RESEARCH ARTICLE

Suppression of epithelial differentiation by Foxi3 is essential formolar crown patterningMaria Jussila1, Anne J. Aalto1,*, Maria Sanz Navarro1,*, Vera Shirokova1, Anamaria Balic1, Aki Kallonen2,Takahiro Ohyama3, Andrew K. Groves4, Marja L. Mikkola1 and Irma Thesleff1,‡

ABSTRACTEpithelial morphogenesis generates the shape of the tooth crown.This is driven by patterned differentiation of cells into enamel knots,root-forming cervical loops and enamel-forming ameloblasts. Enamelknots are signaling centers that define the positions of cusp tips in atooth by instructing the adjacent epithelium to fold and proliferate.Here, we show that the forkhead-box transcription factor Foxi3inhibits formation of enamel knots and cervical loops and thus thedifferentiation of dental epithelium in mice. Conditional deletion ofFoxi3 (Foxi3 cKO) led to fusion of molars with abnormally patternedshallow cusps. Foxi3 was expressed in the epithelium, and itsexpressionwas reduced in the enamel knots and cervical loops and inameloblasts. Bmp4, a known inducer of enamel knots and dentalepithelial differentiation, downregulatedFoxi3 inwild-type teeth.Usinggenome-wide gene expression profiling, we showed that in Foxi3 cKOthere was an early upregulation of differentiation markers, such asp21, Fgf15 and Sfrp5. Different signaling pathway components thatare normally restricted to the enamel knots were expanded in theepithelium, and Sostdc1, a marker of the intercuspal epithelium, wasmissing. These findings indicated that the activator-inhibitor balanceregulating cusp patterning was disrupted in Foxi3 cKO. In addition,early molar bud morphogenesis and, in particular, formation of thesuprabasal epithelial cell layer were impaired.We identified keratin 10as amarker of suprabasal epithelial cells in teeth. Our results suggestthat Foxi3 maintains dental epithelial cells in an undifferentiated stateand thereby regulates multiple stages of tooth morphogenesis.

KEY WORDS: Foxi3, Multituberculata, Epithelium, Morphogenesis,Signaling center, Tooth development

INTRODUCTIONTeeth develop from oral epithelium and underlying mesenchymethrough reciprocal interactions mediated by conserved signalingmolecules (Jussila and Thesleff, 2012). The shape of the toothcrown emerges during the morphogenesis of the epithelium via bud,cap and bell stages. Cell differentiation takes place towards the endof morphogenesis, and tooth shape becomes fixed when the hardtissues are deposited.

Tooth development begins with the formation of an epithelialthickening or placode. Tooth placodes consist of a basal cell layerfacing the mesenchyme and several layers of suprabasal cellscovered by periderm. The basal and suprabasal cells differ in theirgene expression patterns (Palacios et al., 1995; Mitsiadis et al.,1995, 2010; Fausser et al., 1998; Nieminen et al., 1998; Ohazamaand Sharpe, 2007). The mechanism of suprabasal cell formation hasnot been studied extensively in tooth development. After induction,placodal cells proliferate and form a bud that grows to theunderlying mesenchyme. The connection of the bud to the oralepithelium constricts and forms the dental cord, where only a thinlayer of suprabasal cells remains between the basal cells (Jussila andThesleff, 2012). At this time, the suprabasal cells become looselyorganized in the center of the bud. These cells, called stellatereticulum cells, resemble mesenchymal cells morphologically,while still maintaining an epithelial gene expression profile.

From the cap stage onwards, the basal epithelium is divided intoinner enamel epithelium (IEE), which faces the dental papillamesenchyme, and the outer enamel epithelium (OEE), which facesthe dental follicle mesenchyme. A signaling center called theprimary enamel knot (PEK) forms within the IEE and can beidentified histologically as a condensed group of epithelial cells. Itexpresses several signaling molecules and is non-proliferative, asdemonstrated by the expression of genes such as the cyclin-dependent kinase inhibitor p21 (Cdkn1a) and absence of 5′-bromo-2′-deoxyuridine (BrdU) incorporation (Jernvall et al., 1998;Keränen et al., 1998). The signals secreted by the PEK stimulate,either directly or via mesenchyme, the flanking basal epithelium togrow and form the cervical loops, which eventually form the roots.During subsequent morphogenesis of multicuspid molars,secondary enamel knots (SEKs) are induced at the sites of thefuture cusp tips. Like the PEK, the SEKs secrete signalingmolecules that instruct the surrounding intercuspal IEE toproliferate. These IEE cells will eventually differentiate intoameloblasts. Mathematical modeling has shown that the pattern ofthe SEKs results from a balance of activating and inhibiting signalscoupled with tissue growth (Salazar-Ciudad and Jernvall, 2002,2010). Consequently, the local patterns of proliferation, instructedby the signaling centers, generate the shape of the tooth crown. Theinitiation of the second and third molars differs from the first molarin that they do not arise from a placode, but from a posteriorextension of the epithelium associated with the previously formedtooth (Juuri et al., 2013). However, after initiation, theirmorphogenesis proceeds in a similar manner to the first molar.

A heterozygous mutation in the Foxi3 transcription factor wasidentified in hairless dogs, which have missing and abnormallyshaped teeth (Drögemüller et al., 2008). Foxi3 belongs to thesuperfamily of Forkhead box transcription factors that act astranscriptional activators, repressors, pioneer factors or chromatinmodifiers (Benayoun et al., 2011; Lam et al., 2013). Foxi3Received 10 March 2015; Accepted 27 September 2015

1Research Program in Developmental Biology, Institute of Biotechnology,University of Helsinki, Biocenter 1, PO Box 56, Helsinki 00014, Finland. 2Division ofMaterials Physics, Department of Physics, University of Helsinki, PO Box 64,Helsinki 00014, Finland. 3Department of Otolaryngology, Head &Neck Surgery andZilkha Neurogenetic Institute, Keck School of Medicine, University of SouthernCalifornia, 1501 San Pablo Street, Los Angeles, CA 90033-4503, USA. 4Program inDevelopmental Biology, Department of Molecular and Human Genetics andDepartment of Neuroscience, Baylor College of Medicine, BCM295, 1 Baylor Plaza,Houston, TX 77030, USA.*These authors contributed equally to this work

‡Author for correspondence (irma.thesleff@helsinki.fi)

3954

© 2015. Published by The Company of Biologists Ltd | Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

DEVELO

PM

ENT

expression is restricted to the epithelium during the development ofseveral ectodermal appendages, including teeth (Shirokova et al.,2013). Foxi3 is expressed in the dental epithelium at all stages ofdevelopment, but is downregulated in the differentiated ameloblasts(Shirokova et al., 2013). Foxi3 knockout (KO) mice die at birth as aresult of craniofacial malformations, which arise from the lack ofbranchial arch-derived structures (Edlund et al., 2014).Here, we show that conditional epithelial deletion of Foxi3 led to

fusion of molars with abnormally patterned shallow cusps.Genome-wide expression profiling revealed upregulation of genesrelated to the differentiation of PEK and SEK and the cervical loopin Foxi3 mutants. During normal development, Foxi3 is expressedat high levels in IEE except for PEK and SEK signaling centers, tipsof cervical loops and ameloblasts. Bmp4, a known inducer of PEKand SEK formation and ameloblast differentiation, inhibited Foxi3expression. In situ analysis showed that markers normally restrictedto SEKs were extended, which probably reflected the disruptedbalance of activators and inhibitors regulating patterning and cuspformation. In addition, an earlier defect in the suprabasal epithelialcell compartment and budding morphogenesis was evident. Ourresults suggest that Foxi3 maintains epithelial cells in anundifferentiated state and thereby regulates multiple stages oftooth morphogenesis.

RESULTSDeletion of Foxi3 led to fusion of molars with an altered cusppatternThe Foxi3−/− phenotype is embryonic lethal, with severely affecteddevelopment of branchial arch derivatives (Edlund et al., 2014),precluding analysis of all mandibular teeth and maxillary molars.We detected structures resembling upper incisors in Foxi3−/−

embryos in an outbred ICR background, but when the mice weremaintained in an inbred C57Bl/6 background, no signs of toothdevelopment were observed (data not shown).Conditional Foxi3 mutant mice (K14-cre43;Foxi3−/floxed;

hereafter Foxi3 cKO) in a mixed ICR and NMRI backgroundwere viable and fertile, but often smaller than their littermates(Table S2). The adults had erupted molars, but their morphologyand cusp pattern were dramatically altered. Furthermore, the first(M1) and second (M2) molars of Foxi3 cKO mice were fused,and the third molar (M3) was sometimes missing or fused withanterior molars (Fig. 1A-C). Micro-computed tomography (micro-CT) scans on 5-week-old control and Foxi3 cKO lower jaws(Fig. 1D-L; Fig. S1) revealed small cusps in two parallel rows. Thetransverse ridges connecting cusps in the wild-type teeth weremissing frommutants. Shallow cusps were easily visible in a lingualview (Fig. 1G-I). From an anterior view, it was obvious that thebuccal side of the Foxi3 cKO molars was more affected (Fig. 1J-L).An additional row of cusps appeared to be forming on the buccalside of the mutant teeth. The morphologies of the roots of were alsoaffected (Fig. S1J,K)Molars were fused in 95% of the lower jaw halves (38/40) and in

100% of the upper jaw halves (40/40). M3 was missing in 53% oflower jaw halves (21/40) and in 17.5% of upper jaw halves (7/40).Incisors were absent or small (the incisor phenotype will bedescribed elsewhere). We did not observe any phenotype inheterozygous animals. Given that the hairless dogs having asevere tooth phenotype are heterozygotes for Foxi3, it is plausiblethat mice have a compensatory mechanism for reduction in Foxi3levels that is not present in dogs. Taken together, the adultphenotype of the Foxi3 cKO mice indicates that Foxi3 is animportant regulator of tooth morphogenesis.

Epithelial morphogenesis was impaired in Foxi3 cKO miceTo determine the stage of molar morphogenesis when the Foxi3cKO tooth phenotype arises, we analyzed the histology of controland mutant molars from the M1 initiation onwards, as Foxi3 isalready expressed in the epithelium in the molar placode and bud(Shirokova et al., 2013). At embryonic day (E) 12.5, the Foxi3 cKOplacode was smaller compared with controls, and the suprabasalepithelium appeared especially poorly developed (Fig. 2A,B). AtE13.0 and E13.5, budding morphogenesis was impaired in Foxi3cKO (Fig. 2C-F). Both the dental cord and the stellate reticulumwere missing from Foxi3 cKO molars (Fig. 2E-J). Cervical loopsformed in Foxi3 cKO, but they were smaller in size than controls(Fig. 2G,H). At E16, the IEE did not show normal folding,indicating that the shape of the crown was not forming correctly(Fig. 2I-L). At E18, some embryos showed normal M3 budformation despite the fusion of M1 and M2 (Fig. 2M,N).Mesenchymal condensation and ameloblast differentiationappeared normal in Foxi3 cKO embryos (Fig. 2). In postnatal day(P) 8 molar crown, there was secreted enamel and dentin, androot formation had been initiated normally (Fig. 2O,P). Weanalyzed the efficiency of the Cre-driver used and noticed mosaicFoxi3 expression in the Foxi3 cKO molars at E12.5 (Fig. S2A-C).At later stages (E13.5 and E14.5), qRT-PCR and in situhybridization confirmed the downregulation of Foxi3 expression(Fig. 5A; Fig. S2D,E). In conclusion, loss of Foxi3 affects severalepithelial cell populations in the developing molar and impairs toothmorphogenesis.

Foxi3 expression was downregulated upon differentiation ofdental epithelium and is regulated by several signalingpathwaysNext we examined the localization of Foxi3 protein (Fig. 3A-C). Ina similar manner to Foxi3 mRNA expression (Shirokova et al.,2013), at E13.5 Foxi3 was strongly expressed on the lingual side ofthe forming tooth, which grows faster when the epithelium proceeds

Fig. 1. Phenotype ofK14cre43;Foxi3−/floxed (Foxi3 cKO)mice. (A-C) Molarsof 5-week-oldWTand two Foxi3 cKOmice showing fusedmolars in Foxi3 cKO.(D-L) Micro-CT scans showing occlusal (D-F), lingual (G-I) and anterior (J-L)views of right molars of one Foxi3−/floxed and two Foxi3 cKOmice. Arrows pointto an additional cusp-like row in Foxi3 cKO teeth. The remaining micro-CT-scanned samples are shown in Fig. S1. Scale bar: 1 mm (for A-C). bu, buccal;cKO, conditional knockout; CT, computed tomography; li, lingual; M1, firstmolar; M2, second molar; M3, third molar; WT, wild type.

3955

RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

DEVELO

PM

ENT

from bud to cap. At E14.5, double staining with Lef1 revealed thatalthough Foxi3 was present in most epithelial cells, it appearedlargely absent from the Lef1-positive PEK (Fig. 3B). At E16, Foxi3was present in the IEE and in the stellate reticulum, but only weaklyexpressed in the Lef1-positive SEKs (Fig. 3C). In addition, the tipsof the growing cervical loops were negative for Foxi3 staining(Fig. 3C). These observations indicate that Foxi3 is excluded fromthe epithelial cells that have started to differentiate and acquire newidentities, such as enamel knots and the cervical loops.Downregulation of Foxi3 in IEE before their differentiation toameloblasts was reported previously (Shirokova et al., 2013).The morphogenesis of the tooth germ from bud to cap stage and

the induction of PEK are known to be regulated by epithelial-

mesenchymal interactions. Therefore, we decided to explore whichsignaling molecules might regulate Foxi3 expression at this time byusing a hanging drop culture system, in which E13.5 molars areexposed to a growth factor for 4 h before RNA collection forqRT-PCR. Activin A was previously shown to upregulate Foxi3in embryonic skin, and it stimulated Foxi3 in tooth epithelium by2.7-fold (Fig. 3D). Shh induced a 1.7-fold upregulation of Foxi3(Fig. 3E). Bmp4, a known inducer of PEK (Jernvall et al., 1998),downregulated Foxi3 expression levels to half that of the controlsamples (Fig. 3F). Fgf8 had no effect on Foxi3 expression, yet itinduced its own target Dusp6 by over fivefold (data not shown).These results suggest that Foxi3 is a target of Activin A, Shh andBmp4. We have previously shown that ectodysplasin (Eda) alsoenhances Foxi3 expression at this stage in the tooth (Shirokovaet al., 2013). However, after the bud stage Foxi3 expression issignificantly broader than Eda receptor expression (Laurikkalaet al., 2001), indicating that Foxi3 expression is regulated largely byother signals. All these pathways are known to target the dentalepithelium (Jussila and Thesleff, 2012) and might therefore regulateFoxi3 directly.

Suprabasal cell population was reduced in the Foxi3 cKOmolarIn order to study more closely the defect in the early morphogenesisof Foxi3mutant molars, we used E- and P-cadherin (cadherins 1 and3, respectively) as markers of the suprabasal and basal epithelial cellpopulations (Palacios et al., 1995; Fausser et al., 1998). Wemeasured the relative areas of the strongly E-cadherin-positive andweakly P-cadherin-positive suprabasal epithelia and the stronglyP-cadherin-positive basal epithelia at E13.0, and found that thesuprabasal cell population was smaller in the Foxi3 cKO molar(Fig. 4A-C). In control molars, the suprabasal epitheliumrepresented 35% of the total epithelial area, and in the Foxi3 cKOonly 28% (Fig. 4C; P=0.006). Overall, the area of the Foxi3 cKOepithelium was smaller than in control embryos (Fig. S3). Theseobservations raise the possibility that the defect in suprabasal celllayer and budding morphogenesis might be connected.

A putative defect in suprabasal cells was supported by ourmicroarray analysis of E13.5 Foxi3 cKO and wild-type molarepithelia (array results reported in detail below), which showed thatNotch2, Krt10 and Krt1 were downregulated in the Foxi3 cKOmolar. Notch2, together with Notch1 and 3, is expressed in the

Fig. 2. Embryonic phenotype of Foxi3 cKO mice. (A-J) Frontalsections of control and Foxi3 cKOmolars from E12.5 to E16. Arrowsin A,B point to the suprabasal cells; asterisks in E,G,I mark thestellate reticulum; white open arrowheads inG,H point to the cervicalloops; and arrows in G,I point to the dental cord. (K-N) Sagittalsections of control and Foxi3 cKOmolars at E16 andE18. Asterisk inK marks the stellate reticulum; arrows in M,N point to M3.(O,P) Frontal sections of developing roots of control and Foxi3 cKOmolars at P8. Arrowheads point to the tips of roots. D, dentin; E,enamel; IEE, inner enamel epithelium; M1, first molar; M2, secondmolar; M3, third molar. Lingual is on the right in A-J. Scale bars:100 μm.

Fig. 3. Foxi3 protein expression and upstream regulation.(A-C) Localization of Foxi3 protein together with Lef1 (B,C) in molar epitheliumat E13.5, E14.5 and E16. Arrows point to enamel knots; white openarrowheads point to cervical loops. White line indicates the border betweenepithelium and mesenchyme. Scale bars: 100 μm. (D-F) Relative expressionof Foxi3 analyzed by qRT-PCR (mean±s.d.) in E13.5 wild-type molars in thepresence or absence of a growth factor. Known target genes of each pathwaywere used as the positive controls. (D) Activin A induced Foxi3 2.7-fold andfollistatin 5.4-fold (P=0.012, Wilcoxon signed-rank test), n=8. (E) Shh inducedFoxi3 1.8-fold, Gli 2.9-fold and Ptch1 4.8-fold (P=0.028, Wilcoxon signed-ranktest), n=6. (F) Bmp4 induced Foxi3 0.5-fold and Msx2 4.4-fold (P=0.018,Wilcoxon signed-rank test), n=7. *P<0.05.

3956

RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

DEVELO

PM

ENT

suprabasal epithelium throughout tooth development (Mitsiadiset al., 1995). Keratin 10 (K10) is a type I keratin, which formsintermediate filaments with the type II keratin 1 (K1). In skin,suprabasal cells express K1 and K10 both during embryogenesisand in adulthood (Wallace et al., 2012). qRT-PCR validationshowed a downregulation of Notch2 (0.51-fold), K1 (0.32-fold) andK10 (0.16-fold) in the Foxi3 cKO bud stage epithelium (Fig. 4D).Radioactive in situ hybridization (RISH) revealed that Notch2expression was downregulated in the mutant epithelium (Fig. 4E,F),but Notch1, which was not significantly changed in our microarrayanalysis, was expressed in a comparable manner in controls andFoxi3 cKO molars (Fig. 4G,H).

We analyzed expression of K10, and observed few weakly K10-positive cells in control and Foxi3 cKO molars at E13.0 (data notshown). Twelve hours later, there were K10-positive cells in thesuprabasal epithelium of control molars, and in addition, some basalcells expressed weaker K10 signal (Fig. 4I, Fig. S4A,B). In Foxi3cKO molars, only few weakly K10-positive cells were scatteredamong the suprabasal cells (Fig. 4J, Fig. S4C). At E14.5, both K10-positive and K10-negative cells were present in the control molars,whereas in the Foxi3 cKO the K10-positive cells were largely absent(Fig. 4K,L). At E16, the lack of K10-positive cells in the suprabasalcell compartment (i.e. stellate reticulum) of the Foxi3 cKO toothwas striking compared with the control tooth (Fig. 4M,N). Theseresults indicate that the K10-positive suprabasal cell population inthe molars is decreased in the Foxi3 cKOs, consistent with thereduction of the stellate reticulum cell compartment. K10-positivecells associated with the stratification of oral epithelium werepresent in both control and Foxi3 cKO (Fig. 4N; data not shown).

Microarray analysis revealed alterations in multiplesignaling pathway components in the Foxi3 cKO molarIn order to identify putative Foxi3 downstream targets, weperformed genome-wide profiling of differentially expressedgenes in Foxi3 cKO and control molar epithelia at E13.5, theearliest stage displaying efficient Foxi3 deletion. Of thedifferentially expressed genes, 292 were downregulated and 431upregulated (Table S3), but only 30 of the downregulated genesshowed more than a 0.6-fold reduction of expression and only 54upregulated genes showed more than a 1.2-fold difference. Tovalidate the microarray results, we confirmed Foxi3 downregulationand assessed 16 other genes by qRT-PCR. With the exception ofone gene, all showed a statistically significant change with qRT-PCR (Fig. 4D; Fig. 5).

The Bmp4 target gene Msx2, as well as three Iroquois-familytranscription factors (Irx2, Irx3 and Irx5) that are expressed in themolar epithelium (Houweling et al., 2001), were among thedownregulated genes (Fig. 5A). Interestingly, a striking number ofthe genes upregulated in the Foxi3 cKO in the microarray belongedto different signaling pathways, including Fgf, Shh, Wnt and Bmp.Fgf15 and the Wnt inhibitor Sfrp5 were among the highestupregulated genes in the microarray, and qRT-PCR showed about15- and 13-fold upregulation of Fgf15 and Sfrp5 transcripts,respectively (Fig. 5B). In addition, we validated upregulation of theFgf pathway target genes Dusp6 and Etv5 and the Shh pathwaygenes Shh and Ptch1, whereas the difference inGli1 expression wasnot significant (Fig. 5C). Semaphorin 3E (Sema3e) was alsoupregulated in Foxi3 cKO (Fig. 5C).

Subsequently, we localized some of the differentially expressedgenes by RISH in sections of E13.5 control and Foxi3 cKO molars.In the control samples, Fgf and Bmp pathway genes were confinedto the tip of the bud epithelium, but in Foxi3 cKO the expression ofthe Fgf pathway target Dusp6 and Fgf antagonist sprouty 2 (Spry2)spanned the whole depth of the dental epithelium (Fig. 6A-D).Bmp7, as well as the Bmp target Id1, showed a similar broadexpression inFoxi3 cKO (Fig. 6E-H). By contrast, Shhwas expressedin a patchy pattern comparedwith the focal signaling center present incontrol teeth (Fig. 6I,J), andWnt10awas more restricted to the basalportion of the mutant molar epithelium (Fig. 6K,L). Msx2 showed asimilar but weaker expression in the buccal epithelium in the Foxi3mutants compared with controls (Fig. 6M,N). Sema3e expression hasnot been reported for developing molars, and unlike the controlteeth, Sema3e was expressed ectopically in the Foxi3 cKOepithelium (Fig. 6O,P). In conclusion, our microarray, qRT-PCR

Fig. 4. Analysis of the suprabasal epithelium in Foxi3 cKO molars.(A,B) E- and P-cadherin double staining of control and Foxi3 cKO molars atE13.0. Arrows point to the suprabasal epithelium. White line indicates areas ofsuprabasal and basal epithelium measured in C. (C) Relative ratios ofsuprabasal and basal epithelial areas of the total epithelium in wild-type andFoxi3 cKOmolars at E13.0 (n=3). Total areas are shown in Fig. S4. (D) Relativeexpression of downregulated Notch2 (0.51-fold), Krt1 (0.32-fold) and Krt10(0.16-fold) analyzed by qRT-PCR (mean±s.d.) in control and Foxi3 cKOmolarsat E13.5 (P=0.029, Mann–WhitneyU-test, n=4). (E,F) Expression of Notch2 inE13.5 control and Foxi3 cKO molars. (G,H) Expression of Notch1 in E13.5control and Foxi3 cKO molars. (I-N) Keratin 10 and P-cadherin (in I-L) stainingof control and Foxi3 cKOmolars at E13.5, E14.5 and E16. Arrows point to K10-positive cells, open white arrowheads to K10-positive cells in the oralepithelium. White line in E-H indicates the border between epithelium andmesenchyme. Lingual is on the right. Scale bars: 100 μm.

3957

RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

DEVELO

PM

ENT

and RISH data suggest that the defect in epithelial morphogenesis ofthe Foxi3 cKO tooth was associated with incorrect localization andactivity of signaling pathways, and in particular, the Fgf, Shh andBmp pathways were stimulated.

Foxi3 cKO dental epithelium displayed molecular signs ofprecocious differentiationThe PEK and the SEKs are marked by expression of the cyclin-dependent kinase inhibitor p21 (Jernvall et al., 1998). p21 wasupregulated in our microarrays, and RISH confirmed a strongexpression at E13.5 in the tip of Foxi3 cKO epithelium (Fig. 7A,B).At E14.5, there was p21 expression in the PEK and in the dentalcord in control molars, but in the Foxi3 cKO p21 expressionspanned the whole epithelium (Fig. 7C,D). This prompted us toinvestigate other characteristics of the Foxi3 cKO PEK. Analysis ofBrdU-negative cells at E14.0 revealed that, in contrast to weight-matched littermates, there was already a clear BrdU-negative area inthe tip of the epithelial bud of the Foxi3 cKO molar, indicating

precocious PEK formation (Fig. S5A,B). At E14.5, Lef1 and P-cadherin immunostaining revealed that the structure of the PEK wasabnormal in Foxi3 cKO (Fig. S5C-F). However, PEK marker genesShh and Dkk4 were expressed in a similar manner in control andFoxi3 cKO PEK, whereas Wnt10a seemed to be expressed morewidely in Foxi3 cKO (Fig. S5G-L).

At E16, p21 was expressed in the SEKs of the control teeth,whereas in the Foxi3 cKO p21 spanned the whole IEE (Fig. 7E,F).The Wnt and Bmp inhibitor Sostdc1 has been linked to PEKformation and it is expressed in a mirror image with p21 (Laurikkalaet al., 2003; Kassai et al., 2005). Sostdc1 was downregulated in ourmicroarray, and RISH revealed a reduction of Sostdc1-expressingepithelium in the Foxi3 cKO at E13.5 and E14.5, whereas itsmesenchymal expression seemed unaffected (Fig. 7G-J). At E16,Sostdc1 was expressed in the stellate reticulum and in the IEEbetween the SEKs in the control tooth, but in Foxi3 cKO there wasno expression in the IEE (Fig. 7K,L). p21 and Sostdc1 showedmirror-image expression patterns in both the control and Foxi3 cKO

Fig. 6. Validation of differentially expressed genes from themicroarray by in situ hybridization. (A-P) Expression ofmicroarray hit genes in E13.5 control and Foxi3 cKO molars.White line indicates the border between epithelium andmesenchyme. Lingual is on the right. Scale bar: 100 μm.

Fig. 5. Validation of differentially expressed genes fromthe microarray by qRT-PCR. (A) Relative expression ofFoxi3 (0.05-fold), Msx2 (0.5-fold), Irx2 (0.6-fold), Irx3 (0.5-fold) and Irx5 (0.5-fold) analyzed by qRT-PCR (mean±s.d.) inwild-type and Foxi3 cKO molars at E13.5 (mean±s.d.,P=0.029, Mann–Whitney U-test, n=4). (B) Relativeexpression of Fgf15 (14.9-fold) and Sfrp5 (13.6-fold) in wild-type and Foxi3 cKO molars at E13.5 (mean±s.d., P=0.029,Mann–Whitney U-test, n=4). (C) Relative expression of Fgf9(1.9-fold), Dusp6 (2.9-fold), Etv5 (2.7-fold), Shh (4.2-fold),Gli1 (1.5-fold), Ptch1 (2.4-fold) and Sema3e (3.0-fold) in wild-type and Foxi3 cKOmolars at E13.5 (mean±s.d.,Gli1 P=0.34,others P=0.029, Mann–Whitney U-test, n=4). ns, notstatistically significant; *P<0.05.

3958

RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

DEVELO

PM

ENT

epithelium at all stages studied. This suggests that in the Foxi3 cKOthe intercuspal Sostdc1-positive IEE had undergone a change in cellfate into SEK.In the microarray, Fgf15 and Sfrp5were significantly upregulated

in Foxi3 cKO at E13.5, but we could not detect their expression withRISH at this stage. At E14, however, Fgf15was weakly expressed incontrol molars and upregulated in the Foxi3 cKO epithelium(Fig. 7M,N). At E15, Fgf15 expression was present in the SEKs ofthe control tooth, whereas in the Foxi3 cKO there was ectopic Fgf15expression in the cervical loops (Fig. 7O,P). Sfrp5 was expressed inboth the control and Foxi3 cKOmolars at E14.5 around the PEK andin the cervical loops (Fig. 7Q,R). At E15 in the control molar, therewas expression only in the cervical loops, but in the Foxi3 cKO therewas strong expression spanning from the cervical loops towards theenamel knots (Fig. 7S,T). During normal development, Foxi3 isdownregulated in the cervical loops at E16 (Fig. 3C). Takentogether, upregulation of differentiation markers, such as p21,Fgf15 and Srfp5, points to a precocious differentiation of the Foxi3cKO epithelium.In order to investigate whether the precocious epithelial

differentiation had an effect on ameloblasts, we localized expressionof the enamel protein ameloblastin. At E18 in control lower molars,ameloblastin expression had started at the cusp tips and spreadcervically in some sections, whereas in Foxi3 cKO lower molarsthe expression covered a wider area and appeared more intense(Fig. S6A-D). In upper molars, there was no ameloblastin expressionin controls, but inFoxi3 cKO the expression was evident (Fig. S6E,F).These observations suggested an earlier onset of ameloblastdifferentiation in the Foxi3 mutants. However, owing to the restrictednumber of samples the results should be considered preliminary.

Crown patterning signals were misexpressed in the Foxi3cKO molarThe cusp phenotype of the adult Foxi3 cKO molars and theexpression pattern of the SEK marker p21 at E16 (see above)indicated a dramatic defect in SEK patterning. Also, the expressionof other SEK markers, such as Lef1, Dkk4 andWnt10a, spanned theentire IEE in Foxi3 cKO molars as evidenced by analysis in bothsagittal (Fig. 8A-D) and frontal (Fig. 8E-H) sections. However, Fgf4was expressed focally in the SEKs in both the control and in Foxi3cKO molars (Fig. 8I,J). Thus, most but not all SEK markersanalyzed were ectopically expressed in the Foxi3 cKO IEE.

DISCUSSIONWe have shown that Foxi3 affects all major stages of toothmorphogenesis and has several different functions during toothdevelopment (Fig. 9). Early on, it controls the formation of K10-positive suprabasal cells. Later on, Foxi3 acts as an inhibitor ofdifferentiation that prevents the epithelium from precociouslyacquiring the fates of cervical loops and enamel knots andprobably also of ameloblasts. This kind of function has not beensuggested previously for any transcription factor expressed in thedental epithelium (Bei, 2009).

Foxi3 regulates formation of suprabasal cellsThe earliest manifestation of the Foxi3 cKO molar phenotype wasan abnormally shaped placode with a reduced suprabasalcompartment. We saw a specific downregulation of Notch2 butnot Notch1, which suggests that in addition to being fewer innumber, the suprabasal cells are abnormally specified. Little isknown about the cellular mechanism driving tooth placode

Fig. 7. Expression of p21, Sostdc1, Fgf15 and Sfrp5 in Foxi3cKO. (A-F) Expression of p21 in E13.5, E14.5 and E16 controland Foxi3 cKO molars. Arrows in E,F point to p21 expression inIEE. (G-L) Expression of Sostdc1 in E13.5, E14.5 and E16control and Foxi3 cKO molars. Arrows in K,L point to IEE whereSostdc1 is expressed in control molars. (M-P) Expression ofFgf15 in E14.0 and E15 control and Foxi3 cKO molars.(Q-T) Expression of Sfrp5 in E14.5 and E15 control and Foxi3cKO molars. IEE, inner enamel epithelium. White line indicatesthe border between epithelium and mesenchyme. Lingual is onthe right. Scale bars: 100 μm.

3959

RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

DEVELO

PM

ENT

formation and the origin of the suprabasal cells. In the embryonicskin, asymmetric cell divisions of basal cells give rise to suprabasalcells, which express differentiation markers, such as K1, whileremaining proliferative (Lechler and Fuchs, 2005), as do dentalsuprabasal cells. We observed K10 expression in some basal cells,suggesting that also in teeth, the K10-positive cells might originatefrom the basal layer. The lack of stellate reticulum and thedownregulation of K1 and K10 in Foxi3 cKO would indicatea failure in this process. However, K10 expression was detectablein developing teeth only after E13.0, whereas the reduction insuprabasal cell population was already noticeable at the placodestage, suggesting an alternative or additional explanation. Hairplacodes arise from cell migration and intercalation (Ahtiainen et al.,2014), and it is possible that a similar mechanism exists in teeth and isimpaired in the Foxi3 cKO. This could lead to a failure in thespecification of the initial suprabasal cells. Further studies will berequired to uncover the causative mechanism, but unfortunately, theinefficient deletion of Foxi3 prior to E13.5 hampers these efforts.

Foxi3 regulates dental cord formation and prevents molarfusionThe cellular mechanisms that drive the narrowing of the neck of thetooth bud, the dental cord, are not known. The defect in Foxi3 cKO

bud formation could be a result of altered adhesive properties of theepithelium. In support of this hypothesis, several adhesionmolecules, such as cadherins and claudins, were differentiallyexpressed in the microarray. The branchial arch phenotype of theFoxi3 KO has been speculated to result from a defect in celladhesion (Edlund et al., 2014). In addition to Foxi3 cKO, the dentalcord does not form in the molars of the conditional epithelial ShhKO (Dassule et al., 2000). In the Shh cKO, also the M1 and M2 fuseand the molars have shallow cusps with an abnormal pattern(Dassule et al., 2000). Deletion of other Shh pathway components,Smo or Evc, leads to milder molar fusion phenotypes (Gritli-Lindeet al., 2002; Nakatomi et al., 2013). Our hanging drop inductionexperiment suggests that Foxi3 might be a downstream target ofShh, and therefore Foxi3 deletion could lead to a similar phenotypeto the mutations in the Shh pathway components. Sostdc1 wasdownregulated in the Foxi3 cKO, and M1 and M2 are fused in theSostdc1 knockouts (Kassai et al., 2005). However, their cuspphenotype is different from Foxi3 cKO and their early molarmorphogenesis appears normal. The molar fusion in Sostdc1 KOwas suggested to be caused by ectopic p21 expression, which weobserved also in Foxi3 cKO. In general, the mechanism of molarfusion is poorly understood. The buds of M2 and M3 formsequentially from the posterior end of the previous molar, and theseparation of molars requires epithelial downgrowth in a similarmanner to the growth of cusps in the tooth crown. We suggest thatthe molar fusion in Foxi3 cKO is related to the failure in the M1 budformation and to the impaired epithelial downgrowth, which isnecessary for proper separation of M2 from M1. Interestingly, Liet al. (2015) showed recently that the downgrowth of cervical loopepithelium in the molar depends on Shh signaling to regulate themaintenance of Sox2-expressing transient stem cells in the loops. Itis possible that Foxi3 regulates cervical loop downgrowth as part ofthis signaling network.

Foxi3 might function as an epigenetic regulatorOur microarray revealed a large number of up- and downregulatedgenes. They are likely to represent both direct and indirect targetsof Foxi3, the latter reflecting a deficiency in the suprabasalcell population and precocious enamel knot differentiation. Wevalidated by qRT-PCR downregulation of Irx2, Irx3 and Irx5 inFoxi3 cKO, and in addition, Irx1 was downregulated in themicroarray. All four transcription factors have an overlappingexpression pattern with Foxi3 (Houweling et al., 2001), makingthem good candidates for Foxi3 targets, but their function in toothformation is not known. The highest upregulated gene in themicroarray was the enamel knot marker Fgf15 (Kettunen et al.,

Fig. 8. Expression of SEK markers in Foxi3 cKO. (A-D) Expression of Lef1and Dkk4 in sagittal sections of E16 control and Foxi3 cKO molars.(E-J) Expression of Dkk4, Wnt10a and Fgf4 in frontal sections of E16 controland Foxi3 cKO molars. Arrows point to focal expression in SEK signalingcenters. Lingual is on the right. Scale bars: 100 μm.

Fig. 9. Foxi3 inhibits epithelial differentiationand promotes suprabasal cell formation.Schematic illustration of the key findings in thisarticle. At the bud stage at E13.5, loss of Foxi3leads to a lack of suprabasal cells and upregulationof signaling pathway components in theepithelium. At E16, markers of SEKs and cervicalloops become expanded. The key genes identifiedwere Krt10 (K10), Krt1 (K1) and Notch2 insuprabasal cells and p21, Fgf15 and Sfrp5, inaddition to several PEK and SEK markers, asindicators of differentiation. WT, wild type.

3960

RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

DEVELO

PM

ENT

2011; Porntaveetus et al., 2011). Fgf15−/− mice have no phenotype(Porntaveetus et al., 2011), but it might act redundantly with otherFgfs. Interestingly, it has been shown that Foxi3 binds to a specificoxidized form of methylated cytosines on the Fgf15 promoter, andthis binding is linked to repression of transcription (Iurlaro et al.,2013). This suggests that Foxi3 could normally repress genes suchas Fgf15, and perhaps also other microarray hits, such as Sema3eand theWnt inhibitor Sfrp5, which were also among the most highlyupregulated genes. The winged helix domains of Fox factors havestructural similarity to linker histones, and some of them have beenshown to bind andmodulate chromatin in order to induce changes ingene expression (Benayoun et al., 2011). If epigenetic regulation isthe main function of Foxi3 in dental epithelium, it is possible that alarge amount of microarray targets exhibit this type of regulation.This might also explain why we did not see many genes beingstrongly up- or downregulated.

Foxi3 is an inhibitor of epithelial differentiationThe microarray revealed a general upregulation of components ofdifferent signaling pathways, and in particular, PEK markers p21and Fgf15 in the Foxi3 cKO tooth bud epithelium (Fig. 9). Inaddition, Sfrp5, which marks the cervical loops initiating rootformation at late bell stage (E. Juuri and I.T., unpublished results),was induced precociously at the bud stage in Foxi3 cKO (Fig. 9).Foxi3 was expressed throughout the bud epithelium but becamedownregulated during bud to cap stage transition from the PEKsignaling center. During subsequent tooth morphogenesis, Foxi3was downregulated in the cervical loop epithelium. Together, theseobservations suggest that Foxi3 inhibits the dental epithelium fromprecocious differentiation towards PEK and cervical loop fates.Additionally, downregulation of Foxi3 in PEK and SEK might be aprerequisite for their induction. The BrdU incorporation assayindicated that PEK induction was accelerated in Foxi3 mutants. Ourpreliminary data suggested that ameloblasts differentiated slightlyearlier in Foxi3 cKO compared with their littermates, supporting arole for Foxi3 as an inhibitor of precocious differentiation. Weshowed that exposure of bud stage teeth to Bmp4 downregulatedFoxi3 expression. Interestingly, Bmp4 has been shown to inducePEK formation (Jernvall et al., 1998) and ameloblast differentiation(Wang et al., 2004) and this, together with the downregulation ofFoxi3 in the PEK and ameloblasts, suggests that Foxi3 mightfunction as an inhibitor of dental epithelial differentiation.

Balance of activating and inhibiting signals that regulatecrown patterning is perturbed in Foxi3 cKOAt a later stage, during SEK formation, most IEE took the SEK fatein Foxi3 cKO mutants. This was manifested by the ectopicexpression of a number of SEK markers and the absence ofSostdc1 from the intercuspal epithelium, supporting the idea ofFoxi3 as an inhibitor of SEKs in addition to PEK. During crownpatterning, the cells respond to two types of signals, to activatorsinducing SEK formation and to inhibitors. The inhibitors repressdifferentiation and induce proliferation and they prevent newsignaling centers from forming in close proximity to the existingcenters (Salazar-Ciudad and Jernvall, 2010). The spreading of SEKmarkers in Foxi3 cKO suggests that there is a decreased level ofinhibition in the mutant tooth. Thus, Foxi3 might either suppress theresponsiveness of the intercuspal epithelium to activators (such asBmp4) or promote their sensitivity to inhibitors (such as Shh). AsBmp4 was able to inhibit Foxi3 expression in bud stage teeth, itcould likewise also inhibit Foxi3 in the SEKs, allowingdifferentiation of the signaling centers. At the same time, in

intercuspal regions Foxi3 could prevent Bmp4 responses, such asinduction of p21 expression (Jernvall et al., 1998) and ameloblastdifferentiation (Wang et al., 2004). In addition to Bmp4, weidentified several other signals that affected Foxi3 expression,namely Shh, Activin and Eda. They have all been linked tomodulation of crown shape complexity (Harjunmaa et al., 2012);therefore, changes in Foxi3 levels during evolution could be oneway to modify the cusp pattern in different species. Interestingly, thecusp pattern of Foxi3 cKO resembles the multituberculates, anextinct clade of mammals, which had molars with longitudinal cusprows (Wilson et al., 2012).

In conclusion, based on the expression pattern of Foxi3 and thephenotype of the Foxi3 cKO, we propose that during toothmorphogenesis Foxi3 has a unique role as a transcription factorthat keeps the dental epithelium in an undifferentiated state. Foxi3might execute its function partly through epigenetic regulation, andit regulates formation of the suprabasal cells and inhibits thedifferentiation of cervical loops and enamel knots.

MATERIALS AND METHODSAnimalsWild-type NMRI mice (The Jackson Laboratory) were used in hanging dropcultures. K14-cre43;Foxi3+/− males (Andl et al., 2004; Edlund et al., 2014)were crossed with Foxi3floxed/floxed females (Edlund et al., 2014;Foxi3tm1.1Akg/J; The Jackson Laboratory stock 024843) to obtain K14-cre43;Foxi3−/floxed mice (Foxi3 cKO). For analyzing the adult toothphenotype, cleaned skulls were used in micro-CT scan. For collectingembryonic samples, the day of the vaginal plug was counted as E0.5, and theembryos were staged further according to limb and molar morphology.Foxi3+/floxed and Foxi3−/floxed animals were used as controls except inmicroarray experiments where all controls were Foxi3+/floxed. All mousework has been carried out in accordance with the guidelines and approvalfrom Finnish National Board of Animal Experimentation.

Histology, in situ hybridization, immunohistochemistry andimmunofluorescenceFor histology, radioactive in situ hybridization (RISH) andimmunohistochemistry, tissues were fixed overnight in 4%paraformaldehyde, dehydrated and embedded in paraffin. Sections 5-7 μmthick were cut in frontal and sagittal planes. Antigen retrieval forimmunohistochemistry and immunofluorescence was performed byheating the slides in 10 mM sodium citrate buffer (pH 6.0). Each gene orprotein was analyzed in two or three individuals.

RISH was carried out according to a standard protocol. The following[35S]-UTP (Perkin Elmer)-labeled RNA probes were used to detect geneexpression: Bmp7 (Åberg et al., 1997), Dkk4 (Fliniaux et al., 2008), Dusp6(James et al., 2006), Fgf4 (Jernvall et al., 1994), Fgf15 (Kettunen et al.,2011), Foxi3 (Ohyama and Groves, 2004), Id1 (Rice et al., 2000), Lef1(Travis et al., 1991), Msx2 (Jowett et al., 1993), p21 (Jernvall et al.,1998), Sfrp5 (Witte et al., 2009), Shh (Vaahtokari et al., 1996a),Sostdc1 (Laurikkala et al., 2003), Sprouty2 (Zhang et al., 2001) andWnt10a (Dassule and McMahon, 1998). Rat ameloblastin probe was a kindgift from Jan C. Hu (University of Texas School of Dentistry, TX, USA).A 645 bp fragment of the mouse Sema3e gene was amplified using thefollowing primers: forward, ACATTGGATCAGCCTCTGCT; and reverse,AGCCAATCAGCTGCAAGAAT. The PCR fragment was cloned intopCRII-pTOPO vector (Invitrogen by LifeTechnologies) and sequenced toconfirm fragment identity.

To detect proliferating cells, BrdU (Amersham) was injected to pregnantfemales at 10 µl/g, and embryos were collected after 2 h. BrdU was detectedwith anti-BrdU antibody at 1:1000 (mouse; Thermo Fisher Scientific), theM.O.M. immunodetection kit (Vector Laboratories) and DAB staining(DAB Peroxidase Substrate Kit; Vector Laboratories).

For immunofluorescence, primary antibodies were used at the followingdilutions: Foxi3 1:150 (goat; Santa Cruz Biotechnology), E-cadherin1:1000 (mouse; BD Biosciences), P-cadherin 1:100 (goat; R&D Systems),

3961

RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

DEVELO

PM

ENT

Lef1 1:1000 (rabbit; Cell Signaling Technology) and keratin 10 1:200(rabbit; Abcam). Secondary antibodies, Alexa488 donkey anti-goat,Alexa568 goat anti-mouse and Alexa568 donkey anti-rabbit (Invitrogenby Life Technologies), were used at a dilution of 1:800.

All samples were imaged with a Zeiss Axio Imager M2 microscopeequipped with an Axio Cam HR camera (Zeiss) and processed inPhotoshop. Frontal images are oriented so that the lingual side is on the left.

Quantification of the epithelial areas was done on E-cadherin- and P-cadherin-stained sections, and ten sections at the widest part of the molarwere chosen from three control and three Foxi3 cKO individuals. The wholearea of the epithelium, in addition to the basal (strong P-cadherin) andsuprabasal areas (strong E-cadherin), was outlined manually using theZen2011 program (Zeiss). Student’s t-test was used for testing statisticalsignificance, and a P-value of 0.05 was used as the significance threshold.

Hanging drop experimentsFoxi3 inductionwas studied by treating E13.5 wild-type NMRImolars for 4 hin hanging drop culture with control media (Dulbecco’s minimal essentialmedium supplemented with 10% fetal calf serum, glutamine and penicillin-streptomycin) or media containing the signaling molecule of interest at thefollowing concentrations: Activin A 0.5 µg/ml (Harrington et al., 2006), Shh5 µg/ml (R&D Systems), Bmp4 0.1 µg/ml (R&D Systems) and Fgf8 1 µg/ml(R&D Systems). A known signaling pathway target gene was used as apositive control. Left molars or right molars of two to three embryos werepooled together for control and growth factor-treated samples, respectively.

RNA extraction and quantitative reverse transcriptase-polymerase chain reaction (qRT-PCR)RNA from the hanging drop experiment samples or from the molar epitheliacollected for the microarray validation was extracted using the RNeasy minikit (Qiagen) and reverse transcribed using 500 ng of random hexamers(Promega) and Superscript II (Invitrogen by Life Technologies) followingthe manufacturers’ instructions.

qRT-PCR was performed using Lightcycler DNA Master SYBR Green I(Roche Applied Science) with the Lightcycler 480 (Roche AppliedScience). Gene expression was quantified by comparing the sample dataagainst a dilution series of PCR products of each gene of interest. Data wereanalyzed with the manufacturer’s software and normalized against Ranbp.Data are shown as the mean±s.d. Wilcoxon signed-rank test was used forthe paired hanging drop experiment samples and the Mann–Whitney U-testfor the non-paired microarray validation samples for testing statisticalsignificance, and a P-value of 0.05 was used as the significance threshold.Primers are listed in Table S1.

Microarray experiments and data analysisFor identification of Foxi3 target genes, E13.5 molar epithelium wasdissected from Foxi3 cKO and Foxi3+/floxed littermate embryos from sixlitters. Briefly, molar tooth germs were dissected under a microscope inDulbecco’s PBS and transferred to 1:25 Dispase II in 10 mM NaAc pH 7.5(stock 5 U/ml; Sigma-Aldrich) and incubated at 4°C for 3-4 h. Theseparated epithelia of the twomolars of each embryowere collected togetherand frozen in dry ice before storage at −80°C.

Molar epithelia from five embryos were pooled together, and themicroarray consisted of four biological replicates of control and Foxi3 cKOsamples. RNA extraction is described above. RNA quality was monitoredusing a 2100 Bioanalyzer (Agilent Technologies). RNA processing andhybridization on Affymetrix Mouse Exon 1.0 ST arrays (Affymetrix) anddata analysis were carried out at the Biomedicum Functional Genomics Unit(University of Helsinki, Finland). The data were processed using R/Bioconductor and normalized with the RMA algorithm and CustomCDF-database probe annotations. Differentially expressed genes were searchedusing the Cyber-T algorithm. P-values were corrected using the Q-valuemethod. Microarray data are available in Gene Expression Omnibus(accession number GSE65725).

AcknowledgementsWe thank Jukka Jernvall for discussions and comments on themanuscript and RaijaSavolainen, Merja Makinen and Riikka Santalahti for technical assistance.

Competing interestsThe authors declare no competing or financial interests.

Author contributionsM.J., M.L.M. and I.T. designed the study. M.J., M.S.N., A.A., V.S., A.B. and A.K.performed the experiments. M.J. and I.T. analyzed the data. A.G. and T.O.generated the Foxi3 mutant mice. M.J., M.L.M. and I.T. prepared the manuscript.All authors commented on the manuscript.

FundingThis work was financially supported by the Academy of Finland; the Swiss NationalScience Foundation Sinergia [CRSI33_125459]; the Sigrid Juselius Foundation; theJane and Aatos Erkko Foundation and the Finnish Cultural Foundation.

Supplementary informationSupplementary information available online athttp://dev.biologists.org/lookup/suppl/doi:10.1242/dev.124172/-/DC1

ReferencesÅberg, T., Wozney, J. and Thesleff, I. (1997). Expression patterns of bone

morphogenetic proteins (Bmps) in the developing mouse tooth suggest roles inmorphogenesis and cell differentiation. Dev. Dyn. 210, 383-396.

Ahtiainen, L., Lefebvre, S., Lindfors, P. H., Renvoise, E., Shirokova, V.,Vartiainen, M. K., Thesleff, I. and Mikkola, M. L. (2014). Directional cellmigration, but not proliferation, drives hair placode morphogenesis. Dev. Cell. 28,588-602.

Andl, T., Ahn, K., Kairo, A., Chu, E. Y., Wine-Lee, L., Reddy, S. T., Croft, N. J.,Cebra-Thomas, J. A., Metzger, D., Chambon, P. et al. (2004). Epithelial Bmpr1aregulates differentiation and proliferation in postnatal hair follicles and is essentialfor tooth development. Development. 131, 2257-2268.

Bei, M. (2009). Molecular genetics of tooth development. Curr. Opin. Genet. Dev.19, 504-510.

Benayoun, B. A., Caburet, S. and Veitia, R. A. (2011). Forkhead transcriptionfactors: key players in health and disease. Trends Genet. 27, 224-232.

Dassule, H. R. and McMahon, A. P. (1998). Analysis of epithelial–mesenchymalinteractions in the initial morphogenesis of the mammalian tooth. Dev. Biol. 202,215-227.

Dassule, H. R., Lewis, P., Bei, M., Maas, R. and McMahon, A. P. (2000). Sonichedgehog regulates growth and morphogenesis of the tooth. Development 127,4775-4785.

Drogemuller, C., Karlsson, E. K., Hytonen, M. K., Perloski, M., Dolf, G., Sainio,K., Lohi, H., Lindblad-Toh, K. and Leeb, T. (2008). A mutation in hairless dogsimplicates FOXI3 in ectodermal development. Science 321, 1462.

Edlund, R. K., Ohyama, T., Katarchi, H., Riley, B. B. and Groves, A. K. (2014).Foxi transcription factors promote pharyngeal arch development by regulatingformation of FGF signaling centers. Dev. Biol. 390, 1-13.

Fausser, J.-L., Schlepp, O., Aberdam, D., Meneguzzi, G., Ruch, J. V. and Lesot,H. (1998). Localization of antigens associated with adherens junctions,desmosomes, and hemidesmosomes during murine molar morphogenesis.Differentiation 63, 1-11.

Fliniaux, I., Mikkola, M. L., Lefebvre, S. and Thesleff, I. (2008). Identification ofdkk4 as a target of Eda-A1/Edar pathway reveals an unexpected role ofectodysplasin as inhibitor of Wnt signalling in ectodermal placodes. Dev. Biol.320, 60-71.

Gritli-Linde, A., Bei, M., Maas, R., Zhang, X. M., Linde, A. and McMahon, A. P.(2002). Shh signaling within the dental epithelium is necessary for cellproliferation, growth and polarization. Development 129, 5323-5337.

Harjunmaa, E., Kallonen, A., Voutilainen,M., Hamalainen, K., Mikkola, M. L. andJernvall, J. (2012). On the difficulty of increasing dental complexity. Nature 483,324-327.

Harrington, A. E., Morris-Triggs, S. A., Ruotolo, B. T., Robinson, C. V., Ohnuma,S.-i. and Hyvonen, M. (2006). Structural basis for the inhibition of activinsignalling by follistatin. EMBO J. 25, 1035-1045.

Houweling, A. C., Dildrop, R., Peters, T., Mummenhoff, J., Moorman, A. F. M.,Ruther, U. and Christoffels, V. M. (2001). Gene and cluster-specific expressionof the iroquois family members during mouse development. Mech. Dev. 107,169-174.

Iurlaro, M., Ficz, G., Oxley, D., Raiber, E.-A., Bachman, M., Booth, M. J.,Andrews, S., Balasubramanian, S. and Reik, W. (2013). A screen forhydroxymethylcytosine and formylcytosine binding proteins suggests functionsin transcription and chromatin regulation. Genome Biol. 14, R119.

James, M. J., Jarvinen, E., Wang, X.-P. and Thesleff, I. (2006). Different roles ofRunx2 during early neural crest-derived bone and tooth development. J. BoneMiner. Res. 21, 1034-1044.

Jernvall, J., Kettunen, P., Karavanova, I., Martin, L. B. and Thesleff, I. (1994).Evidence for the role of the enamel knot as a control centre in mammalian toothcusp formation: non-dividing cells express growth stimulating Fgf4 gene.Int. J. Dev. Biol. 38, 463-469.

3962

RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

DEVELO

PM

ENT

Jernvall, J., Åberg, T., Kettunen, P., Keranen, S. and Thesleff, I. (1998). The lifehistory of an embryonic signalling center. BMP4 induces p21 and is associatedwith apoptosis in the mouse tooth enamel knot. Development 125, 161-169.

Jowett, A. K., Vainio, S., Ferguson, M. W., Sharpe, P. T. and Thesleff, I. (1993).Epithelial-mesenchymal interactions are required for msx 1 and msx 2 geneexpression in the developing murine molar tooth. Development 117, 461-470.

Jussila, M. and Thesleff, I. (2012). Signaling networks regulating toothorganogenesis and regeneration, and the specification of dental mesenchymaland epithelial cell lineages. Cold Spring Harb. Perspect. Biol. 4, a008425.

Juuri, E., Jussila, M., Seidel, K., Holmes, S., Wu, P., Richman, J., Heikinheimo,K., Chuong, C.-M., Arnold, K., Hochedlinger, K. et al. (2013). Sox2 marksepithelial competence to generate teeth in mammals and reptiles. Development140, 1424-1432.

Kassai, Y., Munne, P., Hotta, Y., Penttila, E., Kavanagh, K., Ohbayashi, N.,Takada, S., Thesleff, I., Jernvall, J. and Itoh, N. (2005). Regulation ofmammalian tooth cusp patterning by ectodin. Science 309, 2067-2070.

Keranen, S. V. E., Åberg, T., Kettunen, P., Jernvall, J. and Thesleff, I. (1998).Association of developmental regulatory genes with the development of differentmolar tooth shapes in two species of rodents. Dev. Genes Evol. 208, 477-486.

Kettunen, P., Furmanek, T., Chaulagain, R., Hals Kvinnsland, I. and Luukko, K.(2011). Developmentally regulated expression of intracellular Fgf11-13, hormone-like Fgf15 and canonical Fgf16, -17 and -20 mRNAs in the developing mousemolar tooth. Acta Odontol. Scand. 69, 360-366.

Lam, E. W.-F., Brosens, J. J., Gomes, A. R. and Koo, C.-Y. (2013). Forkhead boxproteins: tuning forks for transcriptional harmony. Nat. Rev. Cancer 13, 482-495.

Laurikkala, J., Mikkola, M., Mustonen, T., Åberg, T., Koppinen, P., Pispa, J.,Nieminen, P., Galceran, J., Grosschedl, R. and Thesleff, I. (2001). TNFsignaling via the ligand–receptor pair ectodysplasin and edar controls the functionof epithelial signaling centers and is regulated by Wnt and activin during toothorganogenesis. Dev. Biol. 229, 443-455.

Laurikkala, J., Kassai, Y., Pakkasjarvi, L., Thesleff, I. and Itoh, N. (2003).Identification of a secreted BMP antagonist, ectodin, integrating BMP, FGF, andSHH signals from the tooth enamel knot. Dev. Biol. 264, 91-105.

Lechler, T. and Fuchs, E. (2005). Asymmetric cell divisions promote stratificationand differentiation of mammalian skin. Nature 437, 275-280.

Li, J., Feng, J., Liu, Y., Ho, T.-V., Grimes, W., Ho, H. A., Park, S., Wang, S. andChai, Y. (2015). BMP-SHH signaling network controls epithelial stem cell fate viaregulation of its niche in the developing tooth. Dev. Cell. 33, 125-135.

Mitsiadis, T. A., Lardelli, M., Lendahl, U. and Thesleff, I. (1995). Expression ofNotch 1, 2 and 3 is regulated by epithelial-mesenchymal interactions and retinoicacid in the developing mouse tooth and associated with determination ofameloblast cell fate. J. Cell Biol. 130, 407-418.

Mitsiadis, T. A., Graf, D., Luder, H., Gridley, T. and Bluteau, G. (2010). BMPs andFGFs target Notch signalling via Jagged 2 to regulate tooth morphogenesis andcytodifferentiation. Development 137, 3025-3035.

Nakatomi, M., Hovorakova, M., Gritli-Linde, A., Blair, H. J., MacArthur, K.,Peterka, M., Lesot, H., Peterkova, R., Ruiz-Perez, V. L., Goodship, J. A. et al.

(2013). Evc regulates a symmetrical response to Shh signaling in molardevelopment. J. Dent. Res. 92, 222-228.

Nieminen, P., Pekkanen, M., Åberg, T. and Thesleff, I. (1998). A graphical WWW-database on gene expression in tooth. Eur. J. Oral Sci. 106, 7-11.

Ohazama, A. and Sharpe, P. T. (2007). Expression of claudins in murine toothdevelopment. Dev. Dyn. 236, 290-294.

Ohyama, T. and Groves, A. K. (2004). Expression of mouse Foxi class genes inearly craniofacial development. Dev. Dyn. 231, 640-646.

Palacios, J., Benito, N., Berraquero, R., Pizarro, A., Cano, A. and Gamallo, C.(1995). Differential spatiotemporal expression of E- and P-cadherin during mousetooth development. Int. J. Dev. Biol. 39, 663-666.

Porntaveetus, T., Otsuka-Tanaka, Y., Basson, M. A., Moon, A. M., Sharpe, P. T.and Ohazama, A. (2011). Expression of fibroblast growth factors (Fgfs) in murinetooth development. J. Anat. 218, 534-543.

Rice, D. P., Åberg, T., Chan, Y., Tang, Z., Kettunen, P. J., Pakarinen, L., Maxson,R. E. and Thesleff, I. (2000). Integration of FGF and TWIST in calvarial bone andsuture development. Development 127, 1845-1855.

Salazar-Ciudad, I. and Jernvall, J. (2002). A gene network model accounting fordevelopment and evolution of mammalian teeth. Proc. Natl. Acad. Sci. USA 99,8116-8120.

Salazar-Ciudad, I. and Jernvall, J. (2010). A computational model of teeth and thedevelopmental origins of morphological variation. Nature 464, 583-586.

Shirokova, V., Jussila, M., Hytonen, M. K., Perala, N., Drogemuller, C., Leeb, T.,Lohi, H., Sainio, K., Thesleff, I. andMikkola, M. L. (2013). Expression of Foxi3 isregulated by ectodysplasin in skin appendage placodes.Dev. Dyn. 242, 593-603.

Travis, A., Amsterdam, A., Belanger, C. and Grosschedl, R. (1991). LEF-1, agene encoding a lymphoid-specific protein with an HMG domain, regulates T-cellreceptor α enhancer function [corrected]. Genes Dev. 5, 880-894.

Vaahtokari, A., Åberg, T., Jernvall, J., Keranen, S. and Thesleff, I. (1996). Theenamel knot as a signaling center in the developing mouse tooth.Mech. Dev. 54,39-43.

Wallace, L., Roberts-Thompson, L. and Reichelt, J. (2012). Deletion of K1/K10does not impair epidermal stratification but affects desmosomal structure andnuclear integrity. J. Cell Sci. 125, 1750-1758.

Wang, X.-P., Suomalainen, M., Jorgez, C. J., Matzuk, M. M., Werner, S. andThesleff, I. (2004). Follistatin regulates enamel patterning in mouse incisors byasymmetrically inhibiting BMP signaling and ameloblast differentiation. Dev. Cell7, 719-730.

Wilson, G. P., Evans, A. R., Corfe, I. J., Smits, P. D., Fortelius, M. and Jernvall, J.(2012). Adaptive radiation of multituberculate mammals before the extinction ofdinosaurs. Nature 483, 457-460.

Witte, F., Dokas, J., Neuendorf, F., Mundlos, S. and Stricker, S. (2009).Comprehensive expression analysis of all Wnt genes and their major secretedantagonists during mouse limb development and cartilage differentiation. GeneExpr. Patterns 9, 215-223.

Zhang, S., Lin, Y., Itaranta, P., Yagi, A. and Vainio, S. (2001). Expression ofSprouty genes 1, 2 and 4 duringmouse organogenesis.Mech. Dev. 109, 367-370.

3963

RESEARCH ARTICLE Development (2015) 142, 3954-3963 doi:10.1242/dev.124172

DEVELO

PM

ENT