mostof the basal transcription factors like TBP and TFIIB along withgeneric chromatin structure regulators conserved in eukaryotes.Finally, there are noPlasmodium or apicomplexan specific pro-teins with properties that might suggest that they function asuncharacteristic novel transcription factors[47]. It is highly pos-sible that a chromatinic factor may be responsible for the higherlevel of transcription of thePfRh4 andPEBL genes in Dd2(NM).

Note added on proof

While our manuscript was under review, Stubbs et al.[48]have also reported a higher expression of the PfRH4 andPEBL genes in the sialic acid independent clones, W2mef/Nand W2mef�175 compared to the sialic acid dependent clone,W2mef. The disruption of the PfRH4 gene in W2mef parasiteclone was shown to block the switch from sialic acid dependentto independent invasion phenotype, thus proving that PfRH4 isthe molecular basis for the switch in the invasion phenotype oft

A

ayR MDf KarlS h ford

R

rac-Int J

enhment

e in

gly-

er MJ.t

e of

byood

Fig. 5). The cause for this increase in transcription is unknohe surrounding genes are not upregulated, indicating thaot an extension from the telomere as was recently desc

or PfSIR2[38,39]. Bi-directional transcription was previousescribed for two contiguous elongation factor genes EF�And EF-l�B in P. berghei and the intergenic region betwe

he two genes could drive expression in a bidirectional ma40]. Unlike the contiguous elongation factors, the expressioEBL andPfRH4 varies between a clone, Dd2, and its seleubclone, Dd2(NM). No differences in nucleotide sequeetween these two clones were found in the 5′-intergenic regionr in the two open reading frames. As, the 3′-UTR have also beehown to act as regulatory elements in transcription[41–43], weequenced a 1.1 kb region 3′ to the PfRH4 and PEBL ORF

n both Dd2(NM) and Dd2 clones to search for any sequifferences that may explain the transcriptional difference

hese genes. The sequences of the 1.1 kb region 3′ to the twoRFs were identical in both parasite clones. Furthermorepregulation was limited to the schizont stage of parasite dpment, a stage at which parasite receptors involved in invre expressed. Thus, control of transcription is likely to inv

ransactivating factors.The antisense transcripts for the two genesPfRH4 andPEBL

ere also upregulated in Dd2(NM) compared to Dd2. Wntisense transcription inP. falciparum has been reported priously [44–46], our study has demonstrated a differencntisense transcription of thePfRH4 andPEBL genes betwee

wo P. falciparum clones, Dd2(NM) and Dd2. Thus, the siacid dependent clone, Dd2, under selection pressure whe

ured in neuraminidase-treated erythrocytes, triggers an incn sense and antisense transcription of thePfRH4 and PEBL

sd

rf

s-n

l-e

he W2mef parasite clone[48].

cknowledgements

The authors would like to thank the NIAID Microarresearch Facility, National Institutes of Health, Bethesda,

or performing the hybridizations. The authors also thankeydel, Ghislaine Mayer, Subhash Singh and Sanjay Singiscussions and critically reviewing the manuscript.

eferences

[1] Gaur D, Mayer DC, Miller LH. Parasite ligand-host receptor intetions during invasion of erythrocytes by Plasmodium merozoites.Parasitol 2004;34:1413–29.

[2] Miller LH, Aikawa M, Johnson JG, Shiroishi T. Interaction betwecytochalasin B-treated malarial parasites and erythrocytes. Attacand junction formation. J Exp Med 1979;149:172–84.

[3] Perkins M. Inhibitory effects of erythrocyte membrane proteins on thvitro invasion of the human malarial parasite (Plasmodium falciparum)into its host cell. J Cell Biol 1981;90:563–7.

[4] Pasvol G, Wainscoat JS, Weatherall DJ. Erythrocytes deficiency incophorin resist invasion by the malarial parasitePlasmodium falciparum.Nature 1982;297:64–6.

[5] Pasvol G, Jungery M, Weatherall DJ, Parsons SF, Anstee DJ, TannGlycophorin as a possible receptor forPlasmodium falciparum. Lance1982;2:947–50.

[6] Breuer WV, Kahane I, Baruch D, Ginsburg H, Cabantchik ZI. Rolinternal domains of glycophorin inPlasmodium falciparum invasion ofhuman erythrocytes. Infect Immun 1983;42:133–40.

[7] Cartron JP, Prou O, Luilier M, Soulier JP. Susceptibility to invasionPlasmodium falciparum of some human erythrocytes carrying rare blgroup antigens. Br J Haematol 1983;55:639–47.

[8] Facer CA. Erythrocyte sialoglycoproteins andPlasmodium falciparuminvasion. Trans R Soc Trop Med Hyg 1983;77:524–30.


[9] Friedman MJ, Blankenberg T, Sensabaugh G, Tenforde TS. Recognitionand invasion of human erythrocytes by malarial parasites: contributionof sialoglycoproteins to attachment and host specificity. J Cell Biol1984;98:1672–7.

[10] Mitchell GH, Hadley TJ, McGinniss MH, Klotz FW, Miller LH. Invasionof erythrocytes byPlasmodium falciparum malaria parasites: evidencefor receptor heterogeneity and two receptors. Blood 1986;67:1519–21.

[11] Dolan SA, Proctor JL, Ailing DW, Okubo Y, Wellems TE, Miller LH.Glycophorin B as an EBA-175 independentPlasmodium falciparumreceptor of human erythrocytes. Mol Biochem Parasitol 1994;64:55–63.

[12] Hadley TJ, Klotz FW, Pasvol G, et al. Falciparum malaria parasitesinvade erythrocytes that lack glycophorin A and B (MkMk) Strain dif-ferences indicate receptor heterogeneity and two pathways for invasion.J Clin Invest 1987;80:1190–3.

[13] Dolan SA, Miller LH, Wellems TE. Evidence for a switching mechanismin the invasion of erythrocytes byPlasmodium falciparum. J Clin Invest1990;86:618–24.

[14] Rayner JC, Vargas-Serrato E, Huber CS, Galinski MR, Barnwell JW.A Plasmodium falciparum homologue ofPlasmodium vivax reticulocytebinding protein (PvRBPl) defines a trypsin-resistant erythrocyte invasionpathway. J Exp Med 2001;194:1571–81.

[15] Walliker D, Quakyi IA, Wellems TE, et al. Genetic analysis of the humanmalaria parasitePlasmodium falciparum. Science 1987;236:1661–6.

[16] Bhasin VK, Trager W. Gametocyte-forming and non-gametocyte-forming clones of Plasmodium falciparum. Am J Trop Med Hyg1984;33:534–7.

[17] Trager W, Jensen JB. Human malaria parasites in continuous culture.Science 1976;193:673–5.

[18] Su XZ, Carucci DJ, Wellems TE.Plasmodium falciparum: parasite typ-ing by using a multicopy microsatellite marker, PfRRM. Exp Parasitol1998;89:262–5.

[hway

[ acidhem

[

[ ativear-Med

[ al an

[ i JL.

iol

[ he

[ JH.

31.[

[are

asito

[ ich

[30] Triglia T, Duraisingh MT, Good RT, Cowman AF. Reticulocyte- bind-ing protein homologue 1 is required for sialic acid-dependent invasioninto human erythrocytes byPlasmodium falciparum. Mol Microbiol2005;55:162–74.

[31] Rayner JC, Galinski MR, Ingravallo P, Barnwell JW. TwoPlasmodiumfalciparum genes express merozoite proteins that are related toPlas-modium vivax andPlasmodium yoelii adhesive proteins involved in hostcell selection and invasion. Proc Natl Acad Sci USA 2000;97:9648–53.

[32] Duraisingh MT, Triglia T, Ralph SA, et al. Phenotypic variation ofPlasmodium falciparum merozoite proteins directs receptor targeting forinvasion of human erythrocytes. Embo J 2003;22:1047–57.

[33] Taylor HM, Triglia T, Thompson J, et al.Plasmodium falciparumhomologue of the genes forPlasmodium vivax and Plasmodium yoeliiadhesive proteins, which is transcribed but not translated. Infect Immun2001;69:3635–45.

[34] Kaneko O, Mu J, Tsuboi T, Su X, Torii M. Gene structure and expres-sion of a Plasmodium falciparum 220-kDa protein homologous to thePlasmodium vivax reticulocyte binding proteins. Mol Biochem Parasitol2002;121:275–8.

[35] Sim BK, Chitnis CE, Wasniowska K, Hadley TJ, Miller LH. Receptorand ligand domains for invasion of erythrocytes byPlasmodium falci-parum. Science 1994;264:1941–4.

[36] Mayer DC, Mu IB, Feng X, Su XZ, Miller LH. Polymorphism in aPlasmodium falciparum erythrocyte-binding ligand changes its receptorspecificity. J Exp Med 2002;196:1523–8.

[37] Mayer DC, Mu IB, Kaneko O, Duan I, Su XZ, Miller LH. Polymorphismin thePlasmodium falciparum erythrocyte-binding ligand JESEBL/EBA-181 alters its receptor specificity. Proc Natl Acad Sci USA 2004.

[38] Freitas-Junior LH, Hernandez-Rivas R, Ralph SA, et al. Telomericheterochromatin propagation and histone acetylation control mutually

sites.

[ cing

[ is ofe

[ ce

593–

[ ryol

[ses.

[ eriall

-sense.

[ utionl

[ ero-

[ y:

[ itch-nce

19] Gaur D, Stony JR, Reid ME, Barnwell JW, Miller LH.Plasmodium falci-parum is able to invade erythrocytes through a trypsin-resistant patindependent of glycophorin B. Infect Immun 2003;71:6742–6.

20] Chomczynski P, Sacchi N. Single-step method of RNA isolation byguanidinium thiocyanate-phenol-chloroform extraction. Anal Bioc1987;162:156–9.

21] Lambros C, Vanderberg JP. Synchronization ofPlasmodium falciparumerythrocytic stages in culture. J Parasitol 1979;65:418–20.

22] Aley SB, Sherwood JA, Howard RJ. Knob-positive and knob-negPlasmodium falciparum differ in expression of a strain-specific malial antigen on the surface of infected erythrocytes. J Exp1984;160:1585–90.

23] Mu J, Duan J, Makova KD, et al. Chromosome-wide SNPs reveancient origin forPlasmodium falciparum. Nature 2002;418:323–6.

24] Bozdech Z, Zhu J, Joachimiak MP, Cohen FE, Pulliam B, DeRisExpression profiling of the schizont and trophozoite stages ofPlasmod-ium falciparum with a long-oligonucleotide microarray. Genome B2003;4:R9.

25] Bozdech Z, Llinas M, Pulliam BL, Wong ED, Zhu J, DeRisi JL. Ttranscriptome of the intraerythrocytic developmental cycle ofPlasmod-ium falciparum. PLoS Biol 2003;1:E5.

26] Blair PL, Witney A, Haynes JD, Moch JK, Carucci DJ, AdamsTranscripts of developmentally regulatedPlasmodium falciparum genesquantified by real-time RT-PCR. Nucleic Acids Res 2002;30:2224–

27] Hall N, Pain A, Berriman M, et al. Sequence ofPlasmodium falciparumchromosomes 1, 3–9 and 13. Nature 2002;419:527–31.

28] Soubes SC, Wellems TE, Miller LH.Plasmodium falciparum: a highproportion of parasites from a population of the Dd2 strainable to invade erythrocytes by an alternative pathway. Exp Par1997;86:79–83.

29] Triglia T, Thompson JK, Cowman AF. An EBA175 homologue whis transcribed but not translated in erythrocytic stages ofPlasmodiumfalciparum. Mol Biochem Parasitol 2001;116:55–63.

l

exclusive expression of antigenic variation genes in malaria paraCell 2005;121:25–36.

39] Duraisingh MT, Voss TS, Marty AJ, et al. Heterochromatin silenand locus repositioning linked to regulation of virulence genes inPlas-modium falciparum. Cell 2005;121:13–24.

40] de Koning-Ward TF, Speranca MA, Waters AP, Janse CJ. Analysstage specificity of promoters inPlasmodium berghei using luciferasas a reporter. Mol Biochem Parasitol 1999;100:141–6.

41] Waller KL, Muhle RA, Ursos LM, et al. Chloroquine resistanmodulated in vitro by expression levels of thePlasmodium falci-parum chloroquine resistance transporter. J Biol Chem 2003;278:33601.

42] Militello KT, Dodge M, Bethke L, Wirth DF. Identification of regulatoelements in thePlasmodium falciparum genome. Mol Biochem Parasit2004;134:75–88.

43] Hall N, Karras M, Raine ID, et al. A comprehensive survey of thePlas-modium life cycle by genomic, transcriptomic, and proteomic analyScience 2005;307:82–6.

44] Patankar S, Munasinghe A, Shoaibi A, Cummings LM, Wirth DF. Sanalysis of gene expression inPlasmodium falciparum reveals the globaexpression profile of erythrocytic stages and the presence of antitranscripts in the malarial parasite. Mol Biol Cell 2001;12:3114–25

45] Gunasekera AM, Patankar S, Schug J, et al. Widespread distribof antisense transcripts in thePlasmodium falciparum genome. MoBiochem Parasitol 2004;136:35–42.

46] Kyes S, Christodoulou Z, Pinches R, Newbold C. Stage-specific mzoite surface protein 2 antisense transcripts inPlasmodium falciparum.Mol Biochem Parasitol 2002;123:79–83.

47] Aravind L, Iyer LM, Wellems TE, Miller LH. Plasmodium biologgenomic gleanings. Cell 2003;115:771–85.

48] Stubbs J, Simpson KM, Triglia T, et al. Molecular mechanism for swing of P. falciparum invasion pathways into human erythrocytes. Scie2005;309:1384–7.

upregulation of expression of the reticulocyte homology gene 4 in the plasmodium falciparum clone...

Documents