tripon florin crauciuc george andrei, m ă rginean oana maria coord.: ass. prof. dr. b ă nescu...
TRANSCRIPT
![Page 1: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/1.jpg)
Molecular basis of obesity
Tripon Florin Crauciuc George Andrei , Mărginean Oana Maria Coord.: Ass. Prof. Dr. Bănescu Claudia -Genetics departament Prof. Dr. Mărginean Oana -Pediatrics department
University of Medicine and Pharmacy Tîrgu Mureş – Marisiensis 2014
![Page 2: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/2.jpg)
![Page 3: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/3.jpg)
![Page 4: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/4.jpg)
![Page 5: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/5.jpg)
Background
What is happening now?(1-3)
![Page 6: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/6.jpg)
![Page 7: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/7.jpg)
![Page 8: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/8.jpg)
In the Hypothalamus is found in a very large percentage the Fat mass and obesity (FTO) associated protein (4) also known as alpha-ketoglutarate-dependent dioxygenase. An enzyme that in humans is encoded by the FTO gene located on chromosome 16 (5).
Dates from the literature demonstrate that FTO gene is associated with levels of Ghrelin and Leptin hormone (6) also with Body Mass Index (7).
![Page 9: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/9.jpg)
The aim of this study was to evaluate, in a case-controlled study, if the polymorphisms of RS 9939609 T/A and RS 17817449 T/G FTO genes is associated with obesity.
Objective
![Page 10: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/10.jpg)
We obtained the approval of the Ethic Committee of The University of Medicine and Pharmacy Tîrgu Mureș.
Our study included a group control with 89 children whit age, gender and social status similar to those in the patients group, consisting of 90 young obesity patiens. We obtained from the analysis results(1st Pediatrics Clinic of Clinical County Hospital Tîrgu Mures ) the values of followed markers: Leptin and BMIz (standard deviation)
Genetic DNA was extracted from peripheral leukocytes according to the protocol described by manufacturer (ZymoResearch DNA kit).
Matherial and Methods
![Page 11: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/11.jpg)
DNA was submitted to restriction fragment length polymorphism-chain polymerase reaction (RFLP-PCR Eppendorf Mastercycler) using the following primers ( Fermentas/Thermo Scientific)
Rs 9939609 T/A FTO gene Rs 17817449 T/G Fto gene
The results were seen by electrophoresis in 2% agarose gel and a source of UV light.
forward primer sequence: AACTGGCTCTTGAATGAAATAGGATTCAGA AGGACCTCCTATTTGGGACA reverse primer sequence: AGAGTAACAGAGACTATCCAAGTGCAGTAC AGCTTCCATGGCTAGCATTA PCR protocolsinitial denaturation 95°C for 4min 94°C for 5 min denaturation 94°C for 30sec 94°C for 1min annealing 58°C for 35sec X 35 62°C for 1min extension 72°C for 1min 72°C for 1min final extension 72°C for 10min 72°C for 7min
Amplified products were digested with 2U of Sca I Fast digest enzyme 2U of Alw NI Fast digest enzyme For 10 min at 37°C ( Thermo Scientific)
![Page 12: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/12.jpg)
ResultsOur study included a number of 98 women and 81 men, with ages between 2-17 year and an median age of 10 year.
0
10
20
30Distribution of BMIz
0
10
20
30Levels of Leptin hormone ng/dl
![Page 13: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/13.jpg)
Sex distribution in the control group : 60% girls and the remaining 40% boys
The mean BMIz : -0.20 The mean Leptin level : 7.41 ng/dl In the Control group the Rs 9939609 T/A gene was found in the
following variants:-homozygous normal (TT genotype) at 33 people,-heterozygous (TA genotype) 42 and-homozygous mutant (AA genotype) on 14.
T 182 pbA 154 pb
Results Rs 9939609 T/A FTO gene Control Group
![Page 14: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/14.jpg)
Sex distribution : 53.33(3)% boys and 46.33(3)% girls In the Patients group the Rs 9939609 T/A gene was found
in the following variants:-homozygous normal (TT genotype) at 28 people -heterozygous (TA genotype) 29 and-homozygous mutant (AA genotype) on 33.
Results Rs 9939609 T/A FTO gene Patients Group
Genotype
Number of person
Sex distribution (percente)
Mean BMIz
Mean value of Leptin ng/dl
TT 28 20.84% ♂42.85% ♀
2.06 13.52
TA 29 39.58%23.80%
2,19 15.40
AA 33 39.58%33.35%
2,23 18.24
![Page 15: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/15.jpg)
In the Control group the Rs 17817449 T/G gene was found in the following variants:
-homozygous normal (TT genotype) at 0 people,-heterozygous (GT genotype) 54 and-homozygous mutant (GG genotype) on 35.
223 pb G123 pb T100 pb T
ResultsRs 17817449 T/G FTO gene Control Group
![Page 16: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/16.jpg)
In the Patients group the Rs 17817449 T/G gene was found in the following variants:
-homozygous normal (TT genotype) at 3 people,-heterozygous (GT genotype) 60 and-homozygous mutant (GG genotype) on 27.
ResultsRs 17817449 T/G FTO gene Patients Group
Genotype
Number of person
Sex distribution (percente)
Mean BMIz
Mean value of Leptin ng/dl
TT 3 4.16% ♂2.38% ♀
1.71 6.57
GT 60 68.75%64.28%
2.12 16.20
GG 27 27.09%33.34%
2.35 16.67
![Page 17: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/17.jpg)
Distribution of Rs9939609 T/A genotype and allele distribution in Patients group and Control
group.
PATIENTS GROUP
CONTROLGROUP
PATIENST GROUP VS. CONTROL GROUPp value, OR, CI
GenotypeTTTA
AA
28 29
33
3342
14
---p=0,5998 OR 0,8138
95% CI (0,4077-1,624)p=0,0184 OR 2.778
95% CI (1,,245-6.201)
Allele frequency
T alleleAallele
85 95
10670
---p=0,0148, OR 1,692
95% CI (1,111-2,577)
![Page 18: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/18.jpg)
Distribution of Rs17817449 T/G genotype and allele distribution in Patients group and Control group.
PATIENTS GROUP
CONTROLGROUP
PATIENTS GROUP VS. CONTROL GROUPp value, OR, CI
GenotypeGGGT
TT
27 60
3
3554
0
---p=0,0887, OR 0.107695% CI (0,005-2,173)p=0,2480 OR 0,158695% CI (0,008-3,142)
Allele frequencyG alleleT allele
114
66
12454
---p=0,2193, OR 0.7522
95% CI (0,4842-1,169)
![Page 19: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/19.jpg)
BMIz and leptin levels are directly proportional with the number of RS9939609 / Rs17817449 FTO allele, an maximum risk have the patients homozygous mutant for both genes.
Exist a correlation between obesity and the RS9939609 T/A FTO gene polymorphism with statistical and scientific significance.
The RS17817449 T/G FTO gene polymorphism in this study is not related to obesity, compared to other international studies ( 8-9)
The fact that we have not found associations between RS17817449 T/G FTO gene and susceptibility to obesity explains the complex etiology of this disease , with the involvement of multiple several factors: alimentation, social factors, economic conditions, environmental factors etc.
Conclusion
![Page 20: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/20.jpg)
RR 1.530 p=0.018 CI 1.1-2.128
MEN RR 2.285 P=0.0003 CI 1.356-3.520
Conclusion
![Page 21: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/21.jpg)
Protocols by
![Page 22: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/22.jpg)
1. Association of genetic variation in FTOwith risk of obesity and type 2 diabetes with data from 96,551 East and South Asians, H. Li, T. O. Kilpeläinen et all., Diabetologia April 2012, Volume 55, Issue 4, pp 981-995
2. FTO gene associates to metabolic syndrome in women with polycystic ovary syndrome ,Redha Attaouaa, ,Samira Ait El Mkadem et all., Biochemical and Biophysical Research Communications,Volume 373, Issue 2, 22 August 2008, Pages 230–234
3. Genetic Variants of FTO Influence Adiposity, Insulin Sensitivity, Leptin Levels, and Resting Metabolic Rate in the Quebec Family Study, Ron Do,Swneke D. Bailey, et all., DIABETES, VOL. 57, APRIL 2008
4. The common rs9939609 variant of the fat mass and obesity-associated gene is associated with obesity risk in children and adolescents of Beijing,China,Bo Xi1†, Yue Shen et all., BMC Medical Genetics 2010, 11:107
5. Associations between BMI and the FTO Gene Are Age Dependent: Results from the GINI and LISA Birth Cohort Studies up to Age 6 Years ,Peter Rzehaka,b* André Scherag et all., Obes Facts 2010;3:173–180
6. Serological and somatometrical parameters to a Târgu Mureş obese children group,Monica Tarcea et all., Revista Română de Medicină de Laborator Vol. 2, Nr. 1, Martie 2006
7. Hypothalamic-Specific Manipulation of Fto, the Ortholog of the Human Obesity Gene FTO,Affects Food Intake in Rats. Tung Y-CL, Ayuso E, Shan X, Bosch F, O’Rahilly S, et al. (2010) PLoS ONE 5(1): e8771. doi:10.1371/journal.pone.0008771
8. Variation in the FTO gene locus is associated with cerebrocortical insulin resistance in humans,O. Tschritter et all., Diabetologia (2007) 50:2602–2603
9. Childhood obesity: are genetic differences involved? Claude Bouchard, Am J Clin Nutr-2009
Images from www.google.com
References
![Page 23: Tripon Florin Crauciuc George Andrei, M ă rginean Oana Maria Coord.: Ass. Prof. Dr. B ă nescu Claudia -Genetics departament Prof. Dr. M ăr ginean Oana](https://reader030.vdocuments.mx/reader030/viewer/2022033101/5697bf851a28abf838c87720/html5/thumbnails/23.jpg)
THANK YOU!
The Beauty of Science is to make Things Simple
-ZymoResearch