science has the answer: genetic results may surprise you · 2008-04-16 · weighing each...

NEW TWISTS ON DNA • 100 YEARS AFTER THE WRIGHT BROTHERS

DECEMBER 2003 $4.95

WWW.SCIAM.COM

The Day the Earth Burned

Reasons to Return to the Moon

Genetic Results May Surprise

You

ScienceHas the Answer:

COPYRIGHT 2003 SCIENTIFIC AMERICAN, INC.

T E C H N O L O G Y L E A D E R S

55 The Scientific American 50Our second annual salute to the elite of research, industry and politicswhose accomplishments are shaping a better, wiser technologicalfuture for the world.

B I O L O G Y

78 Does Race Exist?B Y M I C H A E L J . B A M S H A D A N D S T E V E E . O L S O NFrom a purely genetic standpoint, no. Nevertheless,genetic information about individuals’ ancestral originscan sometimes have medical relevance.

P L A N E T A R Y S C I E N C E

86 The New MoonB Y P A U L D . S P U D I SRecent lunar missions have shown that there is stillmuch to learn about Earth’s closest neighbor. It’s time to go back.

A V I A T I O N

94 The Equivocal Successof the Wright BrothersB Y D A N I E L C . S C H L E N O F FThe Wrights used aerial control as the key to buildingand flying the first airplane. But trying to refine theirinvention in secret nearly cost them their glory.

G E O S C I E N C E

98 The Day the World BurnedB Y D A V I D A . K R I N G A N D D A N I E L D . D U R D AThe asteroid impact that killed the dinosaurs also ignited a firestorm that consumed the world’s forests.

B I O T E C H N O L O G Y

106 The Unseen Genome: Beyond DNAB Y W . W A Y T G I B B S“Epigenetic” information stored as proteins and chemicals surrounding DNAcan change the meaning of genes in growth, aging and cancer.

contentsdecember 2003

SCIENTIFIC AMERICAN Volume 289 Number 6 features

w w w . s c i a m . c o m S C I E N T I F I C A M E R I C A N 7

78 An amalgam of many races


10 S C I E N T I F I C A M E R I C A N D E C E M B E R 2 0 0 3

departments14 SA Perspectives

Jumping to conclusions about race.

16 How to Contact Us16 On the Web18 Letters22 50, 100 & 150 Years Ago26 Innovations

A quest to diagnose disease using breath tests.

30 News Scan■ Keeping science out of the courtroom.■ The German Stonehenge.■ A diving probe dares the Marianas Trench.■ Breaking the sound barrier without the boom.■ Draft beer on high-tech tap.■ Panama blazes a bioprospecting path.■ By the Numbers: Modernization.■ The Nobel Prizes for 2003.■ Data Points: Hospital care.

48 Staking ClaimsGeneric medicines made in living factories challengethe capacity of drug regulation.

52 InsightsBiological oceanographer Sallie W. Chisholm warnsof the global dangers of disrupting phytoplankton,the cells that populate the seas.

114 Working KnowledgePiezoelectric skis.

116 Technicalities A behind-the-scenes look at a high-tech police lab.

119 ReviewsPower to the People brings a balanced intelligence to the controversies over the future of energy and the environment.

125 Annual Index 2003

34

52

124

SCIENTIFIC AMERICAN Volume 289 Number 6

columns50 Skeptic B Y M I C H A E L S H E R M E R

How alternative medicine harms patients.

122 Puzzling Adventures B Y D E N N I S E . S H A S H AParallel repetition.

123 Anti Gravity B Y S T E V E M I R S K YKid logic and the hairy Houdini.

124 Ask the Experts What is game theory? Why do humans get goose bumps?

128 Fuzzy Logic B Y R O Z C H A S T

Cover photoillustration and page 7: Nancy Burson; this page, at left: Kathleen Dooher.

Scientific American (ISSN 0036-8733), published monthly by Scientific American, Inc., 415 Madison Avenue, New York, N.Y. 10017-1111. Copyright © 2003 by ScientificAmerican, Inc. All rights reserved. No part of this issue may be reproduced by any mechanical, photographic or electronic process, or in the form of a phonographic recording,nor may it be stored in a retrieval system, transmitted or otherwise copied for public or private use without written permission of the publisher. Periodicals postage paid at NewYork, N.Y., and at additional mailing offices. Canada Post International Publications Mail (Canadian Distribution) Sales Agreement No. 242764. Canadian BN No. 127387652RT;QST No. Q1015332537. Subscription rates: one year $34.97, Canada $49 USD, International $55 USD. Postmaster: Send address changes to Scientific American, Box 3187,Harlan, Iowa 51537. Reprints available: write Reprint Department, Scientific American, Inc., 415 Madison Avenue, New York, N.Y. 10017-1111; (212) 451-8877;fax: (212) 355-0408 or send e-mail to [email protected] Subscription inquiries: U.S. and Canada (800) 333-1199; other (515) 247-7631. Printed in U.S.A.

Sallie W. Chisholm, M.I.T.


In October, California voters did something that willhave long-term ramifications for their state. No, we’renot talking about the election of actor ArnoldSchwarzenegger, but the rejection of Proposition 54,which would have voided requirements for govern-ment-affiliated programs to record the race of partic-ipants. Medical groups and physicians had claimedthat the measure would have blocked doctors from

tracking and treating diseasesthat afflict various racial groupsdifferently. C. Everett Koop, for-mer U.S. surgeon general, evendescribed the vote as a “life-and-death decision” in a television ad.

The article by Michael J.Bamshad and Steve E. Olson inthis month’s issue [“Does RaceExist?” on page 78] calls intoquestion Koop’s dire assertion.Commonly used racial and eth-nic categories (such as “African-American,” “white” and “His-

panic”) are often meaningless when it comes to de-termining a person’s DNA makeup. Genetics can beused to sort most people roughly into categories ac-cording to the geographic region where they wereborn, but populations that are the result of recent mi-grations and that have had a great deal of intermix-ing—such as those in South India and the U.S.—can-not be neatly parsed. Self-described African-Ameri-cans, for example, can have anywhere between 20 and100 percent genetic heritage from Africa, whereas 30percent of Americans who consider themselves“white” have less than 90 percent European ancestry.

Yet self-described race is being used as a surrogatefor genetic differences in research. The U.S. Food andDrug Administration has issued a draft “Guidance for

Industry” suggesting that pharmaceutical and bio-technology companies collect data on the race of vol-unteers in clinical trials to test the safety and efficacyof new treatments. The document recommends thatcompanies ask study participants to identify their raceaccording to the categories used by the U.S. Census.

The FDA’s proposed guidelines have elicited out-cries from many interested parties, including J. CraigVenter of the Center for the Advancement of Ge-nomics in Rockville, Md. Venter—whose previouscompany, Celera, issued the first rough sequence ofthe human genome—wants the FDA to scrap the pro-posed guidelines and to advise companies instead tocollect genetic information from each individual in aclinical trial. Using self-identified race as a surrogatefor testing a person directly for a relevant trait is akinto recording the average weight of a group rather thanweighing each individual, Venter and his colleague Su-sanne B. Haga write in the July 25 issue of Science.

The complicating factor, of course, is money.Companies assert that genetic testing costs too muchright now to be feasible as part of every clinical trial.And it is clear that racial differences in health exist: adisproportionate number of African-American mendevelop prostate cancer, for example, whereas whitewomen are more prone than black women to breastcancer. The question is whether those variations canbe attributed largely to genetics or to continuing race-based disparities in income, education or other factors.

Until the advent of a truly egalitarian society, racewill always be a proxy for deeper differences amonggroups. But the importance of racial identity shouldnot be overinterpreted in clinical trials—particularlywhen those racial descriptors turn out to be such poorreflections of a person’s genetic heritage. The bottomline is: when you read or hear about a new health find-ing based on race, question it.


LWA-

DAW

N T

ARD

IF C

orb

is

SA Perspectives

THE EDITORS [email protected]

Racing to Conclusions

IS RACE linked to health?


How to Contact UsE D I T O R I A L

For Letters to the Editors:Letters to the Editors

Scientific American415 Madison Ave.

New York, NY 10017-1111or

[email protected] include your name

and mailing address, and cite the article

and the issue in which it appeared.

Letters may be edited for length and clarity.

We regret that we cannot answer all correspondence.

For general inquiries:Scientific American415 Madison Ave.

New York, NY 10017-1111 212-754-0550

fax: 212-755-1976or

[email protected]

S U B S C R I P T I O N SFor new subscriptions,

renewals, gifts, payments, and changes of address:

U.S. and Canada 800-333-1199

Outside North America 515-247-7631

or www.sciam.com

or Scientific American

Box 3187 Harlan, IA 51537

R E P R I N T S To order reprints of articles:

Reprint DepartmentScientific American415 Madison Ave.

New York, NY 10017-1111212-451-8877

fax: [email protected]

P E R M I S S I O N SFor permission to copy or reuse

material from SA:www.sciam.com/permissions

or 212-451-8546 for procedures

or Permissions Department

Scientific American415 Madison Ave.

New York, NY 10017-1111 Please allow three to six weeks

for processing.

A D V E R T I S I N Gwww.sciam.com has electronic contactinformation for sales representatives of Scientific American in all regions of theU.S. and in other countries.

New YorkScientific American415 Madison Ave.New York, NY 10017-1111212-451-8893fax: 212-754-1138Los Angeles310-234-2699fax: 310-234-2670San Francisco415-403-9030fax: 415-403-9033MidwestDerr Media Group847-615-1921fax: 847-735-1457 Southeast/SouthwestMancheeMedia972-662-2503fax: 972-662-2577DetroitKaren Teegarden & Associates248-642-1773fax: 248-642-6138CanadaDerr Media Group847-615-1921fax: 847-735-1457 U.K.The Powers Turner Group+44-207-592-8331fax: +44-207-630-9922France and SwitzerlandPEM-PEMA+33-1-46-37-2117fax: +33-1-47-38-6329GermanyPublicitas Germany GmbH+49-211-862-092-0fax: +49-211-862-092-21SwedenPublicitas Nordic AB+46-8-442-7050fax: +46-8-442-7059BelgiumPublicitas Media S.A.+32-(0)2-639-8420fax: +32-(0)2-639-8430Middle East Peter Smith Media &Marketing+44-140-484-1321fax: +44-140-484-1320IndiaYogesh Rao Convergence Media +91-22-2414-4808 fax: +91-22-2414-5594JapanPacific Business, Inc.+813-3661-6138fax: +813-3661-6139KoreaBiscom, Inc.+822-739-7840fax: +822-732-3662Hong KongHutton Media Limited+852-2528-9135fax: +852-2528-9281

On the WebWWW.SCIENTIFICAMERICAN.COM

FEATURED THIS MONTHVisit www.sciam.com/onthewebto find these recent additions to the site:

Rejection a Real Pain, Brain Study ShowsIt seems the old adage about sticks and stones andhurtful words may need revision. Social rejection,

researchers report, elicits abrain response similar to theone triggered by physical pain.Subjects snubbed in a virtualgame of catch exhibitedactivity in a brain regioncalled the anterior cingulatecortex, which also plays a rolein pain processing.

Electronic Paper Speeds Up for VideosSomeday soon videos may be showing on paper instead ofscreens. Scientists have created a kind of electronic paperthat can switch rapidly from one color to another, giving itthe ability to display moving images. A number of researchgroups hope to develop electronic ink, but so far thescreens cannot switch from one image to the next quicklyenough for video. In the new work, engineers cleared thishurdle by utilizing a process known as electrowetting.

Ask the ExpertsWhy does moving one’s hands in front of an antennainfluence television and radio reception?David Hysell, an associate professor of earth and atmospheric sciences at Cornell University, explains.

Scientific American.com MarketplaceANNOUNCE YOUR CONFERENCES ON SCIENTIFIC AMERICAN.COMTarget and reach the researchers, educators and businessmanagers of science/technology industries with ScientificAmerican.com. With nearly seven million page views andmore than 700,000 unique visitors a month, ScientificAmerican.com remains the premier Internet sci/tech site forattracting your professional audience.

List in Scientific American.comMarketplace TODAY!For as little as $150 a month . . .www.sciam.com/marketplace/ ©

SC

IEN

CE

16 S C I E N T I F I C A M E R I C A N D E C E M B E R 2 0 0 3COPYRIGHT 2003 SCIENTIFIC AMERICAN, INC.


LettersE D I T O R S @ S C I A M . C O M

E D I T O R I N C H I E F : John Rennie E X E C U T I V E E D I T O R : Mariette DiChristina M A N A G I N G E D I T O R : Ricki L. Rusting N E W S E D I T O R : Philip M. Yam S P E C I A L P R O J E C T S E D I T O R : Gary Stix S E N I O R E D I T O R : Michelle Press S E N I O R W R I T E R : W. Wayt Gibbs E D I T O R S : Mark Alpert, Steven Ashley, Graham P. Collins, Carol Ezzell, Steve Mirsky, George Musser C O N T R I B U T I N G E D I T O R S : Mark Fischetti, Marguerite Holloway, Michael Shermer, Sarah Simpson, Paul Wallich

E D I T O R I A L D I R E C T O R , O N L I N E : Kate Wong A S S O C I A T E E D I T O R , O N L I N E : Sarah Graham

A R T D I R E C T O R : Edward Bell S E N I O R A S S O C I A T E A R T D I R E C T O R : Jana Brenning A S S I S T A N T A R T D I R E C T O R S :Johnny Johnson, Mark Clemens P H O T O G R A P H Y E D I T O R : Bridget Gerety P R O D U C T I O N E D I T O R : Richard Hunt

C O P Y D I R E C T O R : Maria-Christina Keller C O P Y C H I E F : Molly K. Frances C O P Y A N D R E S E A R C H : Daniel C. Schlenoff, Rina Bander, Emily Harrison, Michael Battaglia

E D I T O R I A L A D M I N I S T R A T O R : Jacob Lasky S E N I O R S E C R E T A R Y : Maya Harty

A S S O C I A T E P U B L I S H E R , P R O D U C T I O N : William Sherman M A N U F A C T U R I N G M A N A G E R : Janet Cermak A D V E R T I S I N G P R O D U C T I O N M A N A G E R : Carl Cherebin P R E P R E S S A N D Q U A L I T Y M A N A G E R : Silvia Di Placido P R I N T P R O D U C T I O N M A N A G E R : Georgina Franco P R O D U C T I O N M A N A G E R : Christina Hippeli C U S T O M P U B L I S H I N G M A N A G E R : Madelyn Keyes-Milch

A S S O C I A T E P U B L I S H E R / V I C E P R E S I D E N T , C I R C U L A T I O N :Lorraine Leib Terlecki C I R C U L A T I O N D I R E C T O R : Katherine Corvino C I R C U L A T I O N P R O M O T I O N M A N A G E R : Joanne Guralnick F U L F I L L M E N T A N D D I S T R I B U T I O N M A N A G E R : Rosa Davis

V I C E P R E S I D E N T A N D P U B L I S H E R : Bruce Brandfon A S S O C I A T E P U B L I S H E R : Gail Delott S A L E S D E V E L O P M E N T M A N A G E R : David Tirpack SALES REPRESENTATIVES: Stephen Dudley, Hunter Millington, Stan Schmidt, Debra Silver

ASSOCIATE PUBLISHER, STRATEGIC PLANNING: Laura Salant P R O M O T I O N M A N A G E R : Diane Schube R E S E A R C H M A N A G E R : Aida Dadurian P R O M O T I O N D E S I G N M A N A G E R : Nancy Mongelli G E N E R A L M A N A G E R : Michael Florek B U S I N E S S M A N A G E R : Marie Maher M A N A G E R , A D V E R T I S I N G A C C O U N T I N G A N D C O O R D I N A T I O N : Constance Holmes

D I R E C T O R , S P E C I A L P R O J E C T S : Barth David Schwartz

M A N A G I N G D I R E C T O R , O N L I N E : Mina C. Lux S A L E S R E P R E S E N T A T I V E , O N L I N E : Gary BronsonW E B D E S I G N M A N A G E R : Ryan Reid

D I R E C T O R , A N C I L L A R Y P R O D U C T S : Diane McGarvey P E R M I S S I O N S M A N A G E R : Linda Hertz M A N A G E R O F C U S T O M P U B L I S H I N G : Jeremy A. Abbate

C H A I R M A N E M E R I T U S : John J. Hanley C H A I R M A N : Rolf Grisebach P R E S I D E N T A N D C H I E F E X E C U T I V E O F F I C E R :Gretchen G. Teichgraeber V I C E P R E S I D E N T A N D M A N A G I N G D I R E C T O R ,I N T E R N A T I O N A L : Dean SandersonV I C E P R E S I D E N T : Frances Newburg

Established 1845

®

UNIVERSAL QUESTIONSJacob D. Bekenstein’s “Information inthe Holographic Universe” contains anodd statement: “Our innate perceptionthat the world is three-dimensional couldbe an extraordinary illusion.” But our visual perception of three-dimensionalspace is constructed by the brain fromlight falling on the two-dimensional sur-face of the retina. Contributing to the 3-D “illusion” are our senses of touch,kinesthesia (the system that relies on feed-back from muscles) and hearing. If Bek-enstein’s assertion is correct, it is hard tounderstand why evolutionary adaptationwould have taken such a complex routeto generate this illusion of three dimen-sions when a more accurate perception ofreality might have served us better.

Kellogg Wilsonvia e-mail

In an optical hologram, informationabout the entire image is contained ineach part of the hologram, so if it werebroken up, the whole image could still beseen in each piece. Would the same con-cept hold for the universe hologram?Would a piece of matter in one part ofthe world contain information aboutmatter on the other side of the world—oreven about the distant stars—if only weknew how to view it?

Dale RabinovitzTwinsburg, Ohio

How does the holographic view affect thebig bang description of the origin of the

universe? The big bang implies that theuniverse started from a point object. Thiswould seem to be impossible if the infor-mation content of the universe is con-stant. If this logic is correct, I would beinterested in the smallest size that the uni-verse could be and a description of thissmallest universe.

Larry Jordanvia e-mail

BEKENSTEIN REPLIES: Wilson may be rightthat cerebral processing of ocular and tactilesignals is responsible for our sensing a three-dimensional space and that it would havebeen evolutionarily “cheaper” for our brainsto have a different structure if the world real-ly were two-dimensional. Clearly, three di-mensions are convenient for describing ex-perimental facts and for expressing the fa-miliar laws of physics that explain thosefacts. Nevertheless, the holographic principlecould be true: the ultimate, fundamentalphysical laws could operate in a world with atwo-dimensional geometry. Sensory physiol-ogy and psychology are even more removedfrom fundamental reality than are the effec-tive laws of physics we use today. We cannotdraw conclusions about the ultimate natureof reality from the fact that we literally per-ceive three dimensions.

Rabinovitz is correct that an everyday op-tical hologram contains an entire image (al-beit with impaired resolution) in every smallsection of itself. The holographic principle ofparticle physics and cosmology does notwork that way. To describe the whole uni-verse, we need the whole hologram. The holo-

WE’LL ADMIT IT. Theoretical physics is not for everyone. “Ihave never before read anything so full of ‘scientific’ balder-dash, gobbledygook and obscure theories,” groused Wil Short ofBoise, Idaho, about Jacob D. Bekenstein’s “Information in theHolographic Universe.” Fortunately, hundreds of letter writersoffered different intriguing impressions of the August issue cov-er story. Still others praised the multidisciplinary approach of“Questioning the Delphic Oracle,” by John R. Hale, Jelle Zeilingade Boer, Jeffrey P. Chanton and Henry A. Spiller, which professedthat petrochemical vapors gave the ancient Greek prophesierstheir visions. From physics to fumes, a sampling of our readers’august perspicacity fills the following pages.


graphic description is exact. The key “holo-graphic” property is that the descriptiontakes fewer dimensions than would seemnecessary from the kinds of physical mea-surements we can make today.

As Jordan’s question suggests, the origi-nal form of the holographic bound does en-counter problems in the early stages of thebig bang. Similar problems arise wheneverthe gravitational field is strong and the sys-tem is evolving extremely rapidly. In 1999these inconsistencies led Raphael Bousso,then at Stanford University, to formulate hisversion of the holographic bound, in which theentropy is tallied by imaginary beams of lightrays. The Bousso holographic bound is con-sistent with the big bang picture, even thevery early stages.

DANGEROUS PROPHECY “Questioning the Delphic Oracle,” byJohn R. Hale, Jelle Zeilinga de Boer, Jef-frey P. Chanton and Henry A. Spiller, says:“Extraordinarily for misogynist Greece,the Pythia was a woman.” I don’t seewhat’s so extraordinary. As the articledescribes it, the Pythia held a danger-ous job. The women were occasion-ally forced into service, and theybreathed intoxicating gases thatsometimes killed them. Is it real-ly so unusual that a misogynistculture would relegate this taskto women of no social standing?

Miguel MuñozLos Angeles

A fascinating article. But given allthe ethane, methane or ethylenefloating around, how is it that the an-cient Greeks didn’t blow themselves upwhen they brought in their oil lamps?

Bill SandidgeAtlanta

Although we share the authors’ enthusi-asm, we disagree with their contentionthat the inhalation of ethylene explainsthe experiences of the Pythias in the un-derground oracular chamber. The gas isexplosive in air! Also, the authors ignorecontemporaneous accounts indicating

that the “possession” of the Pythias wasproduced by smoking or ingesting theleaves of the Laurus nobilis (laurel or bayleaf), which was sacred to Apollo.

We acknowledge that ethylene inlow subexplosive (and subintoxicating)concentrations was very likely present inthe chamber but suggest that it may havebeen significant for its effect on plantsrather than its effect on people. Ethyleneaffects the growth of plants and is pro-duced naturally by many plants to influ-ence plant maturation. We wonder if theplant became sacred to those who tend-ed Apollo’s Delphic temple because thetrace quantities of ethylene present helpedto keep fresh the laurel sprigs carried bythe Pythias when they went to work.

Tom PoultonOmaha, Neb.

Mike PoultonLincoln, Neb.

I take exception to the last paragraph ofthis otherwise valuable article. I cannotsee that the ancient Greeks could have ex-hibited a “broad-minded and interdisci-plinary attitude” as we understand suchto be today. They were convinced of the

truth of their religious beliefs and soughtto explain the natural phenomena theyperceived in terms of those beliefs.

Ken HerrickOakland, Calif.

HALE REPLIES: In answer to Sandidge’s let-ter, we believe that the concentrations of hy-drocarbon gas in the oracular shrine at Del-phi must have been high enough to trigger atrance state yet low enough to avoid com-bustion. Oracular sessions were held in themorning, and there are no ancient refer-ences to lamps or torches. One side of thePythia’s adytum was open, so she could seeand respond to questioners. If the Pythia fol-lowed procedures that were standard else-where, then the oracular session may havebeen preceded by three days of fasting, thusheightening her susceptibility to low levelsof ethylene.

Once modern scholars had rejected theancient testimony concerning Delphi’s fis-sure and gaseous emission, alternative ex-planations for the Pythia’s trance rushed in to

fill the void. The Poultons refer to two ofthese, namely, the smoking or ingestion

of laurel. Through frequent repetition inpopular literature, these explanations

are now widely accepted as fact. Thedescription of the Pythia chewinglaurel, or bay leaves, however,comes not from eyewitnesses butfrom hostile satirists and earlyChristians who were attacking the

oracle. As for the “smoke” theory, itrests only on Plutarch’s comment

that before going down to the shrine,the Pythia made a burnt offering of sim-

ple bay leaves and barley flour rather thanexpensive laudanum or frankincense. Ifleaves triggered her trance, then the Pythiashould have been able to prophesy any-where, not just in the sunken adytum of thetemple.

Contrary to the current popular belief ex-pressed by Herrick, the Greeks were not uni-formly dogmatic or superstitious. As early asthe fifth century B.C., the spectrum of beliefcovered a range similar to that of our owntime. At one extreme were scientific re-searchers such as Anaxagoras and Aristotle,


BR

IDG

EM

AN A

RT

LIB

RAR

Y

Letters

SCIENTISTS NOW STUDY the oracles that wereonce consulted by kings.


who sought to observe and explain natureindependently of the gods. At the otherwere religious fundamentalists. Midway be-tween were devout rationalists such as Plu-tarch. Though serving as a priest of Apollo,Plutarch tried to reconcile science and reli-gion by positing a natural world with its ownlaws and properties that could be used bythe gods for their purposes. For example,this line of thinking might suggest thatApollo used the natural exhalation at Delphito stimulate the oracle.

BRAINS ON THE MIND“Rethinking the ‘Lesser Brain,’ ” byJames M. Bower and Lawrence M. Par-sons, is an excellent overview of thenew and evolving science of the cere-bellum. A number of recent studies sug-gest that the cerebellum’s role is to ex-pedite the automating of motor andcognitive skills. If certain skills becomeautomatic, the cerebral cortex canspend more time thinking, acquiringnew skills, or refining and improvingexisting skills. Maybe dysfunction orabsence of the cerebellum slows downthe automating process to a pointwhere it may take much longer to de-velop or where it may never beachieved. Either circumstance couldtake a toll on cerebral performance, af-fecting connections between the sens-es and physical functions as well as theability to organize, create, and com-plete thoughts and tasks. This certain-ly seems to be the case for the cognitiveand motor functioning of patients whohave cerebellar dysfunctions.

D. R. RutherfordSheffield, England

While reading the article, I was struckby the idea that the cerebellum is basi-cally analogous to an input-outputbuffer in electronics. Electronics dataacquisition equipment most often hassome kind of signal-handling buffer. Itallows the acquisition equipment togather simultaneous inputs and to“precondition” the information so themain system can handle it more easily.

Many of the findings from recent stud-ies would imply this same kind of func-tionality for the cerebellum.

Kevin StokesJasper, Ind.

CALCULATING DISASTERIn Perspectives [“Houston, You Havea Problem”], the editors note that thepiece of foam insulation indicted in theshuttle disaster “slammed into the . . .wing at more than 500 miles an hour.”When the foam piece separated fromthe rocket, it was traveling at the samespeed as the shuttle. I presume that atone minute and 21 seconds into theflight, the rocket is in pretty thin air andthe distance from the breakaway pointto the shuttle wing is on the order oftens of feet. How could the relativespeeds of the foam and the shuttle di-minish by 500 mph so quickly?

Tom Sahagianvia e-mail

THE EDITORS REPLY: The air was thin butnot nonexistent. The shuttle had reachedan altitude of just over 20 kilometers,where the air density is roughly 8 percentof its sea-level value. Once the foam sepa-rated, the airflow blew it back. A simple dragcalculation shows that the foam initially ac-celerated at approximately 3,000 metersper second per second relative to the shut-tle. At that rate, it would have reached a rel-ative velocity of more than 300 meters persecond in the 0.1 second it took to fall 20meters. In practice, the foam decelerated asit was swept up in the flow, so it hit the wingat 240 meters per second (540 mph)—

which matches what the launch camerassaw. The analysis appears in section 3.4 ofthe Columbia Accident Investigation Boardreport and accompanying documents(such as www.caib.us/news/documents/impact–velocity.pdf).

ERRATUM In “Information in the Holo-graphic Universe,” by Jacob D. Bekenstein,the William Blake quotation should haveread “see a world in a grain of sand,” not“see the world in a grain of sand.”

w w w . s c i a m . c o m COPYRIGHT 2003 SCIENTIFIC AMERICAN, INC.

DECEMBER 1953RADIO TELESCOPES—“The young scienceof radio astronomy began with investiga-tors simply picking up ‘noise’ from thesky. But about a year and a half ago a sin-gle significant note was discerned throughthe din. Today listening posts all over theworld are tuning in on this high-pitchedmonotone at 1420 megacycles, and fromit they are obtaining a new picture of theuniverse. The signal carries informationabout the hydrogen floating in space. Oneof the first puzzles the new hydrogen tele-scopes [see illustration] are seeking to un-ravel is the manner in which our galaxy isrotating. Jan H. Oort, H. C. van de Hulstand C. A. Muller have alreadydiscerned a spiral arm struc-ture of hydrogen clouds in theMilky Way system.”

MODERN MIND—“Is modernlife driving many people in-sane? One way to get at thequestion is to examine themental health of a secure, sta-ble society. The Hutterites, anisolated Anabaptist religioussect of the North AmericanMiddle West, provide an ide-al social laboratory of thiskind, and they cooperatedgenerously in the interest ofscience. We did not find a sin-gle Hutterite in a mental hos-pital. But this appearance ofunusual mental health did notstand the test of an intensivescreening of the inhabitants.In short, the Hutterite cultureprovided no immunity tomental disorders. The existence of theseillnesses in so secure and stable a social or-der suggests that there may be genetic, or-ganic or constitutional predispositions topsychosis which will cause breakdownsamong individuals in any society, no mat-ter how protective and well integrated. —Joseph W. Eaton and Robert J. Weil”

DECEMBER 1903PLANE FLIGHT—“On December 17,Messrs. Orville and Wilbur Wright madesome successful experiments at KittyHawk, N.C., with an aeroplane pro-pelled by a 16-horsepower, four-cylin-der, gasoline motor, and weighing com-plete more than 700 pounds. The aero-plane was started from the top of a100-foot sand dune. After it was pushedoff, it at first glided downward near thesurface of the incline. Then, as the pro-pellers gained speed, the aeroplane rosesteadily in the air to a height of about 60feet, after which it was driven a distanceof some three miles against a twenty-

mile-an-hour wind at a speed of abouteight miles an hour. Mr. Wilbur Wrightwas able to land on a spot he selected,without hurt to himself or the machine.This is a decided step in advance in aeri-al navigation with aeroplanes.” [Editors’note: The description of the takeoff andflight contains several inaccuracies and

probably came from secondary sources.See “The Equivocal Success of theWright Brothers,” on page 94.]

DECEMBER 1853STEAMSHIP COMMERCE—“On the Pacificside of South America, steamships aremaking good progress in the affections ofthe people. The Chilian Congress haslately adopted, with only one opposingvote, a project of the Government estab-lishing a line of steamers between theircoast and Europe. The proposal is tomake an appropriation in aid of a line ofvessels, ‘with an auxiliary steam engine,’which is to be established between Cal-

dera and Liverpool, touchingat Valparaiso, in the Straitsof Magellan, and at Rio Ja-neiro; one vessel to sail everysix weeks, and never to beover 70 days in passage. Thecompany is made up entirelyof people from the UnitedStates.”

SCIENTIST’S BEST FRIEND—

“Mr. E. Merriam, of Brook-lyn Heights, N.Y., has mademeteorological records fromthree instruments, every hour,day and night, for eight years,many of which have beenpublished in the ‘ScientificAmerican.’ When inquired,‘But, sir, how do you manageto keep your record throughthe night hours?’ The replywas, ‘I retire regularly, mydog is stationed in the entryby the clock, and at its strik-

ing immediately scratches at the door. Irise, make the record, and in a few min-utes am regularly asleep again until thedog gives notice of the expiration of an-other hour.’ We saw the intelligent ani-mal—and also the evidence of his laborperformed on the door of the sleepingroom of his master.”


Cosmic Hydrogen ■ Wright Airplane ■ Canine Labor

NEW RADIO TELESCOPE helps to chart the cosmos, 1953

50, 100 & 150 Years AgoFROM SCIENTIFIC AMERICAN


In 1971 Linus Pauling published a paper in which heanalyzed the constituents of human breath. His studyshowed that an exhalation contained about 200 dif-ferent compounds, many more than had been previ-ously suspected. In the mid-1970s Michael Phillips, atthe time a thirtysomething physician from WesternAustralia working on his fellowship at the Universityof California at San Francisco, read the paper with fas-cination. Phillips was looking for a field of research towhich he could devote himself. “Pauling opened up anew area of science,” he says. “I thought: if all of thesecompounds are there, they must be signaling something.This grabbed my attention, and I’ve pursued it since.”

About a quarter of a century later, Phillips receivedpreliminary approval from the U.S. Food and Drug Ad-ministration for a device that samples the breath ofheart transplant patients for organ rejection in the first

year after the operation, a supplement to regular biop-sies. He hopes that last year’s assent will soon be fol-lowed by endorsement from the agency to charge forthe procedure. Checking breath would be potentiallyfaster, simpler, cheaper and less invasive than biopsiesor other procedures used to detect disease. Phillips’stiny company, Menssana Research, is considering de-velopment of breath analyses for ailments ranging fromlung cancer to markers of biological aging. At the sametime, he continues to battle deep-seated skepticism inthe scientific community about the validity of Mens-sana’s approach to creating a diagnostic breath sniffer.

The idea of making a diagnosis by examiningbreath is as old as medicine. Hippocrates observed thatthe aroma of a patient’s exhalation could provide cluesto disease. Today testing is done routinely to discern acompound such as alcohol or the breakdown productof a substance fed to a patient, which can confirm thepresence of, say, the bacterium Helicobacter pylori, im-plicated in ulcers and other diseases.

In contrast, Phillips, like Pauling, attempts to mea-sure more than a single compound. Formed in the1990s, Fort Lee, N.J.–based Menssana looks at an en-tire spectrum of organic chemicals, elevated or dimin-ished levels of which could serve as an indicator of dis-ease. Early work proceeded by first freezing thesevolatile organic compounds using liquid nitrogen andthen identifying the individual components with a gaschromatograph. But the collection device could be usedonly once, because an ice plug formed in the tube intowhich the subject blew.

When Phillips set up a laboratory at Bayley SetonHospital on Staten Island in the late 1980s, he receiveda small grant that allowed him to adopt a different tech-nical approach. He used an activated-charcoal adsorbenttrap to capture volatile organics and a thermal desorberto bake off and concentrate the breath constituents—allequipment that was developed for conducting environ-mental tests. The chemicals are separated by a gas chro-


NAJ

LAH

FE

ANN

Y

Innovations

Breath TakersA quixotic career-long quest to diagnose disease simply by exhaling By GARY STIX

DIAGNOSTIC PUFF MACHINE: Menssana Research chief executive Michael Phillips poses with an apparatus that collects breath that is then analyzed for the presence of a condition such as lung cancer or heart transplant rejection.


matograph and identified using a mass spectrometer. Astatistical analysis then searches for a particular “finger-print” of volatile organics that differs from that of ahealthy individual and characterizes, for example, hearttransplant rejection or the presence of a lung tumor. Thetheoretical basis for the breath tests stems from the increasein molecules with unpaired electrons called free radicalsthat are present in many disease conditions. Free radicalscause damage to certain lipid tissues, which results inhigher production of a number of volatile organics.

Phillips, also a clinical professor of medicine at NewYork Medical College, is widely credited for bringingsome recognition to the nascent field of breath testing ina Scientific American article that is still cited today, even

Continued on next page


by detractors [see “Breath Tests in Medicine,” by Mi-chael Phillips; Scientific American, July 1992]. Buthe has at times taken an especially risk-laden approachto developing such diagnostics. One of the initial ex-periments performed during the early 1990s attempt-ed to assess whether a breath analysis machine could di-agnose schizophrenia by detecting high levels of pentaneand another organic molecule, a finding that seemed toconfirm the work of Russian researchers, who had seena rise in the hydrocarbon pentane during the course ofthe disease. Phillips acknowledges that schizophrenia,whose biology is not well understood, was a poor firstchoice. “Looking back on it, it was not a smart move,”

he says. The 1993 paper based on the research was even-tually published in the Journal of Clinical Pathology af-ter numerous rejections and criticism.

“It’s been a long slog,” Phillips comments, adding,“I could paper the walls with the number of my grantapplications turned down.” One of the main objectionsfrom investigators in the small breath-testing commu-nity has to do with the organic molecules, called al-kanes, measured by the company’s assays. Critics con-tend that a particular fingerprint of alkanes—and al-kane derivatives—may not be a product of a sickperson’s metabolism but rather turns up because of ex-posure to hydrocarbons from environmental sources,perhaps absorbed from passing vehicles. Phillips and hisMenssana colleagues Joel Greenberg, Renee N. Cata-neo and Irfan Munawar have tried to compensate forthis problem. Samples are drawn from both the pa-

tient’s breath and the room air. Then the measurementsof substances found in the room’s air are subtracted.What is left, they contend, should be constituents thatresult from metabolic processes.

But even this step does not satisfy doubters. Resi-dues of hydrocarbons may persist in body fat for days.So merely taking room air out of the calculation maynot suffice. Moreover, the amount of the specified al-kanes being detected is so vanishingly small that otherresearchers question whether the disparity between thebreath profile of a diseased and a healthy individualmay be nothing more than a statistical fluke. “I don’twant someone to come out with a test only to have itbe measuring artifacts. That would hurt the field,” saysTerence H. Risby, a professor of environmental sci-ences at Johns Hopkins University who is developingbreath tests using another method. Sydney Gordon ofBattelle Memorial Institute in Columbus, Ohio, be-lieves that if detection issues can be overcome, a morefruitful approach would be to look for nitrogen-, sulfur-or oxygen-based compounds, which might give a clear-er signal. In addition, skeptics contend that Menssana’swork has yet to be replicated by other laboratories.

Phillips remains a diehard optimist. And he has a re-sponse for any debating point. Clinical trials for hearttransplant rejection and lung cancer tests show a sta-tistically significant difference in alkane-related levels inthe breath of patients with and without the conditions,he emphasizes. Both groups, he argues, have an equallikelihood of being exposed to car exhaust and other en-vironmental contaminants, so the influence of externalpollutants should not be a confounding factor.

No matter where these academic discussions go, thecompany will have to move quickly. It has survived foryears on small-business grants from the National In-stitutes of Health. It has no venture capital. And thetransplant rejection tests will probably not producemuch revenue. Physicians are comfortable doing stan-dard biopsies and, unless a biopsy is extremely difficultto perform, may be reluctant to utilize the novel breathexams.

Menssana has a clinical trial under way for lung can-cer detection, and it has done a pilot study on breastcancer, research inspired by Phillips’s wife, a breast-can-cer survivor. In the longer term, Phillips contemplatestests for angina and environmental toxins. But it couldbe a while, if ever, before his vision for the future of thistechnology is realized: a Tricorder-like device reminis-cent of Star Trek that lets a patient exhale into it beforediagnosing any of a range of diseases.


NAJ

LAH

FE

ANN

Y

Innovations

JUST BLOW: Michael Phillips demonstrates the use of Menssana’s breath trap.



STE

PH

EN

SP

ER

A (R

EP

RE

SEN

TED

BY

AD F

INE

M)

The latest climate change to capture theattention of environmental scientists istaking place not in the atmosphere but

in the nation’s courtrooms. There science isgetting a chilly reception, argue researcherswith the Project on Scientific Knowledge andPublic Policy (SKAPP). They suspect that a1993 ruling in Daubert v. Merrell Dow Phar-maceuticals is keeping reliable research out oflegal proceedings and preventing certain sci-ence-based lawsuits from moving forward.

The Daubert ruling was supposed to help

judges in their role as evidence gatekeepers.Determining when science is good enough tobe admitted is no easy job, remarks JudgePamela A. Rymer of the U.S. Court of Appealsfor the Ninth Circuit, sitting in Pasadena,Calif. Rymer chairs the advisory committee foran American Association for the Advancementof Science (AAAS) pilot project that offers in-dependent science experts to judges. “In somecases where the science and technology issuesare especially complex, the gatekeeper canbenefit from an independent expert,” Rymerexplains. “The judge has to make the call, butthe scientist can serve as a sounding board.”

The AAAS project is one approach to theproblem the high court tackled in Daubert:How can judges evaluate technical data thatare intimidating to most nonscientists? Whenthe U.S. Supreme Court ruled on Daubert,some observers feared that in opening thecourtroom doors more widely, the decisionwould invite “junk science” as well, confus-ing juries with unsupported, thinly researchedtheories. But a 2001 study by the Rand Insti-tute for Civil Justice concluded that judgesthrew out more scientific evidence and testi-monies after the decision than before. Thebiggest spike occurred between July 1996 andJune 1997, when the rate at which science ev-idence was excluded rose to 70 percent, fromabout 51 percent pre-Daubert.

The rise in inadmissible science has SKAPP

PO

LIC

Y

Science v. LawA DECADE-OLD RULE ON SCIENTIFIC EVIDENCE COMES UNDER FIRE BY PEG BRICKLEY

SCANnews

DAUBERT RULING makes judges evaluate science, usually in environmental lawsuits.



STAT

E D

EP

ARTM

EN

T FO

R A

RC

HAE

OLO

GY

OF

SAXO

NY-

ANH

ALT;

RAL

F SC

HW

ARZ

newsSCAN worried, particularly because a defeat on Dau-

bert grounds often means a lawsuit is over.“Anecdotally, we have collected reports thatDaubert is having a negative impact on theability of individuals to get justice,” saysSKAPP member David M. Michaels, an epi-demiologist at George Washington Universi-ty. “We hope to design studies to find out ifthat’s true.” SKAPP’s analyses will attempt tocapture psychological and economic data, be-cause those forces drive decisions to admit orexclude scientific evidence as much as legaland scientific principles.

Daubert’s defenders say the rule savescourts and society time and money. Amongthem is Christopher C. Horner, an attorneywith the Competitive Enterprise Institute, aWashington, D.C., think tank. He points todecisions such as one in June by a federal ap-peals court in Pennsylvania that upheld a trialcourt decision. That ruling barred a scientistfrom testifying in the case of a dry-cleaningworker who had been exposed to perchlo-roethylene over two years of employment, de-veloped leukemia and wanted to present ex-pert evidence that the chemical had caused herdisease. The trial judge, however, knocked theoffered expert out for failing to explain ade-quately the methods he used to draw his con-clusions. Such instances, Horner says, demon-strate Daubert’s power to head off unworthylawsuits: “Daubert is a good decision that isyielding very good results.”

Daubert contests can consume as muchtime, money and energy as the trial itself, chal-lenging the skills of lawyers, the patience ofjudges and the pocketbooks of litigants. ADaubert challenge would most likely mean an

expensive, arduous pretrial event; as a result,the challenge swings legal economics awayfrom cases where the science is new, Michaelsargues. Unless potential damages top $1 mil-lion, some trial lawyers say, the risk of hiringa battery of experts to push the science past aDaubert challenge is not worthwhile.

To SKAPP members, Daubert in action letslawyers transform what should be a scientif-ic inquiry into a test of the willingness tospend money. In cases involving environmen-tal science, the deepest pockets usually belongto defendants—industries accused of expos-ing people to toxic chemicals, notes SheldonRampton, a journalist who criticized indus-try-funded scientific witnesses in a 2001 book,Trust Us, We’re Experts!, written with JohnStauber. “The whole argument about junk sci-ence was developed by the tobacco industryfor the purpose of defending itself against law-suits, and it has been taken up since then byeveryone in industry,” Rampton says.

Ironically, science may be its own worstenemy when it comes to Daubert, Michaelsobserves. Scientists love to keep questioningthings, and that inquisitiveness makes judgesnervous. “You can manufacture uncertaintybecause scientists don’t always agree,” he ex-plains. “Lawyers take differences among sci-entists and magnify them, and as long as thereis any sort of disagreement, the case does notmove forward.” Rampton argues that goodscience deserves its day in court but that itdoes not need a rule to make it so: “Juries areas able to separate spurious science from thereal thing as judges or attorneys are.”

Peg Brickley is based in Philadelphia.

A vast, shadowy circle sits in a flat wheatfield near Goseck, Germany. No, it isnot a pattern made by tipsy graduate

students. The circle represents the remains ofthe world’s oldest observatory, dating back7,000 years. Coupled with an etched disk re-covered last year, the observatory suggeststhat Neolithic and Bronze Age people mea-

sured the heavens far earlier and more accu-rately than scientists had imagined.

Archaeologists reported the Goseck cir-cle’s identity and age this past August. Firstspotted by airplane, the circle is 75 meterswide. Originally, it consisted of four concen-tric circles—a mound, a ditch and two wood-en palisades about the height of a person—in

Circles for SpaceGERMAN “STONEHENGE” MARKS OLDEST OBSERVATORY BY MADHUSREE MUKERJEE

ARC

HAE

O-

ASTR

ON

OM

Y

In Daubert v. Merrell DowPharmaceuticals, parents sued the

maker of the morning-sicknessdrug Bendectin, arguing that it

caused birth defects. Merrell Dow(bought by Hoechst AG in 1995)

had already voluntarily withdrawnthe drug, although the company

claimed that standard testsshowed that Bendectin posed no

danger to human fetuses. Expertsfor the parents wanted the court toconsider newer ways of evaluating

the drug. The scientist-witnesseswho were called worked either for

the parents or for the defendants;not surprisingly, they heartily

disagreed with one another.

Lower courts decided against theparents, citing the old rule that

only “generally accepted” sciencecan enter the courtroom. But the

Supreme Court took up the caseand concluded in June 1993 that

trial judges should weigh a range offactors in deciding whether to hear

new scientific ideas, rather thanjust determining which of

two conflicting theories is mostwidely accepted.

SETTINGTHE STAGE



STAT

E D

EP

ARTM

EN

T FO

R A

RC

HAE

OLO

GY

OF

SAXO

NY-

ANH

ALT;

KAR

OL

SCH

AUE

R

which stood three sets of gates facingsoutheast, southwest and north, re-spectively. On the winter solstice, some-one at the center of the circles wouldsee the sun rise and set through thesouthern gates.

Although aerial surveys have de-marcated 200-odd similar circles scat-tered across Europe, the Goseck struc-ture is the oldest and best preserved ofthe 20 excavated thus far, and it is thefirst circle whose function is evident.Though called the German Stonehenge,it precedes Stonehenge by at least twomillennia. The linear designs on pottery

shards found within the compoundsuggest that the observatory was builtin 4900 B.C.

Perhaps the observatory’s most cu-rious aspect is that the roughly 100-degree span between the solstice gatescorresponds with an angle on a bronzedisk unearthed on a hilltop 25 kilome-ters away, near the town of Nebra. TheNebra disk, measuring 32 centimetersin diameter, dates from 1600 B.C. andis the oldest realistic representation ofthe cosmos yet found. It depicts a cres-cent moon, a circle that was probablythe full moon, a cluster of seven starsinterpreted to represent the Pleiades,scattered other stars and three arcs, allpicked out in gold leaf from a back-ground rendered violet-blue—appar-ently by applying rotten eggs.

The two opposing arcs, which runalong the rim, are 82.5 degrees longand mark the sun’s positions at sunriseand sunset. The lowest points of the twoarcs are 97.5 degrees apart, signifyingsunrise and sunset on the winter solsticein central Germany at the time. Like-wise, the uppermost points mark sun-rise and sunset on the summer solstice.The sun’s position at solstice has shift-ed slightly over the past millennia, notesWolfhard Schlosser of the Ruhr Uni-versity in Bochum, so that the angle be-tween sunrise and sunset is now slight-ly farther apart than when the Nebra

disk and the Goseck circle were made(by 1.6 and 2.8 degrees, respectively).

Nearby excavations of wood-and-clay houses have turned up a variety ofgrains and evidence of domesticatedgoats, sheep, pigs and cows. Farmersreached this part of the world some 500years before they built the solar obser-vatory. Although these earliest Neo-lithic agriculturists most likely mea-sured only the sun’s movements, overmillennia they came to quantify the lu-nar cycle and the positions of constel-lations. The Pleiades, which depart thenorthern sky in spring and reappear inthe fall, still mark crop cycles for manyfarmers around the world. The Nebradisk may have been a ritual object or,more likely—given its precision—a cal-culational tool used with observations

SOLAR OBSERVATORY in Goseck, Germany, as it might have appeared in 4900 B.C. The circle, easily seen in aerial views today (opposite page), has three gates. To an observer standing at the center of the circle, the sun rises and sets through the southern gates (above, at top) on thewinter solstice; the northern gate’s function is unknown.



STAT

E D

EP

ARTM

EN

T FO

R A

RC

HAE

OLO

GY

OF

SAXO

NY-

ANH

ALT;

JU

RAJ

LIP

TÁK

newsSCAN

Humans have visited the very bottom ofthe ocean—the Marianas Trench in thewestern Pacific, nearly seven miles be-

low the wavetops—only a few times. The firstexpedition took place in 1960, when JacquesPiccard set the U.S. Navy submersible Triestedown on the murky floor; the next occurredsome 35 years later, when Japan’s Kaiko, amultimillion-dollar remotely operated vehi-cle (ROV), returned briefly to that blackrealm during several dives. The extremedepths and pressures of the earth’s least-explored territory have kept scientists fromstudying the ocean’s abyss up close. An in-novative attempt may soon change that.

Engineers at Woods Hole Oceanograph-ic Institution, Johns Hopkins University andthe U.S. Navy have begun developing an un-dersea craft that is designed to do meaning-ful science at the lowest depths routinely and

cost-effectively. The device, explains WoodsHole researcher Andy Bowen, will be a hy-brid ROV; it will combine the capabilities ofa fully autonomous undersea robot withthose of a craft piloted from the surface via athin optical-communications fiber, the sametechnology used to guide torpedoes. The one-ton machine and its support equipment are tofit into a pair of standard shipping contain-ers. Thus, the system is intended to be suffi-ciently compact, lightweight and easily de-ployed from standard oceanographic vessels,thereby avoiding the need for a dedicatedmother ship. These features will make themachine flexible and cheap enough not onlyfor deep diving but for other, traditional sur-vey and sampling jobs. Managers expect thatthe $5.5-million project, which is being fund-ed by the National Science Foundation, theOffice of Naval Research and the National

at Goseck or a similar siteto determine plantingand harvest times.

The third arc on thedisk, believes FrancoisBertemes of the Uni-versity of Halle-Wit-tenberg, is the stuff oflegend. The ancients didnot understand how thesun could set in the west andend up in the east the nextmorning. Representations of a diskin a ship, from Bronze Age Egypt and Scan-dinavia, reveal an age-old belief that a shipcarried the sun across the night sky. The Neb-ra disk is the first evidence of such a faith incentral Europe. That the land-bound cultiva-tors knew of ships is no surprise: Bertemespoints out that travelers spread the latest inBronze Age technology as well as mythology.

The third gate at Goseck remains myste-rious, however: it points north, but not quite.It may have nothing to do with astronomy,for the compound was more than a solar sta-tion. In addition to pottery shards and ar-

rowheads within, ex-cavators found the de-

capitated skulls of oxen,apparently displayed on

poles, and parts of two humanskeletons. The human bones were

cleaned of flesh before being buried. Similarskeletons—several with cut marks or with ar-rowheads in their necks—have turned up inother circles, but archaeologists cannot agreeon whether they attest to human sacrifices orto uncommonly gory funeral rites. Neverthe-less, such ceremonies anoint the site as a tem-ple, Bertemes notes—and show that sciencewas inextricably entangled with superstitionsince Neolithic times.

Madhusree Mukerjee writes fromFrankfurt, Germany.

Down to the DeepCROSSBREEDING TO MAKE EXPLORING THE ABYSS ROUTINE BY STEVEN ASHLEY

OC

EAN

S

Although the fiber-optic link is theprimary technical challenge facing

engineers of the new hybridremotely operated vehicle (ROV),

other obstacles must be overcome.Building on U.S. Navy expertise, the

hybrid ROV will incorporatespherical housings composed ofstrong but lightweight aluminum

oxide ceramic. The high-buoyancyceramic cases would thus be able

to protect onboard electricalequipment from deep-water

pressures as great as 16,000pounds per square inch. Further

flotation will derive from syntacticfoam—epoxy resin filled with glass

microspheres. Pressure-tolerantmechanical connections, cameras,

low-power lighting and otherapparatus must also be

constructed. Because the hybridROV will be battery-powered,

energy management will beanother major concern.

NEED TO KNOW:MORE THAN FIBER

The Nebra disk, the oldestrepresentation of the cosmos,ended up with archaeologists

rather unconventionally. Usingmetal detectors, treasure hunters

dug up the disk in 1999 fromMittelberg Hill near Nebra, along

with two swords, two axes, chiselsand armlets, and then sold the

heist to dealers. Because Germanlaw dictates that such relics are

state property, the police mounteda sting operation, wherein

archaeologist Harald Meller of theState Museum for Prehistory at

Halle posed as a buyer to recoverthe cache. One of the discoverers

was fined this past September, andanother was sentenced to 250 hours

of community service. Othersindicted in the case remain on trial.

OPERATION:RECOVER NEBRA

NEBRA DISK, a bronze artifactwith markings in gold leaf,

is the earliest knownreproduction of the sky. It may have been used to time plantings and harvests.


w w w . s c i a m . c o m

Chuck Yeager ushered in an erawhen he blasted through thesound barrier at Edwards Air

Force Base in 1947. But his Bell X-1also created a problem: the window-and nerve-rattling sonic boom. Nowaeronautical engineers at the same Cal-ifornia air base say that although theyhaven’t busted the sonic boom, at leastthey’ve taken a swing at muffling it.

Flying faster than the speed ofsound—660 miles per hour at 10,000feet—an airplane produces air-pressurewaves that pile up in front. The wavesform highly compressed regions calledshock waves, which lead to sonic booms.

The boom from a straight-flyingcraft is actually two booms in one. A su-personic jet forms a shock wave at its

nose, which claps back together after itstail. This pressure suddenly spikes a cou-ple of pounds per square foot over am-bient atmospheric pressure, then shootsbelow ambient by about an equalamount, spiking again before returningto ambient pressure. A graph of pressureover time would form the letter N.

“We cannot change the energy of theaircraft flying through the air,” says Ed-ward A. Haering, the Dryden ResearchCenter’s Shaped Sonic Boom Demon-stration (SSBD) principal investigator.“But we can redistribute it” to decreasethe pressure changes. Late this past Au-gust engineers at Northrop Grummanaccomplished this redistribution of en-ergy on a modified F-5. They altered itsfront with a “nose glove,” made from

Oceanic and Atmospheric Administra-tion, will be completed in four years.

The crossbreeding approach cir-cumvents the limitations of other, con-ventional bathyscaphic and teleoperat-ed technologies. Occupied submersiblesend up being large and costly to ensurethe safety of the people inside. Totallyindependent robots must be extremely“intelligent” to carry out research ac-tivities—an expensive and technicallydifficult task. Meanwhile the lengthy ca-bles used to tether craft to surface shipsare simply too weak and unwieldy tosupport themselves plus a vehicle ex-ploring broad swaths of the seafloor.

When operated as an autonomousdevice, the hybrid ROV will conductwide-area surveys using sonar and oth-er sensors. For detailed investigations,technicians will strap on an optical-fiber canister and a tool sled containingadditional thrusters, extra flotation,batteries, an electromechanical armand sampling equipment. After beingwinched below the treacherous cur-

rents on a steel cable, the craft will bereleased from a suspended depressorweight. An anchor will then pull the ve-hicle down to the seafloor, paying outoptical fiber during the descent. Oncethe hybrid ROV arrives at the bottom,it will release the anchor and drive offto do its business, reeling out more mi-crofiber from its stern. On completionof its work, the craft will cut the fiberlink and then rendezvous and dockwith the depressor weight, making itready for retrieval by the ship.

If all goes well, the hybrid ROVwill let scientists better understandfundamental processes occurring at thedeep subduction zones along the con-tinental margins where geochemicalrecycling of the earth’s crust takesplace. Further, it will permit explo-ration of the unknown seas below thepolar ice packs (a task that requireslong horizontal transits) as well asrapid deployment to study any newundersea phenomenon that emergesunexpectedly.

Lowering the BoomQUIETER WAYS TO BREAK THE SOUND BARRIER BY PHIL SCOTT

AER

OSP

ACE



GR

EG

CO

RR

EAR

D S

hu

rflo

N

OR

THR

OP

GR

UM

MAN

CO

RP

OR

ATIO

N

newsSCAN

aluminum and composites and resembling apelican’s beak. The glove elongates the noseand blunts it, which prevents shock wavesfrom the engine inlet and wing from movingforward and coalescing with the main shockfrom the bow. In the test, the modified F-5clipped the N-wave, reducing the shock wavefrom 1.2 pounds per square foot to 0.8 pound,resulting in a quieter boom.

The experiment validates a theory pro-posed 30 years ago by aerospace engineeringprofessors Richard Seebass and Albert R.George of Cornell University. They proposedthat a blunter nose could create a pressure spikeahead of the shock wave. The spike wouldraise the air temperature and hence increasethe speed of sound, which in turn wouldspread the shock wave, thereby dampening it.

Seebass also had another theory: “Stretch-ing the vehicle can reduce the sonic boom,”explains Brian M. Argrow, an aerospace en-gineering professor at the University of Col-

orado at Boulder, who collabo-rated with Seebass before hisdeath in November 2000.“Something on the order of 150to 200 feet long and weighingless than 100,000 pounds”—

which is light for an aircraft ofthat length. “If you make it slen-der enough, it can actually fly su-personically with no boom,” Ar-grow states. Dryden’s Haeringremains skeptical of boom-freesupersonics: “Plowing throughthe air, pushing it faster than itcan move out of the way, you’re

going to get a shock wave.”It might be possible to quiet the boom

without modifying the aircraft. In the 1970sRussian researchers proposed generating anelectrical field in the airplane’s nose, thus cre-ating plasma. By heating the surrounding air,the plasma might reduce the shock wave.

Engineers still have more immediate andpractical tricks to try—namely, Haering ex-plains, “by paying attention to placement ofthe wing, tail and engines and the shape ofthe fuselage.” One possible form is a dia-mond-shape wing, with no big protuberancesor abrupt area changes on either the wing orthe fuselage, according to Charles Boccadoro,a program manager at Northrop Grumman.Manufacturers could be ready to unveil qui-eter supersonic jets within the next 10 years.Chuck Yeager would be proud.

Phil Scott writes about aviation technologyfrom New York City.

Thirsty crowds know that where there’sa beer, there’s a wait. That’s because theaverage draft pint takes at least 25 sec-

onds to pull. Any slower, and the beer comesout flat; any faster, and a frothy lager latte re-sults. In the past two years, with profitsshrinking, brewers have become keen to servemore customers without sacrificing quality,

and they have sought technology to help.Pouring beer quickly does not mean sim-

ply using bigger spouts. Draft beer’s ticklishnature requires a fine balance between tem-perature and pressure. Most dispensing sys-tems rely on carbon dioxide gas pumpeddown into the keg to push beer up to a tap.Higher CO2 pressure would speed delivery—

Two-Second DraftsFASTER BEER TAPS FOR THOSE WHO JUST CAN’T WAIT BY BRENDA GOODMAN

FLU

ID F

LOW

Aircraft flying over populated areasmust travel at subsonic speeds to

avoid producing sonic booms.Considering that more than 60

percent of air traffic crosses land,it would seem that commercial

airliners should take an interest intaming sonic booms. But althoughtheories about softer booms have

existed for 30 years, “there is noeconomic driver” to apply the

ideas, says Brian Argrow of theUniversity of Colorado at Boulder.

A supersonic transport, he explains,requires more energy than an

airliner traveling at high subsonicspeeds. Burning more fuel is not

what cost-conscious airlines liketo hear—and explains in part why

the Concorde has been retired.

Even the big-budget Pentagon hasbeen leery of investing in boom-

softening technology. According toEdward A. Haering of the Dryden

Research Center, engineers theretried to modify an SR-71 Blackbird,

the world’s fastest plane, back in1995. But they couldn’t come upwith $3 million for a nose glove.

SUPERSONIC:NOT WORTH IT QUIETER SONIC BOOM was achieved by Northrop Grumman in a test

flight this past summer. This F-5 was outfitted with a “nose glove” inthe shape of a pelican’s beak. The blunter nose creates a pressurespike that dampens the shock wave resulting from supersonic speeds.

BEER could be poured faster with newtaps, such as one made by Shurflofor the 2002 World Series.


newsSCAN

Taps could also pour beer thatstays colder longer. In the U.K.,Coors and IMI have recentlyintroduced a superchill system.First a jet of cold water sprays theglass while it spins, frosting it. Theglass continues to spin while thebeer is poured. Then a blast ofultrasound compresses the carbondioxide gas, chilling it and causinga flurry of ice crystals to appear inthe beer. Coors claims that thebeer stays cold for up to 20minutes longer than a regular pint.U.S. Coors executives have justseen the system used in the U.K.and reportedly aren’t giving it thecold shoulder.

PINT-SIZESCENARIOS

but produce a river of foam. Every brew needsa slightly different pressure to be served well.

The makers of Guinness, which takes 119seconds to pour, were the first to try to de-velop a faster tap. After a year of experi-menting, they gave up. The company won’tsay what went wrong, only that Guinnesscustomers are prepared to wait.

U.K. brewer Carlsberg-Tetley has beenmore successful. With the University of Birm-ingham, which had been offering degrees inbrewing science since 1903, it devised a “hy-drocyclone” system, which spins beer intothe tap like a liquid tornado. Some of the car-bon dioxide in the beer is released into thecenter of the funnel, preventing excessivefoam at higher pouring speeds. “The con-trolled gas breakout is the secret,” explainsGeorge Philliskirk, technical manager forCarlsberg-Tetley. “It creates a tight, creamyhead without excessive foam.” Philliskirk es-timates that since its launch in February2002, the fast-pour system is operating inmore than 100,000 pubs around the U.K.,delivering pints in about 14 seconds.

This past spring Shurflo in Cypress,Calif., and Anheuser-Busch launched theirversion of a faster tap, called the UltimateDraft System. They borrowed a trick bottlersuse to control foam: fill from the bottom up.A flexible tube at the end of a spigot extendsto the base of the beer glass, allowing for sub-surface pumping that can fill a 20-ounce glassin a blistering two seconds. In a test at Bos-ton’s Fenway Park, the system sold 2.4 morekegs per game than conventional taps. KeithD. Lemcke, executive director of the DraughtBeer Guild, was impressed: “The amount ofcarbonation in your mouth is exactly thesame.”

Coors U.K. and IMI Cornelius in Anoka,Minn., plan to introduce a fast-tap system,too, although they remain tight-lipped. In-dustry insiders expect it to be a less expensivebut slightly slower version of the Shurflo mod-el, pulling a pint in five seconds. Either systemwill most likely mean that you’ll spend moretime waiting for the loo than for a brew.

Brenda Goodman is based in Tampa, Fla.



RAF

A AI

ZPR

UA

newsSCAN

P eople all over the world last year paidmore than $400 billion for pharmaceu-ticals, nearly half of which were discov-

ered in the wild. The reefs and rain forests thatyielded those discoveries are found primarilyin countries with no pharmaceutical industry,so the compounds were patented and sold byforeign companies. Without a share of theproceeds, the stewards of the world’s biodi-versity have no incentive to preserve it. So 11years ago ecologists, indigenous peoples andgovernments united to bring the profits home.Since the 1992 Earth Summit in Rio de Janei-ro, 168 nations have signed the Conventionon Biological Diversity and committed them-selves to sharing the benefits that come frombioprospecting.

So far the convention hasn’t worked. Thelaws it inspired rely on the sales of blockbusterdrugs—which take decades to develop—whiledestructive industries such as logging pay offimmediately. Now some countries are look-ing for profits in the beginning of the drug de-velopment process instead of waiting for a fi-nal product—and realizing the dreams of theconvention.

The problem with the 1992 agreement hasbeen implementation. Most countries requirebenefit-sharing agreements that usually call foran up-front cash contribution, training, tech-nology transfer, and royalty payments. Forexample, a 1994 agreement between Surinameand a consortium of U.S. and Surinamese re-searchers called for an initial $60,000 paymentand $20,000 per year for five years of research.

The total outlay of $160,000 is not goingto tip the scales toward conservation, even insuch a small country as Suriname. And to date,no blockbuster drugs have come out of regu-lated bioprospecting. What’s more, low-bud-get, pay-for-access agreements with pharma-ceutical giants can seem like legalized biopira-cy. That has led to public outrage and hasforced the suspension of benefit-sharing agree-ments (and the research they covered) in Brazil,Mexico and even the U.S. Facing such outragein 2000, Brazil’s president banned virtually allbiological material from leaving the country.

The uncertainties are driving away the

vast corporations that can turn a marvelousmicrobe into a billion-dollar drug. “They’reshutting down those divisions of their com-panies, and they’re going to genetically engi-neered products and synthetic chemistryproducts,” says Brian M. Boom, an econom-ic botanist at Columbia University. “I think

it’s going to take real live [court] cases deal-ing with a drug that’s been developed to fig-ure out how the benefits are going to beshared.”

Rather than waiting for judicial solutions,two nations are shifting their approach to bio-prospecting: they hope to capitalize on theenormous research and development industrythat underpins drug discovery. “People thinkthat all the drug discovery research is done bypharmaceutical companies, when in fact thewhole bottom part of this enormous pyramidis often done in academic institutions andsmall biotech firms,” explains biologist Phyl-

Refining Green GoldHOW BIOPROSPECTING COULD BE MADE TO WORK BY DAVID LABRADOR

DR

UG

DIS

CO

VER

Y

Because there is no way to know inadvance which forest sample will

lead to a cancer drug or AIDSvaccine, most countries treat all

research as potentially profitable.In some countries, investigators

must negotiate with several levelsof government. “It puts the kiboshon a lot of basic research that has

nothing to do with profit motive,”says Columbia University

economic botanist Brian M. Boom,who lobbied for the Convention on

Biological Diversity for yearsbefore it was adopted. Now, hesays, “the very people who aremost able to get out there and

discover and describe and quantifybiodiversity are being impeded

from doing it. Everyone struggleswith the paradox of it.”

WELCOME TOTHE JUNGLE

DRUG SEARCH: A local botanist looks for and collectsplant samples in one of Panama’s national parks.



lis D. Coley of the University of Utah.In the October Frontiers in Ecology

and the Environment, Panamanian andU.S. bioprospectors led by Coley andher husband, Thomas A. Kursar, also atthe University of Utah, demonstratedhow a developing country can quicklyestablish a drug discovery industry. In1998 they won a $3-million biopros-pecting grant and funded local scientiststo analyze what they found instead ofpaying U.S. labs to do the same work.“By conducting all of the research inPanama, we circumvent the issue of un-certain royalties and provide immediateand lasting benefits,” they write. “We’reinvolved in the collections, but that’s it,”Kursar elaborates. “All the high-techstuff is being done by Panamanians.”

Now Panama has six new laborato-ries employing 67 researchers who per-form bioassays and run toxicity and ef-ficacy trials. And because Panamanianlabs developed the intellectual proper-ty, it is theirs to license to pharmaceu-tical companies for immediate profit.

Brazil is also cultivating a drug dis-covery industry. Last year the govern-ment opened the Center for AmazonianBiotechnology. Anyone collecting sam-ples in Brazil must patent them thereand contribute toward a goal of $150million in private funds. The center hasmore than 80 affiliated research groupsand will house 26 laboratories when itis completed.

Brazil’s presidential ban on the ex-port of biological material may be un-dermining this initiative to some degree(it prevents the profitable licensing ofpromising compounds and discouragesforeign collaboration). Still, human andfinancial capital is accumulating in theBrazilian drug discovery industry and isgiving locals a huge stake in keeping theforest intact. And in Panama, Coley re-ports that a chemist “who couldn’t havecared less originally is now a wonderfulpublic speaker on the value of biodiver-sity.” Other countries could gain a sim-ilar stake in conservation by followingtheir lead.

David Labrador is a writer andresearcher based in New York City.



RO

DG

ER

DO

YLE

newsSCAN

Modernization, the subject of intensescrutiny at least since the time of Marxand Nietzsche, has seldom been mea-

sured systematically. One of the most usefulattempts to do so has been done by politicalscientists Ronald Inglehart and Wayne E. Bak-er of the University of Michigan at Ann Arbor.

In their approach, being modern impliesnot only a lack of tra-ditional beliefs but alsoa need for free expres-sion. To measure theseattributes, they use re-sponses from the WorldValues Survey, an in-ternational collabora-tive study based on extensive questioningof people in scores ofcountries making upmore than 80 percentof the world’s popula-tion. The first of thesedimensions—the tradi-tional versus secular-

rational scale in the chart—derives from atti-tudes toward religion, respect for authority,and patriotism. The second dimension—sur-vival versus self-expression—derives fromquestions about physical security, trust in oth-er people, gender roles, and personal happi-ness. Self-expression, almost by definition, im-plies freedom from extreme need.

The data for individual countries arecombined into nine cultural groups to formthe bounded areas seen in the chart. As mightbe expected, most Western countries tend tobe in the upper right, indicating high mod-ernization scores, whereas developing soci-eties are generally in the lower left, indicatinglow modernization scores. Countries with aConfucian heritage, which hold relatively sec-ular values, tend to be high on the secularscale but have lower self-expression valuesthan Western countries. The position of for-mer Soviet bloc countries reflects decades of

indoctrination in atheism as well as their re-cent economic troubles.

Among Western countries there are dis-tinct differences, with Protestant Europe oc-cupying the most modern position aboveCatholic Europe and the English-speakingcountries. This positioning reflects extremelylow levels of religious involvement togetherwith high levels of well-being and the toler-ance and trust characteristic of the EuropeanProtestant heritage. Catholic societies, as In-glehart and Baker suggest, may have a lowerposition on the scale because of the heritageof the Roman Catholic Church, the proto-type of a hierarchical, centrally controlled in-stitution. The lower position of the English-speaking countries is a function of, amongother influences, their higher religious com-mitment, particularly in the U.S.

Economic condition and religious-culturalheritage are the basic forces accounting for theposition of societies on the chart, but withinany society, homogeneity wields substantialpower. In the U.S., for example, the basic val-ues of Catholics resemble those of Protestants,rather than those of Catholics in predominant-ly Catholic countries, whereas in Nigeria thevalues of Christians are far closer to those ofMuslims than to those of Western Christians.

The common wisdom is that the world isbecoming Americanized, but the Inglehart-Baker analysis suggests that Americanizationis occurring largely at the superficial level ofCoca-Cola and Big Macs. As they put it in aFebruary 2000 American Sociological Reviewarticle, “industrializing societies in general arenot becoming like the United States.. .[for] itspeople hold much more traditional values andbeliefs than do those in any other equallyprosperous society.” It is not the U.S. butnorthern European cultures, such as those ofthe Nordic countries, that are on the cuttingedge of modernity.

Rodger Doyle can be reached [email protected]

Measuring ModernityTHE U.S. IS NOT NUMBER ONE BY RODGER DOYLE

BY

THE

NU

MB

ER

S

Modernization Theory and theStudy of National Societies:

A Critical Perspective. Dean C. Tipps in Comparative

Studies in Society and History,Vol. 15, No. 2, pages 199–226;

March 1973.

Democracy and EconomicDevelopment: Modernization

Theory Revisited. Zehra F. Arat inComparative Politics, Vol. 21,pages 21–36; October 1988.

Modernization, CulturalChange, and the Persistence

of Traditional Values. Ronald Inglehart and Wayne E.Baker in American Sociological

Review, Vol. 65, No. 1, pages 19–51; February 2000.

FURTHERREADING

U.S.

RussiaChina

Japan PROTESTANT EUROPEE. Germany

NorwaySweden

Netherlands

U.K.

Ireland

Portugal

MexicoLATIN AMERICA

BrazilTanzania

Jordan

SUB-SAHARANAFRICA

Romania

MUSLIM

FORMER SOVIET BLOC

ENGLISH-SPEAKING COUNTRIES

HINDU

CATHOLICEUROPE

Turkey

France

CONFUCIAN

Self-

Expr

essi

onSecular/Rational

Surv

ival

/Sec

urity

Traditional

S O U R C E : R i s i n g T i d e : G e n d e r E q u a l i t y a n d C u l t u r a l C h a n g e a r o u n d t h e W o r l d , b y R o n a l d I n g l e h a r t a n d P i p p aN o r r i s ( C a m b r i d g e U n i v e r s i t y P r e s s , 2 0 0 3 ) . D a t a a r e f o r 7 7 c o u n t r i e s f r o m t h e W o r l d V a l u e s S u r v e y , w i t h m o s tc o u n t r i e s b e i n g s u r v e y e d i n 1 9 9 9 – 2 0 0 1 . N o t a l l c o u n t r i e s a r e s h o w n .

WORLD ATTITUDES,RELATIVE STANDING BY CULTURE GROUP



AP/W

IDE

WO

RLD

PH

OTO

newsSCAN

PHYSIOLOGY OR MEDICINE

OUTSIDE LOOKING IN

“The Shameful Wrong That Must Be Righted”screamed the October advertisement. The per-ceived wrong was committed by those whoawarded this year’s Nobel Prize in Physiologyor Medicine. The committee honored Paul C.Lauterbur and Peter Mansfield for their contri-butions to the development of magnetic reso-nance imaging (MRI) technology—and ignoredRaymond V. Damadian, who took out the full-page ad that appeared in the New York Timesand the Washington Post.

Certainly the winners were deserving.Lauterbur discovered that gradients in the ap-plied magnetic field could lead to two-dimen-sional images. Mansfield showed how themagnetic gradients could be mathematicallyanalyzed, thereby improving the speed and ef-ficiency by which images could be generated.But there is no question that Damadian playeda key role in the development of MRI machinesroutinely used in hospitals today [see “Scanningthe Horizon,” Profile, by David Schneider; Sci-entific American, June 1997]. In 1971 hedemonstrated that nuclear magnetic resonancecan detect cancer in the body and a year laterfiled a patent for a whole-body scanner.

Controversies over Nobel prizes are notuncommon. The Nobel committee’s decisionin this case, however, seemed to be an inten-tional slap in Damadian’s face. Award rulespermit up to three winners in each category, sothe committee could have included Damadian.Curiously, the Nobel’s press release describingthe winners, which typically acknowledgesother contributors, fails to mention Damadi-an. Did the committee ignore Damadian be-cause he chose to leave academia and pursuehis work as a businessman? Did his relentlessself-promotion irritate the judges enough toshun him? Did his creationist viewpoints playany role? (He is on the technical advisoryboard of the Institute for Creation Research.)

Even if the Nobel committee was unkind toDamadian, at least the MRI field itself hasproved generous: in 1997 Damadian won apatent infringement lawsuit against GeneralElectric for $129 million and settled out of

court with other MRI manufacturers, proba-bly also for millions. —Philip Yam

PHYSICS

HIGH PRIZE FOR LOW TEMPERATURES

The announcement sounded awfully familiar:for the fifth time in eight years, the prize wentfor work in low-temperature physics, totalingmore than in any other specialty. Is it Swedishbias, just rewards, or a statistical anomaly?

“Nobel Prize–winning physics almost by de-finition is work done at the frontiers,” says EricA. Cornell of the University of Colorado at Boul-der, a 2001 Nobel laureate. “Certainly one ofthe ‘hottest’ is the frontier of ever lower temper-atures.” A lag of decades can span a discoveryand its Nobel Prize, and Cornell points out thatthe frontier for achieving low temperatures waspushed down nine orders of magnitude fromthe 1960s through the 1990s. That realm provedfertile ground for uncovering phenomena andfor revealing spectacular predictions of quan-tum mechanics. The 2003 prize went to AlexeiA. Abrikosov and Vitaly L. Ginzburg for theo-retical work into the nature of superconductiv-ity and to Anthony J. Leggett for his researchon the peculiar properties of liquid helium.

Physicists are fond of the low-temperaturerealm for its icy simplicity: near absolute zero,physical systems become ever more free ofmessy heat fluctuations, and their quantum-me-chanical properties can shine. The third law ofthermodynamics guarantees that absolute zero(and a cessation of all atomic motion) cannot bereached, but physicists have gotten amazinglyclose—just this past September, Nobel laureate(2001) Wolfgang Ketterle and his group at theMassachusetts Institute of Technology cooled asodium gas to a record-low 0.0000000005 de-gree above zero (0.5 nanokelvin).

And as physics progresses, fundamentalideas increasingly tend to overlap arbitrarylines of specialties. For instance, the work ofAbrikosov, “apart from its importance in su-perconductivity, is also an important insight inthe context of particle physics,” notes EdwardWitten, a mathematician and theoretical physi-cist at the Institute for Advanced Study inPrinceton, N.J. —David Appell

The Nobel Prizes for 2003The Royal Swedish Academy handed out four prizes to honor nine men of science for theirgroundbreaking contributions. Below are commentaries on two of the prizes.

■ Chemistry: Peter Agre andRoderick MacKinnon, for elucidating the processby which water and ionscross cell membranes.Coincidentally, MacKinnon isResearch Leader of the Yearin the SCIENTIFIC AMERICAN 50awards (see page 55).

■ Economics: Robert F. Engleand Clive W. J. Granger, for statistical methods to analyze economic data over time.

NOBEL’S OTHER WINNERS

Details on all the winners are atwww.nobel.se and at

www.sciam.com/news–directory.cfm



TUI

DE

RO

Y M

ind

en P

ictu

res

(top

); J

OH

NN

Y JO

HN

SON

(b

otto

m);

ILL

UST

RAT

ION

BY

MAT

T C

OLL

INS

newsSCAN

B O T A N Y

Leaving AloneThe radiant oranges of a monarch butterfly’swings alert hungry predators that those insectsare poison. In much the same way, the dazzlingorange, red and yellow displays of forests in fallmay be warning would-be leaf munchers of atree’s chemical defenses. Invertebrate biologistSnorre Hagen and his team at the University ofTromsø in Norway monitored the leaves andflowers of a dozen mountain birch trees for twoyears. Scientists have long thought that thebright colors of autumn foliage were just the by-product of how leaves age when they cease pho-tosynthesis, but Hagen and his colleagues reportthat the earlier and the more trees changed col-or, the less damage from chewing occurred thefollowing season. Their report, in the SeptemberEcology Letters, also notes that leaf chemistryanalyses and tests with color-sensitive herbi-vores are needed to uncover the mechanismsthat reduce insect damage. —Charles Choi

A G R I C U L T U R E

Shrinking to EnlargeWheat and rice half as tall as their normal counterparts helped to thwart famine all over In-dia and southeast Asia in the 1960s. Rather than using energy for height, the stunted cropsput it toward making grain instead, quadrupling production in some cases. Investigators havenow identified a genetic mutation that can keep corn and sorghum from growing tall, whichcould improve food yields globally. Researchers at Purdue University found that the muta-tion shuts down production of a sugary protein that controls the flow of auxin, a plant growthhormone. The resulting dwarf crops also have more cells pound for pound in their stalks,making them stronger and perhaps more effective at holding water. Dwarf sorghum couldplay a key role in Africa, where it is often a staple. Other crops that usually grow tall, suchas basmati rice in India and teff, which is cultivated primarily in Ethiopia, may also benefit.The scientists discuss their findings in the October 3 Science. —Charles Choi

The U.S. Agency for HealthcareResearch and Quality established a

set of 20 patient safety indicatorsto assess the quality of care in

hospitals. A study of 18 indicatorsfound that among the most common

are, in order: obstetric traumaduring vaginal delivery (when

instruments are used), bedsores(decubitus ulcers), sepsis, and

embolisms or thrombosis.

Number of extra postoperativedays in hospital:

Obstetric trauma: 0.07Bedsores: 3.98

Sepsis: 10.89Embolism/thrombosis: 5.36

Excess cost:Obstetric trauma: $220

Bedsores: $10,845Sepsis: $57,727

Embolism/thrombosis: $21,709

Annual totals:Extra hospital days: 2.4 million

Excess charges: $9.3 billionAttributable deaths: 32,600

S O U R C E : J o u r n a l o f t h e A m e r i c a n M e d i c a lA s s o c i a t i o n , O c t o b e r 8 , 2 0 0 3 . A n n u a l

t o t a l s a r e b a s e d o n 1 8 o f 2 0 p a t i e n ts a f e t y i n d i c a t o r s .

DATA POINTS:HOSPITAL PAINS

E V O L U T I O N

Scarred GenesThe Galápagos archipelago’s largestpopulation of giant tortoises, which in-habits the slopes of Alcedo volcano, maydescend from a few lucky forebears thatmanaged to dodge hot rock. Researchersbegan to suspect an ancient disaster whenthey discovered that the Alcedo popula-tion is significantly less genetically diversethan four other tortoise populations onthe same island. The only known histor-ical event unique to the Alcedo tortoisesis the violent eruption of their home vol-cano about 100,000 years ago, whichburied much of their prime habitat in sev-eral meters of pumice. The team, led byLuciano B. Beheregaray of MacquarieUniversity in Sydney, concluded that thiseruption killed off all but a few progeni-tors when the group’s analyses revealedthat the genetic bottleneck occurredaround 88,000 years ago. The report ap-pears in the October 3 Science.

—Sarah SimpsonFALL COLOR may be a warning sign to insects.

VOLCANIC descendants.



TOM

TSC

HID

A N

ASA

Dry

den

Fli

gh

t R

esea

rch

Cen

ter

(top

); N

ASA/

JET

PR

OP

ULS

ION

LAB

OR

ATO

RY

(bot

tom

)

newsSCAN

A E R O N A U T I C S

Fly by LightScience-fiction buffs know that laser powermight propel spacecraft between the stars,but the concept has earthly applications, too.Lightweight airplanes or balloons poweredby ground-based lasers could serve as cheapcommunications or surveillance satellites oras unobtrusive probes of the upper atmo-sphere. Last year a Japanese group propelleda tiny aluminum plane by heating a smalldrop of water on its surface with a laser. Thispast October, NASA researchers reported fly-ing the first completely laser-powered air-craft—an 11-ounce, five-foot-wide assem-blage of balsa wood, carbon-fiber tubing andMylar film. The radio-controlled plane cir-cled indoors at a breezy eight miles per houras long as an infrared laser remained trainedon its photovoltaic cells, the power source forthe propeller. The group is thinking abouthow to scale up to a larger aircraft or sta-tionary balloon, says team member RobertV. Burdine of the Marshall Space Flight Cen-ter in Huntsville, Ala. —JR Minkel

■ The U.S. Navy has agreed torestrict the use of its newestsonar after a report connecting it to the formation of gas bubblesin beaked whales. The sonar may have scared the animalsinto surfacing too quickly,creating decompressionsickness, or even triggeredbubble formation directly.

Nature, October 9, 2003

■ Fear factor: Unlearning anxietymay be more effective if thefeared stimulus is delivered inconcentrated bursts, rather thanpaced out over time.

Journal of Experimental Psychology:Animal Behavior Processes, October 2003

■ Protein sequences of the SARSvirus indicate that the virus hasshuffled its genes around,suggesting the pathogen evolvesrapidly and unpredictably.

Infection, Genetics and Evolution,September 2003

■ Lipoprotein molecules—familiarfrom doctor visits as HDL andLDL cholesterol readings—mayexert beneficial effectsdepending on their size. Peoplewho produce bigger lipoproteinmolecules (either HDL or LDL)have greater odds of a long,healthy life.

Journal of the American MedicalAssociation, October 15, 2003

BRIEFPOINTS

E L E C T R O N I C S

A Tunnel for Better WirelessBy governing the flow of current under an ap-plied voltage, diodes form the backbone of themodern electronics world. A diode with an es-pecially useful property is the tunnel diode, inwhich electrons quantum-mechanically “tun-nel” through a layer of material; as a result, thecurrent through the diode rises, drops, then ris-es again as the voltage increases. Such complexbehavior of tunnel diodes can take over thefunctions of some circuits and thereby simpli-fy the construction of computer chips. But re-searchers have struggled to make them fromsilicon to marry them with today’s equipment.

Now a group led by Ohio State Universi-

ty researchers has built a silicon tunnel diodethat generates strong currents at low voltage—

perfect for longer-lasting cell phones andwireless-capable medical devices such as pace-makers. The diode contains thin layers of sil-icon and silicon-germanium, through whichelectrons tunnel, sandwiched between a lay-er heavily doped with boron and anotherdoped with phosphorus. By carefully control-ling the growth temperature, the researcherscan thin the layers to allow more tunnelingwithout muddying the diode’s properties. Theresults are in the October 20 Applied PhysicsLetters. —JR Minkel

A S T R O N O M Y

The Methane SeasTitan, the largest of Saturn’s moons and pos-sessor of the only nitrogen-rich atmosphere inthe solar system apart from Earth’s, keeps itssurface obscured below a thick orange haze.Radar observations using Earth-based radiotelescopes have pierced those clouds and sug-gest the presence of lakes composed of liquidhydrocarbons. Researchers found sharp spikesin the radar echoes, indicating smooth, dark re-flecting areas on Titan, most likely liquid. Whatwould be liquid on Titan, where surface tem-peratures are –180 degrees Celsius? Previousanalyses of Titan’s atmosphere have revealedthe presence of methane and other hydrocar-bons; these compounds could rain down on thesurface (believed to be made of frozen water)and form lakes of liquid methane and ethane.The research was posted online in the October2 Science Express. —Chris Jozefowicz

SHROUDED TITAN, Saturn’s largest moon, may have hydrocarbon lakes.

LIGHT FLIER stays aloft by laser.


About half the prescriptions filled in the U.S. last yearwere for generic drugs. As the nation’s health care costssoar ever skyward, the competition from low-pricedgenerics adds essential ballast. But will the makers ofgenerics be able to offer cut-price knockoffs of therapiesthat are the fruit of biotechnology? The Food and DrugAdministration and its European counterpart are pon-dering the question now, and a great deal of moneyhinges on their decisions.

The patents on the first lucrative products of bio-technology are at last approaching their expiration

dates. If competing firms arepermitted to manufacture them,“biogeneric” versions of the off-patent medicines could com-mand $5 billion next year, esti-mates the Strategic Research In-stitute, a consultancy in NewYork City. Regulators face atough scientific question, how-ever: How should they judgewhether a biogeneric is equiva-lent to the brand-name therapyfor which it substitutes?

Unlike drugs, which are synthesized using repro-ducible chemical procedures, biotech medicines—or“biologics,” as insiders call them—are fabricated frombacteria, farm animals and other organisms that havea life of their own. Biologics are typically large mole-cules, such as hormones, antibodies or cytokines. Mostare constructed from proteins, which are too compli-cated to make from scratch. To function properly, aprotein must be folded up a certain way and must havesugars and other chemicals added to particular spots onthe macromolecule.

Biotechnology companies spend years figuring outthe right combination of mutant host organism and re-actor conditions to fashion a protein therapy that is safeand effective. It’s closer to brewing than to chemistry.

As much as they would like to, biotech firms cannotcomprehend and control all the factors that influencethe purity and function of the macromolecules thatcome out of their bioreactors. The best they can do is tofind a manufacturing process that works—as provedthrough a series of expensive, time-consuming clinicaltrials—and then stick with it.

Generic drugs are cheaper in part because they doan end-run around those trials. Laboratory analysis canprove that the knockoff is chemically identical to thename-brand drug. So a single, abbreviated test in theclinic is usually enough to show that a generic pill per-forms in patients as well as the original does.

Even the manufacturers of generics agree that thehurdle must be set higher for biologics, because smalldifferences in protein concoctions can have enormousconsequences in the body. Ortho Biotech, for example,recently changed one of the chemicals added to its ery-thropoietin alpha medicine as a stabilizer. The newchemical interacted with the protein to cause an im-mune reaction in some patients. Rather than alleviatingthe anemia in these 250 or so people, the “improved”therapy greatly worsened their conditions.

Only a very large trial would have detected the prob-lem with Ortho’s revised formulation, because it affectsonly a small fraction of patients. The dilemma that reg-ulators face is whether to require generics firms to con-duct such large, lengthy and expensive trials—thus ef-fectively raising the price of biogenerics—or whether tomake informed guesses about whether subtle differ-ences in the generic version will harm patients. It’s atough call, but an important one. Some 40 percent ofthe medicines now in final-stage clinical trials originat-ed in biotech labs. If there is no place for generics tocompete with these future medicines, how many peoplewill be able to afford them?


JEN

NIF

ER

KAN

E

Staking Claims

Can Cells Be Generic?As patents expire on its products, the biotechnology industry braces for impact By W. WAYT GIBBS

Please let us know about interesting and unusualpatents. Send suggestions to: [email protected]


After being poked, scanned, drugged and radiated, your doc tellsyou nothing more can be done to cure what ails you. Why nottry an alternative healing modality? What’s the harm?

I started thinking about this question in 1991, when mynormally intelligent mother presented to a psychiatrist symp-toms of cognitive confusion, emotional instability and memo-ry loss. Within an hour it was determined that she was de-pressed. I didn’t buy it. My mom was acting strangely, not de-pressed. I requested a second opinion from a neurologist.

A CT scan revealed an orange-size meningioma tumor. Af-ter its removal, my mom wasback to her bright and cheeryself—such a remarkably recu-perative and pliable organ isthe brain. Unfortunately, with-in a year my mom had twonew tumors in her brain.Three more rounds of this cy-cle of surgical removal and tu-mor return, plus two doses of

gamma knife radiation (pinpoint-accurate beams that destroycancer cells), finally led to the dreaded prognosis: there wasnothing more to be done.

What is a skeptic to do? An ideological commitment to sci-ence is one thing, but this was my mom! I turned to the literature,and with the help of our brilliant and humane oncologist, AvrumBluming, determined that my mom should try an experimentaltreatment, mifepristone, a synthetic antiprogestin better knownas RU-486, the “morning after” contraception drug. A small-sample study suggested that it might retard the growth of tumors.It didn’t work for my mom. She was dying. There was nothingto lose in trying alternative cancer treatments, right? Wrong.

The choice is not between scientific medicine that doesn’twork and alternative medicine that might work. Instead there isonly scientific medicine that has been tested and everything else(“alternative” or “complementary” medicine) that has not beentested. A few reliable authorities test and review the evidence forsome of the claims—notably Stephen Barrett’s Quackwatch(www.quackwatch.org), William Jarvis’s National Council

against Health Fraud (www.ncahf.org), and Wallace Sampson’sjournal The Scientific Review of Alternative Medicine.

Most alternatives, however, slip under the scientific peer-review radar. This is why it is alarming that, according to theAmerican Medical Association, the number of visits to alterna-tive practitioners exceeds visits to traditional medical doctors;the amount of money spent on herbal medicines and nutritiontherapy accounts for more than half of all out-of-pocket ex-penses to physicians; and, most disturbingly, 60 percent of pa-tients who undergo alternative treatments do not report that in-formation to their physician—a serious, and even potentially fa-tal, problem if herbs and medicines are inappropriately mixed.

For example, the September 17 issue of the Journal of theAmerican Medical Association reported the results of a study onSt. John’s wort. The herb, derived from a blooming Hypericumperforatum plant and hugely popular as an alternative elixir (tothe tune of millions of dollars annually), can significantly impairthe effectiveness of dozens of medications, including those usedto treat high blood pressure, cardiac arrhythmias, high choles-terol, cancer, pain and depression. The study’s authors showthat St. John’s wort affects the liver enzyme cytochrome P4503A4, essential to metabolizing at least half of all prescriptiondrugs, thereby speeding up the breakdown process and short-changing patients of their lifesaving medications.

But there is a deeper problem with the use of alternativeswhose benefits have not been proved. All of us are limited to afew score years in which to enjoy meaningful life and love. Timeis precious and fleeting. Given the choice of spending the nextcouple months schlepping my mother around the country on awild goose chase versus spending the time together, my dad andI decided on the latter. She died a few months later, on Septem-ber 2, 2000, three years ago to the day I penned this column.

Medicine is miraculous, but in the end, life ultimately turnson the love of the people who matter most. It is for those rela-tionships, especially, that we should apply the ancient medicalprinciple Primum non nocere—first, do no harm.

Michael Shermer is publisher of Skeptic (www.skeptic.com)and author of How We Believe and In Darwin’s Shadow.


BR

AD H

INE

S

What’s the Harm?Alternative medicine is not everything to gain and nothing to lose By MICHAEL SHERMER

Skeptic

There is onlyscientific medicine

that has beentested andalternative

medicine that hasnot been tested.


An unseen “forest” of microscopic beings fills the upper200 meters of ocean, exerting an influence on this plan-et every bit as profound as the forests on land. The di-verse phytoplankton species inhabiting the ocean’s sur-face waters—which mainly consist of single-celled cya-nobacteria, diatoms and other kinds of algae—form thebase of the marine food web. They account for rough-ly half the photosynthesis on the earth, remove nearly

as much carbon dioxide from the atmosphere as all landplants, and supply about half the oxygen we breathe.Without the activities of these free-floating plantlike or-ganisms, atmospheric carbon dioxide levels would triple.

That phytoplankton could accomplish so much withso little recognition from the general public is surprising[see “The Ocean’s Invisible Forest,” by Paul Falkowski;Scientific American, August 2002]. Even more re-markable, scientists had no idea which microbial speciesperformed the bulk of these vital functions until 15 yearsago, when Sallie W. Chisholm of the Massachusetts In-stitute of Technology, Robert J. Olson of the Woods HoleOceanographic Institution and other collaborators dis-covered marine cyanobacteria from the genus they lat-er named Prochlorococcus. They are the smallest andmost numerous photosynthetic organisms known andarguably the most plentiful species on the earth, re-sponsible at times for more than half the photosynthe-sis in the seas. Cyanobacteria such as Prochlorococcuswere the planet’s first oxygen-producing creatures andare, in a broad sense, the ancestors of all higher plants.

Chisholm and Olson made their discovery by sam-pling ocean water with a flow cytometer—an instru-ment common in life sciences laboratories but one thathad never been taken to sea before. The device helps tocharacterize single cells as they move past a laser beam.By measuring the scattering of laser light by seawater,the researchers saw hints of tiny cells. After isolating andculturing these cells, Chisholm’s team named them Pro-chlorococcus, believing they were related to cyanobac-teria called prochlorophytes—a supposition that laterproved incorrect. Next, the team documented the abun-dance of Prochlorococcus. The microbe’s dominance ofthe seas shocked the oceanography community. “It’shard to believe we’d overlooked something so impor-tant for so long,” says Richard T. Barber of the DukeUniversity Marine Laboratory. Chisholm considers thediscovery “a lesson in humility, showing just how littlewe know about nature.” This past April she was elect-


CR

ED

IT

Insights

The Cells That Rule the SeasThe ocean’s tiniest inhabitants, notes biological oceanographer Sallie W. Chisholm, hold the keyto understanding the biosphere—and what happens when humans disturb it By STEVE NADIS

PH

OTO

GR

APH

BY

KAT

HLE

EN

DO

OH

ER

, W

OO

DS

HO

LE,

MAS

S.

■ Discovered Prochlorococcus in 1988. The microbe’s minute size enables itto capture sunlight efficiently (there is less self-shading).

■ Prochlorococcus is responsible for roughly half the photosynthesis in theoceans. A drop of seawater contains up to 20,000 cells.

■ On promoting phytoplankton growth with iron: “Even if you fertilized theentire ocean, it wouldn’t make much of a dent on global warming—at bestpostponing the inevitable by about five years.”

SALLIE (“PENNY”) CHISHOLM: SEEING SMALL



CLA

IRE

TIN

G

ed to the National Academy of Sciences, largely for her role inthe discovery and subsequent investigation of Prochlorococcus.

Despite its size—just 0.5 to 0.7 micron wide—Prochloro-coccus has a major impact on climate because of its sheer abun-dance, up to 20,000 cells per drop of seawater. That’s not near-ly as dense as soil microbes, which may reach concentrationsmore than 1,000 times as high. But among photosynthesizers, tinyProchlorococcus is huge. “People had assumed that much biggerorganisms were fixing carbon,” notes Scripps oceanographerFarooq Azam. “Penny’s work has focused attention on the roleof the small.” (Chisholm is known as Penny to friends and col-leagues—a childhood nickname that sheadopted to avoid confusion with her moth-er and grandmother, both also named Sallie.)

Although the 56-year-old Chisholm hasindeed kept her gaze on the smallest marinecreatures, her career might easily have tak-en a different turn. In college chemistry ex-periments more than 30 years ago, she mea-sured manganese concentrations in an up-state New York lake. Every water sampleshe inspected was filled with specks of phy-toplankton. She became fascinated withthese organisms and soon jettisoned plans forgraduate study in chemistry.

Instead Chisholm has made Prochloro-coccus her chief research interest, guided bythe conviction that “this organism could opendoors for us. The reason to study it is its global importance. What-ever we learn, the multiplier is enormous.” Chisholm and hercolleagues have identified about 35 Prochlorococcus species andstrains and have categorized two general classes that inhabit dif-ferent subsurface layers, adapted to high and low light conditions.The team has subdivided the genus into six additional categories,based on an analysis of the ribosomal RNA gene. But Chisholmhopes to go much further and obtain complete genomes for allknown species so that more thorough comparisons can be made.

This past August researchers unveiled complete genomes forthree Prochlorococcus strains plus a strain of Synechococcus, aclose relative. Chisholm participated in the analysis of twostrains, one having the smallest genome—1.7 million base pairsand 1,700 genes—of any known oxygen-producing photosyn-thesizer. By seeing which genes a strain possesses—such as a geneto utilize nitrate, nitrite or cyanate—scientists can learn whichnutrients are significant and what parameters govern an organ-ism’s abundance. This approach can reveal environmental fac-tors that have not been appreciated before.

Her ultimate goal is to determine the biosphere’s vital com-ponents: “What regulates them, how much we have to preservefor them to function properly, and what pushes them beyondtheir limits,” Chisholm states. That knowledge can only comeby studying the system as a whole and piece by piece. Until we

understand how the biosphere works, she adds, we can’t gaugethe extent to which human activities disturb its functions.

What would happen, for instance, if we tried to offset glob-al warming by pouring large quantities of iron into the oceans?The idea, sometimes called the “Geritol” solution, is to add themineral to iron-poor ocean regions, thereby stimulating phyto-plankton growth. The proliferating organisms would then re-move carbon dioxide from the air. Although Chisholm has crit-icized this concept since it was advanced in the late 1980s, shehas participated in experiments to test the hypothesis, startingin 1993 with the IRONEX experiment in the eastern equatori-

al Pacific. On a small scale, iron fertilizationcan be a powerful research tool, Chisholmmaintains.

Yet she is equally convinced that large-scale fertilization would be a mistake. “Howcan we manipulate this system when wedon’t know what’s in it?” she asks. “Theoceans are performing all kinds of functionswe don’t understand.” If the approachworks at all—still an open question—it willinevitably alter the food web, promoting thegrowth of larger cells such as diatoms at theexpense of smaller ones such as Prochloro-coccus, with unknown effects ripplingthrough the trophic levels.

By no means an activist, Chisholm rarelyjoins causes or signs petitions, but on this is-

sue she feels obliged to speak out. “I didn’t spend my life study-ing how aquatic ecosystems work only to have this fundamen-tal knowledge ignored,” she says.

Most ocean scientists agree with Chisholm about iron fer-tilization. Nevertheless, she observes, “this idea just won’t goaway.” Every year she hears of a different patent filed, a newcommercial venture or some other fertilization scheme. Part ofthe problem is the profit motive, but Chisholm also holds sci-entists responsible. Although it is essential to clarify iron’s roleas a limiting nutrient, she says, this research is commonly justi-fied by tying it to ocean fertilization. “Somehow we must evolveto the point where people accept the importance of studyinghow the biosphere works—what regulates the flow of energyand cycling of elements—in its own right.”

Chisholm is similarly irritated by claims that Prochlorococ-cus can be genetically engineered to draw down more carbon,thereby making it “useful” to humans. “These guys are alreadyuseful to humans,” she says of her favorite cells. “They’re outthere doing their job in planetary maintenance, helping to reg-ulate the biogeochemical cycles of the biosphere.” The job forChisholm and other humans is to figure out precisely what theseorganisms do and how they do it.

Steve Nadis is based in Cambridge, Mass.

PROLIFIC Prochlorococcus might be themost abundant species on the planet.


w w w . s c i a m . c o m 55

A MICROSCOPE THAT CAN SEE objects smaller than an atom. The first field test of a fleet of electric vehicles powered by fuel cells. A tariff

to limit vehicular traffic in central London. These are but a few of the path-

breaking developments that have taken place in recent months in laborato-

ries, corporate suites and the halls of government. For the second year, the

SCIENTIFIC AMERICAN 50 recognizes the singular accomplishments of

those who have contributed to the advancement of technology in the realms

of science, engineering, commerce and public policy. This year’s selections

by the Board of Editors pay tribute to individuals, teams and companies that

have stood out in a wide variety of technological disciplines. It also honors

Leaders of the Year for achievements in research, business and policy. Their

work again demonstrates the ingenuity and resourcefulness that generate the

ever more sophisticated tools and solutions for meeting society’s needs.

AEROSPACE

AGRICULTURE

AUTOMOTIVE

CHEMICALS & MATERIALS

COMMUNICATIONS

COMPUTING

DEFENSE

ECONOMIC DEVELOPMENT

ENERGY

ENVIRONMENT

IMAGING

MANUFACTURING

MEDICAL PHYSIOLOGY

MEDICAL TREATMENT

NANOTECHNOLOGY & MOLECULARELECTRONICS

PRIVACY & SECURITY

PUBLIC HEALTH & EPIDEMIOLOGY

ROBOTICS

TOM

DR

APE

R D

ESI

GN


R E S E A R C H L E A D E Rof the year


PH

OTO

GR

APH

S C

OU

RTE

SY O

F TH

E R

OC

KE

FELL

ER

UN

IVE

RSI

TY

RODERICK MACKINNON Professor of molecular neurobiology and biophysics, Rockefeller University; investigator, Howard Hughes Medical Institute

Elucidated the structure and function of ion channels, particularly the potassium ion channel.

THAT ELECTRICITY MIGHT ANIMATEmere flesh goes all the way back to Franken-stein, yet the mechanisms remained vague un-til Roderick MacKinnon, a physician, workedout the structure of the potassium channel.Then, this past spring, he deduced the mech-anism by which a potassium channel senseselectricity—its voltmeter, as it were. Theseachievements won him the 2003 Nobel chem-istry prize.

When a channel for any one of three inorgan-ic ions—calcium, sodium or potassium—sens-es a voltage, it opens to allow ions in or out,changing the concentration and thus effectinga behavior, such as neural discharge, muscu-lar contraction or hormone secretion. Wecould neither think nor move nor survive formany minutes without these channels, andMacKinnon’s explanation of them shouldguide the development of drugs for neuro-muscular and other disorders, such as cystic fi-brosis and cardiac arrhythmias. Drug companies should show particular interest in the im-plications for arrhythmia, a common pharmaceutical side effect in numerous patients that hascost them billions in failed clinical trials.

The challenge here, as in the earlier research, lay in forming a crystal of the pore proteins thatwas good enough to diffract x-rays into patterns a computer could render into images. Thetask is hard because the proteins are very large and mixed in oils that must be removed withdetergent, which is itself a problem. Furthermore, the volt-sensing element has moving partsthat are buried deep inside the protein. Interestingly, MacKinnon studied the voltmeter in anArchaebacterium taken from a superhot ocean vent. That an organism so far removed in evo-lutionary history from us should have such similar channels indicates that the structures werehighly resistant to mutation over eons and thus critical to survival.

Molecular snapshot reveals the working parts of the voltage-regulated potassium ion channel.


JOR

GE

CAS

AL U

niv

ersi

ty o

f B

uen

os A

ires

(to

p);

AR

GO

NN

E N

ATIO

NAL

LAB

OR

ATO

RY

(bot

tom

)

Other Research Leaders

LARRY CORNMAN and ROBERT SHARMAN

JOANNE CHORY

KHALIL AMINE

Cornman, project scientist, and Sharman, project scientist, research applications program, National Center for Atmospheric Research, Boulder, Colo.

Discovered an algorithm that allows aircraft radar to better detect turbulence.

THE DOPPLER RADAR carried by commercial airplanes can pick up the strong winds close to thecenter of thunderstorms, where swirling water droplets are abundant and easy to detect. Buildinga clear picture of turbulence is a much more difficult problem, especially toward the edges of a storm.But with funding from NASA, physicist Larry Cornman and meteorologist Robert Sharman devisedan algorithm to give radar the ability to detect turbulence accurately, even at a storm’s fringes. Af-ter the first successful flight test of the algorithm in November 2002, Cornman began to work withthe Federal Aviation Administration to figure out how to test and certify the improved radar in com-mercial systems.

Professor of plant molecular and cellular biology, Salk Institute for BiologicalStudies, San Diego; investigator, Howard Hughes Medical Institute

Pinpointed a gene that may allow shaded plants to grow more productively.

WHEN PLANTS GROW in the shade, they engage in the shade-avoid-ance response. First they grow longer stems (and therefore fewer leaves)in an effort to get out of the shade. If that fails, they produce flowers andseeds prematurely—a last-ditch effort to ensure survival of some offspring.In late 2002 Joanne Chory and a colleague identified a gene, pft1, that reg-ulates this response. The results potentially have great significance. In agri-culture, high density of plantings probably triggers shade avoidance tosome degree in all the plants in a field, affecting how they grow and whatproportions of stem, leaves and seed are produced. With an understand-ing of pft1’s role, it may be possible to develop plants that, even undershady conditions, still flower and seed late—increasing crop yield.

Group leader, Battery Technology Development, Argonne National Laboratory, Argonne, Ill.

Made superior lithium-based batteries for hybrid vehicles and medical devices.

Aerospace

BORN IN MOROCCO and trained inFrance, Khalil Amine last year led a teamof Argonne materials scientists that madenotable achievements in the design of lithi-um batteries. To make batteries suitable forhybrid gasoline-electric vehicles, which re-quire high peak power, they refined a lithi-um-manganese chemistry that is inherent-ly safer than the alternative process, basedon lithium and cobalt. The manganesecrystal is also expected to last longer, avoid-ing the need for an expensive battery change

during the life of the car. The researchersalso improved a design based on lithium,iron and phosphate for implantable medicaldevices, where the sticking point is energystorage rather than peak power. Today’simplantable batteries last only about threeyears, but Argonne’s version is expected tolast 10 years—long enough to make it prac-tical for so-called microstimulators, whichare being investigated as a treatment forParkinson’s disease and other disabilities ofthe central and peripheral nervous systems.

Agriculture

Automotive

Battery forimplantable devicesshould last 10 years.


Shade-avoidingplant (right)

grows a longerstem and fewerleaves than its

ordinary neighbor(above).



THO

MAS

SZY

PE

RSK

I (t

op);

CO

UR

TESY

OF

UN

IVE

RSI

TY O

F C

ALIF

OR

NIA

, B

ER

KE

LEY

(bot

tom

)


LAST YEAR David Culler and his colleagues beganfield-testing sensors that interconnect wirelessly inad hoc networks that can describe their environmentto a base station. Though dubbed “motes” by theDefense Advanced Research Projects Agency(DARPA), the sensors today are each still closer insize to a quarter than to a mote, and they cost sev-eral hundred dollars rather than small change. While

reducing their size and cost,Culler and his group are tryingout sample networks for track-ing local stresses on the GoldenGate Bridge, the microenviron-ment in a redwood grove, thenesting areas of shorebirds andthe rescue operations of fire-fighters. Because the informationcomes from many points, it canconvey the dynamics of situa-tions to firefighters who want,say, to determine whether aburning building is near col-lapse. And because the networkis (or will be) cheap, it can be dis-tributed through potential earth-quake zones and battlefields,

where the sensors can be consulted from a distanceshould the need arise.

COMPUTERS WILL always crash. For theaverage user, rebooting is a mere nuisance,but a network server crash can cost largebusinesses thousands of dollars. ArmandoFox is a leader of a growing trend in the de-sign of computer networks: the creation ofsystems designed to cope with inevitable fail-ure. Fox and his team have developed a tech-nique called micro-rebooting that allows thediverse software modules running on a com-puter at any given time to be restarted inde-pendently when a glitch is encountered.Thus, the entire suite of programs does nothave to be shut down and restarted fromscratch. Last year micro-rebooting wasdemonstrated successfully in a satelliteground station, the type of facility that oftenencounters failures [see “Self-RepairingComputers,” by Armando Fox and DavidPatterson; Scientific American, June].

Mini sensors can track light, temperature and humidity in a redwood grove.

Chemicals and Materials

Computing

THOMAS SZYPERSKI

ARMANDO FOX

Associate professor of chemistry and biochemistry, State University of New York, Buffalo

Adapted nuclear magnetic resonance techniques to map a protein’satomic structure in hours, not days.

NUCLEAR MAGNETIC RESONANCE (NMR) is a laboratorytechnique that uses magnetic fields and radio-frequency pulses toidentify and locate the atoms in molecules. As a way to analyze pro-teins, NMR has always taken a backseat to x-ray crystallographyand other methods because it is slow: picking out the connectionsbetween individual atoms in a large protein involves going throughthe results from thousands of radio-frequency spectra, which cantake up to a week. But in January, Thomas Szyperski published apaper in the Journal of the American Chemical Society describingG-matrix Fourier Transform NMR, a new method to collect data

gleaned from radio-frequency pulses. Theprocess reduced the time for protein map-ping from days to just hours. Szyperski is theinventor of this technique, which improvesthe way NMR data are analyzed.

Assistant professor of computer science, Stanford University

Showed how software could protect networksfrom disastrous crashes in individual servers.

Communications

DAVID E. CULLER Professor of computer science, University of California, Berkeley; former director of the Berkeley laboratory of Intel Research

Field-tested networks of sensors for military andenvironmental applications.

Quick pictures ofprotein structuresemerge withstreamlined NMR.



CO

UR

TESY

OF

Z-M

ED

ICA

(top

); S

AND

Y H

ILL

APP

hot

o (b

otto

m)

THE GREEN REVOLUTION—the steadyincrease in crop yields that started in the1960s—is starting to bump up against lim-itations of land use, water supply, pest con-trol and existing plant genetic variety. Bio-technology may be able to help, but so farit has pretty much passed the developingworld by. Few have done more to changethat than Richard Jefferson. Having madehis name in the 1980s by creating a tech-nique for probing protein synthesis, he hasdedicated himself to ensuring that scientistsand farmers in developing countries sharethe benefits. In 1991 he established CAM-BIA, a nonprofit research institute whosemission is to make often proprietary tech-nology more widely available. For example,CAMBIA is now putting together a do-it-yourself kit that lets start-up companies tin-ker with genes without having to confrontbattalions of intellectual-property lawyers.

Defense

RICHARD JEFFERSON

Environment

President, Z-Medica, Newington, Conn.

Developed a mineral sponge that stops blood loss on the battlefield and on the playground.

BADLY WOUNDED soldiers (like accident victims everywhere) are often at risk of bleed-ing to death before they can be treated, which is why blood loss is the primary cause ofmortality from severe bleeding injuries. Frank Hursey’s invention might change that.QuikClot is an inert granular substance that, when poured on a wound, concentrates theclotting factors in the outflowing blood and thereby speeds coagulation. Last year’s ap-proval of QuikClot by the U.S. Food andDrug Administration means a home ver-sion of the technology should be released in2004. Hursey, a scientist who works on ad-vanced oxygen-generating systems, discov-ered the properties of the QuikClot mater-ial by serendipity. Many years ago he cuthimself while shaving. On a whim, heturned to an adsorptive agent that he hadbeen developing for one of his researchprojects and applied it to his face. Thebleeding stopped immediately.

IF THE MUCH HERALDED hydrogen economyis ever to arrive, a cheap way to make hydrogenmust be discovered. James Dumesic has developedcatalytic methods that turn carbohydrates in bio-mass directly into hydrogen. The processes canoperate at low temperature, in the liquid phase,saving a lot of energy compared with other ap-proaches being researched. Last year Dumesic andhis colleagues showed how the reaction could bemediated with a platinum catalyst; this year theydid it with a far cheaper combination of nickeland tin. The main by-products are water and car-bon dioxide. Although carbon dioxide is a green-house gas, the biomass grown for the next cycleof energy harvesting would absorb it all, so no netgreenhouse gas would be produced.

Energy

Professor of chemistry, University ofWisconsin–Madison

Pioneered economical catalysts for turningbiomass into hydrogen fuel.

JAMES A. DUMESIC

Chair, Center for the Application ofMolecular Biology to InternationalAgriculture, Canberra, Australia

Helps innovators in the Third Worlddevelop biotechnologies.

FOR YEARS, Daniel Pauly has been carefully doc-umenting the devastating effects of overfishing,particularly on large predator species such as cod, snapper and tuna [see “Count-ing the Last Fish,” by Daniel Pauly and Reg Watson; Scientific American, July].This year Pauly attempted to spread the alarm to the general public with his bookIn a Perfect Ocean (Island Press). An iconoclastic and erudite researcher, he ar-gues that governments must abolish subsidies to fishing fleets and establish marinereserves to allow fisheries to recover. (Present marine reserves cover less than halfof 1 percent of the total sea area.) Pauly spent much of his early career developingnew methods for estimating fish populations. One of his latest projects is FishBase,an online database with information on more than 28,000 fish species.

DANIEL PAULY Fisheries scientist, University of British Columbia

Advances the case for setting up marinereserves so that fisheries can make a comeback.

FRANK X. HURSEY

Granules stem bleedingwhen poured on a wound.

Marine reserves might combat overfishing.

Economic Development



IBM

RE

SEAR

CH

(to

p);

CO

UR

TESY

OF

RE

YA A

ND

DU

NC

AN D

uke

Un

iver

sity

(b

otto

m)


Addition of Wnt to blood-forming stem cellsprompts proliferation(bottom).

IN AN ADVANCE that couldbenefit cancer patients, RoelNusse and his colleagues an-nounced last April that theyhad purified a powerful factor

that prompts blood-forming stem cells to proliferate. Themolecule, named Wnt, had eluded purification for years be-cause it has a fatty “tag” that makes it stick to test tubes.Scientists are now evaluating Wnt’s ability to restore bloodcells that are destroyed during chemotherapy for cancer.Physicians might one day remove a sample of a patient’sbone marrow, where stem cells for the blood system reside,expose them to Wnt in the laboratory to cause them to di-vide, and return the expanded population of cells to the pa-tient as a treatment.

HIV, THE VIRUS that causes AIDS, must bind to several re-ceptor molecules to infect cells. One such receptor is calledCCR5. People who have naturally occurring mutations in thereceptor show some degree of resistance to HIV infection.Bahige Baroudy and Chris Hitchcock led teams at their respec-tive pharmaceutical companies to formulate small-moleculedrugs that can block CCR5, preventing HIV from entering cellsand thereby halting its ability to reproduce and spread. Bothcompanies’ compounds entered clinical trials in human patientsin the past year. Preliminary results suggest that the potentialdrugs have few side effects and are well tolerated by patients.

OPTICAL TWEEZERS, which use light to move semitransparent objects, date back to the mid-1980s. But arrays of tweezers, created by using holograms to separate light from a single laser intomultiple beams, have recently shown promise as powerful tools for use in microscopic and nano-scopic machines. David Grier, a professor at the University of Chicago before moving this month,reported this past spring that holographic optical tweezers could twist light to spin vortices in a flu-id. Such vortices can function as microscopic pumps: beads spun by the vortices can propel fluids

around the microscopic channels of devices that may eventu-ally be used in pharmaceutical manufacturing. One day theymight even spin the gears on micromachines. Grier’s work wasthe inspiration for Arryx, a company that has begun to com-mercialize holographic optical tweezer technology.

Medical Physiology

Imaging

PHILIP E. BATSON

DAVID GRIER

Researcher, department of physical sciences, IBM Thomas J. Watson Research Center, Yorktown Heights, N.Y.

Demonstrated an electron microscope that can see objects smaller than an atom.

Manufacturing

Professor of physics, New York University

Built arrays of optical tweezers that may eventually power micromachines.

Professor of developmentalbiology, Stanford University Schoolof Medicine; investigator, Howard Hughes Medical Institute

Purified a molecule that mayrestore blood cells destroyedthrough chemotherapy.

ROEL NUSSE

Medical Treatment

ASTRONOMERS MEASURE instabilities in the atmosphere and in the telescope itself, then usecomputers to manipulate the lenses, correcting for the distortions. Such “adaptive optics” have nowbeen applied to a complex set of 40-odd magnetic corrective lenses in an electron microscope, al-lowing researchers to resolve features smaller than an angstrom, about the diameter of a hydrogenatom. Philip Batson, along with non-IBM scientists Ondrej Krivanek and Niklas Dellby, reportedin the August 8, 2002, Nature, that the instrument leads to a qualitatively new understanding ofthe atomic-level behavior of nanometer-scale objects. These improvements in electron microscopywill allow routine observation of single-atom behavior within a bulk material.

Correcting distortions(top) improves

atomic-level imaging.

Baroudy, director, department of antiviral therapy, Schering-PloughResearch Institute, Kenilworth, N.J., and Hitchcock, senior director of exploratory development, Pfizer Global Research and Development, Sandwich, England

Created drugs that blocked a receptor to prevent HIV from entering cells.

BAHIGE M. BAROUDY and CHRIS HITCHCOCK



SLIM

FIL

MS

(top

); R

OB

ER

TO O

STI

(bot

tom

)

Grids of nanowiresmay form circuits infuture computers.

CHARLES LIEBER’S laboratory is responsible this year for several key innovations in nanotech-nology, the controlled manipulation of matter at the atomic or molecular scale. He and his colleagueshave achieved better control over nanowire growth, gaining the ability to build wires of differinglengths and thicknesses. In addition, the laboratory has made nano “on/off” switches that might beuseful for digital memory storage. With such electronic controls, nanowire lasers could potentiallybe used to transmit information across a silicon chip, to etch microchips or to give laser surgerygreater precision. In January, Lieber published a paper that described how a cadmium-sulfidenanowire could produce laser light from the ends. Last year saw the creation of a nanoscale biosen-sor, in which certain molecules (antigens) present in the bloodstream activate a nanowire transistor.

THE MALARIA PARASITE/MOSQUITO GENOME PROJECTSUnraveled the genetic information of the parasite that causes malaria and of the mosquito that spreads it.

MALARIA CONTINUES to be the most deadlydisease in human history, slaying millions everyyear. Late in 2002 two international researchconsortia announced that they had sequenced theDNA for the malaria parasite Plasmodium andfor the Anopheles mosquito, which transmits theparasite from person to person. The extraordi-nary potential of this achievement should accel-erate the design of a vaccine and of drugs target-ed to these organisms’ genetic vulnerabilities. Itwill also encourge the development of environ-mentally sound methods to control mosquitoes.The sequencing of the Plasmodium genome wasdone by a partnership composed of the Institutefor Genomic Research (TIGR), the U.S. Nation-al Institute of Allergy and Infectious Diseases (NI-

AID), the Wellcome Trust, the Burroughs Well-come Fund, the U.S. Department of Defense, theStanford Genome Center and the WellcomeTrust Sanger Institute. The Anopheles genomewas sequenced by a collaboration made up of theCelera Genomics Group, NIAID, the WorldHealth Organization’s Special Program of Re-search on Tropical Diseases, Germany’sEuropean Molecular Biology Labora-tory, the Institute of Molecular Bi-ology and Biotechnology in Crete,the Pasteur Institute in Paris,TIGR, Genoscope (the French Na-tional Sequencing Center), and theuniversities of Iowa, Rome, NotreDame and Texas A&M.

WE FORGET THINGS we do not need or want;perhaps databases must cull their memories in thesame way to keep sensitive data from falling intothe wrong hands. As a pioneer of data mining—

the art of extracting useful patterns from massesof data—Rakesh Agrawal knew that this technol-ogy could take off only if privacy could be assured.Because the most important data are indeed sensi-

tive—involving purchasing decisions, online search-es, health records and the like—he sought ways tomake misuse impossible once the information hadbeen analyzed into a general trend. Recently hedeveloped software that enables a computer to de-cide what to delete or, in less onerous cases, toquarantine data from all but the most privilegedusers. Another method he has investigated wouldsafeguard one data point among many like it—say, an individual’s age, as entered on a Web siteform—by adding or subtracting a random num-ber to it. The system would then aggregate all thedata points and statistically reconstruct the over-all distribution of ages with reasonable accuracy,while keeping each individual’s age a secret.

CHARLES LIEBER Nanotechnology and Molecular Electronics

Professor of chemistry, Harvard University

Made nanowires, switches, sensors and lasers; fabricated electronic components and devices with features only billionths of a meter across.

Privacy and Security

Fellow, IBM Almaden Research Center, San Jose, Calif.

Devised methods to preserve the privacy ofinformation in large databases.

Public Health and Epidemiology

RAKESH AGRAWAL

Anopheles mosquitotransmits the malariaparasite.



B U S I N E S S L E A D E Rof the year

TOYOTA MOTOR CORPORATIONToyota City, Japan

Commercialized affordable hybrid cars.

WHEREAS MOST OTHER auto-makers have merely talked of com-bining internal-combustion engineswith electric motors, Toyota has ac-tually been selling such a hybrid carfor years. Called the Prius, it cameout first in Japan in the late 1990sand soon after in the U.S. Toyota’s2004 Prius, due out in October, ap-pears to get around the dismal engi-neering trade-offs associated withhybrids by improving performanceand fuel economy over last year’smodel while keeping the price thesame, around $20,000.

Hybrid power plants do away withbig engines and their extravagancewith both fuel and pollution by sub-stituting a small engine, to providesteady power, and an electric motorto assist it during acceleration. The strategy pays off best in stop-and-go city driving (whichthe Environmental Protection Agency test emphasizes strongly), when a big engine goes al-most entirely to waste. Indeed, the Prius actually gets better mileage in the city than on thehighway. Unlike the so-called mild hybrids, the Prius does not use the motor solely as anassist but is capable of cruising around on electricity alone.

The new model has been lengthened just enough to move it into the midsize category, giv-ing it more legroom. It also has better acceleration. Yet according to preliminary estimatesby the EPA, it now gets 59 miles per gallon in the city and 51 miles per gallon on the high-way, up from 52 and 45 mpg, respectively, for the 2003 model. The Prius now goes abouttwice as far on a gallon of gasoline as the average car in the U.S. fleet; if all vehicles didthat well, it would save the U.S. some 1.5 billion barrels of imported oil a year.

Prius, a hybrid vehicle from Toyota, saves fuel and cuts down on pollutionby pairing a small engine with an electric motor.

TOYO

TA P

RO

DU

CT

CO

MM

UN

ICAT

ION

S



CO

UR

TESY

OF

SCAL

ED

CO

MP

OSI

TES

(top

); M

ER

CE

DE

S-B

EN

Z U

SA (

bot

tom

)

Other Business Leaders

Oxygen goes in andmere water comes out of DaimlerChrysler’s fuel bus.

SpaceShipOne, apassenger spacecraft,comes in for a landing.

BURT RUTAN

FERNANDO DE CASTRO REINACH

DAIMLERCHRYSLER

President, Scaled Composites, Mojave, Calif.

Designed a reusable suborbital passenger spacecraft.

BURT RUTAN first gained wide recognition when his twin-engine, polymer-composite Voyager airplane became, in 1986, the first aircraft to travel aroundthe world nonstop. Rutan and his collaborators have completed more than35 truly innovative manned and unmanned aircraft. In April his company,Scaled Composites, unveiled its entry to the X Prize, a privately funded con-test established in 1996 that will award $10 million to the first firm that buildsand flies a reusable suborbital passenger spacecraft. Scaled Composites’s design, called Space-ShipOne, is similar to the U.S. Air Force’s late-1950s X-15, which was launched from an airborneB-52. One of the most innovative qualities of the design forwarded by Rutan is a tail that flips upto brake through the air during reentry. (The company has not released any information regard-ing how much it would cost for someone to take a ride on the completed spacecraft.) Scaled Com-posites is one of the few companies that are taking an active role in privately funded space research.

General partner, Votorantim Ventures, São Paulo, Brazil

Started biotechnology companies that are trying to improve Brazilian crops.

AS A UNIVERSITY professor, Fernando de Castro Reinach has made a name for himself by initi-ating a project that in 2000 sequenced the genome of Xylella fastidiosa, a bacterium that destroysmillions of dollars’ worth of Brazilian citrus every year. That effort put Brazil on the internationalbiotech map and produced a national cadre of highly trained scientists. In 2002 Reinach also tookon the role of general partner at Votorantim Ventures, one of Brazil’s largest venture capital funds.The fund has started up (among others) the companies Alellyx and Canavialis, both with Reinachas temporary CEO. This past spring Alellyx determined that a mutant of the tristeza virus was thecause of $20-million damage to Brazil’s 2002 orange crop. Alellyx is now working on a laboratorytest for detecting the disease and developing a genetically modified orange tree with resistance to themutant strain. Canavialis, meanwhile, is laboring on disease-resistant sugar cane.

Stuttgart, Germany

Pushed fuel-cell cars toward the commercial marketplace.

Aerospace

SINCE THE MID-1990s, DaimlerChrysler has spearheaded a fuel-cell project. Recently the company began the first field test ofa fleet of electric vehicles powered by the technology, whichis essentially hydrolysis in reverse. About 30 such buses weredistributed to a number of European cities this year; cars,based on the Mercedes-Benz A-Class, are to be tested in theU.S. by the end of this year. In fuel cells, ambient oxygen re-acts with hydrogen (stored as compressed gas), producingmere water. They thus achieve the California-mandatedgoal of zero smog and zero greenhouse emissions. The firstcars will serve as package delivery vehicles for UPS andwill tank up at the EPA’s office in Ann Arbor, Mich.

Agriculture

Automotive



CO

UR

TESY

OF

APP

LE (

bot

tom

)


TWO TECHNOLOGIES, the MPEG audio fileformat and decentralized file-sharing software,have made life difficult for the recording industry.Although a few companies launched pay-for-playonline music stores this year, Apple’s iTunes stoodout from the pack for its simplicity and low cost(only 99 cents per song). It also received attentionfor its popularity: by September, more than 10 mil-lion songs had been purchased. Unlike some oth-

er services, it alloweddownloading by thetrack and did not re-quire a subscriptionfee. Originally, iTuneswas open exclusivelyto Macintosh users;the company recentlyunveiled a Windowsversion of the service.Its chances for long-term success are stillunknown, but Applehas at least made astab at a workable ap-proach to online mu-sic distribution.

THERE ARE MANY promising ideas thatthe Internet cannot try out by itself, either be-cause it would bog down in a flood of data orlay itself open to malicious attacks. In June,to provide an independent test bed for thoseideas, Intel formally launched PlanetLab, con-tributing the first 100 of a planned 1,000computer nodes maintained by heavy Netusers around the world, mostly universities.The project is already helping to monitor sys-tem usage, locate bottlenecks, and set trapsfor the propagators of viruses and worms.Meanwhile, to encourage consumer use ofnetwork services, Intel has launched its Cen-trino line of wireless products, which take ad-vantage of the increasing number of Wi-Fi“hot spots,” in places such as food courts andcity squares. Centrino laptops contain a wire-less communications card, a communicationschip and a microprocessor all optimized towork together. To make portable Internet ac-cess more practical, the computers squeezemore processing power out of each watt, ex-tending battery life—perhaps the single great-est impediment to mobility.

iTunes stands outamong music servicesfor its simplicity andlow cost.

Enzymes that break downthe leaves and stalks ofcorn and other biomassproducts to createethanol fuel may now bemade more inexpensively.


Communications Computing

STEVEN JOBS

NOVOZYMES

INTEL CORPORATION

Bagsvaerd, Denmark

Launched a program to reduce by an order of magnitude the cost of enzymes for making ethanol.

“WHITE BIOTECHNOLOGY” involves finding natural organisms and compounds that can per-form the work done today by petroleum-based chemicals. A major player in this arena is Novozymes,the world’s largest producer of industrial enzymes. The company is just completing a successful three-year effort funded by the U.S. Department of Energy’s biomass program to seek a 10-fold reductionin the cost of producing a critical enzyme blend for the making of ethanol from the leaves and stalksof corn. The blend is used to create sugar mixtures required in the production of clean, renewablebiomaterials for industries such as chemicals and transportation fuels. Another company—Genen-cor—is independently pursuing the same research. An enzymatic process to produce these sugars of-fers the best prospects for making this approach competitive with petroleum-based fuels and chem-icals. Before this breakthrough, enzymes were considered too expensive to be utilized for the con-version of cellulose to sugars. The teams used a variety of advanced biochemical, genetic andengineering technologies to enhance enzyme activities. Novozymes has also recently released otherinnovative enzymes for various industrial applications using a process it licenses called directed evo-lution, which introduces new combinations of genes and then screens for the best enzymes.

CEO, Apple Computer, Cupertino, Calif.

Started an online music service that serves as a model for the rest of the record industry.

Santa Clara, Calif.

Crafted possible solutions for Internetbottlenecks and constructed chip sets thatmake wireless networking easier.



JEFF

JO

HN

SON

(to

p);

CO

UR

TESY

OF

LOS

ALAM

OS

NAT

ION

AL L

ABO

RAT

OR

Y (b

otto

m)

Fuel cell developed atLos Alamos couldbecome a keycomponent of zero-emission coal plants.

Identification of theanthrax bacterium(above) now takes placein minutes, not hours.

Defense

Environment

Sunnyvale, Calif.

Enabled some post offices to track anthrax through use of biodetectors.

THE ANTHRAX ATTACKS in the fall of 2001 set off a scramble to find readily de-ployable technology for detecting biological weapons. Cepheid has become a leaderin this emerging marketplace by making biodetectors that distinguish pathogens frombenign microbes by analyzing their DNA. The company supplies its GeneXpert tech-nology to Northrop Grumman, which received a $175-million contract from the U.S.Postal Service earlier this year to install technology in its facilities to detect anthrax.GeneXpert speeds the process of carrying out the polymerase chain reaction, whichamplifies samples of DNA. The process, which usually takes several hours, can becompleted within 30 minutes with the Cepheid device. After the anthrax attacks,the company bolstered revenues substantially by selling its products to the U.S. mil-itary and federal and state public health laboratories.

MOTHER EARTH learned long ago how to turn biomass into oil, but for those of us who cannotwait for eons while subterranean plates grind, heat and decompose dead plants, Changing WorldTechnologies has evolved a plan. It runs a slurry of biomass through a pressure cooker to break downthe longer polymers, then releases the material into a much lower pressure to boil off half the wa-ter. The oil in the remaining sludge can then be separated by centrifuge and cracked, just as with nat-ural oil. The company has already demonstrated the process in a small plant in Philadelphia, andthis past summer it opened a larger plant in Missouri that plans to convert 200 metric tons of offalfrom a nearby turkey processing plant into 10 tons of gas and 600 barrels of oil. Even if the idea con-tributes only a smidgen to our energy needs, it will certainly help get rid of burgeoning waste.

Energy

West Hempstead, N.Y.

Devised a method for turning solid waste into oil.

CHANGING WORLD TECHNOLOGIES

NORTH AMERICA is blessed with vast seams of coal, but conventional coal-firedpower plants release large amounts of the greenhouse gas carbon dioxide and otheremissions into the atmosphere. In recent years, researchers at Los Alamos National Lab-oratory have been developing a zero-emission concept for power generation. The pro-cess would convert coal into methane, which would in turn be reformed into hydrogenand calcium carbonate. The hydrogen would go to a fuel cell to generate electricitywhile the calcium carbonate would be broken down to calcium oxide and carbon diox-ide. The latter gas could be incorporated into a mineral (magnesium carbonate), thendisposed underground. In essence, the carbon would return to the earth from which itwas mined. The process is about 70 percent efficient, roughly twice that of current coal-fired plants. A consortium of energy companies and research institutes formed the ZeroEmission Coal Alliance in 1999. The for-profit ZECA Corporation replaced the alliancein 2001 and is now working to design and construct a pilot plant.

Calgary, Canada, and Los Alamos, N.M.

Commercialized a process to convert coal into hydrogen fuel.

CEPHEID

ZECA CORPORATION and LOS ALAMOS NATIONAL LABORATORY



CO

UR

TESY

OF

FLU

IDIG

M (

top

); C

OU

RTE

SY O

F N

ANO

SYS

(bot

tom

)


Protein crystals grow inwells of the TopazCrystallizer chip.

Vials hold semiconductor nanocrystals for which Nanosys controls the intellectual-property rights.

NANOSYS spent 2003 snapping up proprietary rights to some of the year’s keynanotechnology innovations, including nanowire lasers and nanocomposite so-lar-cell technology. By May the firm had secured an additional $38 million infunding, giving it a total of nearly $70 million to continue its buying spree. In June,Nanosys forged an exclusive licensing agreement with Yissum, the technology-transfer subsidiary of the Hebrew University of Jerusalem. Thanks to that arrange-ment, Nanosys now controls the patents for more than 120 basic nanocrystal ma-terials and applications. These deals give the company the ability to commercial-ize a vast array of nanotechnology products. Improved solar cells, for example,could be on the market as early as 2006. Nanosys intends to bring these prod-ucts to market through corporate partnerships in various industries.

GENENTECH is poised to become the first company to make a commercial success of drugs toblock angiogenesis, the formation of new blood vessels. To survive and spread, cancers must makeyards of new vessels, called capillaries. Compounds that stifle the growth of new vessels were shownyears ago to shrink tumors in animals, but supportive data in humans have been slow to appear.Genentech’s angiogenesis inhibitor is bevacizumab, trademarked as Avastin. It is a monoclonalantibody—a specific molecule produced by the immune system—that targets a growth factor cru-cial to vessel formation. Last May the company announced that Avastin improved the survival ofpatients with metastatic colorectal cancer when administered along with traditional chemothera-py. Several large-scale clinical trials involving people with breast cancer and nonsmall-cell lung can-cer are also in progress, and the drug has been granted fast-track status by the U.S. Food and DrugAdministration.

NANOSYS Palo Alto, Calif.

Funded the development of nanotechnology.

Manufacturing

FLUIDIGM

GENENTECH

South San Francisco, Calif.

Built microscopic channels, pumps and valves that will create the fluidic equivalent of microchips.

Medical Treatment

South San Francisco, Calif.

Developed the first commercial drug that stops blood vessel growth in tumors.

Nanotechnology and Molecular Electronics

A START-UP co-founded by Stephen R. Quake, a young professor of biophysics from theCalifornia Institute of Technology, continues to distinguish itself as a leader in the emergingfield of microfluidics. Fluidigm moved ahead during the past year with the release of the TopazCrystallizer, a system that can very rapidly crystallize large numbers of proteins for the pur-pose of learning their structures. Moreover, the system can work with extremely small vol-umes of protein solutions, enabling many tests to be run in parallel. To build the microfluidicsystem, Quake used a novel lithography technique that constructs three-dimensional net-works of microscopic channels, valves and reaction chambers. It creates these structures us-ing a silicone-based rubber stamp. In September 2002 the company announced that it hademployed a microfluidic valve technology, built using this so-called soft lithography method,to partition a sample into 20,000 polymerase chain reactions (gene amplifications), with thesolution in each reaction holding less than a billionth of a liter.


LIN

DA

STAN

NAR

D U

niv

ersi

ty o

f C

ap

e To

wn

(top

); C

OU

RTE

SY O

F iR

OB

OT

(bot

tom

)

WITH THE PASSAGE of the Sarbanes-OxleyAct of 2002, companies are now required to re-frain from an act of retribution against employ-ees who blow the whistle on accounting prac-tices they deem dubious. How to be seen to be incompliance with the law remains an open ques-tion, one to which an answer has been offered bythe Internet security firm Anonymizer. In Aprilthe company launched SECtips.com, a Web-based service that any company can join. Mem-

ber companies must provide their employeeswith a password that would enable them to sub-mit tips from any computer without fear of iden-tification. Despite the name of the site, the tipsdo not go directly to the Securities and ExchangeCommission but rather to the company’s owncompliance officer. The compliance officers donot themselves enjoy anonymity; if they receivea tip and sit on it, they can assume that prosecu-tors will eventually find out.

CERVICAL CANCER kills 250,000 women every year, more than anyother type in developing countries. In November 2002 scientists atMerck Research Laboratories announced that they had developed avaccine that protects women from viral infections caused by a strain ofhuman papillomavirus (HPV-16) found in roughly half of all cervicaltumors. The researchers made the vaccine by mass-producing one oftwo proteins that form a shell around the HPV-16 virus. The proteinthen elicits an immune reaction. To test the vaccine’s effectiveness, astudy at multiple research centers tracked 2,392 women, half of whomreceived the vaccine and half a placebo. In regular samples taken during the course of the study, noneof the women receiving the vaccine tested positive for the virus, but 41 in the placebo group did.

ANONYMIZERPrivacy and Security

San Diego, Calif.

Protected the anonymity of those offering tips about corporate malfeasance.


Robotics

iROBOT Burlington, Mass.

Introduced the first truly mass-market household robot.

FOR DECADES, technopundits have been predicting that robots wouldsoon whiz into our daily lives: fetching the paper, cleaning the house andfixing dinner. If that vision is now starting to become a reality, it is inlarge measure thanks to iRobot. The company was founded in 1990by three leading roboticists at the M.I.T. Artificial Intelligence Lab—

among them the lab director, robotics pioneer Rodney Brooks. In thefall of 2002 the company introduced Roomba, the first mass-mar-ket household robot. Roomba will automatically vacuum and sweepa floor while avoiding obstacles. The breakthrough was not the tech-nology per se—most of the components were available back in the1980s—but the packaging into a useful, durable and affordable unit.Another iRobot product, a remote-controlled tanklike robot called Pack-Bot, was deployed by U.S. forces in Afghanistan during 2002. There, andlater in Iraq, PackBots inspected potential booby traps and ambush positions.

MERCK RESEARCH LABORATORIESWest Point, Pa.Created a vaccine that may help eliminate cervical cancer.

Roomba robotvacuums the

floor unaided.

Humanpapillomavirusvaccine has thepotential tocombat the virusthat accounts foralmost allcervical tumors.

w w w . s c i a m . c o m S C I E N T I F I C A M E R I C A N 69COPYRIGHT 2003 SCIENTIFIC AMERICAN, INC.


P O L I C Y L E A D E Rof the year

GRO HARLEM BRUNDTLAND Former secretary general, World Health Organization

Coordinated a rapid global response to stem the SARS outbreaks.

WITH TYPICAL SCANDINAVIAN understatement,Gro Harlem Brundtland, then the secretary general ofthe World Health Organization, worked mainly un-dercover to meet the challenge of SARS. But she rec-ognized the need to concentrate minds with decisivestrokes and did so on three occasions last year. She is-sued the first global health alert ever, warned abouttravel to Toronto and other cities, and frankly criti-cized the Chinese government, which had suppressednews of the outbreak in Guangdong Province.

Quarantines, perhaps helped along by the simplechanging of the seasons, contained the outbreak, andthat is why the unprecedented toughness is now seenas fully justified. In any case, the old-fashioned con-tainment measures have bought time for the molecu-lar biologists to develop better diagnostic tests and thefirst vaccines. Furthermore, by setting the precedent ofexerting pressure on influential member states (ofwhich there are 192), Brundtland has made life easier for her successors if they should facesimilar situations. In all these actions, she worked together closely with David Heymann,director of the WHO’s office of communicable diseases, and with the Centers for DiseaseControl and Prevention, whose director, Julie Gerberding, lent critical support. The CDC’sThomas Ksiazek led a team that quickly identified the coronavirus responsible for SARS.

Brundtland, a medical doctor, honed her political talents in a variety of senior governmen-tal jobs in her native Norway before becoming its prime minister, a position she held forthree terms. At WHO, she used those skills to raise the organization’s profile and to culti-vate support in the United Nations. By vigorous fund-raising, particularly among privatefoundations, she increased the WHO budget by about two thirds, to about $1 billion a year.The money goes to finish old projects, such as the eradication of polio, and the new ones shestarted, including bringing low-cost drugs to poor countries and improving the surveillancesystem for emerging diseases, such as SARS. Although Brundtland would very likely havesailed into a second term, she decided to retire, citing her age, which is 64.

Children in Hong Kong have surgical masks put on in earlyApril in the hopes of fending off SARS.

PAU

L H

ILTO

N E

PA

Ph

oto

(top

); A

NAT

GIV

ON

AP

Ph

oto

(bot

tom

)



RIC

HAR

D T

. N

OW

ITZ

Cor

bis

(to

p);

RIC

HAR

D O

LIVI

ER

Cor

bis

(b

otto

m)

Other Policy Leaders

Low-cost drip irrigation delivers water

to plant roots.

HAROLD W. GEHMAN, JR.

PAUL R. POLAK

KEN LIVINGSTONE

Chair, Columbia Accident Investigation Board

Distinguished himself for a hard-nosed approach to investigating the Columbia accident.

EARLY CRITICS of the board that NASA appointed to investigate the destruction of the space shut-tle Columbia said the all-government panel would not be independent enough to uncover the un-derlying factors that led to the orbiter’s breakup during reentry on February 1. The board’s August26 report may have forever silenced those doubters. The panel blamed the mishap not only on thedamage to the left wing by a chunk of foam shortly after the launch but also on the institutional cul-ture that allowed a preventable accident to occur. But even before the report was released, the chiefinvestigator, Harold Gehman, had already stood out as someone who would not be constrainedby the space agency. His leadership of the accident board may serve as a model for how to bringneeded scrutiny to bear on an organization in crisis.

President, International Development Enterprises, Lakewood, Colo.

Encouraged local markets to improve access to water for Third World farmers.

PAUL POLAK has pioneered an approach to poverty alleviation that has already markedlyimproved the lives of millions of people. By providing small land holders with access to af-fordable microirrigation technologies—such as low-cost drip irrigation—Polak aims to helpmore than 30 million rural farm families in the developing world rise out of poverty by 2015.He has been pursuing this goal by spearheading the Smallholder Irrigation Market Initiative(SIMI) of International Development Enterprises. SIMI, active in both Africa and Asia, oper-ates not by providing handouts, which often do not produce sustainable change, but by en-couraging participation of local markets in developing improvements in irrigation—a $100-an-acre drip-irrigation package in India, for instance. In the summer of 2002 SIMI Net waslaunched to compile and disseminate useful knowledge related to smallholder irrigation.

Mayor, London, England

Implemented tariffs to regulate city traffic.

Aerospace

ECONOMISTS HAVE LONG fretted about ex-ternalities—the exploitation of common resourcesby some people at the expense of others. Drivinga car in a city and thereby clogging traffic offersa classic example of such an externality, one thatcan be balanced onlyby imposing a tax so unpopular that politi-cians never dared totry it on a large scale,until early this year,when London’s may-or, Ken Livingstone,showed the necessarycourage. The forayinto such social-cost

pricing has worked: now that drivers must pay a£5—nearly $8—fee, traffic jams are a third lesscommon and the drivers themselves are happywith the trade-off. Livingstone’s show of gutsand leadership was widely questioned at first,

and many commen-tators thought that hemight forfeit his officebecause of it. Now itlooks like he’ll be get-ting another term—

and mayors of otherbig cities, includingthose on this side ofthe Atlantic, are tak-ing notice.

Agriculture

Automotive

Charging fees for road use has unclogged thestreets in central London, making traffic jams muchless common.


72 S C I E N T I F I C A M E R I C A N

CO

UR

TESY

OF

ANTH

ON

Y J.

MU

SCAT

(to

p);

CO

UR

TESY

OF

IBM

(b

otto

m)


CORPORATIONS INTENT on mo-nopolizing the digital economy havecome to fear Edward Felten, who hasfought their claims with technicalanalysis sharpened by a sense of theridiculous. When Microsoft, in its an-titrust case, claimed that its browsercould not be separated from its oper-ating system, Felten separated them.When the Recording Industry Associ-ation of America unveiled a music-en-cryption technology, he found holesin it (and was almost sued for pub-lishing the holes). Now he is fightingHollywood’s efforts to introduce leg-islation mandating privacy devices forall digital products, particularly digi-tal television. In testimony beforeCongress, he pointed out that awould-be pirate could already video-tape a movie for a few dollars ratherthan go the digital route, which wouldcost hundreds of dollars. His Web siteposts comical examples of devices,such as toys, that a proposed lawwould digitally bind and gag.

WHILE WORKING for disk-drive maker Quantum in the1980s, Henry Chesbrough began to wonder why largecorporations such as IBM and AT&T couldn’t seem toreap the market benefits of the advanced technologies theycreated. The problem, he decided, was that these mega-corporations were too insular: the companies used onlyconcepts conceived in-house. Recently technological up-heavals in computing and communications, often fosteredin start-ups or university research centers, have made someof these companies realize that they no longer have a mo-nopoly on ideas. In his influential book Open Innovation:The New Imperative for Creating and Profiting fromTechnology, published this year, Chesbrough suggeststhat the solution is to eliminate the boundaries that tradi-tionally exist among businesses and universities. Althoughcompanies may share their research, what they gain in re-turn may outweigh the cost of this sacrifice.

Reactor vessel uses an environmentallyfriendly process to clean and build microelectronic devices.


Computing

ANTHONY J. MUSCAT

HENRY CHESBROUGH

Associate professor of chemical and environmental engineering, University of Arizona

Introduced environmentally friendly chipmaking technologies.

THE BEST INCENTIVE for the semiconductor industry to adoptenvironmentally friendly chipmaking technologies is if those samemanufacturing methods also save piles of money. Last year An-thony Muscat and his team of researchers demonstrated tech-niques using supercritical carbon dioxide (in a pressurized statepoised between liquid and gas) to clean the porous insulating ma-terial used in today’s most advanced microchips. Supercritical car-bon dioxide cleans better than the chemicals currently used. Inaddition, supercritical CO2 can be acquired from the copiousemissions from most heavy industries and is easily recycled. Mus-cat’s group is also researching chemicals that can block out ar-eas of a chip surface like masking tape around a painted wall,eliminating costly and polluting steps in the chip-etching process.

Visiting assistant professor, Institute of Management, Inno-vation and Organization, University of California, Berkeley

Advocated the abolition of the not-invented-heresyndrome that afflicts many companies.

Communications

EDWARD FELTEN Professor of computer science, Princeton University

Persistently criticized proposeddigital TV standards.

IBM Research has opened its doors to new ideas.



EVA

N V

UC

CI

EPA

Ph

oto

(top

); J

ASO

N S

ZEN

ES

EPA

Ph

oto

(bot

tom

)

Defense

Director, Office of Force Transformation, U.S. Department of Defense

Articulated the “network-centric” approach to warfareimplemented during the Iraq conflict.

THE OUTSTANDING performance of U.S. military forcesin this year’s war in Iraq can be ascribed in large part to theremarkable coordination of action among all the partici-pants. This radical approach to war fighting, which linksunits from multiple services electronically to permit rapid de-cision making on the battlefield, is known as network-cen-tric warfare. Since 1995 Arthur Cebrowski has led the effortto develop and implement this information-based strategywithin the Pentagon, where he is known informally as itstransformation czar. Cebrowski is credited not only with bestarticulating and advancing the cause of network-centric war-fare but also with laying much of the groundwork for this vi-sion in his prior roles as director of command, control, com-munications and computers on the Joint Chiefsof Staff and as head of the Naval War College.

AFTER AUGUST’S great blackout in the U.S., noone needs to be reminded that the electric grid hasnot kept pace with rising demand and sweepingmarket deregulation. Yet Kurt Yeager began re-minding the country in 1996, when he took thetop job at EPRI. One of hisfirst actions as chief executivewas to assemble experts fromindustry and government tochart the future and lay outthe needed technologies andthe money they would cost.Their conclusions were sum-marized in the EPRI Electrici-ty Technology Roadmap andcontinually updated. They in-cluded a call for reductions ingreenhouse emissions, improvements in powerquality and—notably—a 250 percent increase inspending on transmission infrastructure. Thespending would have covered not only new pow-er lines but also grid-level electric storage and oth-er features that would have come in handy on Au-gust 14, 2003. Since that dark day, Yeager has ar-gued that after years of borrowing against thefuture, the infrastructure bill has finally come due.

ARTHUR K. CEBROWSKI

WHEN TRYING to make sense of the warsand other struggles that wrack the world to-day, journalists and policymakers tend to tracethe political roots, especially ethnic tensions.But Frances Stewart is beginning to convincepeople that the economic roots are just as im-portant. Stewart started the Center for Re-search on Inequality, Human Security and Eth-nicity this past April. Since the 1960s she hasstudied and promoted poverty alleviation, par-ticularly in the form of long-term aid that as-sists people in helping themselves, political in-stitutions that defend the interests of the poor,and the removal of trade barriers against de-veloping nations’ exports. Her recent work onconflict has influenced institutions such as theUnited Nations, which traditionally paid littleattention to the economics of civil conflicts.Stewart argues that long-standing antipovertyprograms should carry on even while warrages; by reducing inequalities, they can hastenthe end of conflict.

FRANCES J. STEWART Economic Development

Professor of development economics,University of Oxford

Promoted antipoverty campaigns to helpquell armed conflicts in developing nations.

August 14, 2003, was adark day for New York Cityand a big swath of therest of North America.

Linking units frommultiple military servicespermits rapid decisionmaking on the battlefield.

Energy

Chief executive officer, Electric Power Research Institute (EPRI), Palo Alto, Calif.

Lobbied for a major overhaul of the power industrylong before the 2003 blackouts.

KURT YEAGER



CO

UR

TESY

OF

AND

RE

W B

ALM

FOR

D (

top

); G

IDE

ON

ME

ND

EL

Cor

bis

(bot

tom

)


Forest clearance candecrease the economicbenefits reaped from a habitat.

Preventing newbornsfrom contracting AIDS is a priority.

IN HIS FEBRUARY State of the Union address, President George W. Bush asked the U.S. to com-mit $15 billion over the next five years to combat AIDS in Africa and the Caribbean. Much of thecredit for bringing about this development, according to AIDS activists, goes to Anthony Fauci, whoworked to convince administration officials to dedicate resources on a large scale. Congress is ex-pected to pledge between $2 billion and$3 billion to the initiative in fiscal year2004. Among the project’s goals are toprevent 60 percent of the 12 million newinfections anticipated in 14 targetedcountries, to offer antiretroviral drugs totwo million HIV-positive people, and toprovide care for 10 million AIDS pa-tients and orphans. An estimated 42 mil-lion people worldwide are living withHIV, and 20 million more have died ofAIDS, according to the Joint United Na-tions AIDS Program.

ANTHONY S. FAUCIDirector, National Institute of Allergy and Infectious Diseases

Convinced the Bush administration to commit $15 billion to combat AIDS in Africa and the Caribbean.

Environment

ANDREW BALMFORD Conservation scientist, University of Cambridge; co-founder, Cambridge Conservation Forum

Described how economic motives can justify preserving natural habitats.

Medical Treatment

CAN YOU PUT a price tag on nature? In an influential article last year in Science, Andrew Balm-ford attempted to do just that. He and his co-authors reviewed studies of five habitats inMalaysia, Cameroon, Thailand, Canada and the Philippines that had been converted to privateuse. The researchers found that the economic benefits from the habitats consistently decreasedafter they were razed, drained or dynamited for logging, farming or fishing. For example, theprofits earned from turning a Thai mangrove into a shrimp farm were far outweighed by thecosts of damage to offshore fisheries and the loss of storm protection. But Balmford has gone be-yond simply publishing these results; he works with conservation groups to determine the bestways to reverse the shrinkage of natural habitats. In 2000 he co-founded the Cambridge Con-servation Forum to strengthen the links between researchers and conservation practitioners.

FOR 15 YEARS, Heather White tracked down outsidecontractors who could serve as suppliers to apparelcompanies. Today she is a watchdog of the contractorsshe once hired. Verité, an organization that she startedin 1995, has become one of the foremost groups in-volved in monitoring factory conditions worldwide toidentify worker exploitation and health and safety in-fractions. Last summer Verité started a campaign tocombat debt bondage in Asia. Workers from Vietnam,Thailand and the Philippines migrate to Taiwan andother countries that want to stay competitive with main-land China. They pay high placement fees and depositsto find jobs and are often relegated to a form of inden-tured servitude. Since it opened its doors, Verité has per-formed 1,000 “social audits” in factories to assess com-pliance with workplace standards. Since 2002 the Stateof California Public Employees’ Retirement System hasbased some of its investment decisions on Verité’s rat-ings of labor practices in developing countries.

Manufacturing

HEATHER WHITEFounder and executive director, Verité, Amherst, Mass.

Campaigned to extricate migrant workers from virtual slavery.



SLIM

FIL

MS

(top

); B

ILL

& M

ELI

ND

A G

ATE

S FO

UN

DAT

ION

(b

otto

m)

Bill and Melinda Gatesvisit Mozambique.

Molecular transistors maybecome a linchpin of the nanotechnology era.

FROM THE TIME he was sworn into office in October 2001, Phillip Bond has beenan outspoken public supporter of nanotechnology. Bond is particularly keen on mak-ing sure that the U.S. is prepared to blaze a trail in this new frontier that bridges the gap betweenbasic science and applied technology. In his view, nanotechnology will become a key driver of eco-nomic growth and will promote the nation’s leadership in technology, but the country will need toinvest substantially in nanotech to realize that benefit. The Commerce Department supports re-search on nanotechnologies, mostly through the National Institute of Standards and Technology.The Bush administration has requested $46.2 million for NIST for the 2004 federal fiscal year, morethan 5 percent of the proposed $847 million in federal spending on nanotechnology.

BILL & MELINDA GATES FOUNDATION Seattle, Wash.

Gave hundreds of millions of dollars to meet the challenges of global health.

OVER THE PAST YEAR the Gates Foundation, which was established in2000, evinced the power of its carefully honed vision and its huge endowment.Its strong philosophical base holds that millions of people in the developing worlddie every year from treatable diseases and that we in the developed world possessthe means to prevent much of this suffering and death. Toward this end, the foun-dation’s Global Health Program has committed more than $3 billion in grants toexpand access to existing interventions for malaria, tuberculosis, trachoma andAIDS and to fund research into new tools. Two important milestones occurredin 2003. One was the establishment of Grand Challenges in Global Health, a$200-million program in partnership with the National Institutes of Healththat will identify critical health problems and increase research on diseases ofthe developing world. The other is a $168-million grant to accelerate malariaresearch, the largest ever single donation toward fighting the mosquito-bornedisease. The number of lives that will be touched by the foundation’s vision andby its intelligent and generous implementation is probably without precedent.

THE THEFT of data, like other forms of white-collar crime, is so embarrassing that companiesare loath to report it. As a result, many peoplenever learn that hackers or criminals workingon the inside have invaded their privacy.Thanks to the sponsorship of Assemblyman JoeSimitian and former state senator Steve Peace,a law remedying that problem took effect inCalifornia in July. From now on, companiesmust notify by letter or e-mail anyone whose

name, Social Security number, driver’s licensenumber or bank account data may have falleninto the wrong hands. Companies that do notwork hard enough to make their employeesaware of the need for such disclosures are sub-ject to class-action lawsuits. The two legisla-tors’ leadership has already had wider reper-cussions: U.S. Senator Dianne Feinstein hassaid that she will introduce a federal bill mod-eled on the California law.

PHILLIP J. BONDNanotechnology and Molecular Electronics

U.S. undersecretary of commerce for technology

Promoted nanotechnology effectively within the executive branch.

Privacy and Security


JOE SIMITIAN and STEVE PEACESimitian, state assemblyman (Palo Alto), and Peace, former state senator (San Diego County), California State Legislature

Sponsored law that requires issuing warnings when possible identity theft occurs.


Alice Amsden, Massachusetts Institute of Technology Ronald C. Arkin, Georgia Institute of Technology

Anthony Atala, Harvard Medical School David Awschalom, University of California, Santa Barbara

Charles P. Casey, University of Wisconsin–Madison Robert J. Cava, Princeton University

Thomas R. Cech, Howard Hughes Medical Institute Stephen Y. Chou, Princeton University • Sunlin Chou, Intel

Larry Dalton, University of Washington Martin E. Dandridge, Northrop Grumman Integrated Systems

Emilio Emini, Merck Research Laboratories Gary W. Ervin, Northrop Grumman Integrated Systems • Chris Galvin, Motorola Marc Goldburg, ArrayComm • Paul M. Grant, Electric Power Research Institute

Jeff Greason, XCOR Aerospace • Paul Horn, IBM, Thomas J. Watson Research Center Roland Hwang, Natural Resources Defense Council

Lawrence Lessig, Stanford Law School • Robert Lucky, Telcordia Michael E. Mann, University of Virginia • Peter D. Meldrum, Myriad Genetics

John P. Moore, Cornell University Frank O’Donnell, Clean Air Trust

Sandra Postel, Global Water Policy Project William H. Rastetter, IDEC Pharmaceuticals

Pamela Samuelson, University of California, Berkeley Harvey Sapolsky, Massachusetts Institute of Technology • Jill Sideman, CH2M HILL

Gary W. Small, University of California, Los Angeles Allison A. Snow, Ohio State University

Richard Truly, National Renewable Energy Laboratory Jun Yu, University of Washington • R. Stanley Williams, Hewlett-Packard

Shari Zussman, Argonne National Laboratory

EDITORIAL CONTRIBUTORSMark Alpert, Steven Ashley, Daniel Cho, Graham P. Collins,

Mariette DiChristina, Daniel G. Dupont, Carol Ezzell, W. Wayt Gibbs, George Musser, Tim Palucka, Michelle Press, John Rennie, Philip E. Ross,

Ricki L. Rusting, Gary Stix, Dennis Watkins, Philip M. Yam

SCIENTIFIC AMERICAN 50 EDITORIAL ADVISORY BOARD

We would like to acknowledge

the contributions of these advisers

in providing and evaluating nominees:

76 D E C E M B E R 2 0 0 3COPYRIGHT 2003 SCIENTIFIC AMERICAN, INC.


IF RACES ARE DEFINED AS GENETICALLY DISCRETE GROUPS, NO.

BUT RESEARCHERS CAN USE SOME GENETIC INFORMATION TO

GROUP INDIVIDUALS INTO CLUSTERS WITH MEDICAL RELEVANCE

By Michael J. Bamshad and Steve E. Olson

DOES EXISTRACE


from a biological standpoint? Do physi-cal features reliably say anything infor-mative about a person’s genetic makeupbeyond indicating that the individual hasgenes for blue eyes or curly hair?

The problem is hard in part becausethe implicit definition of what makes aperson a member of a particular race dif-fers from region to region across theglobe. Someone classified as “black” inthe U.S., for instance, might be considered“white” in Brazil and “colored” (a cate-gory distinguished from both “black”and “white”) in South Africa.

Yet common definitions of race dosometimes work well to divide groups ac-cording to genetically determined pro-pensities for certain diseases. Sickle celldisease is usually found among people oflargely African or Mediterranean de-scent, for instance, whereas cystic fibro-sis is far more common among those ofEuropean ancestry. In addition, althoughthe results have been controversial, ahandful of studies have suggested thatAfrican-Americans are more likely to re-

spond poorly to some drugs for cardiacdisease than are members of other groups.

Over the past few years, scientistshave collected data about the geneticconstitution of populations around theworld in an effort to probe the link be-tween ancestry and patterns of disease.These data are now providing answers toseveral highly emotional and contentiousquestions: Can genetic information beused to distinguish human groups havinga common heritage and to assign indi-viduals to particular ones? Do suchgroups correspond well to predefined de-scriptions now widely used to specifyrace? And, more practically, does divid-ing people by familiar racial definitionsor by genetic similarities say anythinguseful about how members of thosegroups experience disease or respond todrug treatment?

In general, we would answer the firstquestion yes, the second no, and offer aqualified yes to the third. Our answersrest on several generalizations about raceand genetics. Some groups do differ ge-

netically from others, but how groups aredivided depends on which genes are ex-amined; simplistically put, you might fitinto one group based on your skin-colorgenes but another based on a differentcharacteristic. Many studies have dem-onstrated that roughly 90 percent of hu-man genetic variation occurs within apopulation living on a given continent,whereas about 10 percent of the variationdistinguishes continental populations. Inother words, individuals from differentpopulations are, on average, just slightlymore different from one another than areindividuals from the same population.Human populations are very similar, butthey often can be distinguished.

Classifying HumansAS A FIRST STEP to identifying linksbetween social definitions of race and ge-netic heritage, scientists need a way to di-vide groups reliably according to theirancestry. Over the past 100,000 years orso, anatomically modern humans havemigrated from Africa to other parts ofthe world, and members of our specieshave increased dramatically in number.This spread has left a distinct signature inour DNA.

To determine the degree of related-ness among groups, geneticists rely ontiny variations, or polymorphisms, in theDNA—specifically in the sequence ofbase pairs, the building blocks of DNA.Most of these polymorphisms do not oc-cur within genes, the stretches of DNAthat encode the information for makingproteins (the molecules that constitute


■ The outward signs on which most definitions of race are based—such as skincolor and hair texture—are dictated by a handful of genes. But the other genes of two people of the same “race” can be very different. Conversely, two people of different “races” can share more genetic similarity than twoindividuals of the same race.

■ Nevertheless, scientists can use genetics to sort most large populationsaccording to their ancestral geographic origin. This approach does not work aswell for populations resulting from recent mixing with other groups, however.

■ The medical implications of racial genetic differences are still under debate.

Overview/Genetics of Race

Look around on the streets of any major city, and you will see a

sampling of the outward variety of humanity: skin tones ranging from

milk-white to dark brown; hair textures running the gamut from fine

and stick-straight to thick and wiry. People often use physical characteristics

such as these—along with area of geographic origin and shared culture—to

group themselves and others into “races.” But how valid is the concept of race

PH

OTO

ILLU

STR

ATIO

NS

BY

NAN

CY

BU

RSO

N (

pre

ced

ing

pa

ge)


much of our bodies and carry out thechemical reactions of life). Accordingly,these common variations are neutral, inthat they do not directly affect a particu-lar trait. Some polymorphisms do occurin genes, however; these can contributeto individual variation in traits and to ge-netic diseases.

As scientists have sequenced the hu-man genome (the full set of nuclearDNA), they have also identified millionsof polymorphisms. The distribution ofthese polymorphisms across populationsreflects the history of those populationsand the effects of natural selection. Todistinguish among groups, the ideal ge-netic polymorphism would be one that ispresent in all the members of one groupand absent in the members of all othergroups. But the major human groupshave separated from one another too re-cently and have mixed too much for suchdifferences to exist.

Polymorphisms that occur at differ-ent frequencies around the world can,however, be used to sort people roughlyinto groups. One useful class of poly-morphisms consists of the Alus, shortpieces of DNA that are similar in se-quence to one another. Alus replicate oc-casionally, and the resulting copy splicesitself at random into a new position onthe original chromosome or on anotherchromosome, usually in a location that

has no effect on the functioning of near-by genes. Each insertion is a uniqueevent. Once an Alu sequence inserts it-self, it can remain in place for eons, get-ting passed from one person to his or herdescendants. Therefore, if two peoplehave the same Alu sequence at the samespot in their genome, they must be de-scended from a common ancestor whogave them that specific segment of DNA.

One of us (Bamshad), working withUniversity of Utah scientists Lynn B.Jorde, Stephen Wooding and W. ScottWatkins and with Mark A. Batzer of Lou-isiana State University, examined 100 dif-ferent Alu polymorphisms in 565 peopleborn in sub-Saharan Africa, Asia and Eu-rope. First we determined the presence orabsence of the 100 Alus in each of the 565people. Next we removed all the identify-ing labels (such as place of origin and eth-nic group) from the data and sorted thepeople into groups using only their ge-netic information.

Our analysis yielded four different

groups. When we added the labels backto see whether each individual’s groupassignment correlated to common, pre-defined labels for race or ethnicity, wesaw that two of the groups consisted onlyof individuals from sub-Saharan Africa,with one of those two made up almostentirely of Mbuti Pygmies. The other twogroups consisted only of individuals fromEurope and East Asia, respectively. Wefound that we needed 60 Alu polymor-phisms to assign individuals to their con-tinent of origin with 90 percent accura-cy. To achieve nearly 100 percent accu-racy, however, we needed to use about100 Alus.

Other studies have produced compa-rable results. Noah A. Rosenberg andJonathan K. Pritchard, geneticists for-merly in the laboratory of Marcus W.Feldman of Stanford University, assayedapproximately 375 polymorphisms calledshort tandem repeats in more than 1,000people from 52 ethnic groups in Africa,Asia, Europe and the Americas. By look-


Individuals from

different populations

are, on average, just

slightly more

different from one

another than are

individuals from the

same population.

MICHAEL J. BAMSHAD and STEVE E. OLSON have come to the subject of human genetic vari-ation from different directions. Bamshad, a geneticist at the University of Utah School ofMedicine, studies the genetics of populations to better understand human history and theorigins of disease. Olson, a science writer who lives outside Washington, D.C., is the authorof Mapping Human History: Genes, Race, and Our Common Origins, which was nominatedfor the 2002 National Book Award in nonfiction. They met during the writing of MappingHuman History and have been working together ever since to explore and explain patternsof human genetic variation worldwide.

THE

AU

THO

RS


ing at the varying frequencies of thesepolymorphisms, they were able to distin-guish five different groups of peoplewhose ancestors were typically isolatedby oceans, deserts or mountains: sub-Sa-haran Africans; Europeans and Asianswest of the Himalayas; East Asians; in-habitants of New Guinea and Melanesia;and Native Americans. They were alsoable to identify subgroups within each re-gion that usually corresponded with eachmember’s self-reported ethnicity.

The results of these studies indicatethat genetic analyses can distinguishgroups of people according to their geo-graphic origin. But caution is warranted.The groups easiest to resolve were thosethat were widely separated from one an-other geographically. Such samples max-imize the genetic variation among groups.When Bamshad and his co-workers usedtheir 100 Alu polymorphisms to try toclassify a sample of individuals fromsouthern India into a separate group, the

Indians instead had more in commonwith either Europeans or Asians. In other words, because India has been sub-ject to many genetic influences from Eu-rope and Asia, people on the subconti-nent did not group into a unique cluster.We concluded that many hundreds—orperhaps thousands—of polymorphismsmight have to be examined to distin-guish between groups whose ancestorshave historically interbred with multiplepopulations.

HUMAN GENETIC DIVERSITY


NAD

IA S

TRAS

SER

RESEARCHERS OFTEN USE SHORT PIECES of DNA called Alupolymorphisms to determine whether various populations arerelated to one another. Alus have no known function, yet theycopy and insert themselves at random throughout a person’sgenome. Because previously inserted Alus do not excisethemselves, Alu patterns can be used as yardsticks to estimatehow close two people—and, on average, two populations—aregenetically. For example, an Alu polymorphism on chromosome1 occurs in roughly 95 percent of sub-Saharan Africans whohave been sampled, 75 percent of Europeans and northern

Africans, and 60 percent of Asians, whereas a different Alupolymorphism on chromosome 7 is carried by approximately 5percent of sub-Saharan Africans, 50 percent of Europeans andnorthern Africans, and 50 percent of Asians. Some individualscarry both polymorphisms. No single polymorphism can, byitself, distinguish all the members of one major human groupfrom all the members of another group, but by analyzinghundreds of these polymorphisms, scientists can groupindividuals sampled from different locations on the basis of their genetic profiles. —M.J.B. and S.E.O.

Chromosome 1 Alu

Chromosome 7 Alu

Both Alus

EUROPEANS ANDNORTHERN AFRICANS 75% Chromosome 1 Alu 50% Chromosome 7 Alu (25% Both)

SUB-SAHARAN AFRICANS95% Chromosome 1 Alu5% Chromosome 7 Alu

ASIANS60% Chromosome 1 Alu50% Chromosome 7 Alu(10% Both)


The Human RaceGIVEN THAT PEOPLE can be sortedbroadly into groups using genetic data, docommon notions of race correspond tounderlying genetic differences amongpopulations? In some cases they do, butoften they do not. For instance, skin col-or or facial features—traits influenced bynatural selection—are routinely used todivide people into races. But groups withsimilar physical characteristics as a resultof selection can be quite different geneti-cally. Individuals from sub-Saharan Afri-ca and Australian Aborigines might havesimilar skin pigmentation (because ofadapting to strong sun), but geneticallythey are quite dissimilar.

In contrast, two groups that are genet-ically similar to each other might be ex-posed to different selective forces. In thiscase, natural selection can exaggeratesome of the differences between groups,making them appear more dissimilar onthe surface than they are underneath. Be-cause traits such as skin color have beenstrongly affected by natural selection, theydo not necessarily reflect the populationprocesses that have shaped the distribu-tion of neutral polymorphisms such asAlus or short tandem repeats. Therefore,traits or polymorphisms affected by nat-ural selection may be poor predictors ofgroup membership and may imply genet-ic relatedness where, in fact, little exists.

Another example of how difficult it isto categorize people involves populationsin the U.S. Most people who describethemselves as African-American have rel-atively recent ancestors from West Africa,and West Africans generally have poly-morphism frequencies that can be distin-guished from those of Europeans, Asiansand Native Americans. The fraction ofgene variations that African-Americansshare with West Africans, however, is farfrom uniform, because over the centuriesAfrican-Americans have mixed exten-sively with groups originating from else-where in Africa and beyond.

Over the past several years, Mark D.Shriver of Pennsylvania State Universityand Rick A. Kittles of Howard Universi-ty have defined a set of polymorphismsthat they have used to estimate the frac-tion of a person’s genes originating fromeach continental region. They found thatthe West African contribution to thegenes of individual African-Americansaverages about 80 percent, although itranges from 20 to 100 percent. Mixing ofgroups is also apparent in many individ-uals who believe they have only Euro-pean ancestors. According to Shriver’sanalyses, approximately 30 percent ofAmericans who consider themselves“white” have less than 90 percent Euro-pean ancestry. Thus, self-reported ances-try is not necessarily a good predictor of

the genetic composition of a large num-ber of Americans. Accordingly, commonnotions of race do not always reflect aperson’s genetic background.

Membership Has Its PrivilegesUNDERSTANDING the relation betweenrace and genetic variation has importantpractical implications. Several of the poly-morphisms that differ in frequency fromgroup to group have specific effects onhealth. The mutations responsible forsickle cell disease and some cases of cys-tic fibrosis, for instance, result from ge-netic changes that appear to have risen infrequency because they were protectiveagainst diseases prevalent in Africa andEurope, respectively. People who inheritone copy of the sickle cell polymorphismshow some resistance to malaria; thosewith one copy of the cystic fibrosis traitmay be less prone to the dehydration re-sulting from cholera. The symptoms ofthese diseases arise only in the unfortu-nate individuals who inherit two copiesof the mutations.

Genetic variation also plays a role inindividual susceptibility to one of theworst scourges of our age: AIDS. Somepeople have a small deletion in both theircopies of a gene that encodes a particularcell-surface receptor called chemokine re-ceptor 5 (CCR5). As a result, these indi-


Genetic analyses

can distinguish

groups of people

according to their

geographic origin.

But caution

is warranted.


viduals fail to produce CCR5 receptorson the surface of their cells. Most strainsof HIV-1, the virus that causes AIDS,bind to the CCR5 receptor to gain entryto cells, so people who lack CCR5 re-ceptors are resistant to HIV-1 infection.This polymorphism in the CCR5 recep-tor gene is found almost exclusively ingroups from northeastern Europe.

Several polymorphisms in CCR5 donot prevent infection but instead influ-ence the rate at which HIV-1 infectionleads to AIDS and death. Some of thesepolymorphisms have similar effects indifferent populations; others only alterthe speed of disease progression in se-lected groups. One polymorphism, forexample, is associated with delayed dis-ease progression in European-Americansbut accelerated disease in African-Amer-icans. Researchers can only study suchpopulation-specific effects—and use that

knowledge to direct therapy—if they cansort people into groups.

In these examples—and others likethem—a polymorphism has a relativelylarge effect in a given disease. If geneticscreening were inexpensive and efficient,all individuals could be screened for allsuch disease-related gene variants. Butgenetic testing remains costly. Perhapsmore significantly, genetic screening rais-es concerns about privacy and consent:some people might not want to knowabout genetic factors that could increasetheir risk of developing a particular dis-ease. Until these issues are resolved fur-ther, self-reported ancestry will continueto be a potentially useful diagnostic toolfor physicians.

Ancestry may also be relevant forsome diseases that are widespread in par-ticular populations. Most common dis-eases, such as hypertension and diabetes,

are the cumulative results of polymor-phisms in several genes, each of whichhas a small influence on its own. Recentresearch suggests that polymorphismsthat have a particular effect in one groupmay have a different effect in anothergroup. This kind of complexity wouldmake it much more difficult to use de-tected polymorphisms as a guide to ther-apy. Until further studies are done on thegenetic and environmental contributionsto complex diseases, physicians may haveto rely on information about an individ-ual’s ancestry to know how best to treatsome diseases.

Race and MedicineBUT THE IMPORTANCE of group mem-bership as it relates to health care has beenespecially controversial in recent years.Last January the U.S. Food and DrugAdministration issued guidelines advo-cating the collection of race and ethnicitydata in all clinical trials. Some investiga-tors contend that the differences betweengroups are so small and the historicalabuses associated with categorizing peo-ple by race so extreme that group mem-bership should play little if any role in ge-netic and medical studies. They assert thatthe FDA should abandon its recommen-dation and instead ask researchers con-ducting clinical trials to collect genomicdata on each individual. Others suggestthat only by using group membership, in-cluding common definitions of race basedon skin color, can we understand how ge-netic and environmental differencesamong groups contribute to disease. Thisdebate will be settled only by further re-search on the validity of race as a scien-tific variable.

A set of articles in the March 20 issueof the New England Journal of Medicinedebated both sides of the medical impli-cations of race. The authors of one arti-cle—Richard S. Cooper of the LoyolaStritch School of Medicine, Jay S. Kauf-man of the University of North Carolinaat Chapel Hill and Ryk Ward of the Uni-versity of Oxford—argued that race isnot an adequate criterion for physiciansto use in choosing a particular drug fora given patient. They pointed out twofindings of racial differences that are both


CO

UR

TESY

OF

NAN

CY

BU

RSO

N

NEW YORK ARTIST Nancy Burson used her invention, called the Human Race Machine,to generate the series of composite photographs that appears on page 79 (two alsoappear elsewhere in this article). The machine takes a photograph of an individual—in this case, a white woman—and adds and subtracts various outward features ofracial identity to show what a person might look like if he or she were a member ofanother race. Burson says she seeks to use her work to underscore the commonalityof humanity. And indeed, outward features often say little about the bulk of aperson’s genetic makeup. The Human Race Machine was one of the most popularattractions at the Millennium Dome in London, where it drew hundreds of thousandsof people. More about the artist and her work can be found on her Web site,www.nancyburson.com

About the Photoillustrations


now considered questionable: that acombination of certain blood vessel–di-lating drugs was more effective in treat-ing heart failure in people of African an-cestry and that specific enzyme inhibitors(angiotensin converting enzyme, or ACE,inhibitors) have little efficacy in such in-dividuals. In the second article, a groupled by Neil Risch of Stanford Universitycountered that racial or ethnic groupscan differ from one another geneticallyand that the differences can have medicalimportance. They cited a study showingthat the rate of complications from type2 diabetes varies according to race, evenafter adjusting for such factors as dispar-ities in education and income.

The intensity of these arguments re-flects both scientific and social factors.Many biomedical studies have not rig-orously defined group membership, re-lying instead on inferred relationshipsbased on racial categories. The disputeover the importance of group member-

ship also illustrates how strongly the per-ception of race is shaped by different so-cial and political perspectives.

In cases where membership in a geo-graphically or culturally defined grouphas been correlated with health-relatedgenetic traits, knowing something aboutan individual’s group membership couldbe important for a physician. And to theextent that human groups live in differ-ent environments or have different expe-riences that affect health, group mem-bership could also reflect nongenetic fac-tors that are medically relevant.

Regardless of the medical implica-

tions of the genetics of race, the researchfindings are inherently exciting. For hun-dreds of years, people have wonderedwhere various human groups came fromand how those groups are related to oneanother. They have speculated about whyhuman populations have different physi-cal appearances and about whether thebiological differences between groups aremore than skin deep. New genetic dataand new methods of analysis are finallyallowing us to approach these questions.The result will be a much deeper under-standing of both our biological natureand our human interconnectedness.


NAD

IA S

TRAS

SER

Mapping Human History: Genes, Race, and Our Common Origins. Steve Olson. Mariner Books, 2003.Human Population Genetic Structure and Inference of Group Membership. Michael J. Bamshad et al. in American Journal of Human Genetics, Vol. 72, No. 3, pages 578–589; March 2003.The Importance of Race and Ethnic Background in Biomedical Research and Clinical Practice.Esteban González Burchard et al. in New England Journal of Medicine, Vol. 348, No. 12, pages 1170–1175; March 20, 2003.Race and Genomics. Richard S. Cooper, Jay S. Kaufman and Ryk Ward in New England Journal of Medicine, Vol. 348, No. 12, pages 1166–1170; March 20, 2003.

M O R E T O E X P L O R E

People from Europe/Middle East

People from Africa

AAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAG

AAAGAAAGAAAG AAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAG

Carries 2 and 3 repeats: Likely to have

African heritage

Carries 6 and 8 repeats: Likely to have ancestors from Europe or the Middle East

Number of Repeats on a Chromosome

Rela

tive

Num

ber o

f Car

riers

Chromosome inherited from mother

Chromosome inherited from father

2 3 4 5 6 7 8

Unit of repeat

DNA

Tracing Human Origins

COUNTING THE NUMBER of DNA units called short tandemrepeats on chromosomes can allow scientists to groupindividuals according to probable ancestry. One such repeat,AAAG, occurs between two and seven times in people withAfrican heritage but between five and eight times in thosewhose ancestors came from Europe or the Middle East. (Everyperson inherits one set of repeats from their mother and one

from their father.) Accordingly, someone who carries two andthree repeats is likely to have African heritage, whereassomeone with six and eight repeats probably has ancestorsfrom Europe or the Middle East. People with between five andseven repeats occur in both populations, however, makingthese individuals more difficult to classify using only thisparticular repeat. —M.J.B. and S.E.O.


BY PAUL D. SPUDIS

Although Earth’s airless satellite was the firstplanetary object to be explored by spacecraftand the only body ever visited by astronauts,scientists still have many unanswered ques-tions about its history, composition and in-ternal structure. In recent years, researchershave called for renewed exploration of themoon; the European Space Agency andJapan are planning to send probes into lunarorbit, and NASA is considering landing anunmanned spacecraft on the moon’s far side.By studying the moon, these missions mayalso illuminate the history of all the rockyplanets in the inner solar system: Mercury,Venus, Mars and especially Earth. Becausethe moon’s surface has remained relativelyunchanged for the past three billion years, itmay hold the key to understanding how theinner planets formed and evolved.

When astronomers first gazed at themoon through telescopes 400 years ago, theyfound that its surface consists of two princi-pal types of terrain: bright, rugged, heavilycratered highlands and dark, more sparselycratered lowlands. Galileo Galilei, the 17th-century astronomer, called the lowlands

maria—Latin for “seas”—because of theirsmooth, dark appearance. One of the biggestsurprises of the space age came in 1959,when the Soviet spacecraft Luna 3 pho-tographed the moon’s far side, which hadnever been seen before because it is alwaysturned away from Earth. The photographsshowed that it almost completely lacks thedark maria that are so dominant on the nearside. Although scientists now have some the-ories that could explain this dichotomy ofterrain, it remains an unsolved puzzle.

Analysis of the lunar rocks and soilbrought back to Earth by the Apollo astro-nauts and by unmanned Luna landers al-lowed researchers to get a glimpse of themoon’s evolution. The evidence suggests thatthe moon was created about 4.5 billion yearsago when a Mars-size body hit the earlyEarth. This collision sent a spray of vapor-ized rock into orbit around Earth, and thesesmall bodies rapidly coalesced into themoon. They accumulated so quickly that theheat generated by the process melted the out-er portion of the nascent moon and formeda global ocean of liquid rock, or magma. The

TheNewMoon

Recent lunar missions have shown that there is still much to learn about Earth’s closest neighbor

THE MOON does not yield her secrets easily.

D E C E M B E R 2 0 0 3

NAS

A



MOON’S SOUTH POLE is shown in this mosaic of 1,500 images taken by theClementine spacecraft’s ultraviolet/visible camera in 1994. The pole is at

the center of the mosaic; the lunar latitude of 70 degrees south is at theedge. Both Clementine and the Lunar Prospector orbiter found evidence of

water ice in the permanently shadowed areas near the moon’s poles.


lunar crust then formed from low-densi-ty minerals that floated to the surface ofthis magma ocean.

This early phase was followed by a vi-olent pelting of the moon’s surface bycomets, asteroids and meteoroids. Someof the larger objects blasted out enormousbasins more than 2,000 kilometers in di-ameter. Most craters and basins, at leaston the near side, were filled with iron-richbasaltic lava over the next 300 million to400 million years, forming the dark mariaseen today. As time went on, the bom-bardment eased, with impacts becomingless frequent and less powerful. This factexplains why the maria, which areyounger than the highlands, have fewerand smaller craters. Little has occurred onthe moon since about three billion yearsago; after the volcanic fires died, the onlyactivity has been the occasional formationof an impact crater, the constant rain ofmicrometeorites and the six blink-of-an-eye visits by a dozen astronauts more than30 years ago.

Because the moon has experiencedimpact, volcanism and tectonic activity, itcan serve as a touchstone for understand-ing those processes. In particular, themoon’s companionship to Earth makes itan ideal place for studying the extraplan-etary events that occurred in this part ofthe solar system during its early history.Nearly all traces of the asteroids andcomets that struck Earth billions of yearsago have been erased from our planet’sgeologically active surface. Yet this recordis preserved on the moon, where it can berecovered and read.

Scientists learned much from theApollo explorations, but many mysteriesremained after that program ended. Re-searchers realized that they needed to

map the moon globally with a variety ofremote-sensing instruments. A hint of thefascinating discoveries awaiting global re-connaissance came from two flybys of theEarth-moon system in the early 1990s bythe Jupiter-bound Galileo spacecraft. Inthe southern hemisphere of the moon’sfar side, mission scientists saw an unusu-al signature of high-iron rocks in the floorof the South Pole–Aitken (SPA) basin, thelargest basin on the moon. Galileo alsomapped some of the maria using spectralfilters that provided information on sur-face composition; the results suggestedthat researchers could use remote space-craft data to delineate the sequence oflava flows in the maria.

Maria and HighlandsIN 1994 the U.S. Department of De-fense launched the Clementine spacecraft.Its goal was to test lightweight sensors de-veloped for national ballistic-missile de-fense while traveling in a polar orbit of themoon. Clementine successfully orbitedthe moon for 71 days. It obtained a com-plete global map of the lunar surface in 11wavelengths in the visible and near-infrared parts of the spectrum. The space-craft also carried a laser ranger that al-lowed researchers to make a topograph-ic map of the entire moon for the firsttime. In addition, radio tracking of thespacecraft’s orbit provided better infor-mation on the moon’s gravity field. Andan improvised radar experiment uncov-ered tantalizing hints that water ice existsin the permanently shadowed areas nearthe lunar south pole.

Following up on Clementine, NASA

sent the Lunar Prospector spacecraftinto a polar orbit of the moon in 1998.One of NASA’s Discovery-class missions,

Lunar Prospector mapped the moon’ssurface composition using gamma-rayand neutron spectroscopy. It confirmedClementine’s detection of ice near thesouth pole and discovered additional de-posits at the north pole. An alpha-parti-cle spectrometer measured gas emissionsfrom the lunar interior while a magne-tometer mapped the distribution of localsurface magnetic anomalies. Additionalradio tracking of the spacecraft improvedour knowledge of the moon’s gravityfield. Finally, ground controllers deliber-ately crashed it into the moon in an at-tempt to induce a release of water vaporfrom the surface. Telescopes on Earthand in space were trained on the crashsite to observe a vapor plume, but nonewas detected.

By putting the Apollo discoveries in aglobal context, the Clementine and LunarProspector measurements prompted sci-entists to revise their understanding of themoon and its history. For example, in theOceanus Procellarum, a huge depressionin the western part of the moon’s nearside, the astronauts of Apollo 12 andApollo 14 found anomalous basalticrocks that were rich in trace elements col-lectively known as KREEP (“K” for po-tassium, “REE” for rare-earth elementsand “P” for phosphorus). Geologists re-fer to these trace elements as incompati-ble—that is, they do not fit well into thecrystal structures of common rock-form-ing minerals. The presence of KREEP-richrocks indicates that the early moon un-derwent intense melting and differentia-tion, a process in which the incompatibleelements were concentrated in the moltenpart of an increasingly solid, crystallizedsystem. Lunar Prospector revealed thatthe highest concentrations of KREEP oc-cur in the Oceanus Procellarum, althoughthe reason for this unusual distribution isnot clear.

Furthermore, the lunar orbiters con-firmed that the highlands of the moon aredominated by anorthosite, an igneousrock composed primarily of the mineralfeldspar and rich in calcium and alu-minum. These rocks were created early inlunar history, when the outer portion ofthe moon was completely molten; thelow-density anorthosite floated to the sur-


■ In the 1990s the Clementine and Lunar Prospector spacecraft providedscientists with global maps of the moon’s topography, surface composition,gravitational variations and magnetic anomalies.

■ The findings gave context to the discoveries made by the Apollo missions butalso raised new questions. In particular, researchers want to know more aboutthe violent bombardment of the moon that occurred about four billion years ago.

■ The European Space Agency, Japan and the U.S. plan to send more unmannedprobes to the moon to solve some of the lingering lunar mysteries.

Overview/The Moon’s Mysteries


face of the magma ocean. Although sci-entists had postulated this phase of lunarhistory based on the Apollo samples, theproof came from the Clementine and Lu-nar Prospector data, which indicated theglobal distribution and large abundanceof anorthosite. Because the only source ofheat that could melt the entire moonwould be a very rapid accumulation ofsmall bodies, the presence of large quan-tities of anorthosite in the lunar crust sup-ports the theory that the moon coalescedfrom the debris of a planetary collision.

The lunar orbiters also explained oneof the more puzzling discoveries of theApollo missions: the unusually high con-tent of titanium in the mare basalts col-lected by the Apollo 11 astronauts duringthe first moon landing. Lunar geologistshad been hard-pressed to explain howvery high density, titanium-rich magmascould have ascended through the moon’slow-density anorthosite crust. Clementineand Lunar Prospector showed that thehigh-titanium lavas found by Apollo 11are actually quite rare on the moon. Al-though mare basalts have a range of tita-nium concentrations, only a small frac-tion have the extreme compositions ob-served at the first landing site in the Sea of

Tranquility. Lunar researchers learned avaluable lesson: samples from a single lo-cation on the moon are not necessarilyrepresentative of large regions.

Because lava flows typically have uni-form and distinct compositions, the datafrom Clementine and Lunar Prospectorcan be used to map the flows that have oc-curred in the maria. The age of each flowcan then be determined by measuring itsdensity of impact craters. Older mareflows have been exposed to bombard-ment longer than younger flows, so theyhave higher crater densities. Scientists al-ready know the ages of the mare flows atthe Apollo sites from analyzing the ra-dioisotopes in the rock samples, so theycan estimate the ages of other flows bycomparing their crater densities withthose of the landing-site flows. The resultsshow that although the moon has marelavas of widely varying compositions and

ages, the bulk erupted between 3.8 billionand three billion years ago.

Although maria are recognized bytheir dark color, certain areas of the high-lands appear to be intermediate in re-flectance and contain relatively highamounts of iron. Some of these surfacesare mare deposits that have been coveredby blankets of highland debris—layers ofejected rock spread by the impacts thatcreated the moon’s basins. Because thesemare lavas predate the highland debrislayers, which were laid down duringbasin formation 3.8 billion years ago,they indicate that the eruption of lavaonto the moon began well before the agesof the oldest mare flows sampled by Apol-lo. Global mapping has shown that theseancient mare flows are very widespreadacross the far side of the moon and thelimb regions (the border between the nearand far sides).


LUN

AR A

ND

PLA

NE

TAR

Y IN

STIT

UTE

PAUL D. SPUDIS is a senior professional staff member at the Applied Physics Laboratory ofJohns Hopkins University. Since 1982 he has been a principal investigator in the PlanetaryGeology Program of the NASA Office of Space Science, specializing in research on the pro-cesses of impact and volcanism on the planets. From 1980 to 1990 he was a geologist withthe U.S. Geological Survey’s Branch of Astrogeology, and from 1990 to 2002 he was a staffscientist at the Lunar and Planetary Institute in Houston. He was deputy leader of the sci-ence team for the U.S. Department of Defense’s Clementine mission to the moon in 1994.

THE

AU

THO

R

Light and Dark

Mare Imbrium

Mare Tranquillitatis

South Pole–Aitken Basin

Mare Serenitatis

NEAR SIDE FAR SIDE

15

CLEMENTINE’S IMAGES of the moon’s near side show the twoprincipal types of terrain: bright, heavily cratered highlands anddark, smooth lowlands called maria. In contrast, the far side

almost completely lacks maria. Six Apollo missions visited the nearside (the yellow circles show the landing sites and missionnumbers). Now NASA wants to send a robotic lander to the far side.

17

OceanusProcellarum

12 14

16

11


CR

ED

IT

Moon Maps

KILOMETERS

0 8–8 –4 4

0

8

16

<0.5

1

3

>6

IRON

THORIUM

0.228–0.230

0.223–0.225

0.217–0.219

0.212–0.214

TOPOGRAPHY

WATER ICE

FLUX OF MEDIUM-ENERGY

NEUTRONS (neutrons per square

centimeter per second) PAU

L D

. SP

UD

IS A

ND

LU

NAR

AN

D P

LAN

ETA

RY

INST

ITU

TE (

top

ogra

ph

y,

iron

an

d t

hor

ium

ma

ps)

; R

EP

RIN

TED

BY

PE

RM

ISSI

ON

FR

OM

A.

S. K

ON

OP

LIV

ET

AL.

IN S

CIE

NC

E, V

OL.

28

1,

PAG

ES

14

76

–1

48

0,

19

98

(g

ravi

ty m

ap

), A

ND

W.

C.

FELD

MAN

ET

AL.

IN S

CIE

NC

E, V

OL.

28

1,

PAG

ES

14

96

–1

50

0;

19

98

(w

ate

r ic

e m

ap

); ©

19

98

AAA

S

GRAVITY

5

1

0

–2.5

CLEMENTINE’S CAMERAS captured images in 11 wavelengths in the visibleand near-infrared parts of the spectrum. Using data from two of thosewavelengths (750 and 950 nanometers), researchers created a mapshowing the concentration of iron in the soils of the lunar surface. Iron levelsare highest in the maria on the near side and lowest in the central part of thefar side (above the South Pole–Aitken basin).

GAMMA-RAY SPECTROMETER was used by Lunar Prospector to measure theabundance of 10 elements in the moon’s crust. One of those elements wasthorium, which behaves much like the trace elements collectively known asKREEP—it does not fit well into the crystal structures of common rock-formingminerals. The highest levels of thorium occur in the Oceanus Procellarum onthe near side, but the reason for this unusual distribution is not clear.

TRAVELING IN AN ORBIT that came as close as seven kilometers to the lunarsurface, Lunar Prospector was able to precisely measure variations in themoon’s gravity. Careful tracking of the spacecraft’s orbit revealed strongerthan expected gravity (red areas) above some of the youngest impactbasins. One possible explanation is that plugs of dense rock from the lunarmantle may have risen toward the surface of the basins after impact.

LUNAR PROSPECTOR also discoveredevidence of water ice at the moon’s poles.

The craft’s neutron spectrometer found a lackof medium-energy neutrons bouncing off

permanently shadowed areas (purple). Iceslows down neutrons because of collisions

with hydrogen atoms in water molecules.The results confirmed Clementine’sdetection of ice in these dark areas.

NEAR SIDE FAR SIDE

THE OBSERVATIONS made by theClementine and Lunar Prospector

spacecraft enabled scientists to drawthe first detailed global maps of the

moon’s surface. Clementine carried alaser ranger that measured the

distance to the surface once a secondduring each polar orbit. The results

showed the enormous extent of theSouth Pole–Aitken basin (purple

splotch on moon’s far side), an impact feature that stretches

2,600 kilometers across.

SOUTH POLENORTH POLE

ABUN

DANC

E OF

FER

ROUS

OXID

E (p

erce

nt)

ABUN

DANC

E OF

TH

ORIU

M(p

arts

per

mill

ion)

ACCE

LERA

TION

(m

illim

eter

s pe

r sec

ond

per s

econ

d)


Bumpy and LumpyTHE MOON IS a very rough world. Thedifference in altitude from its lowest point(within the SPA basin) to its highest (onthe rim of the Korolev basin on the farside) is more than 16 kilometers. OnEarth, where the maximum altitude dif-ferential is about 20 kilometers, surfacetopography is the result of tectonic activ-ity that creates high mountain belts anddeep ocean trenches. The moon, in con-trast, has a static outer shell; the lunarcrust has been cold and rigid for at leastthe past four billion years. Topographicrelief on the moon is entirely related toimpact craters and basins. It is no accidentthat the largest basin on the moon is alsothe locale for the greatest extremes in al-

titude, although it is somewhat surprisingthat such a large and old feature still re-tains most of its original relief.

Internally, the moon also appears tobe quite lumpy. Radio tracking of the tra-jectory of Lunar Prospector, which trav-eled in a low orbit that came as close asseven kilometers to the lunar surface,showed stronger than expected gravityabove some of the youngest impactbasins. Scientists do not think the marebasalts in the basins are the source of thegravity anomalies; individual lava flowsappear to be quite thin—from a few me-ters to a few tens of meters—and total ac-cumulations are typically 200 meters orless. Rather researchers believe the massconcentrations are plugs of dense rockfrom the lunar mantle that rose towardthe surface of the basins after impact.

The moon’s unusual dichotomy ofterrain, with the near side dominated bydark maria and the far side by brighthighlands, may also be explained bystructural differences under the surface.Although scientists have not definitivelyresolved this problem, the most likely rea-son for the dichotomy is that the crust on

the near side is relatively thinner, andtherefore ascending magmas can reachand break through the surface more eas-ily there than on the far side. The enor-mous SPA basin contains most of themare lavas on the far side, yet even thesedeposits are very thin and of limited ex-tent. The SPA basin as a whole is largelyunfilled by mare lavas, whereas even thesmallest basin on the near side tends tohave copious lava fill.

The topographic map produced byClementine’s laser ranger revealed the as-tounding dimensions of the SPA basin,which stretches 2,600 kilometers across,making it the largest impact crater in theentire solar system. Clementine also doc-umented the presence of numerous addi-

tional basins, some of which were un-known before the orbiter’s flight. Re-searchers now estimate that the moon hasmore than 45 basins (defined as impactfeatures with diameters greater than 300kilometers). Based on crater densitieswithin the basins, SPA appears to be theoldest and Orientale the youngest.

Scientists, however, know the absoluteages of only the basins that were visitedby the Apollo and Luna missions. Ra-dioisotope dating of the impact-melt sam-ples—rocks that melted when an asteroidor comet struck the moon, therefore re-vealing when an impact occurred—showsthat all these basins formed in a narrowinterval between 3.9 billion and 3.8 bil-lion years ago. This small range of basinages has been interpreted to mean that themoon experienced a very high impact ratefor a short period, which has been dubbedthe lunar cataclysm.

But how could such a deluge have oc-curred? Models of the solar system’s ear-ly history posit that the frequency of im-pacts should have tapered off between 4.5billion and four billion years ago becausemost of the planetesimals—the small

rocky bodies that formed from the solarnebula—were gradually cast out of the in-ner solar system or absorbed by the out-er planets. If researchers can confirm thatthe lunar cataclysm did indeed occur, thediscovery would have profound implica-tions for the history of all the inner plan-ets. It is possible, for example, that a verylarge body in the asteroid belt broke apartabout 3.9 billion years ago and that thedebris was swept toward the Earth-moonsystem. If that is the case, it could meanthat lunar cratering history is unique andcannot be used as a guide for dating fea-tures on other planets besides Earth.

One way to tell whether the lunar cat-aclysm actually occurred would be to de-termine the absolute age of the SPA basin.

Scientists know that SPA must be olderthan any other lunar basin, and the oldestof the basins that can be reliably datedfrom impact-melt samples is Mare Seren-itatis, which is estimated to be 3.87 billionyears old. The impact that created SPAclearly happened after the lunar crust so-lidified, which occurred about 4.3 billionyears ago. The age of SPA must thereforefall between these dates, but nearer towhich end?

If SPA is found to be close in age to theother basins, then scientists would have astrong argument for the lunar cataclysm.On the other hand, if SPA’s age is deter-mined to be close to the solidification ageof the lunar crust, there would be no needto postulate a lunar cataclysm. The moon’scratering history could be seen as evi-dence of an exponentially declining fre-quency of impacts. In this case, the lunarrecord could indeed serve as a guide to theinterpretation of cratering on inner plan-ets such as Mars. To date the SPA basin,however, researchers would need to ob-tain samples of its impact melt.

Perhaps the most exciting result of theClementine and Lunar Prospector mis-


NAS

A

The moon may hold the key to understanding how the INNER PLANETS FORMED AND EVOLVED.


sion was the evidence of water ice at thelunar poles. Because the moon’s spin axisis inclined just 1.5 degrees—that is, itsaxis is almost perpendicular to the planeof Earth’s orbit around the sun—the sunis always at or near the horizon whenviewed from the lunar poles. (In contrast,Earth’s axis is tilted about 23 degrees.) Ifa place near the lunar pole is about 600meters above the average surface eleva-tion, it is in permanent sunlight; if it is atleast 600 meters below the surface, it is inperpetual shadow. In the latter areas, theonly sources of heat would be the meageramount of radioactive decay from the lu-nar interior and the feeble cosmic radia-tion. Scientists estimate that these per-manently dark regions, which have ex-isted for two billion to three billion years,are extremely cold—on the order of –223to –203 degrees Celsius. These cold trapscould accumulate water ice derived fromcomets and meteorites hitting the moon,

because the ice would never be vaporizedby sunlight.

Although Clementine did not carryany instruments specifically designed tosearch for polar ice, the mission’s scienceteam was able to improvise an experi-ment using the radio transmitter onboardthe spacecraft. Whereas rocky surfacesscatter radio waves randomly, ice partlyabsorbs the waves and reflects some ofthem coherently. When Clementine di-rected radio waves at permanently shad-owed regions near the moon’s south pole,the reflected signals were characteristic ofan icy surface. Four years later the neu-tron spectrometer carried by Lunar Pros-pector showed large amounts of hydro-gen in the dark regions of both poles; themost likely explanation is that the craftdetected the hydrogen in water ice. Cur-rent estimates indicate that more than 10billion tons of ice exist within the upperfoot or so of the surface at both poles. Re-

searchers do not know, however, thephysical state of this material, its exactcomposition, purity or accessibility. Thisknowledge can be acquired only by futuremissions to the moon.

The images from Clementine alsoshowed that some regions near themoon’s poles appear to be in near-con-stant sunlight. An area near the rim ofShackleton crater, for example, is illumi-nated for more than 75 percent of the lu-nar rotation period. These areas have arelatively benign thermal environment,with surface temperatures ranging from–60 to –40 degrees C. (In contrast, tem-peratures near the lunar equator swingfrom –150 to 100 degrees C.) Locating anunmanned or manned outpost in one ofthe sunlit areas near the poles wouldgreatly ease the challenge of designingequipment to survive the temperature ex-tremes of the lunar surface. And if icecould be retrieved from a permanently

Back to the Moon

LUN

AR A

ND

PLA

NE

TAR

Y IN

STIT

UTE

The resurgence of scientific interest in the moon has inspired space agencies to plan new lunar missions.

Spacecraft Country Launch Date Mass without Fuel Lunar Research(kilograms)

PAST AND PRESENT MISSIONS Clementine U.S. Jan. 25, 1994 227 Used cameras and laser ranger to map surface composition

and topography. Radar experiment found first evidence of water ice at the lunar poles.

Lunar Prospector U.S. Jan. 7, 1998 158 Spectrometers revealed abundance of elements in the crust and detected further evidence of ice. Magnetometer and electron reflectometer measured magnetic fields.

SMART-1 European Sept. 27, 2003 280 On arrival at the moon in early 2005, camera and spectrometers Space will chart the moon’s minerals and peer into dark craters Agency to search for ice.

FUTURE MISSIONS Lunar A Japan Aug.–Sept. 2004 520 The orbiter will drop two penetrators that will burrow into the

surface on opposite sides of the moon. Seismometers and heat-flow sensors will probe the lunar interior.

SELENE Japan 2005 1,600 Large array of cameras, spectrometers and other instruments will map the moon’s surface composition, topography, gravity and magnetic fields in even greater detail.

South Pole– U.S. Before 2010 To be determined Robotic lander will collect samples of rock and soil from Aitken Basin the basin floor and rocket them to Earth for analysis of age Sample Return and composition.


dark area nearby, the base would have asource of water that could be used for lifesupport as well as for rocket fuel (bybreaking the water into liquid hydrogenand oxygen, the most powerful chemicalpropellants).

Return to the MoonAS A RESULT of the successes of Clem-entine and Lunar Prospector, a spate ofnew lunar missions are in various stagesof preparation. In September the Euro-pean Space Agency launched the SMART-1 spacecraft, whose primary mission is totest an ion-propulsion engine during a 16-

month journey to the moon. After enter-ing lunar orbit, SMART-1 will use a cam-era and x-ray sensor to map the moon’ssurface. In 2004 Japan is scheduled tolaunch Lunar A, an orbiter that will droptwo hard-landing probes, called penetra-tors, to the moon’s surface. Equippedwith seismometers and heat-flow sensors,the probes will gather information on themoon’s interior and possibly map itscore. And in 2005 Japan plans to followup the mission with a larger orbiter calledSELENE. This craft will map the moon ineven greater detail using x-ray and gam-ma-ray spectrometers, a terrain camera, alaser altimeter and a radar sounder.

In addition, the newly appreciated sig-nificance of the SPA basin has revived theidea of landing a robotic probe there tocollect samples and rocket them to Earthfor analysis. A 2002 report by a panel ofscientists sponsored by the NationalAcademy of Sciences advocated such amission. The primary goal of the effortwould be to obtain samples of the SPAbasin’s impact melt. By revealing whenthe basin formed, these rocks could set-tle the question of whether there was a lu-nar cataclysm. Moreover, because the im-pact melt is a composite of all the rocksthat were struck by the colliding asteroid

or comet, studying it could reveal thecomposition and structure of the lunarcrust in the basin target site. Some re-searchers suspect that the colliding objectmay well have penetrated the crust andexposed parts of the upper mantle, pos-sibly from depths as great as 120 kilome-ters. If the impact melt contains some ma-terial from the mantle, scientists may beable to characterize in some detail thecomposition of the deep lunar interior.

A sample-return mission to the SPAbasin is simple in concept but difficult toexecute. Mission planners must select alanding site that would yield the proper

samples to solve the scientific issues con-cerning the SPA’s age and composition.Researchers can use existing remote-sens-ing information to identify areas that, byvirtue of their composition and geologicsetting, are good candidates to yield thedesired rocks. Because the sites would beon the moon’s far side, the lander wouldhave to either operate autonomously orcommunicate with ground controllersthrough a relay satellite.

What is more, the spacecraft must ob-tain both rocks and soil from the landingsite. Rocks are needed to analyze the min-eralogy and date the samples, whereas thesoil enables scientists to determinewhether the collected rocks are actuallyrepresentative of the area. (The soil mayalso contain small fragments of rare or ex-otic rock types.) The samples must bepacked into a small Earth-return vehiclecarried by the lander. This vehicle wouldthen use a rocket engine to lift it off the

moon and put it on a course back toEarth. After using Earth’s atmosphere todecelerate, the vehicle would land in a re-mote area and turn on a radio beacon toattract the recovery team. All these ele-ments make the mission ambitious andtechnically challenging, but it is well with-in our capabilities.

NASA has already requested proposalsfor a sample-return mission to the SPAbasin, which could be launched before2010. But when will astronauts return tothe moon? There are numerous scientificreasons for human exploration. A mannedmission would provide excellent opportu-

nities for a whole range of studies, fromplanetary exploration to astronomy. Andthe existence of water ice at the lunar polescould make it much easier to establish apermanent human presence. NASA has re-cently sketched out proposals that wouldpermit new human missions to the moonusing existing launch and space trans-portation infrastructure, thereby savingbillions of dollars in development costs.

But the return of astronauts to themoon requires a political rationale, not ascientific justification. It will never be un-dertaken solely for scientific purposes, norshould it. The missions must address awide range of national concerns. Once wedo return, though, new vistas of scientif-ic possibilities will beckon. We have readpart of the moon’s story, but much is stillmurky. Future exploration will most like-ly show us that the history of our closestneighbor is more complicated and inter-esting than we ever imagined.


NAS

A

The Once and Future Moon. Paul D. Spudis. Smithsonian Institution Press, 1996.A New Moon for the Twenty-First Century. G. Jeffrey Taylor in Planetary Science ResearchDiscoveries, August 2000. Available online at www.psrd.hawaii.edu/Aug00/newMoon.htmlLunar Meteorites and the Lunar Cataclysm. Barbara A. Cohen in Planetary Science ResearchDiscoveries, January 2001. Available online at www.psrd.hawaii.edu/Jan01/lunarCataclysm.htmlThe Clementine Atlas of the Moon. D. Ben J. Bussey and Paul D. Spudis. Cambridge University Press, 2004.


The return of astronauts to the moon requires a political rationale, NOT A SCIENTIFIC JUSTIFICATION.



APP

HO

TO

The Wrights used aerial control as the key to building

and flying the first airplane. But trying to refine their

invention in secret nearly cost them their glory

By Daniel C. Schlenoff

WILBUR AND ORVILLE WRIGHT (left and right), printers,bicycle mechanics, inventors of the powered airplane.

The Equivocal Success of the

n December 17, 1903, Orville Wright took offin a powered airplane, flew for 12 seconds and 120 feet, thenbumped down into the sand. A century later we honor the dateas an aviation milestone, but for that flight alone it is hard to ar-gue that the Wrights were more successful than other inventorswho had already flown farther (and crashed harder).

It took two more years for the Wrights to build and fly theworld’s first truly controllable airplane. Unfortunately, until theyfelt sure of the sale of their perfected machine, their secretivenessinvited skepticism from Scientific American and other publicationsof the day and left them underappreciated by their peers and thegeneral public.

Other contenders for the “first airplane” laurels merely madeshort or uncontrolled flights. Clement Ader can be credited withthe first powered takeoff in 1890. But his steam-powered aircraftreached an altitude of eight inches, sufficient to classify it as a flightonly to his French countrymen. German-born Gustave Whiteheadwas adept at fabricating stories about flying in the U.S., but he nev-er built a workable airplane. New Zealanders are proud ofRichard Pearse: in March 1903 this reclusive, eccentric farmer flewhis bamboo-and-canvas monoplane for about 450 feet beforecrashing into a gorse hedge. His example illustrates, rather painful-ly, the need for controllability in aerial navigation.

Control Is the KeyWILBUR WRIGHT, in a talk before the Western Society of Engi-neers in Chicago in September 1901, said that the greatest obsta-cle to a functional airplane was “the balancing and steering of themachine after it is actually in flight.” The Wrights therefore gavepriority to working out a method of aerial control. They also re-


alized that just as a cyclist needed to learn how to ride a bicy-cle, a pilot would have to learn how to fly.

The Wrights studied the work of Otto Lilienthal, a Germanengineer widely considered to be the world’s first pilot. Lilien-thal made thousands of flights in sophisticated gliders of his owndesign, steering by shifting his body just as hang gliders do to-day. He perished after a flying accident, however, and theWrights decided they needed a method of control more suitablefor airplanes big enough to carry a motor. They thought that ifthe wingtips could be warped while in flight, then the balanceand the direction of the flying machine could be maintained.

In August 1899 the Wrights, taking a break from their prof-itable bicycle business in Dayton, Ohio, constructed a small bi-plane kite with a five-foot wingspan to test some of their theo-

ries. The kite was rigged with wires that slightly twisted thewings while aloft. An elevator, a small wing set forward of themain wing, stabilized the pitch (up-and-down motion) of thecraft. Promising results encouraged them to make a scaled-upversion in 1900 with a wing area of 165 square feet.

They took this kite to Kitty Hawk, on the Outer Banks ofNorth Carolina, where consistently steady breezes blew off theAtlantic Ocean and the gently sloping sand dunes providedspace and a soft landing. The Wrights were pleased enoughwith the results of their experiments to return in 1901 with anambitiously larger glider, but they went back to Dayton puz-zled by problems they had encountered with the contemporaryaeronautical data. To refine their wing designs, they testedmore than 60 model cross sections in a wind tunnel they built.


SCIE

NTI

FIC

AM

ERIC

AN,

VOL.

XC

IV,

NO

. 9

, AU

GU

ST 2

9,

19

08

THE WRIGHT AIRPLANEis publicly demonstratedby Wilbur for the firsttime. His flights in theModel A on August 8,1908, at a racetracknear Le Mans, France,showed that the Wrightswere far ahead of any competitor.


From the information they gleaned came the 1902 glider,with an efficient, long, narrow wing design. They added a twinvertical tail to control yaw (side-to-side movement). The pilotlay prone in a hip cradle, and his own lateral movement pulledwires that warped the wings and controlled flight direction. AtKitty Hawk during the late summer and early fall, both broth-ers logged many hours of unpowered flight in this glider.

Having constructed and learned how to fly an unpowered air-craft, the Wrights then embarked on creating a more robust, mo-torized version. Most automobile engines being too heavy, theydesigned their own and built it using an aluminum-copper alloy.

To find the optimal shape for propellers, they turned againto wind-tunnel testing, treating the propeller as a small revolv-ing wing. Their design had an efficiency of almost 70 percent,just 10 percent less than modern versions. They mounted twoof these propellers at the back of the aircraft [see illustration onopposite page], rotating in opposite directions to counter effectsfrom torque.

The Great DayAT KILL DEVIL HILLS near Kitty Hawk on December 17,1903, the Wrights sat their Flyer 1 on the launching rail, laidon flat sand. Orville was at the controls (decided by a coin toss).They started the motor and, with Wilbur running alongsideguiding the wing, the craft became airborne—briefly. If it is de-batable whether the first flight of the day was a controlled flightor a hop, the fourth and last, with Wilbur at the controls, wasdefinitive: it covered 852 feet in 59 seconds. The Wrights hadflown a powered, heavier-than-air machine in free, controlled,sustained flight. Nine days later Scientific American cautiously

noted: “This is a decided step in advance in aerial navigationwith aeroplanes” [see 50, 100 & 150 Years Ago, on page 22].

The Wrights were triumphant aircraft inventors. Unfortu-nately, they were terrible aviation businessmen. They becameso concerned about losing financial control of their inventionthat they kept it away not only from the prying eyes of com-petitors but also from potential customers and those who couldhave helped spread word of their progress. Even after they wereawarded patent number 821,393 in May 1906 (after a wait ofthree years), they did not believe that it offered much protec-tion—an opinion that turned out to be justified.

Back in Dayton, at Huffman Prairie, the Wrights continuedwork on producing a salable flying machine. With their Flyer 2they made more than 100 short flights, later on using a catapultto facilitate takeoff. Still, they avoided the limelight, much tothe frustration of aviation enthusiasts excited by snippets ofnews. In June 1904, with rumors trickling in from Dayton, Sci-entific American complained: “Great secrecy was maintainedabout the test, and but few witnessed it.”

There was at least one witness, Amos Ives Root, and hewrote an article about what he had seen. He published it in hismagazine, Gleanings in Bee Culture, on January 1, 1905. Rootclaimed that Scientific American had rejected his offer to pub-lish the article. We have no record of why the editors mighthave done so, but perhaps the style was too flowery for theirtaste. Here is the first sentence as it appeared in Bee Culture:“I have a wonderful story to tell you—a story that, in some re-spects, out rivals the Arabian Nights fables—a story, too, witha moral that I think many of the younger ones need, and per-haps some of the older ones too if they will heed it.”


CO

UR

TESY

OF

SPE

CIA

L C

OLL

EC

TIO

NS

AND

AR

CH

IVE

S, W

RIG

HT

STAT

E U

NIV

ER

SITY

THEORIZE, TEST, REFINE:The Wrights applied thelessons they learnedfrom more simple flyingmachines. Thisphotograph, more than acentury old, shows themconducting experimentson their glider/kite nearKitty Hawk, N.C., in 1901.


The Flyer 2 and the Flyer 3 were as difficult to control as theKitty Hawk Flyer, and hard landings were frequent (pointsworth remembering by those attempting modern re-creationsof the aircraft). A crash in July 1905 forced the Wrights into aradical and fortuitous reconstruction of the Flyer 3. They en-larged the control surfaces and placed them farther from thecenter of balance. On October 5, 1905, with Wilbur at the con-trols, the airplane flew 24 miles in 39.5 minutes.

The Wrights had developed the world’s first truly practicalairplane and clinched their status as avia-tion pioneers. But it was a laurel conferredby history alone, because the Wrights al-lowed so few people to observe—or pho-tograph—the aircraft flying. It was not un-til 1990 that the Flyer 3 was designated asa National Historic Landmark, the soleairplane ever to receive that honor.

The Wrights offered to sell the airplaneto, variously, the U.S. secretary of war, theFrench, the British and the Germans. Butthey refused to demonstrate its flight ca-pabilities without a signed sales contract.Not surprisingly, customers balked at buy-ing so novel a device without seeingwhether it worked.

Unable to get additional informationfrom, or about, the Wrights, ScientificAmerican commented huffily in a January1906 article, “It seems that these allegedexperiments were made at Dayton, Ohio,a fairly large town, and that the newspapers of the UnitedStates, alert as they are, allowed these sensational performancesto escape their notice.”

The French dubbed the Wrights “bluffeurs.” A Germanaeronautical journal called their flights “ein amerikanischer‘bluff.’ ” The Wrights, however, did not think their flying ma-chine sufficiently advanced to demonstrate it yet.

Fame Slips AwayMEANWHILE, FAR AWAY from Dayton, in France, Brazilian-born Alberto Santos-Dumont made the first public demonstra-tion of flight. He took off from a field on November 12, 1906,and flew for 722 feet. Because there was no proof to the contraryat the time, he was hailed as the first man to fly. His countrymen

today still revere Santos-Dumont as the Father of Aviation.In an effort to encourage innovation in aeronautics, the

Aero Club of America and this magazine offered a prize in 1907to the first person who could take off and fly one kilometer ina straight line. The Wrights chose to pursue sales contracts anddid not compete for the prize. Glenn Hammond Curtiss and theAerial Experiment Association, backed by Alexander GrahamBell, entered and won the trophy with their June Bug aircraft ina triumphal flight on July 4, 1908. Because of this feat and the

prominence of Curtiss in early Americanaviation as a pilot and inventor, many inthe U.S. believed he was the first to fly.

The Wrights waited until they wereclose to selling airplanes to both the U.S.Army Signal Corps and to a French syndi-cate before showing their aircraft publicly.Starting on August 8, 1908, at a racetracknear Le Mans, France, in a Wright ModelA Flyer, Wilbur astonished viewers withmultiple flights of unprecedented pilotingskill and technological advance, and theWrights were hailed as heroes.

By 1909 the Wrights reached the peakof their fame. In the autumn of that yearperhaps a million astounded onlookerssaw Wilbur fly over New York Harbor andaround the Statue of Liberty; a few dayslater a similarly huge crowd saw him takean aerial trip up the Hudson River.

Yet the burgeoning field of aviation wasrapidly overtaking the Wrights as money and talent poured intothis exciting new industry. By 1911 several companies, mostlyin Europe, were manufacturing aircraft that were safer, fasterand more maneuverable than the Wright flyers.

When Wilbur died of typhoid fever in 1912, Orville was leftfloundering against the rising tide of competition and fightingprotracted patent-infringement lawsuits. By 1915 he had tiredof the flying business, and he quit. But he never gave up strug-gling to secure his status in the history books as half of the teamthat had worked so hard and so successfully to solve the prob-lem of airplane flight.

Daniel C. Schlenoff edits the 50, 100 & 150 Years Agocolumn in Scientific American.


SCIE

NTI

FIC

AM

ERIC

AN,

VOL.

24

1,

NO

. 1

, JU

LY 1

97

9

A POPULAR MYTH about the Wright brothers is that “they wereconsidered cranks because everyone knew that flying was im-possible.” Untrue. This fiction is based on the turn-of-the-cen-tury writings of several skeptics, principally Simon Newcomb, aprominent astronomer, who noted the difficulty of scaling up thepower needed for working models to full-size aircraft. The real-ity is that people had been flying since 1783, thanks to the in-vention in France of a practical hot-air balloon by brothers

Joseph-Michel and Jacques-Étienne Montgolfier. By 1903 pow-ered balloon flights and glider soaring were commonplace, andengines were becoming lighter and producing more horsepow-er. Fitting the elements together was acknowledged as tricky,risky and expensive, but few people thought that airplane flyingwould always be “impossible.” It was the Wrights’ secretivenessthat made this magazine (and many others) skeptical abouttheir accomplishment. —D.S.

A Wright Brothers Myth

PAINTING of a section of the 1903 Flyer,with one of its 8.5-foot-long propellers,graces the cover of our July 1979 issue.


By David A. Kring and Daniel D. Durda

The dinosaur-killing impact set off a wave of wildfires that consumed Earth’s forests

BURNEDThe Day theWORLD


to an abrupt end. Less well known, though, is exactly how theyand so many other species became extinct and how ecosystemsmanaged to rebuild themselves afterward. The cataclysm wentfar beyond the regular insults from which living things must re-cover. The asteroid or comet flashed through the sky more than40 times as fast as the speed of sound. It was so large that whenits leading edge made contact with ground, its trailing edge wasat least as high as the cruising altitude of a commercial airlin-er. It produced an explosion equivalent to 100 trillion tons ofTNT, a greater release of energy than any event on our planetin the 65 million years since then.

The remnants of that collision lie below the tropical forestof the Yucatán, the Maya ruins of Mayapán, the seaport villageof Progreso and the waters of the Gulf of Mexico. The crater,called Chicxulub after modern Maya villages in the area, is ap-proximately 180 kilometers in diameter and is surrounded bya circular fault 240 kilometers across, apparently produced

when the crust reverberated with the shock of the impact.Science sometimes overwhelms science fiction in its capacity

to startle and amaze. Such is the case for this impact. It destroyedone world and made way for a new one. But studies over the pastseveral years suggest that the impact did not kill off species di-rectly or immediately. Rather it had a variety of severe and com-plex environmental effects that spread the devastation world-wide. One of the most destructive forces was the ignition of vastwildfires that swept across continents. The fires wiped out crit-ical habitats, wrecked the base of the continental food chain andcontributed to a global shutdown of photosynthesis.

Broiler OvenTO SEE THE IMPRINT of mass death for yourself, you canvisit any number of rock outcrops in the western U.S., south-ern Europe and elsewhere. An especially good location is theRaton Basin in Colorado and New Mexico [see illustration onpage 104]. Sandwiched between rock layers from the Creta-ceous (K) period of the dinosaurs and the subsequent Tertiary(T) period is a one-centimeter layer of clay laced with exotic el-ements. Looking closely at the layer in various locations aroundthe world, Wendy S. Wolbach of DePaul University and her col-leagues made a startling discovery in 1985. They found micro-scopic particles of soot—spherical particles of carbon oftenclustered like grapes, with a composition that matches thesmoke from forest fires. Globally the soot amounts to nearly 70billion tons of residue. It is the ash of the Cretaceous world.

At the time, the soot interested researchers mainly as addi-tional evidence that the mass extinction was caused by an im-pact rather than by volcanoes, whose effect would not havebeen so abrupt or widespread [see “An Extraterrestrial Im-pact,” by Walter Alvarez and Frank Asaro; Scientific Amer-ican, October 1990]. In 1990 University of Arizona planetaryscientist H. Jay Melosh and his colleagues described how an im-


ALFR

ED

T.

KAM

AJIA

N (

pre

ced

ing

pa

ges

)■ The Chicxulub impact is notorious as the cause of the

Cretaceous-Tertiary mass extinction, which claimed thedinosaurs and more than 75 percent of animal and plantspecies on Earth. Less well known are the global wildfiresthat the impact ignited.

■ As fast-moving debris superheated the atmosphere,vegetation burst into flame over much of the planet.Animals had nowhere to flee. Ecosystems collapsed. Firewas among the most destructive of the impact-generatedenvironmental calamities.

■ Not all areas were equally affected. Far to the north of theimpact site, for example, many species survived. Fromthese niches, life repopulated the planet.

Overview/Dinosaur Barbecue

By now it is common knowledge that the impact ofan asteroid or comet brought the age of the dinosaurs


LATE CRETACEOUS swamps and rivers in North America had a mix ofconiferous, broad-leaved evergreen and deciduous trees. They formedcanopied forests and open woodlands with understories of ferns,aquatic plants and flowering shrubs.

THE CHICXULUB IMPACT occurred in a shallow sea and immediatelylofted rocky, molten and vaporous debris into the atmosphere. The bulk of the debris rained down on nearby continental regions, butmuch of it rose all the way into space.

AFTER FIRES had ravaged the landscape, only a few stark trunks and skeletons remained. Soot from the fires and dust from the impact slowly settled to the ground. Sunlight was dramatically, if not totally, attenuated for months.

SHRUBS TOOK ADVANTAGE of the vacant landscape and began to coverit. Species pollinated by the wind did better than those that relied oninsects. Trees began to grow, but it took years for forest canopies torebuild. The recovery time is uncertain.

THE VAPOR-RICH PLUME of material expanded to envelop Earth. As material in that plume fell back to the ground, it streaked through the atmosphere like trillions of meteors, heating it in some places by hundreds of degrees.

THE POSTIMPACT ENVIRONMENT was less diverse. Ferns and algae werethe first to recover. Plant species in swamps and swamp marginsgenerally survived better than species in other types of ecosystems.Conifers fared particularly badly.


CH

RIS

BU

TLE

R

A World Lost, a World Remade

THE DAY BEFORE IMPACT

40 MINUTES

ONE YEAR 50 YEARS

ONE WEEK


pact could have set off fires around the world. As it hit, the as-teroid or comet disintegrated and vaporized a chunk of Earth’scrust, creating a plume of debris. With increasing speed, thefiery plume rose out of the crater and rocketed through the at-mosphere, carrying crystals of quartz that, only moments be-fore, had been as deep as 10 kilometers below the surface.

The plume swelled to a diameter of 100 to 200 kilometers,punching its way into space and expanding until it enveloped theentire Earth. Material then began to fall back under the influ-ence of gravity, plowing into the atmosphere with nearly all theenergy with which it had been launched from Chicxulub. Mov-ing at speeds of 7,000 to 40,000 kilometers an hour, the parti-cles lit up the sky like trillions of meteors and heated a large vol-ume of the atmosphere to several hundred degrees, before slow-ly settling to the ground and forming the layer we see today.

Melosh’s team calculated that the reentering debris couldhave ignited vegetation over a huge fraction of the globe. Butnobody in 1990 knew the location or precise size of the impact,so the team could not determine the total amount of heating orthe distribution of the fires. Although soot had been foundthroughout the world, fires need not have erupted everywhere,because soot could have been blown to some sites by the wind.

A Blue Rain Doth FallSOON AFTER MELOSH REPORTED his findings, a team ofseven American, Canadian and Mexican scientists (includingone of us, Kring) discovered that Chicxulub was the impact site.This discovery settled the argument over the root cause of theextinction. Since then, researchers’ attention has turned to thedetails of the event.

Last year the two of us completed a new study of the wild-fires. Knowledge of the impact location allowed us to recon-struct the trajectories and distribution of material ejected fromthe crater and evaluate the extent of the fires. Our calculationssuggest that some of the material reached halfway to the moonbefore plummeting back to Earth. Within four days almost allof it had returned to Earth. Slightly more than 10 percent es-caped Earth’s gravity altogether, to be flung across the solar sys-tem and possibly to collide with other planets. (Similarly, piecesof Mars and the moon have landed on Earth, although the ejec-tion process differed.)

The reentering debris heated the atmosphere so severely thatit ignited wildfires in the southern and central areas of NorthAmerica, central South America, central Africa, the Indian sub-continent and southeast Asia (which, because of continentaldrift, were in different positions than they are today). Depend-ing on the trajectory of the impacting asteroid or comet, firesmay have also struck other parts of those continents and pos-sibly Australia, Antarctica and Europe.

The two worst places to be were the Chicxulub region and,ironically, the place farthest away: India, which 65 million yearsago was located on the opposite side of the planet from Chic-xulub, making it a focus point for debris. In the hours and daysthat followed, Earth’s rotation carried landmasses to the east,


SOU

RC

E:

DAV

ID A

. K

RIN

G A

ND

DAN

IEL

D.

DU

RD

A; L

AUR

IE G

RAC

E (

illu

stra

tion

)

TOASTED PLANET: To dry out plants and set them on fire takes 12,500 wattsof heating per square meter for at least 20 minutes. These conditions werereached in two main areas, centered on Chicxulub and its antipode in India.From these regions, corridors of fire stretched westward as Earth rotatedbeneath the hail of reentering debris. This computer simulation assumes acertain impact configuration; other scenarios incinerated even larger areas.

Impact site

Antipode


bringing them under the hail of ejected material. Thus, the glob-al wave of wildfire ignition shifted westward, slowly diminish-ing in intensity.

In most areas, it did not really matter whether vegetationwas growing in a dry place or in a humid swamp. Hot temper-atures lasted so long that moisture was driven from wet vege-tation, like wood in a kiln, and then set ablaze. Did animalspanic when the sky began to glow with falling debris? Werethey alarmed when the temperatures began to rise? Did theystand completely still, or did they run in some direction—to-ward water, for example? Mercifully, most animals would have

fallen unconscious as the temperatures rose and never felt thefire bursting out in the bushes and trees around them.

In addition to ravaging forests, the fires produced severe airpollution. Soot and impact-generated dust choked the sky overthe entire planet, making it impermeable to sunlight. Some cal-culations suggest that the surface was as dark as a lightless cave,although the precise amount of darkening remains uncertain. Inany event, photosynthetic plants died and food chains collapsed,even in areas untouched by wildfires, such as the sea. This phasehas been likened to “nuclear winter,” a cold spell that somemodelers have suggested may follow a nuclear exchange [see


ALL

RIG

HTS

RE

SER

VED

, IM

AGE

AR

CH

IVE

S, D

EN

VER

MU

SEU

M O

F N

ATU

RE

AN

D S

CIE

NC

E (

top

); D

ON

NA

BR

AGIN

ETZ

(b

otto

m)

CRETACEOUS PARK

THE CLIMATE during the late Cretaceous period, justbefore the comet or asteroid impact 65 million yearsago, was warmer than it is now. No ice covered the polarregions, and some dinosaurs migrated as far north astoday’s Alaska and as far south as the Seymour Islandsof Antarctica. A seaway cut through North America,joining the Gulf of Mexico with the Arctic Ocean.Ecosystems ranged from swamps to deciduous forest.Paleobiologists have mapped out those in NorthAmerica, where the continental sediments that containfossils are well preserved. (Little is known about lateCretaceous vegetation in other parts of the world.)

In what is now southern Colorado and northern NewMexico, meandering streams flowed from the nascentRocky Mountains to a coastal plain in the east. Charles L.Pillmore and his colleagues at the U.S. Geological Surveyhave mapped several sedimentary settings, includingstream channels, overbank deposits, floodplains andswamps. Using fossil leaves in those sediments, JackWolfe and Garland Upchurch of the USGS have shownthat the vegetation was dominated by near-tropical,broad-leaved evergreen trees that formed an opencanopy woodland.

In what is now the Dakotas, Kirk R. Johnson of theDenver Museum of Nature and Science has found fossilleaves that suggest the vegetation was a woodlanddominated by angiosperms (flowering plants), mostlysmall trees (the size of dogwoods) to medium ones (thesize of aspen). Wolfe and Upchurch have argued thatconditions became wetter farther to the north, supportinga broad-leaved evergreen forest. This forest was denser,and the canopy was probably closed in some areas.Some vines had large leaves with drip tips—long, drawn-out extensions from which water could drain.

Arthur Sweet of the Geological Survey of Canada andhis colleagues have shown that, in contrast to theflowering plants that dominated in the U.S., conifers andother cone-bearing plants were the most common inwhat is now western Canada. —D.A.K. and D.D.D.

TERTIARY FOREST initially had less biodiversity. The earlier fern and herbaceouscover gave way to relatives of modern sycamore, walnut and palm trees.

CRETACEOUS FOREST was warm and wet, home to broad-leaved and palmtrees, tropical paddle-leaved and herbaceous plants, and ferns.


“The Climatic Effects of Nuclear War,” by Richard P. Turco,Owen B. Toon, Thomas P. Ackerman, James B. Pollack andCarl Sagan; Scientific American, August 1984]. The dirt tookmonths to wash out, probably falling as blue rain similar to theblue ash-rich rain seen after modern volcanic eruptions.

Using modern forest fires as a guide, we have estimated thatthe conflagrations also released 10,000 billion tons of carbondioxide, 100 billion tons of carbon monoxide and 100 billiontons of methane—an amount of carbon equivalent to 3,000years of modern fossil-fuel burning. Therefore, the dark, win-try conditions were followed by an interval of greenhousewarming. The fires also produced debilitating gases such as py-

rotoxins, chlorine and bromine, the latter two of which helpedto destroy the ozone layer. All these effects dramatically com-pounded the other environmental consequences of the impact,such as nitric acid rain, sulfuric acid rain, and the vaporizationof carbon dioxide stored in rocks at the impact site.

The Day AfterTHE FOSS IL RECORD contains a pattern of ecological dis-turbance that matches what one would expect from the moth-er of all wildfires. In the sediments deposited immediately af-ter the impact is a classic biological signature of fire: an anom-alously high concentration of fern spores, first seen by RobertH. Tschudy and his colleagues at the U.S. Geological Survey.Ferns (Cyathidites) were thus the first plant species to repopu-late the denuded landscape—the same pioneering behavior theyexhibit when forests are scorched today. The ferns sometimesoccurred together with a wind-pollinated flowering plants, Ul-moideipites. In some ecosystems without ferns, blooms of al-gae dominated the postimpact environment.

In sediments deposited in what is now Colorado and Mon-tana, Iain Gilmour and his colleagues at the Open University inEngland have found chemical and isotopic fingerprints of meth-ane-oxidizing bacteria—a sign that the loss of so much life mayhave temporarily created anoxic, or oxygen-starved, conditionsin small freshwater ecosystems. Although the success of thesebacteria is not a signature of fire per se, it does indicate the per-vasiveness and abruptness of death, which requires a mecha-nism such as a global conflagration to explain.

One might ask how anything managed to survive the infer-no at all. A crucial factor was the uneven distribution of fire.Simulations indicate, and paleobotanists have confirmed, thatnorthernmost North America and Europe escaped the worst ofthe devastation. In what is now the Northwest Territories,Arthur Sweet of the Geological Survey of Canada found that


DAN

IEL

D.

DU

RD

A (l

eft)

; D

AVID

A.

KR

ING

(ce

nte

r a

nd

rig

ht)

; W

EN

DY

S. W

OLB

ACH

DeP

au

l U

niv

ersi

ty (

inse

t)

DAVID A. KRING and DANIEL D. DURDA met while they were bothworking at the University of Arizona. Kring was on the team thatattributed the Chicxulub crater to an impact and linked it to theCretaceous/Tertiary mass extinction. Durda was studying the col-lisional and dynamical evolution of asteroids. Combining their ex-pertise, they worked out the sequence of events that must haveunfolded after the impact. Kring is still at Arizona and has studiedthe environmental effects of nearly two dozen impacts. His fa-vorite haunt is the Barringer Meteorite Crater (a.k.a. MeteorCrater) in Arizona, the world’s best preserved impact site. Durdais now at the Southwest Research Institute in Boulder, Colo. He hasmade astronomical observations from high-performance jet aircraft. An avid pilot, he has logged time in more than a dozentypes of aircraft, including the F/A-18 Hornet, and he is also a well-known astronomical artist.

THE

AU

THO

RS

MASS GRAVE left by the Chicxulub cataclysm has been preserved as a light-colored layer of clay, which is about as thick as a Swiss Army knife (above).One of the authors (Kring) points to this layer in a rock outcrop in the RatonBasin of the southwestern U.S. (left). A detailed view of the layer (right)


the abundance of gymnosperm pollen (from conifers and theirrelatives) decreased dramatically but did not go to zero. Thus,part of the forest canopy survived the wildfires even in caseswhere fires consumed the undergrowth, which consisted most-ly of angiosperms (flowering plants). In these and other com-paratively safe regions, the heat was less intense, so swamps orswamp margins afforded plants and animals some protection.

Based on studies of fossil plants, spores and pollen, Kirk R.Johnson of the Denver Museum of Nature and Science and hiscolleagues concluded that 51 percent of angiosperm species, 36percent of gymnosperms, and 25 percent of ferns and fern al-lies were extinguished in North America. The fossil pollen andleaves suggest that deciduous trees survived better than evergreentrees, perhaps because they could lie dormant.

Trees that were wind-pollinated also seem to have survivedbetter, because they could prosper even if pollinating insects andother animals were exterminated. Indeed, Conrad C. Laban-deira of the Smithsonian Institution and his associates have ar-gued that many insects disappeared or went extinct, based on adramatic drop in the frequency of insect-damaged leaves in thefossil record of North Dakota, which escaped the direct bruntof the impact. Researchers still do not know the detailed effectson other animal species.

Sweet has shown that the initial “survival” ecosystem, dom-inated by the most robust species, soon gave way to an “op-portunistic” ecosystem, composed of a different type of fern(Laevigatosporites) and several kinds of flowering plants thatwere able to take advantage of the ecological clean slate. To-gether these plants produced an herbaceous ground cover. In thefinal stage of recovery, the forest canopy returned. Based on ob-servations of modern forests, that regrowth took at least 100years. Both Sweet and Upchurch have argued that the processwas, in fact, far slower—taking up to 10,000 years, judging fromthe rate at which fossil plants occur in postimpact sediments.

Another measure of the recovery time is the response of theglobal carbon cycle. The loss of forests, which contain morethan 80 percent of aboveground carbon (at least today), andthe emission of carbon dioxide from fires and vaporized lime-stone at the impact site sharply increased the amount of carbonin the atmosphere. In an isotopic analysis of sediments de-posited after the impact, Nan C. Arens of the University of Cal-ifornia at Berkeley and A. Hope Jahren of Johns Hopkins Uni-versity concluded that it may have taken 130,000 years for thecarbon cycle to return to equilibrium in continental settings. Inthe marine environment, Steven L. D’Hondt of the Universityof Rhode Island and other investigators suggest that it tookthree million years for the flux of organic material to the deepsea to return to normal.

Silent SpringTHE WORLD AFTER the Chicxulub impact event looked,smelled and even sounded different. We have all been magical-ly transported to the Amazon and other forests by audio record-ings of bird, insect and monkey sounds. If we had a recordingfrom the Cretaceous, we might hear dinosaurs moving throughthe brush, their calls to one another and the buzz of some in-sects. Mammals would have been relatively quiet, only rustlingamong the leaves much as moles do today. But in the monthsafter the impact, the world was far quieter. Wind, flowing wa-ter and falling rain dominated the soundscape. Gradually in-sects, then mammals, could be heard again. Hundreds of years,if not hundreds of thousands of years, were needed for ecosys-tems to build new, robust architectures.

The firestorm created by the Chicxulub impact and the sub-sequent pollution were devastating. But it was probably thecombination of so many environmental effects that proved tobe so deadly. They attacked different ecosystems in differentways on different timescales, ranging from days for reenteringejecta to months for dust in the stratosphere to years for sulfu-ric acid aerosols.

Life’s diversity was its salvation. Although multitudes of spe-cies and countless individual organisms were lost, some formsof life survived and proliferated. The impact opened ecologicalniches for mammalian evolution, which eventually led to the de-velopment of our own species. In this sense, the Chicxulub crateris the crucible of human evolution.


Major Wildfires at the Cretaceous/Tertiary Boundary. Wendy S.Wolbach, Iain Gilmour and Edward Anders in Global Catastrophes in EarthHistory. Edited by Virgil L. Sharpton and Peter D. Ward. Geological Societyof America, Special Paper 247, pages 391–400; July 1990.

Extinction: Bad Genes or Bad Luck? David M. Raup. W. W. Norton, 1991.

T. rex and the Crater of Doom. Walter Alvarez. Princeton University Press, 1997.

Night Comes to the Cretaceous. James Lawrence Powell. Harvest Books, 1999.

Trajectories and Distribution of Material Ejected from the ChicxulubImpact Crater: Implications for Postimpact Wildfires. David A. Kring andDaniel D. Durda in Journal of Geophysical Research: Planets, Vol. 107, No. E8, pages 6–22; August 2002.


shows two sublayers. The lower one appears only in sites fairly near theimpact and consists of molten rock ejected from the crater. The upperone contains debris that rocketed into space and settled back onto theground, as well as soot from fires (inset).

UPPER LAYER

LOWERLAYER

CRETACEOUS SHALE


ATAGCGCGGAGCCAGCGCGCTCTAGACAGACGTAGCATATCGGATAGCGACGAGCCAGTCCGCGCGGACAGTACAAM M M

M M M

Genome:DNA was once consideredthe sole repository ofheritable information. But biologists are startingto decipher a separate,much more malleable layerof information encodedwithin the chromosomes.Genetics, make way for epigenetics

Unseen

IDENTICAL TWINS have identical DNA sequences. Yet in mostcases where one twin develops a complex disease known to havea genetic component, such as schizophrenia, bipolar disorder orchildhood diabetes, the other twin does not. Environmentalfactors may play a role, but increasingly biologists are realizingthat important traits can be transmitted epigenetically, throughthe chromosomes but outside the DNA.

Beyond DNA

The

GATAGCGCGACGAGCCAGCGCTCTAGACAGACGTAGCCGCGCGGATAGCGACGAGCCAGTCCGCGGACAGTACAAM M M

M M M

BY W. WAYT GIBBS



RAN

DY

HAR

RIS

PH

OTO

GR

APH

Y (p

rece

din

g p

ag

e)

as the New York Times reported that three biotech companieshave made thumbnail-size devices that can record the activity ofall the genes in a sample of human tissue. Thus is fulfilled one ofthe promises of the Human Genome Project: by scanning the hu-man DNA sequence, scientists can now guess which bits are thegenes that are transcribed into RNA messages and then trans-lated into functional proteins.

When the “final draft” of the sequence was released in April,many said that the string of three billion A, T, G and C bases inhuman DNA represents—choose your metaphor—the book ofinheritance, the source code of cells, the blueprint for a life. Butin truth, all these metaphors mislead.

A genome, the sum of heritable information that is held inthe chromosomes and that governs how an organism develops,is not a static text passed from one generation to the next. Rathera genome is a biochemical machine of awesome complexity.Like all machines, it operates in three-dimensional space, and ithas distinct and dynamic interacting parts.

Protein-coding genes make up just one of those parts—andoften a small one at that, accounting for less than 2 percent ofthe total DNA in each human cell. But for the better part of fivedecades, those genes were enshrined by the central dogma ofmolecular biology as the repository of heritable traits. Hence thenotion of the genome as a blueprint.

As far back as the 1960s, experimenters had uncovered im-portant information hiding elsewhere in the chromosomes.Some was tucked among the “noncoding” DNA, and some lay

outside the DNA sequence altogether. The tools of genetic en-gineering worked best on conventional genes and proteins, how-ever, so scientists looked hardest where the light was brightest.

In recent years, geneticists have been exploring the less visi-ble parts of the genome more thoroughly, in search of explana-tions for anomalies that contradict the central dogma: illnessesthat run in families but pop up unpredictably, even differingamong identical twins; genes that switch on or off in cancers yetharbor no mutations; clones that usually die in the womb. Theyhave found that these second and third layers of information,distinct from the protein-coding genes, connect in surprisinglydeep and potent ways to inheritance, development and disease.

In the November issue of Scientific American, “The UnseenGenome: Gems among the Junk” described those connectionsfor the second layer, which consists of myriad “RNA only”genes sequestered within vast stretches of noncoding DNA. Sci-ence had dismissed such DNA as the useless detritus of evolu-tion, because no proteins are made from it. But it turns out thatthese unconventional genes do give rise to active RNAs, throughwhich they profoundly alter the behavior of normal genes. Mal-functions in RNA-only genes can inflict severe damage.

The third part to the genomic machine, as fascinating as ac-tive RNA genes and probably even more important, is the “epi-genetic” layer of information stored in the proteins and chemi-cals that surround and stick to DNA. Epigenetic marks are sonamed because they can dramatically affect the health and char-acteristics of an organism—some are even passed from parentto child—yet they do not alter the underlying DNA sequence.

Geneticists have yet to decipher the complex code by whichepigenetic marks interact with the other components of the genome. But in working out some of the critical mechanisms, re-searchers have noticed that the epigenetic part of the genomeseems to play crucial roles in growth, aging and cancer. “Epimu-tations” are also suspected of contributing to diabetes, schizo-phrenia, bipolar disorder and many other complex ailments.

Epigenetics may suggest new ways to treat these diseases.Whereas cells doggedly protect their DNA against mutation, theyroutinely add or erase epigenetic marks. In principle, drugs couldtinker with the epigenetic code to turn entire sets of rogue geneson and off. New medicines may be able to reverse some of the ge-netic damage that accompanies aging and precedes cancer.

■ Most traits are transmitted by genes in the DNA thatencode proteins. But a separate code, written in chemicalmarks outside the DNA sequence, also has dramaticeffects on the health and appearance of organisms.

■ The epigenetic code may explain why some diseases skipgenerations and affect only one in a pair of identicaltwins. Epigenetic mistakes seem to play a role in cancer.

■ A genome operates like a machine with several complexinteracting parts. The epigenetic part should be easier tomodify with medicine than the DNA sequence has been.

Overview/Epigenetics

“Human Genome Placed on Chip”read the headline this past October


Beautiful ButtocksTHE STORY OF SOLID GOLD illustrates how the three partsof the genome can interact to confound conventional notions ofinheritance. Born in 1983 on an Oklahoma sheep ranch, ayoung ram was christened “Solid Gold” after its rear end grewto prodigiously meaty proportions. Sensing a moneymakingmutation, the rancher promptly put the ram out for stud.

Big-bottomed sons of Solid Gold were crossed with normalewes. Half the offspring, both male and female, took after dad.Researchers called them callipyge (pronounced “kalipeezh”),Greek for “beautiful buttocks.” A 50–50 split is just what onewould expect from a mutation on a dominant gene. “But thenthings got more interesting,” recalls Michel Georges, a re-searcher at the University of Liège in Belgium who had beencalled in as a consultant.

When female callipyge sheep were mated with normal males,not a single lamb of any sex showed the maximal gluteus socharacteristic of its mother, even though some did inherit themutation. It seemed as if callipyge had suddenly switched froma dominant to a recessive characteristic.

The geneticists next tried crossing normal-looking rams whowere carriers of the mutation with completely normal ewes. Etvoilà, half the lambs were callipyge. So the trait was appearingonly when sheep inherited the mutation from their sires.

“Things got really bizarre,” Georges recalls, when breedingyielded sheep bearing two callipyge alleles (in other words, thesame mutation on both copies of the chromosome). If callipygewere a standard gene, then animals inheriting the mutant formfrom both parents should have been guaranteed thunderous

thighs. Yet all the doubly mutated sheep looked perfectly nor-mal [see illustration on next page]. What was going on?

Ten years of experiments have finally answered that question.In May, Georges and his co-workers published a recipe for thecallipyge trait and pedigree: a standard protein-making gene, oneor more RNA-only genes, plus two epigenetic effects. The finalingredient is a tiny mutation, a G base where an A normally ap-pears, at a particular spot “in the middle of a gene desert, 30,000bases from the nearest known gene,” Georges says. Somehowthe DNA at that spot controls the activity of the recipe’s pro-tein-coding and RNA-only genes on the same chromosome.

The A-to-G alteration can make those genes hyperactive, sothat too much protein or active RNA is made in muscle cells. Ex-cess protein explains the huge hindquarters—but not the odd in-heritance pattern. Georges and others see an epigenetic phe-nomenon, imprinting, at work in the family tree.

For most genes, both the maternal and paternal alleles turnon or off at the same time. Imprinting disrupts this balance. Forsome imprinted genes, only the copy that came from dad is ex-pressed; the allele inherited from mom is silenced. The protein-making, rump-plumping gene involved in callipyge works thisway. That is why sheep receiving the A-to-G mutation frommom look normal; the mutation cannot override the selectivecensorship imposed by imprinting.

The opposite form of imprinting affects the callipyge gene(or genes) that makes active RNAs. Those RNAs are producedonly from the allele on the maternal chromosome. This secondbit of epigenetic wizardry helps to explain why the trait disap-pears from animals carrying two callipyge alleles.


SAM

JAC

KSO

N T

exa

s Te

ch U

niv

ersi

ty

HUGE HINDQUARTERS distinguish a callipyge ewe ( far left) and ram (rightcenter) from their normal siblings. The bizarre pattern of inheritance of the

callipyge trait can be explained only by the interaction of three distinctlayers of information in the genome.


In these double-mutant sheep the mutation on dad’s chro-mosome throws the protein-making gene into overdrive. At thesame time, the copy of the A-to-G mutation on mom’s chro-mosome boosts levels of active RNAs from the RNA-only genes.Somehow the amplified RNAs block the amplified growth sig-nal, and so the lamb looks svelte.

Such “overdominance” effects seem to be rare. Imprinting,however, is quite common, especially in flowering plants. RandyL. Jirtle of Duke University keeps a running list of imprinted hu-man genes; the number is now up to 75. Many more may awaitdiscovery. Maxwell P. Lee of the National Cancer Institute re-ported in August that a scan of 602 genes in seven people foundone allele to be significantly more active than the other in halfthe genes. For 170 of those genes, the difference between the al-leles’ expression exceeded a factor of four.

In the first few days after conception, nearly all imprinting isremoved from the chromosomes. How this happens is a mys-tery. But sometime between then and mid-gestation, the epige-netic state is reestablished, says Emma Whitelaw of the Univer-sity of Sydney. Reprogramming mistakes do happen, however.

The human gene for insulin growth factor 2 (IGF2), for in-stance, normally is imprinted; the maternal copy is deactivat-ed. Yet about one person in 10 has no imprinting at the IGF2gene. “When we go into the clinic, we find that defect in 40 per-

cent of people who have sporadic colon cancer,” notes CarmenSapienza of Temple University. “It is just an association, but itis very interesting,” he says. A blood test that detects the loss ofIGF2 imprinting is already being evaluated as a way to predictthe risk of colon cancer. Faulty imprinting is also a prime sus-pect in several rarer genetic diseases, such as Prader-Willi, An-gelman and Beckwith-Wiedemann syndromes. The last causesfacial deformities and an elevated risk of childhood cancer.

Epigenetic variations “could explain the odd discordanceof diseases among identical twins,” Whitelaw suggests. Identi-cal twins share identical DNA sequences. But when one ac-quires a disease with a genetic component, such as schizophre-nia, bipolar disorder or childhood diabetes, the other “identi-cal” twin usually does not. Last year a group led by RosannaWeksberg of the Hospital for Sick Children in Toronto com-pared twins discordant for Beckwith-Wiedemann syndromeand found that in every case the affected twin had lost im-printing within a critical area on chromosome 11, whereas thehealthy twin had not.

“Clearly for cancer, for development, for birth defects, it isa very important phenomenon,” says Francis Collins, directorof the National Human Genome Research Institute. “How im-printing works is still not entirely understood. But DNA meth-ylation seems to play a very significant role.”

Big-bottomed ram (left) or ewe (right)

Normal descendants of Solid Gold

Normal mates unrelated to Solid Gold

Chromosome 18 from father (left) and mother (right)

Cross Mutated chromosome


SOU

RC

E:

CAR

OLE

CH

ARLI

ER

AN

D M

ICH

EL

GE

OR

GE

S U

niv

ersi

ty o

f Li

ège,

Bel

giu

m;

NAD

IA S

TRAS

SER

(il

lust

rati

on)

TWISTS AND TURNS IN A FAMILY TREETWENTY YEARS AGO a sheep named “Solid Gold” was born with a mutation on chromosome 18 that caused its rump to growunusually large. Solid Gold passed the trait to about half itsoffspring (green), the typical pattern for a dominant gene. Later generations revealed, however, that sheep inheriting

the mutation from their mother look normal (blue)—even if theyget a second copy of the gene from their father (purple). Because of epigenetic effects, the only sheep that develop bigbottoms are those that receive just one copy of the mutation,from their father (orange).

The initial mutation for beautiful buttocksoccurred in a ram named “Solid Gold,” whowas crossed with normal ewes.

Generation 1 seemed to displaya standard dominant trait (all that inherited the mutationhad large rumps) . . .

The trait skips a generation (blue)when transmitted by a ewe.

But the trait appears in everyoffspring (orange) whentransmitted by a ram thatcarries the mutation on bothcopies of chromosome 18.

. . . and bygeneration 3 the patternof inheritanceseemed trulybaffling.

. . . but only rams passedthe trait on togeneration 2 . . .


KEY

This Be Madness, Yet There Is Methyl in ItSIMPLE YET POWERFUL, methyl consists of a carbon, threehydrogens and a hankering to bond to—to methylate—some-thing else. Methyl has a special affinity for the C (cytosine) basesof DNA. Special-purpose enzymes take methyl molecules de-rived from basic nutrients, such as folic acid and vitamin B12,and stick them onto certain C bases throughout the genome.

In general, the more methylated a stretch of DNA, the lesslikely it is to be transcribed to RNA and to carry out its func-tion. The silent allele of an imprinted gene is almost always high-ly methylated, for example. But imprinting may be a side job forDNA methylation; it mainly seems to defend the genome againstparasitic genetic elements called transposons.

“We like to think of the genome as this pristine endow-ment,” observes Timothy H. Bestor of Columbia University.“But revolting as it may seem, our DNA is filled with genetic par-asites.” Roughly 45 percent of the human DNA sequence con-

sists of viral genes (or gene fragments) that have copied them-selves into the genome during the course of evolution. Fortu-nately for us, nearly all of this selfish DNA is heavily methylatedand rendered inactive.

Jirtle’s lab at Duke demonstrated the tight link betweenmethyls and transposons this summer in a fascinating experi-ment with agouti mice, whose fur color varies from yellow toblack under the control of a parasitic element. One group ofpregnant agouti mice ate a normal diet; about 60 percent oftheir offspring grew yellow coats. But another group was fedchow enriched with vitamin B12, folic acid and other goodsources of methyl. The high-methyl diet changed the hair col-or of the resulting litter; now 60 percent developed brown coats.The shift appeared to be the result solely of increased methyla-tion (and reduced expression) of the agouti transposon DNA.

But what happens if the methyl defense falters? In a famousstudy five years ago, genetic engineers disabled one of themethyl-adding enzymes in embryonic stem cells. With themethyl guard lowered, many transposons became active. Therate of DNA mutations in the cells shot up 10-fold. Such ex-periments raised an intriguing possibility: Could epigenetic ab-normalities accelerate—perhaps even initiate—the genetic chaosthat leads to cancer?

After all, tumor cells often contain both too little methyla-tion in the genome overall and, confusingly, too many methylmolecules attached to certain genes that normally prevent de-ranged cells from becoming malignant. “In colon polyps [benigngrowths from which tumors often arise], we can already see agenome-wide reduction in DNA methylation” occurring evenbefore mutations knock out key antigrowth genes on the roadto cancer, says Stephen B. Baylin of Johns Hopkins University.

No one knows why so many methyls fall off the DNA in thefirst place—no methyl-removing enzyme has been positively

identified. But researchers suspect that methyl-poor chromo-somes are more likely to malfunction during cell division, tak-ing a step toward malignancy.

Work this year by Rudolph Jaenisch of the Whitehead In-stitute at M.I.T. reinforced that suspicion. His group createdmice with an inborn deficiency of a methylating enzyme. In mostof the mice, at least one of the undermethylated chromosomesbecame unstable. Mutations accumulated quickly, and 80 per-cent of the mice died from cancer within nine months.

The idea that a lack of methyl on the DNA can lead to hu-man cancer is still just a hypothesis, and in any case oncologistshave no drugs that can correct genome-wide undermethylation.But doctors are testing several anticancer drugs that attack theother methyl problem: too much of it stuck on some cancer-related genes. Until recently, many scientists believed that a tu-mor could take hold only after mutation had knocked tumorsuppressor genes out of commission. Yet in many tumor cells

these cancer-fighting genes have a perfectly normal DNA se-quence. Methylation mistakes, not mutations, lay the genes low.

Drugs such as the anesthetic procaine, the mood stabilizervalproic acid and the chemotherapy agent decitabine all seem toeither strip methyl groups from DNA or prevent methyl tagsfrom being attached to newly formed cells. Jean-Pierre Issa hasbeen testing decitabine in patients with advanced leukemia athis clinic at the M. D. Anderson Cancer Center at the Universi-ty of Texas. Like most chemotherapies, the compound is quitetoxic. But “when the drug works,” Issa says, “the leukemia goesaway: 99.9 percent of the cancerous cells are gone.” Eight of 130patients had such good fortune, in a controlled trial Issa pub-lished in August, and in 22 others the demethylating medicinesent the disease into partial remission.

“These drugs are quite promising,” avers Sabine Maier ofEpigenomics, a biotech company in Berlin that is working withRoche in Basel, Switzerland, to develop methylation-based di-agnostics for cancer. “But there is one problem,” she adds. “Thedrugs all lead to demethylation of the whole genome. This prob-ably causes side effects.”

Another worry is that the effect is temporary: methyl tagssoon start popping up again, and the tumor suppressor genesswitch back off. “The drug-induced change in gene expressionmay not be permanent,” Issa acknowledges, “but if it changesin such a way that the immune system can identify the tumor cellor that induces apoptosis [cell suicide], then the cell is still dead.”

Breaking the CodeTHE REEMERGENCE of a distinctive DNA methylation pat-tern after drugs wipe it clean strangely echoes the reprogrammingof an embryo’s imprinting marks shortly after conception. Whatdirects the methyl-adding enzymes back to those tumor-sup-pressing genes or to those few alleles that should be imprinted?


“When the drug works, the leukemia goes away: 99.9 percent of the cancerous cells are gone.”


2Chromosomes are made ofchromatin, a mélange of DNA,

proteins and other chemicals.Inside a chromosome, the doublehelix loops around spools of eighthistone proteins to form a rosary-like chain of nucleosomes.

Nucleosomes

Chromatin fiber

Active chromatin

Active geneSilenced gene

Methyl-addingenzyme

Acetyl (COCH3)Ubiquitin

Chemical tags attached to the tails of

the histone proteins

Exposed DNAbeing transcribedto RNA

Histones

3An intricate histone code—written in chemical tags stuckto the histones’ tails (above)—governs gene expression

as well. Acetyl tags usually amplify nearby genes, whereasacetyl-removing enzymes mute them. But the rest of thecode remains to be deciphered.

4Genes can also be suppressed by methyl tags thatstick directly to the DNA, usually at places where a C

base is followed by a G. Whether DNA methylation turnsdown genes independently or only in combination withhistone tags is still a mystery.

Active transposon

Transposon blocked bymethyl groups

DNA copies

Distantchromosome

RNA transcripts

Hyperactivated geneDisabled gene

HIGH

LOW

LOW

HIGH

THE DNA SEQUENCE is not the only code stored in the chromo-somes. So-called epigenetic phenomena of several kinds canact like volume knobs to amplify or mute the effect of genes.Epigenetic information is encoded as chemical attachments to

the DNA or to the histone proteins that control its shape withinthe chromosomes. Among their many functions, the epigeneticvolume controls muffle parasitic genetic elements, calledtransposons, that riddle the genome.

5Transposons, also called jumpinggenes, can clone themselves and

then insinuate the copies into distantsections of the genome, sometimesdisabling or hyperactivating genes. Onemajor function of DNA methylationseems to be the suppression oftransposons, which make up almost halfthe human genome.

Methyl tag

Acetyl-removingenzyme

DNA

VOLUME CONTROLS FOR GENES

1Chemical changes to a chromosome canforce some parts of it to condense into a

tight, inaccessible mass or can recruitrepressor proteins. In both cases, the genes onthat part of the DNA temporarily stop working.

Methyl (CH3)Phosphate

TER

ESE

WIN

SLO

W


HIGH

LOW

Silent chromatin

Cell nucleus

Repressorproteins


That question must be answered if cloning is ever to becomeroutine. Currently epigenetic reprogramming goes terribly awryin clones that are made by replacing the DNA in a fertilized eggwith DNA from an adult cell. “The majority of such clones dis-play abnormal patterns of methylation and gene expression,”says David Wells, a cloning expert at AgResearch in Hamilton,New Zealand. Even though their DNA sequence may be fine,90 percent of the animals die before birth; half of those bornalive never make it to adulthood. The few that survive to matu-rity tend to suffer obesity and diseases of the immune system.

To permanently prevent or reverse the methylation errors socommon in clones, tumors and imprinting disorders, researchersmust decipher a related epigenetic code—one altogether separatefrom DNA. “Methylation alone doesn’t silence the genes,” Bay-lin of Johns Hopkins says, “it just locks in the silent state.” Themethyl-adding enzymes seem to take their orders from elsewhere.

Zoom in on a chromosome, and you will find that it is not(as often drawn) a haphazard tangle of DNA, nor even a single

object, but a dynamic assembly of DNA, proteins and otherchemicals. This filamentlike assemblage, called chromatin, doesmore than support the DNA. It also controls access to it.

Chromatin contains half as much DNA as it does protein,most of which is in the form of histones. Histones are nature’sanswer to the question: How does a cell fit 1.8 meters of DNAinto its nucleus? In a word, clever packaging. DNA wrapsaround histone spools to form a rosarylike chain, which is thentwisted into a bundle [see illustration on opposite page]. Sec-tions of chromatin can condense and expand independently, ef-fectively hiding whole swaths of the DNA from view while ex-posing other sections for transcription.

Females, for example, start out life with two active X chro-mosomes; males inherit just one. A female embryo must muzzlethe extra X to prevent its cells from getting a double dose of X-borne genes. To do this, two parts of the genomic machine con-spire to shut down the third. A noncoding gene named Xist pro-duces an active RNA that coats the unneeded X chromosome.The needed X meanwhile produces “antisense” RNA, whichacts like an antidote to protect it from Xist. A chain reactionspreads down the unwanted chromosome: methyls tag much ofthe DNA, histones shed the chemical acetyl from their tails, andthe chromatin compacts into an inaccessible, RNA-coated mass.The silent X chromosome is then passed down, inactive, to everygenome-bearing cell as the woman grows.

The role of histones in this drama is not clear, but recentwork has shown that the protein tails that hang off the histonespools can sport an impressive array of chemical additions.Where acetyls adorn certain spots on the histones, for example,the chromatin is usually open for business, allowing the cell’stranscription machinery to read the DNA in that part of thechromosome.

Compact, silent chromatin generally lacks acetyls in the spe-cial positions and instead will often have methyl groups stuck atdifferent points on the histone tails. The histones also play hostto phosphate groups and to the peptide ubiquitin—and all ofthese tags appear in a bewildering variety of locations and com-binations. The histone code will not be easy to crack.

Unlike the stable genetic code of DNA, many epigeneticmarks are in constant flux. When one section of chromatin con-denses, the silence can spread along the chromosome until it hitsa barrier. Xin Bi of the University of Rochester recently identi-fied boundary elements that recruit acetyl-adding enzymes to hi-stones, ensuring that they stay active. Sometimes a physical gapwhere the DNA floats free of any histones can halt the spread,Bi says. At other places, there is no boundary, just a continual tug-of-war between the active and silent regions of the chromosome.

Issa thinks this struggle might explain why cancer risk risesso steadily with age. Perhaps the barriers in the chromosomesthat separate the tightly condensed, highly methylated and silent

portions from the accessible, unmethylated and active portionsbreak down over the years as cells divide or grow old.

The darker parts of the genome are still perceived only dim-ly. But it is quite clear, Sapienza asserts, that “the Human GenomeProject was just the beginning of the job. We now need to pro-duce a similar description of the epigenetic landscape.” In Oc-tober, Epigenomics and the Wellcome Trust Sanger Institute inthe U.K. undertook to do just that, launching a five-year HumanEpigenome Project to map all the DNA methylation sites. Theconsortium also announced its completion of a map of more than100,000 methyl tags attached to the major histocompatibilitycomplex, a section of chromosome 6 linked to many diseases.

The new view of the genomic machine is energizing, becauseit opens avenues to genomic engineering. Those 30,000-oddprotein-coding genes, so important yet so immutable, are notthe only instruction set to which cells refer. Noncoding DNAmatters. Chemical attachments to DNA and to the histones mat-ter. The shape of chromatin matters. And all of these are subjectto manipulation. “There is a whole new universe out there thatwe have been blind to,” Bestor says. “It is very exciting.”

W. Wayt Gibbs is senior writer.


The Epigenome: Molecular Hide and Seek. Edited by Stephan Beck andAlexander Olek. Wiley, 2003.

Controlling the Double Helix. Gary Felsenfeld and Mark Groudine inNature, Vol. 421, pages 448–453; January 23, 2003.

The Callipyge Locus: Evidence for the Trans Interaction of ReciprocallyImprinted Genes. Michel Georges, Carole Charlier and Noelle Cockett inTrends in Genetics, Vol. 19, No. 5, pages 248–252; May 2003.

Summaries of recent research, lists of imprinted genes, and otherinformation on epigenetics are available online at geneimprint.com


“There is a whole new universe out there that we have been blind to. It is very exciting.”



SOU

RC

E:

HE

AD S

PO

RT

AG;

ILLU

STR

ATIO

NS

BY

KE

NT

SNO

DG

RAS

S P

reci

sion

Gra

ph

ics

ELECTRONIC SKIS

For decades, skiers slid down snow-covered hills onlong rectangular planks. But in the mid-1990s com-panies began offering skis with an hourglass shape.They turned more easily because they concentratedthe skier’s weight at the middle of the ski’s inside bladeedge. The focus makes the ski less likely to slip out ofthe track that the blade carves as it traverses the inev-itable microbumps of snow on any slope. Today“shaped” or “carving” skis dominate the market.

There’s a subtle catch, however. The concentrat-ed forces create a strong angular moment within theski. To maintain structural integrity, the ski must bebuilt with more rigidity. But that means the ski is aptto vibrate, which is annoying and can even lift it offthe snow, causing a skier to wipe out.

In the past six years, manufacturers have laid var-ious synthetics in the ski to dampen vibrations. But themost effective option may be piezoelectric fibers, al-ready employed in tennis rackets, which convert vi-bration, compression or bending energy into electriccurrent. A chip embedded in the ski accumulates, re-verses and returns the current, making the fibers ex-pand and contract, countering the angular momen-tum and creating a smooth, easy turn. A growingnumber of pro skiers are using piezo designs. “It’s aquieter ride,” says Joe Cutts, equipment editor for Skimagazine. The skis are also “more versatile” in vari-ous snow conditions, says Peter Keelty, co-founder ofRealSkiers.com.

Unfortunately, chip-controlled, or “active,” piezoskis cost about 50 percent more. And some reviewersthink the benefits may be lost on recreational skiers,making a noticeable difference only at higher speedson icy snow. K2, a large ski maker, has dropped itspiezo models, which used piezo patches that passive-ly absorbed vibrations rather than a chip for activefeedback. Other designers maintain that a smartly de-vised layer of rubber can provide almost the same ben-efits at a fraction of the cost.

But Herfried Lammer, senior design engineer atHead Sport AG in Kennelbach, Austria, the piezoleader, says that skiers prefer the electronic glide. “Atthe end of the day, skiers must like what they feel onthe slopes. And they do.” —Mark Fischetti

At the Moment

WORKINGKNOWLEDGE

DURING A TURN, a skier’s weight presses downnear the ski’s center while the snow’s reactiveforce pushes up along the ski’s inside edge. Theoffset creates an angular moment in the ski’s toplayer that tends to lift the edge from the snow(single ski, left), which the skier must resist toprevent a skid. The moment changes throughoutthe turn, setting up vibrations that the skier feelsas “chatter”—bumping and downslope slippage.

Angular moment

BEFORE FIBERS REACT

AFTER FIBERS REACT

Fibers get shorter

Fibers get longer

Position of skiwithout fibers

Chip

Shearforce



SPECIAL MATERIALS can reduce chatter. The angularmoment sets up a shear force that peaks just ahead of theskier’s boot. In one design by Head Sport (above), thestress causes piezoelectric fibers to shorten and lengthen,converting the mechanical energy into current. A chipreverses, accumulates and returns the current, promptingthe fibers to lengthen and shorten, creating acounteracting moment every five milliseconds that holdsthe edge against the snow and dampens vibrations.

CERTAIN TENNIS RACKETS havepiezoelectric fibers that dampenvibrations from the ball’s impact,decreasing stress on a player’s arm.

Have an idea for a topic? Send it to [email protected]

RUBBER PLATES betweenthe boot and ski absorb some

vibrations in one alternativedesign, reducing chatter to an extent.

Reactive force of snow

Weight

Piezoelectric fibers

DID

YOU

KNOW

... ➤ HOT SHOES: Advanced Cerametrics in Lambertville, N.J., is devel-

oping self-heated hiking and ski boots powered by piezomaterials in

the heel, plus military boots that recharge batteries. It is also devis-

ing self-powered fishing lures that emit the sounds of a fish’s prey.

➤ EVANGELIST ON SKIS: For years, John Howe was director of product

development for Head Ski in Baltimore and later consulted for other ski

equipment giants. But today the mechanical engineer works from his

Waterford, Me., home, annually handcrafting 50 to 100 pairs of a rad-

ical product he calls the Claw. It has a rubber layer that he claims damp-

ens vibrations more than any other design. Reviewers say it is superb

on icy New England slopes but can be tough sledding

in soft snow. Howe sees many commercial innovations as hype. He

also sells a book, The New Skiing Mechanics, which extensively de-

scribes the forces encountered during skiing as it evangelizes the Claw.

➤ TENNIS ELBOW?: Head Sport first deployed piezomaterials in ten-

nis rackets, to reduce vibrations in the handle after hitting a ball. In

July 2002 Werner Zirngibl of the Institute of Orthopedics and Sports

Medicine in Munich gave piezo rackets to 55 recreational players who

were being treated for either temporary or chronic tennis elbow. Af-

ter six weeks of regular play, enthusiasts with a chronic condition

found little or no relief, but those who had had transient pain report-

ed significant improvement.


I admit it: I’m a Law & Order fan. I lovewatching television show detectives LennieBriscoe and Ed Green trade wisecracks asthey slip the cuffs on another homicidesuspect. But, like millions of other fans,I’ve sometimes wondered how realisticthe show is. In particular, I was skepticalof that stock scene (it occurs in nearlyevery episode) in which the geeky techni-cian in the police laboratory uncovers apiece of evidence that blows the case wideopen. Come on, I thought, how oftendoes that actually happen? And are policelabs really that technologically sophisti-cated? I felt compelled to see for myself,so I arranged a visit to the New York CityPolice Department’s forensic laboratory,the real-life counterpart of the lab on Law& Order.

The police lab is located in an unglam-orous building in the borough of Queens.Much of the work done there is alsounglamorous: far more drug cases thanhomicides. According to Lieutenant PaulScardino, commanding officer of the lab’scontrolled substances analysis section,seized drugs from about 200,000 casesare delivered to the lab every year. Thecontraband ranges from garbage bags fullof uprooted marijuana plants to glassineenvelopes packed with heroin. Top pri-ority goes to analyzing heroin, cocaineand other felony drugs; to bring an in-dictment under New York State law, thelab has only five business days to identifya suspected sample and measure its puri-ty, which reveals the weight of the drug.(The severity of the charge depends on theweight.)

Until recently, the lab used color and

crystal tests to determine whether a sam-ple contained heroin or cocaine. Investi-gators would put a few crumbs of pow-der in five wells on a spot plate, then adda different chemical to each well. Thepresence of heroin or cocaine would beconfirmed by a distinctive set of reactions:the chemicals would change color in someof the wells and form crystals in others.Although this method worked reliably fordecades, forensic scientists argued thatthere was a small chance that an un-known or rare compound could produceexactly the same reactions as the illegaldrugs. So over the past five years the po-

lice lab has shifted to a high-tech toolmore commonly seen in university re-search facilities: the gas-chromatographymass spectrometer (GCMS).

How does the GCMS work? First,technicians dissolve the drug sample inmethanol and place a small amount of theliquid in a vial. The GCMS vaporizes theliquid and uses helium to carry the mix ofgases through 15 meters of slender glasstubing coiled inside the machine. Differ-ent molecules travel through the tubing atdifferent rates because of interactionswith a thin coating on the tube’s insidesurface. Therefore, the GCMS is able to

TECHNICALITIES


JOH

N F

RAS

ER

Science for CopsA BEHIND-THE-SCENES LOOK AT A HIGH-TECH POLICE LAB BY MARK ALPERT

COMPARING BULLETS fired from seized guns with bullets found at crime scenes is just one of the manytasks performed at forensic laboratories, which also analyze drugs and trace evidence.


isolate the heroin and cocaine mole-cules, which are then bombarded withelectrons to ionize them. The ions passthrough a magnetic field, and theamount of deflection reveals their mo-lecular weight. If the GCMS fingerprintof a sample matches that of heroin orcocaine, it is nearly impossible for eventhe best defense lawyer to challenge theresult successfully. To ensure the accu-racy of the machines, the lab techniciansrecalibrate each GCMS every morningby testing vials of pure heroin and co-caine obtained from pharmaceuticalcompanies.

The new technology doesn’t comecheap: each GCMS costs about $80,000,and the police lab uses two dozen. Andbecause certain drugs—such as LSD,MDMA (better known as Ecstasy) andketamine (“Special K”)—are destroyedby high temperatures, the lab also hastwo liquid-chromatography mass spec-trometers that don’t require vaporizingthe sample. Overall, the controlled sub-stances section employs about 60 peo-ple, who are officially called criminal-ists. Very few conform to the pasty-faced Law & Order stereotype; on thecontrary, the staff reflects the extraordi-nary ethnic diversity of Queens, with aparticularly large number of peoplefrom India.

Next to drugs, guns are the policelab’s biggest commodity. Every yearabout 10,000 seized guns are sent to thefirearms section in the lab’s basement.The examiners there first determinewhether the guns are operable. (Mostfirearms used by criminals are not in thebest condition.) Then the examinerstest-fire the guns to see if the markingsimprinted on the shells or bullets match

any evidence previously found at crimescenes.

Robert Tamburri, a detective in thefirearms section, gave me a vivid demon-stration of the test-firing process. Hepicked up a worn and weathered-look-ing semiautomatic pistol and took meinto a soundproof room. Inside was alarge metal tank containing 600 gallonsof water. The detectives fire into the tankbecause water can stop the bullets with-out damaging the telltale marks madeby the gun. I got a bit nervous as Tam-burri inserted two nine-millimeter bul-lets into the pistol’s magazine and pre-

pared to fire intothe tank’s gunport; I’d neverbeen so close to a cocked semiautomat-ic before. (And I sincerely hope that Inever get that close again!) Then theshots rang out—luckily, I was wearingear protectors—and the shells landed ina net below the gun port. Tamburriopened the tank’s lid, and we fished outthe two bullets using a suction hose.

We took the shells and bullets to acomparison microscope, which is basi-cally a pair of microscopes joined to-gether so that two objects can be viewedside by side. Looking at both bulletsthrough the stereoscopic eyepiece, Icould see that they shared the same pat-tern of marks left by the rifling (the spi-raling grooves inside the gun’s barrelthat spin the bullet to give it flight sta-bility). But even more striking was thesimilarity between the marks on theshells: the circular pits made by the fir-ing pin when it struck the shell’s primerand the parallel lines imprinted on theshell casing when it recoiled against thebreech face. The firearms lab routinely


New York City’s police lab isactually more surprising and fascinating

than Law & Order’s.



TECHNICALITIES

digitizes these images and comparesthem with the images stored in the In-tegrated Ballistics Identification System,which archives bullet and shell evidencefrom crime scenes across the U.S. Thesoftware calls up the closest matches; iftwo images appear to be identical, theexaminer retrieves the physical evidenceand does a firsthand inspection.

Last but not least, I visited the policelab’s trace analysis section, which han-dles the forensic work most often de-picted on TV—examining fibers, paints,papers and other crime scene evidence.This section has enough high-tech in-struments to make it the envy of anychemistry department. In one room, in-vestigators use an x-ray diffraction ma-chine to look for crystals in explosivematerials; across the hall, they employ ascanning electron microscope to searchfor the spherical particles present in gun-shot residue. Other rooms contain in-frared microscopes, an x-ray fluores-cence machine and a Raman spectrom-eter. Tools such as these are indeed usedin homicide investigations, but that’sjust a small fraction of their workload.For example, the lab can find evidenceof arson by identifying kerosene or bu-tane in fire debris.

Although some of this work maysound mundane, New York City’s po-lice lab is actually more surprising andfascinating than Law & Order’s. At onepoint in my tour of the firearms section,Tamburri led me into a room that con-tained dozens of old guns, many usedfor spare parts when investigators needto fix a seized weapon before test-firingit. He picked up a pair of scuffed re-volvers that were lying on a desk. Onewas the gun that Mark David Chapmanhad used to kill John Lennon in 1980;the other had belonged to David Berk-owitz, the “Son of Sam” killer whomurdered half a dozen people in themid-1970s. Staring at the ugly grayweapons, I felt disoriented. My god, Ithought. This is a lot stranger than any-thing I’ve ever seen on TV.


REVIEWS


FRAN

CIS

DE

AN N

ewsC

om

The Quest for Affordable EnergyASKING THE HARD QUESTIONS—AND PROVIDING SOME ANSWERS BY JOHN P. HOLDREN

Energy is the lifeblood of industrial civ-ilization and an absolutely necessary (al-beit certainly not sufficient) condition forlifting the world’s poor from their pover-ty. But current methods of mobilizingcivilization’s energy are more disruptiveof local, regional and global environ-mental conditions and processes thananything else that humans do.

This dichotomy defines the core ofthe energy challenge in the century beforeus: How can we supply enough afford-able energy to permit the billions who arecurrently poor (and the billions morewho will be added to their numbers in thedecades ahead) to attain prosperity—andto sustain and expand the prosperity ofthose already rich—without suffering in-tolerable damage to the environmentaldimensions of human well-being in in-dustrial and developing countries alike?

How difficult will meeting this chal-lenge be? Is the “business as usual” ap-proach—subsidizing fossil-fuel supply andnuclear energy and large hydro projects,maintaining low energy prices to con-sumers by keeping environmental and po-litical costs “external,” propping up oil

supply by every available means—part ofthe solution or part of the problem? Canthe privatization of energy sectors in thedeveloping countries and the restructuringand deregulation of energy sectors in in-dustrial countries be accomplished inways that provide the economic benefitsof competition while still preserving es-sential public benefits such as the reliabil-ity and resilience of the electricity system?

In his book, Power to the People, Vi-jay Vaitheeswaran tackles these and theother hard questions at the core of soci-ety’s energy dilemmas with style, balanceand insight. The style is entertaining andaccessible. The balance is impeccable—

Vaitheeswaran generally lets the mostforceful and effective exponents on differ-ent sides of the major issues state their casein their own words—but after ventilatingthe various positions he is not afraid to letthe reader know where he comes out.

And this is where the insight comes in.Vaitheeswaran brings to these questionsthe respect for markets and marketlikemechanisms of a writer for the Econo-mist, the understanding of technology ofan M.I.T.-trained engineer, and the sym-

pathy for the plight of the world’s poor ofan individual born in India—all of whichhe happens to be. He also happens tohave, in my judgment, a good sense ofhow to think about—and convey—the in-terplay of the economic, technological,environmental and sociopolitical dimen-sions of the energy issue as well as the rea-sons that the uncertainties afflicting ourknowledge of all the dimensions do notadd up to a good reason for inaction.

Among the critically important pointsabout all this that the book convincing-ly conveys:■ Civilization is in no immediate danger

of running out of energy or even justout of oil. But we are running out ofenvironment—that is, out of the ca-pacity of the environment to absorbenergy’s impacts without risk of intol-erable disruption—and our heavy de-pendence on oil in particular entailsnot only environmental but also eco-nomic and political liabilities.

■ Choices that countries make about en-ergy supply commit them to those choic-es for decades, because power plantsand other energy facilities typically last

POWER TO THE PEOPLE:HOW THE COMING ENERGY REVOLUTIONWILL TRANSFORM AN INDUSTRY, CHANGEOUR LIVES, AND MAYBEEVEN SAVE THE PLANETby Vijay VaitheeswaranFarrar, Straus and Giroux,2003 ($25)

WIND FARM in the Baltic Sea off the coast of Denmark, which generates more of its power by wind than any other country—18 percent in 2002.


for 40 years or more and are too costlyto replace before they wear out. This isone of the reasons it is imprudent in theextreme to wait for even more evidencethan we already have before letting cli-mate-change risks start to influencewhich energy options we choose.

■ Energy technologies that exist or areunder development could greatly in-crease energy efficiency in residencesand businesses, reduce dependence onoil, accelerate the provision of energyservices to the world’s poor, increasethe reliability and resilience of electric-ity grids, and shrink the impacts of en-ergy supply on climate and other envi-ronmental values. The most promisingof these options include renewablesources of a variety of types, advancedfossil-fuel technologies that can captureand sequester carbon, and hydrogen-powered fuel cells for vehicle propulsion

and dispersed electricity generation. ■ These prosperity-building, stability-

enhancing and environment-sparingoptions will not materialize in quan-tity matching the need unless and un-til three conditions are met: The mas-sive subsidies favoring continuation ofenergy business as usual are ended.The massive risks of greenhouse gas–induced climate change are at leastpartly internalized with a carbon taxor its equivalent. And the industrialnations commit to helping the devel-oping ones “leapfrog” past the ineffi-cient and dirty-energy technologiesthat fueled the industrialization of theformer but mortgaged the environ-ment in the process.

There are a few small technical slipsin the elaboration of all this, but notmany, and none that matter to the thrustof the argument.

Written for the intelligent layperson,Vaitheeswaran’s book is by far the mosthelpful, entertaining, up-to-date and ac-cessible treatment of the energy-economy-environment problematique available. Itstitle, Power to the People, might strikesome at first as too cute or too presump-tuous. By the time I finished the book,though, I thought the title was apt, and inmore ways than one. One must hope thatknowledge translates to power in the po-litical sense and that the knowledge to thepeople conveyed here will help lead to thepolitical outcomes needed to bring thebook’s optimistic vision into being.

John P. Holdren is Teresa and JohnHeinz Professor and director of theProgram on Science, Technology andPublic Policy at the John F. KennedySchool of Government at HarvardUniversity.


REVIEWS



ALMOST HEAVEN: THE STORY OF WOMEN IN SPACEby Bettyann Holtzmann Kevles. Basic Books, 2003 ($25.95)

“It was midnight at Cape Canaveral on July 18, 1999, and still hot and humid.” The opening sentence takes us to a launchof the space shuttle Columbia—the first time in history that a woman, U.S. Air Force Lieutenant Eileen Collins, would be incommand. The final pages describe Columbia’s fatal flight in January 2003 with two female astronauts on board. And frombeginning to end, this book is riveting. Meticulously researched, the story of women’s struggle to gain a place in space isframed by the historical context of cold war competition and the American women’s movement. Within this larger frame,the entire sweep of women’s fight “to decide for themselves what risks they were willing to take” plays out: The first 13women (the FLATS, or Fellow Lady Astronaut Trainees) who tried and failed to become astronauts in the early 1960s. TheSoviet women cosmonauts, who faced their own version of sexism. At long last, in 1983, Sally Ride’s historic flight. Right

up to the present, when there are “so many women astronauts that few people recognize their names.” References to popular culture—

Barbarella, Star Trek, the criticism of Ride’s shorts—are often as telling as the key events. It is a testament to the skill of Kevles, whoteaches history at Yale University, that the story never slows or loses focus despite its scope and its many threads.

A DEVIL’S CHAPLAIN: REFLECTIONS ON HOPE, LIES, SCIENCE, AND LOVEby Richard Dawkins. Houghton Mifflin, Boston, 2003 ($24)Dawkins, a renowned evolutionary biologist who now holds an endowed chair as professor of the public understanding ofscience at the University of Oxford, is a man of firm opinions, which he expresses with clarity and punch. His topics in thiscollection of essays range widely—academic obscurantism, his “distrust of the jury system” and “where we go wrong in ed-ucation” among them. He also enlarges on concepts he put forward in his acclaimed book The Selfish Gene and in introduc-ing the meme. That is the name he gave to “mind viruses,” or the idea “that self-replicating information leaps infectiously frommind to mind.” He sees religions as such viruses. “To describe religions as mind viruses,” he writes, “is sometimes interpreted as con-temptuous or even hostile. It is both. . . . As a lover of truth, I am suspicious of strongly held beliefs that are unsupported by evidence.”

All the books reviewed are available for purchase through www.sciam.com

THE EDITORS RECOMMEND


PUZZLINGADVENTURES


NIN

A FI

NK

EL

You Don’t Say! BY DENNIS E. SHASHA

But I repeat myself. But you repeat yourself.You might have read the first sentence as an in-

triguing lead. What was there to repeat? In the sec-ond sentence, you might have observed the parallelstructure but wondered what was going on.

In this puzzle, the goal is to study such parallelrepetition. Let’s call a sequence of symbols (each onerepresenting a word or perhaps several words) “sur-prising” if, for every pair of symbols X and Y andevery distance D, there is at most one position in thesequence where X precedes Y by distance D. Thetop two sentences have the same distance between“But” and “repeat,” so the eight-word utterancethey form would not be considered surprising.

Here are other symbolic examples: AAB is sur-prising, as is AABA, but AABB is not, because thereare two instances when A is followed by B two sym-bols away (by distance 2). Similarly, AAXYBB is notsurprising, because A is followed by B four symbolsaway two times.

To warm up, explain why the following se-quence composed from the symbols A, B and C isnot surprising: BCBABCC. And find a surprising se-quence using A, B and C that is at least seven sym-bols long.

Here are three much harder challenges: Con-struct the longest surprising sequence you can thatis composed from five distinct symbols. Then findthe longest sequence you can make using 10 and 26distinct symbols, respectively. For convenience, usethe letters of the alphabet as symbols (A through E,A through J, and A through Z, respectively). Youwill find that the length doesn’t increase very fast,and I believe that even for 26 symbols, the longest

surprising sequence is less than 100 letters long.The notion of surprise above is called 2-surpris-

ing because only pairs are involved. We could alsodefine 3-surprising to mean that for any triplet ofsymbols and distances D1 and D2, there is at mostone position in the sequence where the first symbol(X) precedes the second (Y) by distance D1 and theY precedes the third (Z) by D2.

What is the longest 3-surprising sequence com-posed of the first five letters of the alphabet you canfind? I know of no simple rule that will give thelongest possible k-surprising sequences composedfrom sets of n symbols for any k and n. Can you finda pretty theory?

Dennis E. Shasha is professor of computer scienceat the Courant Institute of New York University.

Answer to LastMonth’s PuzzleThe followingpermutations are notpossible with threelevels of switches:A D E C BA E D B CB C D E AC E D A BD E A C BE A B C D

All thesepermutations wouldbe possible, however,if there were fourlevels of switches.

Web SolutionFor more discussionof last month’sproblem and a peekat the answer to thismonth’s problem,visit www.sciam.com

ANSWER TO WARM-UP PROBLEM:BCBABCC is not surprising, because the letter B precedes a second B by distance 2 twice. A surprising sequence of length seven is BACCBCA.

Surprising, or Not?

No:

No:

No:

Yes:


ANTIGRAVITY

Observation followed by deduction isstandard practice in science. But it’s notfoolproof, because, as has often been not-ed, fools can be so ingenious. Small chil-dren, though no fools, can likewise be ex-ceptionally clever. I was recently remind-ed just how nimble their little minds canbe when I listened to an old episode of theexcellent radio program This AmericanLife. The show in question (see www.thislife.org, June 22, 2001) was entitled“Kid Logic” and dealt with what hap-pens when the scientific method is em-ployed by those whose hands aren’t quitebig enough to hold it.

For example, a woman named Rebec-ca recalled a conversation with her friendRachel from when they were both littlekids. Rachel told her that she had lost atooth and, following the usual procedure,put it under her pillow. She happened towake up while the tooth was being ex-changed for money and saw exactly whowas making the switch: her father.

Now, to the adult mind the logicalconclusion is (probably) that parents arebehind the mysterious appearance of sub-pillow cash and that credit goes to thetooth fairy. But Rachel’s conclusion wasthat her father was the tooth fairy. Andher pal Rebecca, hearing the facts of thecase, thus firmly believed that the toothfairy was a guy named Ronnie Loeberfeld.

Later in the same show, an inter-viewer asked children what they thoughtthe tooth fairy does with all those teeth.A boy came up with one molar solution,conjecturing that the tooth fairy buildsentire tooth houses. The interviewer thenasked why the tooth fairy wouldn’t sim-

ply make a house out of bricks. To whicha kid responded: “Because no one doesn’thave brick teeth.” Feel free to take a sec-ond to get your wind back.

Kid logic, of course, isn’t limited tokids. Adults can be just as guilty of not somuch leaping as tunneling to conclu-sions. For example, the New Haven Reg-ister reported in September the story of

one James Perry, who had perpetrated anidentity theft, one of the fastest-growingcrimes in America. The apparently logi-cal conclusion reached by Perry wasalong the lines of “I’m such a loser thatanybody’s identity has to be better thanmine.” Wrong.

Perry, who wanted a Connecticut dri-ver’s license despite his four drunk-dri-ving arrests, allegedly stole the identity ofone Robert Kowalski. Perry as Kowalskigot the driver’s license and some credit

cards and seemed to have achieved hisdesire to eat, drink and be not Perry.

How then did Perry wind up desper-ately trying to convince the authoritiesthat he in fact was not Robert Kowalski?Well, Perry got himself arrested for dis-orderly conduct, and all his identificationhad him being Kowalski. The police werehappy to get their hands on Kowalski,what with him being a convicted sex of-fender who had failed to register in Con-necticut in accordance with state law.Perry ultimately diskowalskified himselfand now faces only his own tribulationsand possible trials.

Also in September another misnamedperpetrator was in the news in New En-gland. Little Joe, a 300-pound adolescentgorilla at Boston’s Franklin Park Zoo, es-caped. He was found two hours later,near a football stadium, which couldhave been a fantastic hiding place for alarge, hairy, grunting primate.

Anyway, this same Little Joe had got-ten loose before, just a month earlier. Thepoor logic employed by zoo officials wasthat the gorilla, having demonstrated theability to negotiate a moat and a wall,would be stopped by the addition of anelectrified wire that supplies a painful,but not injurious, shock. Little Joe, pre-viously nicknamed “The Scientist,” ei-ther figured out a way to disable the elec-tricity or used the oldest trick in the bookto deal with pain, namely, not minding.He’s now back in custody, where heprobably faces a brighter future than ei-ther Perry or Kowalski. Perhaps he’d findit tougher to bust out of one of thosetooth houses.


ILLU

STR

ATIO

N B

Y M

ATT

CO

LLIN

S; P

HO

TOG

RAP

H B

Y FR

ANK

VE

RO

NSK

Y

Quod Error DemonstrandumSOMETIMES LOGIC ITSELF CAN BE THE FLAW IN THE OINTMENT BY STEVE MIRSKY


Q

Q


MAT

T C

OLL

INS

Saul I. Gass, professor emeritus at the University of Maryland’sRobert H. Smith School of Business, explains:

Game theory is a formal way of analyzing competitive orcooperative interactions among people who are making deci-sions—whether on a game board or in society at large. Start-ing simply, we can draw some generalizations about commongames such as tic-tac-toe or chess. These games are said to haveperfect information because all the rules, possible choices andpast history of play are known to all participants. That meansplayers can win such games byusing a pure strategy, which isan overall plan that specifiesmoves to be taken in all eventu-alities that can arise in play.Games without perfect informa-tion, such as stone-paper-scis-sors or poker, offer no purestrategy that ensures a win. If aplayer employs one strategy toooften, his or her opponent willcatch on. This is where the mod-ern mathematical theory of games comes into play. It offers in-sights regarding optimal mixes of strategies and the frequencywith which one can expect to win.

Stone-paper-scissors is called a two-person zero-sum game,because any money one player wins, the other loses. Mathe-matician John von Neumann proved that all two-person zero-sum games have optimal strategies for both players. Such agame is said to be fair if both players can expect to win noth-ing over a long run of plays, as is the case in stone-paper-scis-sors, although not all zero-sum games are fair.

The power of game theory goes far beyond the analysis ofthese relatively uncomplicated games. In many-person compet-itive situations, some players can form coalitions against otherplayers, games may have an infinite number of strategies, andthere are nonzero-sum games, to name a few possibilities. Math-ematical analysis of such games yields an equilibrium solution(a set of mixed strategies), one solution for each player, such thatno one has a reason to deviate from that game plan (assumingall the players stick to their equilibrium approaches). As math-

ematician John Nash proved, any many-person, noncoopera-tive, finite-strategy game has at least one equilibrium solution.

The greater significance of game theory is that such contestsare metaphors for other interactions and can be used to analyzereal-world situations, including missile defense, labor manage-ment negotiations and consumer price wars. It is important tonote, however, that for many circumstances game theory doesnot really solve the problem at hand. Instead it helps to illumi-nate the task by offering a different way of interpreting the com-petitive interactions and possible results.

Why do we get goose bumps?—D. Polevoy, Kitchener, Ontario

George A. Bubenik, a physiologist and professor of zoology atthe University of Guelph in Ontario, offers this answer:

Getting goose bumps is a physiological phenomenon inher-ited from our mammalian ancestors that was useful to them butnot much help to us. So named because they resemble the skin ofpoultry after the feathers have been plucked, goose bumps resultfrom the contractions of miniature muscles attached to the hairson our body. Each contracting muscle creates a shallow de-pression on the skin surface, which causes the area surroundingthe hair to protrude and the hair to stand up. In animals with athick coat the raised hairs expand the layer of air that serves asinsulation. Humans lack a thick coat, but goose bumps persist,perhaps because contraction of the muscles around body hairconstricts blood flow to the skin, reducing heat loss.

Hair will also stand up on many animals when they feelthreatened, presumably to increase their apparent size and thusfrighten potential attackers. Both this reaction and the hair-rais-ing response to cold stem from the stimulation of the autonom-ic nervous system. Humans get goose bumps not only when theyare cold but also in situations that elicit strong emotional re-sponses—even when they hear favorite songs from long ago orwatch a horror movie.

What is game theory and what aresome of its applications? —B. Royce, New York City

ASK THE EXPERTS

For a complete text of these and other answers from scientists in diverse fields, visit www.sciam.com/askexpert


ANNUAL INDEX 2003

AUTHORSAlbee, Arden L. THE UNEARTHLY LAND-

SCAPES OF MARS; June, p. 44.Ashley, Steven. ARTIFICIAL MUSCLES; Oct.,

p. 52.Ashley, Steven. FLYING ON FLEXIBLE

WINGS; Nov., p. 84.Ashman, Keith M., and Stephen E. Zepf. THE

UNEXPECTED YOUTH OF GLOBULARCLUSTERS; Oct., p. 46.

Bamshad, Michael J., and Steve E. Olson. DOESRACE EXIST?; Dec., p. 78.

Barabási, Albert-László, and Eric Bonabeau. [IN-FORMATION TECHNOLOGY] SCALE-FREE NETWORKS; May, p. 60.

Bartel, David P., and Nelson C. Lau. [RNA IN-TERFERENCE] CENSORS OF THE GE-NOME; Aug., p. 34.

Basu, Kaushik. THE ECONOMICS OF CHILDLABOR; Oct., p. 84.

Begun, David R. PLANET OF THE APES; Aug.,p. 74.

Bekenstein, Jacob D. INFORMATION IN THEHOLOGRAPHIC UNIVERSE; Aug., p. 58.

Bennett, Charles H., Ming Li and Bin Ma. [IN-FORMATION SCIENCE] CHAIN LET-TERS AND EVOLUTIONARY HISTORIES;June, p. 76.

Binnig, Gerd, and Peter Vettiger. THE NANO-DRIVE PROJECT; Jan., p. 46.

Blaustein, Andrew R., and Pieter T. J. Johnson.EXPLAINING FROG DEFORMITIES; Feb.,p. 60.

Bonabeau, Eric, and Albert-László Barabási. [IN-FORMATION TECHNOLOGY] SCALE-FREE NETWORKS; May, p. 60.

Bower, James M., and Lawrence M. Parsons. RE-THINKING THE “LESSER BRAIN”; Aug.,p. 50.

Brush, Alan H., and Richard O. Prum. WHICHCAME FIRST, THE FEATHER OR THEBIRD?; March, p. 84.

Cahill, Larry, Paul E. Gold and Gary L. Wenk.THE LOWDOWN ON GINKGO BILOBA;April, p. 86.

Caplan, Arthur L. [BRAIN] IS BETTER BEST?;Sept., p. 104.

Chanton, Jeffrey P., John R. Hale, Jelle Zeilinga deBoer and Henry A. Spiller. QUESTIONINGTHE DELPHIC ORACLE; Aug., p. 66.

Chapman, Clark R., Russell L. Schweickart, Ed-ward T. Lu and Piet Hut. THE ASTEROIDTUGBOAT; Nov., p. 54.

Cline, David B. THE SEARCH FOR DARKMATTER; March, p. 50.

Cooper, Martin. ANTENNAS GET SMART;July, p. 48.

Curiel, David T., and Dirk M. Nettelbeck. [CAN-CER] TUMOR-BUSTING VIRUSES; Oct., p. 68.

De Boer, Jelle Zeilinga, John R. Hale, Jeffrey P.

Chanton and Henry A. Spiller. QUESTION-ING THE DELPHIC ORACLE; Aug., p. 66.

Dickson, James H., Klaus Oeggl and Linda L.Handley. THE ICEMAN RECONSIDERED;May, p. 70.

Duncan, Robert C., Chryssa Kouveliotou andChristopher Thompson. MAGNETARS; Feb.,p. 34.

Durda, Daniel D., and David A. Kring. [DI-NOSAUR EXTINCTION] THE DAY THEWORLD BURNED; Dec., p. 98.

Ezzell, Carol. [SUICIDE] WHY? THE NEURO-SCIENCE OF SUICIDE; Feb., p. 44.

Feigenbaum, Harvey B. DIGITAL ENTER-TAINMENT JUMPS THE BORDER; March,p. 78.

Foster, Ian. THE GRID: COMPUTING WITH-OUT BOUNDS; April, p. 78.

Fox, Armando, and David Patterson. SELF-RE-PAIRING COMPUTERS; June, p. 54.

Gage, Fred H. BRAIN, REPAIR YOURSELF;Sept., p. 46.

George, Mark S. STIMULATING THE BRAIN;Sept., p. 66.

Gibbs, W. Wayt. THE UNSEEN GENOME:BEYOND DNA; Dec., p. 106.

Gibbs, W. Wayt. THE UNSEEN GENOME:GEMS AMONG THE JUNK; Nov., p. 46.

Gibbs, W. Wayt. UNTANGLING THE ROOTSOF CANCER; July, p. 56.

Gold, Paul E., Larry Cahill and Gary L. Wenk.THE LOWDOWN ON GINKGO BILOBA;April, p. 86.

Grabowski, Robert, Luis E. Navarro-Serment andPradeep K. Khosla. AN ARMY OF SMALLROBOTS; Nov., p. 62.

Hale, John R., Jelle Zeilinga de Boer, Jeffrey P.Chanton and Henry A. Spiller. QUESTION-ING THE DELPHIC ORACLE; Aug., p. 66.

Hall, Stephen S. [BRAIN] THE QUEST FOR ASMART PILL; Sept., p. 54.

Handley, Linda L., James H. Dickson and KlausOeggl. THE ICEMAN RECONSIDERED;May, p. 70.

Holloway, Marguerite. THE MUTABLEBRAIN; Sept., p. 78.

Hubbard, Edward M., and Vilayanur S. Rama-chandran. [SYNESTHESIA] HEARING COL-ORS, TASTING SHAPES; May, p. 52.

Hut, Piet, Russell L. Schweickart, Edward T. Luand Clark R. Chapman. THE ASTEROIDTUGBOAT; Nov., p. 54.

Hyman, Steven E. [BRAIN] DIAGNOSING DIS-ORDERS; Sept., p. 96.

Johnson, Pieter T. J., and Andrew R. Blaustein.EXPLAINING FROG DEFORMITIES; Feb.,p. 60.

Kane, Gordon. THE DAWN OF PHYSICS BE-YOND THE STANDARD MODEL; June, p. 68.

Keane, Martin A., John R. Koza and Matthew J.Streeter. [INFORMATION TECHNOLO-

GY] EVOLVING INVENTIONS; Feb., p. 52.Kenoyer, Jonathan Mark. UNCOVERING THE

KEYS TO THE LOST INDUS CITIES; July,p. 66.

Khosla, Pradeep K., Robert Grabowski and LuisE. Navarro-Serment. AN ARMY OF SMALLROBOTS; Nov., p. 62.

Klatsky, Arthur L. DRINK TO YOURHEALTH?; Feb., p. 74.

Klein, Joshua R., Arthur B. McDonald and DavidL. Wark. SOLVING THE SOLAR NEUTRI-NO PROBLEM; April, p. 40.

Kouveliotou, Chryssa, Robert C. Duncan andChristopher Thompson. MAGNETARS; Feb.,p. 34.

Koza, John R., Martin A. Keane and Matthew J.Streeter. [INFORMATION TECHNOLO-GY] EVOLVING INVENTIONS; Feb., p. 52.

Kring, David A., and Daniel D. Durda. [DI-NOSAUR EXTINCTION] THE DAY THEWORLD BURNED; Dec., p. 98.

Lane, Nick. [PHOTODYNAMIC THERAPY]NEW LIGHT ON MEDICINE; Jan., p. 38.

Langer, Robert. [DRUG DELIVERY] WHEREA PILL WON’T REACH; April, p. 50.

Lau, Nelson C., and David P. Bartel. [RNA IN-TERFERENCE] CENSORS OF THE GE-NOME; Aug., p. 34.

Li, Ming, Charles H. Bennett and Bin Ma. [IN-FORMATION SCIENCE] CHAIN LET-TERS AND EVOLUTIONARY HISTORIES;June, p. 76.

Liger-Belair, Gérard. [CHAMPAGNE] THESCIENCE OF BUBBLY; Jan., p. 80.

Lu, Edward T., Russell L. Schweickart, Piet Hutand Clark R. Chapman. THE ASTEROIDTUGBOAT; Nov., p. 54.

Ma, Bin, Charles H. Bennett and Ming Li. [IN-FORMATION SCIENCE] CHAIN LET-TERS AND EVOLUTIONARY HISTORIES;June, p. 76.

Maeder, Thomas. THE ORPHAN DRUGBACKLASH; May, p. 80.

Marantz Henig, Robin. [REPRODUCTIVETECHNOLOGIES] PANDORA’S BABY;June, p. 62.

McDonald, Arthur B., Joshua R. Klein and DavidL. Wark. SOLVING THE SOLAR NEUTRI-NO PROBLEM; April, p. 40.

Musser, George. THE FUTURE OF STRINGTHEORY: A CONVERSATION WITH BRI-AN GREENE; Nov., p. 68.

Navarro-Serment, Luis E., Robert Grabowski andPradeep K. Khosla. AN ARMY OF SMALLROBOTS; Nov., p. 62.

Nettelbeck, Dirk M., and David T. Curiel. [CAN-CER] TUMOR-BUSTING VIRUSES; Oct., p. 68.

Oberg, James. CHINA’S GREAT LEAP UP-WARD; Oct., p. 76.

Oeggl, Klaus, James H. Dickson and Linda L.Handley. THE ICEMAN RECONSIDERED;May, p. 70.



ANNUAL INDEX 2003

Olson, Steve E., and Michael J. Bamshad. DOESRACE EXIST?; Dec., p. 78.

Parsons, Lawrence M., and James M. Bower. RE-THINKING THE “LESSER BRAIN”; Aug.,p. 50.

Patterson, David, and Armando Fox. SELF-RE-PAIRING COMPUTERS; June, p. 54.

Pauly, Daniel, and Reg Watson. COUNTINGTHE LAST FISH; July, p. 42.

Perovich, Donald K., Matthew Sturm and Mark C.Serreze. [GLOBAL WARMING] MELT-DOWN IN THE NORTH; Oct., p. 60.

Pfeiffer, Tom. MOUNT ETNA’S FEROCIOUSFUTURE; April, p. 58.

Prum, Richard O., and Alan H. Brush. WHICHCAME FIRST, THE FEATHER OR THEBIRD?; March, p. 84.

Puttré, Michael. SATELLITE-GUIDED MUNI-TIONS; Feb., p. 66.

Ramachandran, Vilayanur S., and Edward M.Hubbard. [SYNESTHESIA] HEARING COL-ORS, TASTING SHAPES; May, p. 52.

Rennie, John. A CONVERSATION WITHJAMES D. WATSON; April, p. 66.

Rosen, Clifford J. RESTORING AGED BONES;March, p. 70.

Ross, Philip. [BRAIN] MIND READERS; Sept.,p. 74.

Sapolsky, Robert. BUGS IN THE BRAIN;March, p. 94.

Sapolsky, Robert. TAMING STRESS; Sept., p. 86.

Schlenoff, Daniel C. THE EQUIVOCAL SUC-CESS OF THE WRIGHT BROTHERS; Dec.,p. 94.

Schweickart, Russell L., Edward T. Lu, Piet Hutand Clark R. Chapman. THE ASTEROIDTUGBOAT; Nov., p. 54.

Serreze, Mark C., Matthew Sturm and Donald K.Perovich. [GLOBAL WARMING] MELT-DOWN IN THE NORTH; Oct., p. 60.

Siegel, Jerome M. WHY WE SLEEP; Nov., p. 92.Simpson, Sarah. QUESTIONING THE OLD-

EST SIGNS OF LIFE; April, p. 70.Spiller, Henry A., John R. Hale, Jelle Zeilinga de

Boer and Jeffrey P. Chanton. QUESTIONINGTHE DELPHIC ORACLE; Aug., p. 66.

Spudis, Paul D. THE NEW MOON; Dec., p. 86.Stampfer, Meir J., and Walter C. Willett. RE-

BUILDING THE FOOD PYRAMID; Jan., p. 64.

Stein, Ross S. EARTHQUAKE CONVERSA-TIONS; Jan., p. 72.

Stix, Gary. [BRAIN] ULTIMATE SELF-IM-PROVEMENT; Sept., p. 44.

Streeter, Matthew J., John R. Koza and Martin A.Keane. [INFORMATION TECHNOLOGY]EVOLVING INVENTIONS; Feb., p. 52.

Sturm, Matthew, Donald K. Perovich and Mark C.Serreze. [GLOBAL WARMING] MELT-DOWN IN THE NORTH; Oct., p. 60.

Stutz, Bruce. PUMPHEAD; July, p. 76.Tegmark, Max. PARALLEL UNIVERSES; May,

p. 40.Thompson, Christopher, Chryssa Kouveliotou and

Robert C. Duncan. MAGNETARS; Feb., p. 34.Vettiger, Peter, and Gerd Binnig. THE NANO-

DRIVE PROJECT; Jan., p. 46.Wald, Matthew L. DISMANTLING NUCLEAR

REACTORS; March, p. 60.Wark, David L., Arthur B. McDonald and Joshua

R. Klein. SOLVING THE SOLAR NEUTRI-NO PROBLEM; April, p. 40.

Warschauer, Mark. DEMYSTIFYING THEDIGITAL DIVIDE; Aug., p. 42.

Watson, Reg, and Daniel Pauly. COUNTINGTHE LAST FISH; July, p. 42.

Weaver, Kimberly. THE GALACTIC ODDCOUPLE; July, p. 34.

Wenk, Gary L., Paul E. Gold and Larry Cahill.THE LOWDOWN ON GINKGO BILOBA;April, p. 86.

Willett, Walter C., and Meir J. Stampfer. RE-BUILDING THE FOOD PYRAMID; Jan., p. 64.

Wong, Kate. [EVOLUTION] AN ANCESTORTO CALL OUR OWN; Jan., p. 54.

Wong, Kate. [EVOLUTION] STRANGER IN ANEW LAND; Nov., p. 74.

Yam, Philip. [CHRONIC WASTING DISEASE]SHOOT THIS DEER; June, p. 38.

Zepf, Stephen E., and Keith M. Ashman. THEUNEXPECTED YOUTH OF GLOBULARCLUSTERS; Oct., p. 46.

ARTICLESANTENNAS GET SMART, by Martin Cooper;

July, p. 48.APES, PLANET OF THE, by David R. Begun;

Aug., p. 74.ASTEROID TUGBOAT, THE, by Russell L.

Schweickart, Edward T. Lu, Piet Hut and ClarkR. Chapman; Nov., p. 54.

BONES, RESTORING AGED, by Clifford J.Rosen; March, p. 70.

BRAIN, BUGS IN THE, by Robert Sapolsky;March, p. 94.

[BRAIN] DIAGNOSING DISORDERS, bySteven E. Hyman; Sept., p. 96.

[BRAIN] IS BETTER BEST?, by Arthur L. Ca-plan; Sept., p. 104.

[BRAIN] MIND READERS, by Philip Ross;Sept., p. 74.

BRAIN, THE MUTABLE, by Marguerite Hol-loway; Sept., p. 78.

[BRAIN] THE QUEST FOR A SMART PILL,by Stephen S. Hall; Sept., p. 54.

BRAIN, REPAIR YOURSELF, by Fred H. Gage;Sept., p. 46.

BRAIN,” RETHINKING THE “LESSER, byJames M. Bower and Lawrence M. Parsons; Aug.,p. 50.

BRAIN, STIMULATING THE, by Mark S.George; Sept., p. 66.

[BRAIN] ULTIMATE SELF-IMPROVE-MENT, by Gary Stix; Sept., p. 44.

[CANCER] TUMOR-BUSTING VIRUSES, byDirk M. Nettelbeck and David T. Curiel; Oct., p. 68.

CANCER, UNTANGLING THE ROOTS OF,by W. Wayt Gibbs; July, p. 56.

[CHAMPAGNE] THE SCIENCE OF BUBBLY,by Gérard Liger-Belair; Jan., p. 80.

CHILD LABOR, THE ECONOMICS OF, by

Kaushik Basu; Oct., p. 84.CHINA’S GREAT LEAP UPWARD, by James

Oberg; Oct., p. 76.[CHRONIC WASTING DISEASE] SHOOT

THIS DEER, by Philip Yam; June, p. 38.COMPUTERS, SELF-REPAIRING, by Arman-

do Fox and David Patterson; June, p. 54.COMPUTING WITHOUT BOUNDS, THE

GRID:, by Ian Foster; April, p. 78.DARK MATTER, THE SEARCH FOR, by

David B. Cline; March, p. 50.DELPHIC ORACLE, QUESTIONING THE,

by John R. Hale, Jelle Zeilinga de Boer, Jeffrey P.Chanton and Henry A. Spiller; Aug., p. 66.

DIGITAL DIVIDE, DEMYSTIFYING THE, byMark Warschauer; Aug., p. 42.

DIGITAL ENTERTAINMENT JUMPS THEBORDER, by Harvey B. Feigenbaum; March, p. 78.

[DINOSAUR EXTINCTION] THE DAY THEWORLD BURNED, by David A. Kring andDaniel D. Durda; Dec., p. 98.

DRINK TO YOUR HEALTH?, by Arthur L.Klatsky; Feb., p. 74.

[DRUG DELIVERY] WHERE A PILL WON’TREACH, by Robert Langer; April, p. 50.

EARTHQUAKE CONVERSATIONS, by RossS. Stein; Jan., p. 72.

ETNA’S FEROCIOUS FUTURE, MOUNT, byTom Pfeiffer; April, p. 58.

[EVOLUTION] AN ANCESTOR TO CALLOUR OWN, by Kate Wong; Jan., p. 54.

[EVOLUTION] STRANGER IN A NEWLAND, by Kate Wong; Nov., p. 74.

FEATHER OR THE BIRD?, WHICH CAMEFIRST, THE, by Richard O. Prum and Alan H.Brush; March, p. 84.

FISH, COUNTING THE LAST, by Daniel Paulyand Reg Watson; July, p. 42.

FLYING ON FLEXIBLE WINGS, by StevenAshley; Nov., p. 84.

FOOD PYRAMID, REBUILDING THE, byWalter C. Willett and Meir J. Stampfer; Jan., p. 64.

FROG DEFORMITIES, EXPLAINING, by An-drew R. Blaustein and Pieter T. J. Johnson; Feb.,p. 60.

GALACTIC ODD COUPLE, THE, by Kimber-ly Weaver; July, p. 34.

GENOME: BEYOND DNA, THE UNSEEN,by W. Wayt Gibbs; Dec., p. 106.

GENOME: GEMS AMONG THE JUNK, THEUNSEEN, by W. Wayt Gibbs; Nov., p. 46.

GINKGO BILOBA, THE LOWDOWN ON, byPaul E. Gold, Larry Cahill and Gary L. Wenk;April, p. 86.

[GLOBAL WARMING] MELTDOWN INTHE NORTH, by Matthew Sturm, Donald K.Perovich and Mark C. Serreze; Oct., p. 60.

GLOBULAR CLUSTERS, THE UNEXPECT-ED YOUTH OF, by Stephen E. Zepf and KeithM. Ashman; Oct., p. 46.

HOLOGRAPHIC UNIVERSE, INFORMA-TION IN THE, by Jacob D. Bekenstein; Aug.,p. 58.

ICEMAN RECONSIDERED, THE, by James H.Dickson, Klaus Oeggl and Linda L. Handley;May, p. 70.

INDUS CITIES, UNCOVERING THE KEYSTO THE LOST, by Jonathan Mark Kenoyer;July, p. 66.



[INFORMATION SCIENCE] CHAIN LET-TERS AND EVOLUTIONARY HISTORIES,by Charles H. Bennett, Ming Li and Bin Ma;June, p. 76.

[INFORMATION TECHNOLOGY] EVOLV-ING INVENTIONS, by John R. Koza, MartinA. Keane and Matthew J. Streeter; Feb., p. 52.

[INFORMATION TECHNOLOGY] SCALE-FREE NETWORKS, by Albert-László Barabásiand Eric Bonabeau; May, p. 60.

LIFE, QUESTIONING THE OLDEST SIGNSOF, by Sarah Simpson; April, p. 70.

MAGNETARS, by Chryssa Kouveliotou, Robert C.Duncan and Christopher Thompson; Feb., p. 34.

MARS, THE UNEARTHLY LANDSCAPESOF, by Arden L. Albee; June, p. 44.

MOON, THE NEW, by Paul D. Spudis; Dec., p. 86.

MUSCLES, ARTIFICIAL, by Steven Ashley;Oct., p. 52.

NANODRIVE PROJECT, THE, by Peter Vet-tiger and Gerd Binnig; Jan., p. 46.

NUCLEAR REACTORS, DISMANTLING, byMatthew L. Wald; March, p. 60.

ORPHAN DRUG BACKLASH, THE, byThomas Maeder; May, p. 80.

[PHOTODYNAMIC THERAPY] NEWLIGHT ON MEDICINE, by Nick Lane; Jan.,p. 38.

PHYSICS BEYOND THE STANDARD MOD-EL, THE DAWN OF, by Gordon Kane; June,p. 68.

PUMPHEAD, by Bruce Stutz; July, p. 76.RACE EXIST?, DOES, by Michael J. Bamshad

and Steve E. Olson; Dec., p. 78.[REPRODUCTIVE TECHNOLOGIES] PAN-

DORA’S BABY, by Robin Marantz Henig;June, p. 62.

[RNA INTERFERENCE] CENSORS OF THEGENOME, by Nelson C. Lau and David P. Bar-tel; Aug., p. 34.

ROBOTS, AN ARMY OF SMALL, by RobertGrabowski, Luis E. Navarro-Serment andPradeep K. Khosla; Nov., p. 62.

SATELLITE-GUIDED MUNITIONS, by Mi-chael Puttré; Feb., p. 66.

SCIENTIFIC AMERICAN 50, THE, by the Ed-itors; Dec., p. 55.

SLEEP, WHY WE, by Jerome M. Siegel; Nov., p. 92.

SOLAR NEUTRINO PROBLEM, SOLVINGTHE, by Arthur B. McDonald, Joshua R. Kleinand David L. Wark; April, p. 40.

STRESS, TAMING, by Robert Sapolsky; Sept., p. 86.

STRING THEORY: A CONVERSATIONWITH BRIAN GREENE, THE FUTURE OF,by George Musser; Nov., p. 68.

[SUICIDE] WHY? THE NEUROSCIENCE OFSUICIDE, by Carol Ezzell; Feb., p. 44.

[SYNESTHESIA] HEARING COLORS, TAST-ING SHAPES, by Vilayanur S. Ramachandranand Edward M. Hubbard; May, p. 52.

UNIVERSES, PARALLEL, by Max Tegmark;May, p. 40.

WATSON, A CONVERSATION WITHJAMES D., by John Rennie; April, p. 66.

WRIGHT BROTHERS, THE EQUIVOCALSUCCESS OF THE, by Daniel C. Schlenoff;Dec., p. 94.

STATEMENT OF OWNERSHIP, MANAGEMENT AND CIRCULA-TION (required by 39 U.S.C. 3685). 1. Publication title: ScientificAmerican. 2. Publication number: 509-530. 3. Filing date: Sep-tember 26, 2003. 4. Issue frequency: monthly. 5. Number of is-sues published annually: 12. 6. Annual subscription price: U.S. andits possessions, 1 year, $34.97; Canada, 1 year, $49; all othercountries, 1 year, $55. 7. Complete mailing address of known of-fice of publication: 415 Madison Avenue, New York, NY 10017-1111. 8. Complete mailing address of the headquarters or gener-al business office of the publisher: 415 Madison Avenue, New York,NY 10017-1111. 9. Full names and complete mailing address ofpublisher, editor and managing editor: Publisher, Bruce Brandfon,415 Madison Avenue, New York, NY 10017-1111. Editor, John Ren-nie, 415 Madison Avenue, New York, NY 10017-1111. ManagingEditor, Ricki L. Rusting, 415 Madison Avenue, New York, NY 10017-1111. 10. Owner: Scientific American, Inc., 415 Madison Avenue,New York, NY 10017-1111; Holtzbrinck Publishing Holdings Lim-ited Partnership, 123 West 18th Street, 8th Floor, New York, NY10011: (a) Holtzbrinck Publishing Group, Inc. (General Partner),100 West 10th Street, Wilmington, DE; (b) Georg von HoltzbrinckGmbH & Co. (Limited Partner), Gaensheidestrasse 26, 70184Stuttgart, Germany. 11. Known bondholders, mortgagees and oth-er security holders owning or holding 1 percent or more of totalamount of bonds, mortgages or other securities: none. 12. Tax sta-tus: not applicable. 13. Publication title: Scientific American. 14.Issue date for circulation data below: September 2003. 15. Extentand nature of circulation: a. Total number of copies (net pressrun): average number of copies each issue during preceding 12months, 920,730; number of copies of single issue publishednearest to filing date, 1,116,731. b. Paid and/or requested circu-lation: (1) Paid/requested outside-county mail subscriptions stat-ed on Form 3541 (include advertiser’s proof and exchangecopies): average number of copies each issue during preceding12 months, 536,466; number of copies of single issue publishednearest to filing date, 541,078. (2) Paid in-county subscriptionsstated on Form 3541 (include advertiser’s proof and exchangecopies): average number of copies each issue during preceding12 months, 0; number of copies of single issue published near-est to filing date, 0. (3) Sales through dealers and carriers, streetvendors, counter sales and other non-USPS paid distribution: av-erage number of copies each issue during preceding 12 months,152,068; number of copies of single issue published nearest tofiling date, 273,880. (4) Other classes mailed through the USPS:average number of copies each issue during preceding 12months, 0; number of copies of single issue published nearest tofiling date, 0. c. Total paid and/or requested circulation (sum of15b (1), (2), (3) and (4)): average number of copies each issueduring preceding 12 months, 688,534; number of copies of sin-gle issue published nearest to filing date, 814,958. d. Free dis-tribution by mail (samples, complimentary and other free): (1)Outside-county as stated on Form 3541: average number ofcopies each issue during preceding 12 months, 0; number ofcopies of single issue published nearest to filing date, 0. (2) In-county as stated on Form 3541: average number of copies eachissue during preceding 12 months, 0; number of copies of singleissue published nearest to filing date, 0. (3) Other classes mailedthrough the USPS: average number of copies each issue duringpreceding 12 months, 22,630; number of copies of single issuepublished nearest to filing date, 31,386. e. Free distribution out-side the mail (carriers or other means): average number of copieseach issue during preceding 12 months, 1,000; number of copiesof single issue published nearest to filing date, 1,000. f. Total freedistribution (sum of 15d and 15e): average number of copieseach issue during preceding 12 months, 23,630; number ofcopies of single issue published nearest to filing date, 32,386. g.Total distribution (sum of 15c and 15f): average number ofcopies each issue during preceding 12 months, 712,164; num-ber of copies of single issue published nearest to filing date,847,344. h. Copies not distributed: average number of copieseach issue during preceding 12 months, 208,566; number ofcopies of single issue published nearest to filing date, 269,427.i. Total (sum of 15g and 15h): average number of copies each is-sue during preceding 12 months, 920,730; number of copies ofsingle issue published nearest to filing date, 1,116,771. Percentpaid and/or requested circulation (15c/15g × 100): averagenumber of each issue during preceding 12 months, 96.68%; num-ber of single issue published nearest to filing date, 96.18%. 16.Publication of statement of ownership is required. Will be print-ed in the December 2003 issue of this publication. 17. I certifythat all information furnished above is true and complete. I un-derstand that anyone who furnishes false or misleading infor-mation on this form or who omits material or information re-quested on the form may be subject to criminal sanctions (in-cluding fines and imprisonment) and/or civil sanctions (includingcivil penalties). Signature and title of Editor, Publisher, BusinessManager, or Owner: (signed) Gretchen Teichgraeber, Presidentand CEO. Date: September 26, 2003.


science has the answer: genetic results may surprise you · 2008-04-16 · weighing each...

Documents