[email protected]/25180/2/02whole.pdf · crozier rh (2012) colony genetic...

This file is part of the following reference:

Qian, Zengqiang (2012) Evolution of social structure of

the ant genus Myrmecia fabricus (Hymenoptera:

Formicidae. PhD thesis, James Cook University.

Access to this file is available from:

http://eprints.jcu.edu.au/25180

The author has certified to JCU that they have made a reasonable effort to gain

permission and acknowledge the owner of any third party copyright material

included in this document. If you believe that this is not the case, please contact

[email protected] and quote http://eprints.jcu.edu.au/25180

ResearchOnline@JCU

http://eprints.jcu.edu.au/25180

mailto:[email protected]

http://eprints.jcu.edu.au/#25180

Evolution of Social Structure in the Ant

Genus Myrmecia Fabricius

(Hymenoptera: Formicidae)

Thesis submitted by

Zengqiang QIAN MSc

in January 2012

For the degree of Doctor of Philosophy

in Tropical Ecology and Zoology

within the School of Marine and Tropical Biology

James Cook University

Townsville, Queensland, Australia

TABLE OF CONTENTS

LIST OF FIGURES………...…………………………………………………………i

LIST OF TABLES……………………………………………………………………ii

ACKNOWLEDGEMENTS………………………………………………………iii

CONTRIBUTIONS OF OTHERS….………………………………………………iv

PUBLICATIONS ARISING FROM THIS THESIS……………………………v

ABSTRACT………………………...………………………………………………vi

CHAPTER 1: General Introduction………...………………………………………1

Background…………………..……………………………………………………1

Colony structure of eusocial insects……………………………………………………1

The Australian bulldog or jumper ant genus Myrmecia Fabricius…..……………3

Objectives and outline of the thesis………………………………………………4

CHAPTER 2: Polymorphic EST-Derived Microsatellites in the Fire Ant

Solenopsis invicta and Their Cross-Taxa Transferability in the Bulldog Ant

Myrmecia brevinoda and the Black Tree Ant Tetraponera punctulata……………6

Abstract……………………………………………………………………………6

Introduction……………………..…………………………………………………7

Materials and methods…………….………………………………………………9

Primer design……………..………………………………………………………………9

PCR amplification and genotyping analysis….………………………………………9

Data analysis……………………….……………………………………………………10

Results and discussion……………………………………………………………10

CHAPTER 3: Characterization of Polymorphic Microsatellites in the Giant

Bulldog Ant Myrmecia brevinoda and the Jumper Ant M. pilosula……………12

Abstract………………….………………………………………………………12

Introduction………………………………………………………………………13

Materials and methods………...…………………………………………………14

Insect samples and DNA extraction……..……………………………………………14

Microsatellite isolation…………………………………………………………………15

PCR amplification and genotyping analysis…………..……………………………16

Data analysis………………………….…………………………………………………16

Results………………………….………………………………………………19

Discussion…………………………………………………………………………20

CHAPTER 4: Intraspecific Support for the Polygyny-vs.-Polyandry Hypothesis

in the Bulldog Ant Myrmecia brevinoda…………………………………………21

Abstract…………………………………………………………………………21

Introduction………………………………………………………………………22

Materials and methods…………...………………………………………………25

Insect samples and DNA extraction…………..………………………………………25

Microsatellite genotyping………………………………………………………………25

Statistical analyses……………….……………………………………………………26

Results……………………………………………………………………………29

Basic population genetics and identification of colony boundaries….….….……29

Queen mating frequency and paternity skew……….…………….…………………31

Intracolonial relatedness………….…….…….….……………………………………31

Number of queens and maternity skew……………….………………………………33

Polygyny vs. polyandry…………………………………………………………………33

Discussion…………………………………………………………………………33

Queen number, mating frequency and dispersal……………………………………33


CHAPTER 5: Nestmate Recognition in the Facultatively Polygynous Bulldog Ant

Myrmecia brevinoda…………………………………………………………………39

Abstract…………………………………………………………………………39

Introduction………………………………………………………………………40

Materials and methods…………………………………………………………42

Ant sampling……………….….…………………………………………………………42

Behavioural assays……………..………………………………………………………43

Statistical analyses………………….…….….…………………………………………44

Results…………………….………………………………………………………45

Discussion…………………………………………………………………………49

CHAPTER 6: Colony Genetic Structure in the Australian Jumper Ant Myrmecia

pilosula…………………………….…………………………………………………52

Abstract…………………….……………………………………………………52

Introduction………………………………………………………………………53

Materials and methods…………………………………………………………55

Field sampling, DNA extraction and microsatellite genotyping…………………55

Marker evaluation and population genetic estimates………………………………57

Estimation of relatedness………………………………………………………………58

Queen numbers, queen-mating frequencies and reproductive skew…….….….…58

Results………………………….………….………………………………………59

Basic population genetics and identification of colony boundaries….…….….…59

Queen mating frequency and paternity skew……….……….………………………61

Intracolonial relatedness………………………………………………………………61

Number of queens and maternity skew……….………………………………………63


Discussion…………………………………………………………………………63

Queen-mating frequency and dispersal………………………………………………63


CHAPTER 7: General Discussion…………………………………………………68

Summary of key findings……….…….…………………………………………68


Queen dispersal and colony foundation….…….……………………………………69

Nestmate recognition…….………….….………………………………………………69

Future directions…………………………………………………………………70

REFERENCES……………………………………………………………………73

APPENDICES………………………………………………………………………94

Appendix I: AI-based internest aggression matrix in M. brevinoda…….……94

Appendix II: MAI-based internest aggression matrix in M. brevinoda………95

Appendix III: MAS-based internest aggression matrix in M. brevinoda….…96

i

LIST OF FIGURES

Chapter 4

Fig. 4.1 Schematic map of Myrmecia brevinoda colonies…………..………………25

Fig. 4.2 Correlation between geographic and genetic distances for pairs of Myrmecia

brevinoda nests (r = 0.013, P = 0.420; 9999 permutations) ….….…………28

Fig. 4.3 Estimated (a) and pedigree-effective (b) number of matings per queen in

Myrmecia brevinoda…………………………….………….………………30

Fig. 4.4 The relationship across colonies of Myrmecia brevinoda between polygyny,

measured as the number of queens per colony, and polyandry, measured as

the mean estimated (a) or pedigree-effective (b) number of matings per

queen……………………….………….……………………………………32

Chapter 5

Fig. 5.1 Schematic map of Myrmecia brevinoda colonies…….………….….………42

Fig. 5.2 Mantel’s correlations among internest distance and aggression matrices…46

Fig. 5.3 Observed within- (a) and between-nest (b) aggression levels in Myrmecia

brevinoda……………………………………………………………………47

Chapter 6

Fig. 6.1 Schematic map of Myrmecia pilosula colonies……….……….……………55

Fig. 6.2 Correlation between geographic and FST genetic distances for pairs of

Myrmecia pilosula nests (r = 0.324, P = 0.046; 9999 permutations)………60

Fig. 6.3 Correlation between geographic and FST genetic distances for pairs of

Myrmecia pilosula nests (r = 0.403, P = 0.040, 9999 permutations)………60

Fig. 6.4 Estimated (a) and pedigree-effective (b) number of matings per queen in

Myrmecia pilosula….……….………….………….………….……………62

ii

LIST OF TABLES

Chapter 2

Table 2.1 Characterization of 12 polymorphic EST-derived microsatellite loci in

Solenopsis invicta (n = 24).……..…………….….………………………8

Table 2.2 Cross-taxa amplification of EST-derived microsatellite loci in distantly

-related species………….……………………….………………………11

Chapter 3

Table 3.1 Characterization of polymorphic microsatellite loci in M. brevinoda and M.

pilosula, and amplifiability in M. pyriformis……………………………17

Table 3.2 Transferability and utility of candidate microsatellite loci in M. brevinoda

and M. pilosula…………………..………………………………………19

Chapter 4

Table 4.1 Characteristics of the colonies used to study colony genetic structure in

Myrmecia brevinoda…………….….……………………………………24

Table 4.2 Relatedness among workers in the colonies of Myrmecia brevinoda…..…29

Chapter 5

Table 5.1 Aggression scale used to score interactions among workers of Myrmecia

brevinoda……………………..……….…………………………………43

Table 5.2 Mantel’s correlations among internest distance and aggression matrices…45

Table 5.3 Pairwise comparisons of internest aggression levels among various social

form combinations using two-tailed independent-samples t-tests….……48

Table 5.4 Pairwise comparisons of internest aggression levels among nests with

different levels of worker-worker relatedness using two-tailed

independent-samples t-tests……………………………………………48

Chapter 6

Table 6.1 Characteristics of the colonies used to study colony genetic structure in

Myrmecia pilosula………………….……………………………………56

iii

ACKNOWLEDGEMENTS

Many people and organizations have provided valuable assistance during my PhD

candidature. In particular, I wish to express my sincere gratitude to:

My supervisors Prof. Ross H. Crozier, A/Prof. Simon K. A. Robson, Dr. Helge

Schlüns, Prof. Birgit C. Schlick-Steiner and Dr. Florian M. Steiner for their

continuous guidance, advice and encouragement. Without their patient supervision,

the completion of this thesis would have been impossible.

Ching Crozier for her assistance in sample collection and her technical guidance in

the laboratory. Your rich knowledge of molecular biology has left me a deep

impression.

All other members of the Crozier lab over the years, especially Ellen Schlüns, Faye

Christidis, Itzel Zamora-Vilchis, F. Sara Ceccarelli, Philip S. Newey and Melissa E.

Carew, for their valuable help and friendly advice. Working with you has been a

pleasant and inspiring experience.

The Department of Education, Employment and Workplace Relations (Australia)

for financial support to cover tuition fees and living expenses during my PhD

candidature.

The School of Tropical Biology at James Cook University and the Australian

Research Council (ARC) for financial support to cover costs associated with the

research.

Hui Cao and Yuxin Fu for their assistance in field survey and sample collection.

Dr. Robert W. Taylor for his assistance in sample collection and identification.

Ainsley Calladine for his assistance in microsatellite genotyping.

Staff at the School of Marine and Tropical Biology (JCU) for their general daily

support.

Two examiners for their critical comments and constructive suggestions on the

earlier version of this thesis.

My wonderful family for their unconditional love and understanding during these

years.

iv

CONTRIBUTIONS OF OTHERS

People and organizations, who have substantially contributed to the major chapters of

this thesis, have been acknowledged in details in the following table.

Chapters 2 3 4 5 6

Idea ZQ ZQ, FC, MC, RC

ZQ, RC ZQ, RC ZQ, RC

Study design ZQ ZQ, FC, MC ZQ, RC ZQ, RC, BS, FS

ZQ, RC

Sample collection ZQ, RC, CC ZQ, RC, CC ZQ, YF ZQ, YF RC, CC

Data collection ZQ, CC ZQ, FC, MC ZQ ZQ ZQ

Data analyses ZQ, RC ZQ ZQ, SR ZQ, SR ZQ

Manuscript preparation

ZQ, RC, BS, FS

ZQ, FC, MC, BS, FS, HS

ZQ, BS, ES, FS, HS, SR



Financial support ARC, DEEWR, SMTB

ARC, DEEWR, SMTB

ARC, DEEWR, SMTB

ARC, DEEWR, SMTB

ARC, DEEWR, SMTB

BS = Birgit C. Schlick-Steiner; CC = Ching Crozier; ES = Ellen A. Schlüns; FC = F. Sara

Ceccarelli; FS = Florian M. Steiner; HS = Helge Schlüns; MC = Melissa E. Carew; RC = Ross H.

Crozier; SR = Simon K. A. Robson; YF = Yuxin Fu; ZQ = Zengqiang Qian

ARC = Australian Research Council; DEEWR = the Department of Education, Employment and

Workplace Relations, Australia; SMTB = School of Marine and Tropical Biology, James Cook

University

Supervised by:

Prof. Ross H. Crozier, James Cook University (Australia)

Assoc./Prof. Simon K. A. Robson, James Cook University (Australia)

Dr. Helge Schlüns, James Cook University (Australia)

Prof. Birgit C. Schlick-Steiner, University of Innsbruck (Austria)

Dr. Florian M. Steiner, University of Innsbruck (Austria)

v

PUBLICATIONS ARISING FROM THIS THESIS

Peer-reviewed journal articles:

Qian Z-Q, Crozier YC, Schlick-Steiner BC, Steiner FM, Crozier RH (2009)

Characterization of expressed sequence tag (EST)-derived microsatellite loci in the

fire ant Solenopsis invicta (Hymenoptera: Formicidae). Conservation Genetics, 10,

1373-1376.

Qian Z-Q, Ceccarelli FS, Carew ME, Schlüns H, Schlick-Steiner BC, Steiner FM

(2011) Characterization of polymorphic microsatellites in the giant bulldog ant,

Myrmecia brevinoda and the jumper ant, M. pilosula. Journal of Insect Science, 11,

71.

Qian Z-Q, Schlüns H, Schlick-Steiner BC, Steiner FM, Robson SKA, Schlüns EA,

Crozier RH (2011) Intraspecific support for the polygyny-vs.-polyandry hypothesis in

the bulldog ant Myrmecia brevinoda. Molecular Ecology, 20, 3681-3691.

Qian Z-Q, Robson SKA, Steiner FM, Schlick-Steiner BC, Schlüns EA, Schlüns H,

Crozier RH (2011) Intraspecific aggression in the facultatively polygynous bulldog

ant Myrmecia brevinoda, 20, 3681-3691.

Qian Z-Q, Schlick-Steiner BC, Steiner FM, Robson SKA, Schlüns H, Schlüns EA,

Crozier RH (2012) Colony genetic structure in the Australian jumper ant Myrmecia

pilosula. Insectes Sociaux, 59, 109-117.

Conference abstract:

Qian Z-Q, Robson SKA, Schlüns H, Schlüns EA, Schlick-Steiner BC, Steiner FM,

Crozier RH (2010) Colony structure in three species of the ant genus Myrmecia. XVI

Congress of the International Union for the Study of Social Insects, Copenhagen,

Denmark.

vi

ABSTRACT

Eusocial insects vary significantly in colony queen number and mating frequency,

resulting in a wide range of social structures. Detailed studies of colony genetic

structure are essential to elucidate how various factors affect the relatedness and the

sociogenetic organization of colonies. The polygyny-vs.-polyandry hypothesis argues

that polygyny and polyandry should be negatively associated since both can result in

increased intracolonial genetic variability and have costs. However, evidence for this

long-debated hypothesis has been lacking at the intraspecific level. Ants of the genus

Myrmecia Fabricius display many ancestral biological traits, and thus are considered

valuable in investigating the origin and evolution of more derived social behaviors,

life histories and morphologies as found in other ants. In this research, a set of highly

polymorphic microsatellite loci were developed, and employed to determine

fine-scale sociogenetic organizations in two species of this genus, i.e., the bulldog ant

M. brevinoda and the jumper ant M. pilosula. The polygyny-vs.-polyandry hypothesis

was also examined using both cases. In addition, I evaluated nestmate recognition in

M. brevinoda using behavioural assays, and investigated the impacts of colony social

structure, genetic and spatial distances on recognition and aggression.

M. brevinoda is facultatively polygynous and polyandrous. The numbers of

queens per colony varied from 1 to 6, and queens were inferred to mate with 1 to 10

males. Nestmate queens within polygynous colonies were on average related, but the

overall relatedness between queens and their mates was indistinguishable from zero. A

lack of genetic isolation by distance among nests indicated the prevalence of

independent colony foundation. In accordance with the polygyny-vs.-polyandry

hypothesis, the number of queens per colony was significantly negatively associated

with the estimated number of matings (Spearman rank correlation R = -0.490, P =

0.028). This study thus provides the rare intraspecific evidence for the

polygyny-vs.-polyandry hypothesis.

vii

Workers of M. brevinoda were always non-aggressive towards nestmates, but

acted either aggressively or non-aggressively towards alien conspecifics, suggesting

that they are generally able to discriminate between nestmates and non-nestmates.

Mantel tests revealed no significant impact of genetic and spatial distances on

nestmate discrimination. Moreover, the data appear to lend no support to the

hypothesis that colony social structure (queen number) variation significantly affects

nestmate recognition and aggression. Thus, the actual mechanism underlying

nestmate recognition in this species remains to be resolved.

M. pilosula is also facultatively polygynous and polyandrous. The number of

queens per colony ranged from 1 to 4, and queens were inferred to mate with 1-9

males. Nestmate queens within polygynous colonies, and queens and their mates,

were generally unrelated. This is the first time that the rare co-occurrence of polygyny

and high polyandry has been found in the M. pilosula species group. The

isolation-by-distance pattern and the occurrence of polygynous polydomy suggest the

occurrence of dependent colony foundation in M. pilosula; however, independent

colony foundation may co-occur since queens of this species have fully developed

wings and can fly. There is no support for the predicted negative association between

polygyny and polyandry in ants.

Combining the support from the case of M. brevinoda and the rejective evidence

from the case of M. pilosula and other intraspecific studies, I suggest that the high

costs of multiple matings and the strong effect of multiple matings on intracolonial

genetic diversity may be essential to the negative association between polygyny and

polyandry, and that any attempt to empirically test this hypothesis should place

emphasis upon these two key underlying aspects.

1

CHAPTER 1: General Introduction

Background

Colony structure of eusocial insects

Knowledge of sociogenetic organization is fundamental to understand the evolution of

insect eusociality (Seppä & Walin 1996), in which close relatedness has long been

considered as a critical factor (Abbot et al. 2011; Hamilton 1964; Hughes et al.

2008a). In eusocial Hymenoptera, colony structure is defined demographically and

genealogically by the numbers and identities of reproductive females and males, and

spatially by the nest number, size and architecture (Steiner et al. 2009). The former

class of factors, i.e., colony queen number, queen mating frequency, relatedness

among reproductives and their relative contributions to the worker brood

(reproductive skew), together determine the degree of intracolonial relatedness. Both

the occurrence of multiple queens (polygyny) and multiple paternity (polyandry)

decrease the intracolonial relatedness, while mating among sibs increases relatedness

between the workers and the brood they rear (Thurin et al. 2011).

Colony queen number and queen-mating frequency are the most important

determinants of colony structure in eusocial insects. Eusocial insect colonies with the

simplest relatedness structure are headed by a single, once-mated queen, which is

considered ancestral in the evolution of insect eusociality (Hughes et al. 2008a).

However, polygyny and polyandry are not rare at all, especially in ants (reviewed by

Baer 2011; Crozier & Pamilo 1996; Keller & Reeve 1994; Schmid-Hempel & Crozier

1999). As estimated from the dataset of Hughes et al. (2008b), 41.54% and 44.62% of

formicid species show some level of polygyny and polyandry, respectively. Even so,

the co-occurrence of polygyny and high levels of polyandry appears to be rare, since

the lattter have thus far been mostly known from a few genera with strictly

monogynous colonies, such as the honey bee (Apis) (Page 1980; Palmer & Oldroyd

2000; Schlüns et al. 2005b; Schlüns et al. 2005a; Tarpy et al. 2004), army ants

2

(Dorylus and Eciton) (Denny et al. 2004; Kronauer et al. 2004), harvester ants

(Pogonomyrmex) (Rheindt et al. 2004; Wiernasz et al. 2004), and the leaf-cutting ants

(Atta and Acromyrmex) (Sumner et al. 2004; Villesen et al. 2002).

The relationship between colony queen number and queen-mating frequency is

one of the major issues in the evolution of multiple matings in eusocial insects, and

has long been the focus of much attention in evolutionary biology. On the one hand,

polygyny undermines a queen’s individual fitness by sharing her colony’s

reproductive output with other queens, while polyandry involves increased energetic

loss, higher risk of predation and/or sexually transmitted diseases (reviewed by

Hughes et al. 2008b). On the other hand, both polygyny and polyandry can result in

increased intracolonial genetic diversity which has been hypothesized to increase the

resistance of colonies to pathogens or diseases, to enhance the expression of

genetically-based caste systems, to reduce the among-colony variance of diploid male

production, and to alleviate genetic drift and inbreeding within local populations

(reviewed by Crozier & Fjerdingstad 2001). The polygyny-vs.-polyandry hypothesis

argues that polygyny and polyandry should be negatively associated since both have

benefits and costs (Keller & Reeve 1994). Despite being supported by two recent

comparative analyses across species (Hughes et al. 2008b; Kronauer & Boomsma

2007), to my knowledge, this hypothesis has so far gained no empirical support at the

intraspecific level (Bekkevold et al. 1999; Chapuisat 1998; Hammond et al. 2001;

Kellner et al. 2007; Pedersen & Boomsma 1999b; Schlüns et al. 2009; Trontti et al.

2005). One reason for this may be that the variation in queen-mating frequency is

frequently limited in association with that of colony queen number (Hughes et al.

2008b).

During the past decades, the developments of various molecular marker systems

and statistical tools have greatly advanced the study of social structure in eusocial

insects. Microsallites, also known as simple sequence repeats (SSRs), have become

the de facto standard tool for analyzing fine-scale sociogenetic organizations because

of their hypervariability and good reproducibility, and have been widely applied to

3

diverse eusocial insect taxa (e.g., Lucas et al. 2011; Sanetra 2011; Schlüns et al. 2009;

Thurin et al. 2011). The study of social structure in eusocial insects has also been

greatly facilitated by the recent developments of various statistical tools, e.g.,

MateSoft v1.0 (Moilanen et al. 2004), Curve v3.0 (Kalinowski et al. 2007) and

COLONY v2.0 (Jones & Wang 2010; Wang & Santure 2009).

The Australian bulldog or jumper ant genus Myrmecia Fabricius

Ants of the genus Myrmecia Fabricius, colloquially known as bulldog and jumper ants,

are, together with the monotypic genus Nothomyrmecia Clark, the only extant

representatives of the formicid subfamily Myrmeciinae. This genus comprises nine

recognized species groups and 90 described species, all of which are restricted to the

Australian zoogeographic region (Bolton et al. 2007; Hasegawa & Crozier 2006;

Ogata 1991). Although they were for a long time thought to be among the most basal

formicids (Ogata 1991), this status has been rigorously rejected by recent

phylogenetic studies (Brady et al. 2006; Moreau et al. 2006; Moreau 2009; Rabeling

et al. 2008; Ward & Brady 2003). However, these ants display many biological traits

that are considered to be ancestral in the family Formicidae. These include, for

instance, the limited queen-worker divergence (Dietemann et al. 2004), the solitary

foraging behaviour using primarily visual and tactile cues (Hölldobler & Wilson 1990;

Haskins & Haskins 1950), and its apparent inability to communicate stimuli among

individuals (Haskins & Haskins 1950). In addition, this genus has long been

considered as representing the most generalized form of independent colony

foundation (ICF) (reviewed by Dumpert 1981), which is also widely believed to be

ancestral in ants (Peeters & Molet 2009).

From studies of the social organization of Myrmecia ants, one can hope to learn

more about the early stages of formicid social evolution (Heinze 2008). However, to

my knowledge, only a very few reports have dealt with this aspect (Craig & Crozier

1979; Sanetra 2011). Using one polymorphic allozyme locus, Craig & Crozier (1979)

investigated the colony genetic structure in an unknown species of the jumper ant M.

4

pilosula complex, and indicated the occurrence of multiple related functional queens

in single colonies. But largely due to the low resolution of the single allozyme locus,

no further details were made available about the other aspects of that species’ colony

structure. Recently, Sanetra (2011) reported polygyny and high levels of polyadnry in

the bulldog ant M. pyriformis by analyzing variation at five microsatellite loci.

This research focuses on two species of this genus, i.e., the bulldog ant M.

brevinoda and the jumper ant M. pilosula. M. brevinoda, one of the larger species of

Myrmecia, belongs to the M. gulosa species group, while M. pilosula is among the

smaller species and belongs to the M. pilosula species group (Hasegawa & Crozier

2006). Thus, they are relatively distantly related in phylogeny, and are good

representatives of the genus Myrmecia.

Objectives and outline of the thesis

The specific objectives of this thesis were:

(i) to develop polymorphic microsatellite loci for genetic assays of population and

colony structure of Myrmecia ants;

(ii) to examine the colony genetic structure in M. brevinoda and M. pilosula;

(iii) to test the relationship between colony queen number and queen-mating

frequency using both cases;

(iv) to evaluate nestmate recognition in M. brevinoda; and

(v) to investigate the impacts of colony social structure (queen number),

intracolonial worker-worker relatedness, genetic and spatial distances on

recognition and aggression in M. brevinoda.

This thesis is organized as a series of stand-alone, but conceptually interconnected

research papers.

In Chapter 2, I characterized a set of polymorphic microsatellites from publicly

5

available expressed sequence tags (ESTs) of the fire ant Solenopsis invicta, and

evaluated their cross-transferability in M. brevinoda.

In Chapter 3, I characterized a set of genomic microsatellites from Myrmecia

ants. These microsatellites were evaluated for their utility in M. brevinoda and M.

pilosula, and for their amplifiability in M. pyriformis.

In Chapter 4, I investigated the colony genetic structure in M. brevinoda using

the novel microsatellite markers. A total of 20 colonies (23 nests) from a population in

Paluma (Queensland, Australia) were examined for colony queen number,

queen-mating frequency, reproductive skew, relatedness among reproductives and the

mode of colony foundation. The polygyny-vs.-polyandry hypothesis was also tested

using the present case.

In Chapter 5, I evaluated nestmate recognition in M. brevinoda. A total of nine

nests, whose social structure had been determined in Chapter 4, were behaviourally

assayed for their pairwise internest aggression. I also examined the impacts of colony

social structure (queen number), intracolonial worker-worker relatedness, genetic and

spatial distances on recognition and aggression.

In Chapter 6, I investigated the fine-scale sociogenetic organization of 14

colonies (16 nests) of M. pilosula. These samples had been sampled from a population

in Mongarlowe (New South Wales, Australia). The polygyny-vs.-polyandry

hypothesis was also tested using the present case.

In Chapter 7, I presented a general discussion of the major findings in this

research, and suggested the directions for future research.

6

CHAPTER 2: Polymorphic EST-Derived Microsatellites in the Fire Ant

Solenopsis invicta and Their Cross-Taxa Transferability in the Bulldog Ant

Myrmecia brevinoda and the Black Tree Ant Tetraponera punctulata

Abstract

The fire ant Solenopsis invicta (Myrmecinae) has received considerable attention as a

damaging invasive pest. In the present study, 12 polymorphic microsatellite loci were

developed from publicly available expressed sequence tags (ESTs) of S. invicta. The

number of alleles varied between 3 and 12, with an average of 6.42 per locus. The

observed and expected heterozygosities ranged from 0.4167 to 1.0000 and from

0.3446 to 0.8543, respectively. These loci were evaluated for their cross-subfamilial

transferability in the bulldog ant Myrmecia brevinoda (Myrmeciinae) and the black

tree ant Tetraponera punctulata (Pseudomyrmecinae); two loci were successfully

amplified for each of these species, with both proving polymorphic. These

informative EST-derived microsatellite loci provide a powerful complementary tool

for genetic studies of S. invicta.

7

Introduction

Solenopsis invicta (Myrmicinae), the red imported fire ant (RIFA), is native to South

America (Tschinkel 2006) but is invasive and highly damaging both economically

(Pimentel et al. 2000) and to the biota (Allen et al. 2001; Wojcik et al. 2001). It has

become established in North America (Callcott & Collins 1996), New Zealand

(Pascoe 2002), Australia (Henshaw et al. 2005) and China (Du et al. 2007). This

species has two distinct social forms, i.e., the monogyne (single-queen) form and the

polygyne (multiple-queen) form, and thus is an ideal model for investigating the

colony- and population-level genetic consequences of variation in social organization

(Krieger et al. 1999). It has also been reported that genetic changes during or

subsequent to introduction have caused alterations in social behaviour and colony

structure in S. invicta, which in turn promotes the invasive success of introduced

populations (Tsutsui & Suarez 2003). So, a good knowledge of its population genetics

is of great importance for the formulation of effective strategies in preventing its

spread and eradicating its existing populations.

To date, both dominant random amplified polymorphic DNA (RAPD) markers

(Shoemaker et al. 1994) and codominant allozyme (Ross et al. 1987a; Ross et al.

1987b) and genomic microsatellite (Krieger & Keller 1997) markers have been

developed to facilitate genetic studies of S. invicta (Ross et al. 1999). Codominant

markers are more informative than their dominant counterparts since two or more

alleles can segregate visibly (Miao et al. 2008), and compared to allozymes,

microsatellites are more powerful tools because of their higher variability, neutrality,

relative abundance and better genome coverage. However, it is well-known that the

development of microsatellites from genomic libraries can be costly and

time-consuming. In addition, genomic microsatellites are frequently species-specific

and have poor cross-taxa transferability (Ellis & Burke 2007). One possible solution

to these limitations would be to exploit the publicly available expressed sequence tags

(ESTs). EST-derived microsatellites, also known as EST-derived simple sequence

repeats (EST-SSRs) or genic microsatellites, provide a time- and cost-efficient method,

8

Table 2.1 Characterization of 12 polymorphic EST-derived microsatellite loci in Solenopsis invicta (n = 24)

Locus

GenBank

Acc. No.

Primer sequences (5’-3’)

Repeat motif TA (°C)

Expected

size (bp) NA

Size range

(bp) HO HE P (BL) Forward Reverse

Sinv01 EE149355 *GGCTTCATTCGGCAACAAAT GCATGATTCGCTTCCTCTCTAAC (TCAT)35 + (ATTC)15 55 273 4 277-290 0.4583 0.5842 0.1755 (0.0375)

Sinv02 EH412825 *GTTGTTGTGTTTGGGAGAACTG AAGCGATATGCGACGTATGC (GCAC)5 + (CA)26 + (GTAT)7 55 386 12 401-427 0.9167 0.8490 0.0000 (0.0043)

Sinv05 EE138510 GCGTATCTAAATAGTCTGGCAC *ATTATGCTGGCTAGTTGGCTC (TTC)19 55 273 5 277-289 1.0000 0.6936 0.0000 (0.0047)

Sinv10 EH413421 CAGTCACCTTACCAAGCGATAG *CGGACCTAACTGGACACTGC (ATC)11 57 242 5 256-263 0.7917 0.5738 0.4983 (0.05)

Sinv14 EE128023 TCGTTATTGCGTGTCTCTTAG *TTGCCAGTCACATCGTGTT (GA)13 57 212 4 223-233 0.4167 0.3446 0.9480 (0.05)

Sinv15 EE146800 *CGTTGTTAAGTCTCGCAAGTC GGCATTCTTCTCGGAAGTG (TC)18 57 190 6 186-204 0.9583 0.7170 0.0774 (0.024)

Sinv17 EE135479 *GGTATGCCATTAAGGATGT TGATTCTATTGTATGCGTAAG (CA)22 57 172 7 183-200 1.0000 0.7222 0.4977 (0.05)

Sinv18 EE128736 CCAATATCGACGCCTATGGAG *GTGTGTAATGCCCTGCCCTCT (AG)21 57 142 6 163-179 1.0000 0.7439 0.0172 (0.0167)

Sinv19 EH413471 TTCTTACTTCCGCTCTGTCTTC *GATGGTTGCTACGGTGTGATT (AT)16 57 202 10 210-234 0.9545 0.8543 0.0067 (0.0122)

Sinv20 EE129933 *CTTGATTGGGACTTACGACT CTCCTGGTTGTCATATCTCTT (AG)15 57 189 10 191-215 0.9545 0.8326 0.0000 (0.0051)

Sinv21 EH412758 *CGGTTCCTTGTTGTATGAAGAG GATCACAATCGGGCTATCTG (AC)30 55 234 3 225-229 1.0000 0.6003 0.0004 (0.0094)

Sinv22 EE131246 *CAAGTTAGCGATGTAGCGTG TCTCATTACCACCGAAAGACA (AC)10 + (CGCA)11 55 406 5 221-230 1.0000 0.6950 0.0000 (0.0057)

Mean 6.42 0.8604 0.6859

Fluorolabels with asterisks (*): 5’-GGTGGCGACTCCTGGAG-3’; TA, annealing temperature (°C); NA, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity; P, Chi-square P-value for Hardy-Weinberg

equilibrium test; BL, FDR threshold from the FDR controlling procedure of Benjamini & Liu (1999); n, number of individuals assayed. Loci with significant deviations from HWE are denoted in bold.

9

and have found wide applications in analyses of functional diversity, genetic mapping,

marker-assisted selection in crop species and population genetic analyses (Ellis &

Burke 2007; Varshney et al. 2005). Despite their relatively lower variability,

EST-SSRs are also well documented to be more widely transferable across species,

and even genera (Ellis & Burke 2007), and thus can be a good complement to the

traditional ‘anonymous’ microsatellites.

In this study, I developed 12 novel polymorphic microsatellite markers from the

EST sequences of S. invicta (Wang et al. 2007). Their cross-taxa transferability was

also tested in two distantly-related species, the bulldog ant Myrmecia brevinoda

(Myrmeciinae) and the black tree ant Tetraponera punctulata (Pseudomyrmecinae).

Materials and methods

Primer design

A total of 22876 ESTs of S. invicta were retrieved from GenBank, and used to

perform the contig assembly using Sequencher v4.5 (Gene Codes Corporation, USA)

(Minimum overlap: 40; Minimum match: 85%). In all, 12191 unigenes, comprising

4677 contigs and 7514 singletons, were obtained and screened for the SSR-containing

unigenes using SciRoKo v3.3 (Kofler et al. 2007). The parameters were set for

detection of mono-, di-, tri-, tetra-, penta- and hexanucleotide motifs with a minimum

of 14, 7, 5, 4, 4 and 4 repeats, respectively (under perfect MISA search mode). A total

of 1112 microsatellite loci were identified, and 23 SSR-containing unigenes were

selected for marker development. Primers flanking each repeat sequence were

designed using Oligo v6 (Molecular Biology Insights, USA). Either forward or

reverse primer of each locus was synthesized with a 5’-end 17-base tag to enable the

labelling strategy of Shimizu et al. (2002) (Table 2.1).

PCR amplification and genotyping analysis

Genomic DNA samples of S. invicta used in this study were obtained from a previous

study (Henshaw et al. 2005). Totally, 24 workers (either polygyne or monogyne form)

10

were randomly sampled from two populations. DNA samples of M. brevinoda and T.

punctulata were extracted with PUREGENE DNA Isolation Kit (Gentra Systems,

USA) following the manufacturer’s protocol. Polymerase chain reaction (PCR) was

performed in a 15-μL reaction volume containing 1x PCR buffer, ~75 ng of genomic

DNA, 1.5 mM MgCl2, 0.2 mM each of dNTPs, 0.3 U Taq polymerase (Invitrogen Life

Technologies, USA), 0.4 μM universal fluorescent primer

(GGTGGCGACTCCTGGAG, 5’ labelled with TET, HEX or FAM), 0.1 μM tagged

primer and 0.4 μM untagged primer. The amplifications were performed in the

thermal cycler GeneAmp PCR System 9700 (PE Applied Biosystems, USA) with the

following program: initial denaturation at 94 °C for 3 min; followed by 35 cycles of

94 °C for 30 s, appropriate annealing temperature (see Table 2.1 for details) for 30 s,

72 °C for 45 s; and last synthesis at 72 °C for 7 min. Fluorolabelled PCR products

were cleaned by centrifugation through 300 μL of Sephadex G-50 and multiplexed,

and ET-400R size standard (Amersham Biosciences, USA) was added before

genotyping on MegaBACE 1000.

Data analysis

The program PowerMarker v3.0 (Liu & Muse 2005) was employed to calculate

various parameters: the number of alleles per locus (NA), observed (HO) and expected

(HE) heterozygosities, deviation from Hardy-Weinberg equilibrium (HWE) and

linkage disequilibrium (LD). For the detection of LD and the deviation from HWE,

the false discovery rate (FDR) controlling procedure of Benjamini & Liu (1999) was

applied at the significance level of 0.05.

Results and discussion

Following the discarding of five loci because of poor amplification or multiple bands

and another six monomorphic ones (at the 95% criterion), 12 polymorphic loci with

clear and interpretable bands were obtained (Table 2.1). These loci yielded a total of

77 alleles, ranging from 3 (Sinv21) to 12 (Sinv02) with an average of 6.42 per locus.

The observed and expected heterozygosities ranged from 0.4167 to 1.0000 and from

11

0.3446 to 0.8543, respectively. The heterozygosity levels reported were comparable to

those previously reported in either monogyne form (HO: 0.333-0.806 ; HE:

0.282-0.782) or polygyne form (HO: 0.300-0.825 ; HE: 0.258-0.776) using seven

polymorphic genomic microsatellites (Krieger & Keller 1997). Thus, these EST-SSRs

provide a useful complementary tool to the available allozymes and genomic

microsatellites. Deviations from HWE were observed in six loci after following the

FDR controlling procedure, and significant linkage disequilibrium was detected

between six pairs of loci (Sinv05/Sinv10, Sinv15/Sinv17, Sinv17/Sinv18,

Sinv18/Sinv19, Sinv20/Sinv21, Sinv21/Sinv22 with Chi-square P-values of 0.006,

0.000, 0.000, 0.0001, 0.001 and 0.000, respectively). The deviation from HWE could

be attributed to the presence of null alleles and/or the social and genetic structure of

this species (Bay et al. 2007; Ruger et al. 2005), while the observed LD can be

explained by the social structure and/or possible recent migration events.

Table 2.2 Cross-taxa amplification of EST-derived microsatellite loci in distantly-related species

Myrmecia brevinoda Tetraponera punctulata

Locus NA / n Size range (bp) NA / n Size range (bp) Sinv10 2 / 17 408-411 -

Sinv15 - 4 / 7 426-439

Sinv19 4 / 20 102-108 4 / 7 408-417

NA, number of alleles; n, number of individuals assayed; –, no amplification; M, monomorphic locus.

I investigated the transferability of these markers using the same conditions as

for RIFA (subfamily Myrmicinae) with two distantly-related ants, the bulldog ant M.

brevinoda (Myrmeciinae) and the black tree ant T. punctulata (Pseudomyrmecinae).

Two loci were successfully amplified for each of these species, with both proving

polymorphic (Table 2.2).

12

CHAPTER 3: Characterization of Polymorphic Microsatellites in the Giant

Bulldog Ant, Myrmecia brevinoda and the Jumper Ant, M. pilosula

Abstract

The ant genus Myrmecia Fabricius (Hymenoptera: Formicidae) is endemic to

Australia and New Caledonia, and has retained many biological traits that are

considered to be basal in the family Formicidae. Here, I present a set of 16

dinucleotide microsatellite loci that are polymorphic in at least one of the two species

of the genus, M. brevinoda and M. pilosula, 13 being novel loci and three being loci

previously published for the genus Nothomyrmecia Clark (Hymenoptera: Formicidae).

In M. brevinoda, the total of 12 polymorphic microsatellites yielded a total of 125

alleles, ranging from 3 to 18 with an average of 10.42 per locus; the observed and

expected heterozygosities ranged from 0.4000 to 0.9000 and from 0.5413 to 0.9200,

respectively. In M. pilosula, the nine polymorphic loci yielded a total of 67 alleles,

ranging from 3 to 12 with an average of 7.44 per locus; the observed and expected

heterozygosities ranged from 0.5625 to 0.9375 and from 0.4863 to 0.8711,

respectively. Five loci were polymorphic in both target species. In addition, 15 out of

the 16 loci were successfully amplified in M. pyriformis. These informative

microsatellite loci provide a powerful tool for investigating the population and colony

genetic structure of M. brevinoda and M. pilosula, and may also be applicable to a

range of congeners considering the relatively distant phylogenetic relatedness between

M. pilosula and the other two species within the genus Myrmecia.

13

Introduction

Studying ‘primitive’ ants has drawn wide attention from myrmecologists and other

scientists because it may provide valuable insight into the origin and evolution of

more derived social behaviors, life histories and morphologies as found in other ants

(Haskins 1970). Ants of the genus Myrmecia Fabricius (Hymenoptera: Formicidae),

colloquially known as bulldog and jumper ants, are, together with the monotypic

genus Nothomyrmecia Clark (Hymenoptera: Formicidae), the only extant

representatives of the formicid subfamily Myrmeciinae (Hymenoptera: Formicidae).

The genus Myrmecia comprises nine recognized species groups and 90 described

species, all of which are endemic to Australia with just one of them present in New

Caledonia (Bolton et al. 2007; Hasegawa & Crozier 2006; Ogata 1991). Although

they were for a long time thought to be among the most basal formicids (Ogata 1991),

this status has been rigorously rejected by recent phylogenetic studies (Brady et al.

2006; Moreau et al. 2006; Moreau 2009; Rabeling et al. 2008; Ward & Brady 2003).

However, these aggressive ants have retained many biological traits that are

considered to be ancestral in the family Formicidae. These include, for instance, the

limited queen-worker divergence (Dietemann et al. 2004), the solitary foraging

behavior using primarily visual and tactile cues (Hölldobler & Wilson 1990; Haskins

& Haskins 1950), and its apparent inability to communicate stimuli among individuals

(Haskins & Haskins 1950). From studies of the social organization of Myrmecia ants,

one can hope to learn more about the early stages of formicid social evolution (Heinze

2008).

A great body of cytogenetic studies have been carried out on the genus Myrmecia

(reviewed by Lorite & Palomeque 2010), but to date, the availability of

molecular-genetic markers has been poor for this genus. Of 25 isozymes assayed by

Craig & Crozier (1979), only one proved polymorphic and useful in M. pilosula. Due

to their highly polymorphic and codominant nature, microsatellites have found wide

applications in revealing the social structure of social insects (e.g., Schlüns et al. 2009;

Wiernasz et al. 2004). Successful cross-taxa amplifications of 11 Nothomyrmecia

14

macrops microsatellites in M. forficata were reported, but no details were made

available regarding their polymorphisms, heterozygosity, linkage disequilibrium (LD)

and deviation from Hardy-Weinberg equilibrium (HWE) (Sanetra & Crozier 2000).

Similar transferability was reported for two microsatellites, which were originally

designed from the publicly available expressed sequence tags (ESTs) of Solenopsis

invicta (Formicidae: Myrmicinae) but successfully amplified in M. brevinoda (see

Chapter 2 for details).

Here, I present a set of 16 dinucleotide microsatellite loci that are polymorphic in

the giant bulldog ant M. brevinoda (from the M. gulosa species group) and/or the

jumper ant M. pilosula (from the M. pilosula species group), for the analysis of these

ants’ population and colony genetic structure. The set consists of ten novel loci

isolated from an enriched genomic library of M. brevinoda, three novel loci isolated

from a partial genomic library of M. pyriformis (from the M. gulosa species group),

and three loci previously published for the genus Nothomyrmecia. All loci were also

examined for their amplifiability in M. pyriformis.


Insect samples and DNA extraction

Samples of M. brevinoda were collected from a population in Paluma (Queensland,

Australia; 19.0206°S / 146.1433°E) in November 2009. Workers of M. pilosula were

sampled from a population in Mongarlowe (New South Wales, Australia; 35.4647°S /

149.9381°E) in February 2008. The sampling of M. pyriformis was conducted in the

Wildlife Reserve of La Trobe University (Victoria, Australia; 37.7166ºS / 145.0533ºE)

in September 1999.

Genomic DNA of M. brevinoda and M. pilosula was prepared with PUREGENE

DNA Isolation Kit (Gentra Systems, USA) following the manufacturer’s protocol.

DNA extraction of M. pyriformis was conducted using a standard phenol

chloroform-based method which incorporated an RNase step (Sambrook et al. 1989).

15

Microsatellite isolation

The isolation of microsatellite loci in M. brevinoda followed the standard protocol for

microsatellite-enriched library construction (Bloor et al. 2001). Approximately 6 µg

of genomic DNA was cut with the restriction enzyme RsaI (New England BioLabs,

USA). Adaptor-ligated DNA fragments ranging in size from 400 to 1000 bp were

selected and enriched for (AG)15 repeats using M-280 Dynabeads (Invitrogen, USA).

The DNA was then ligated using the pGEM-T vector (Promega, USA) and

transformed into JM109 Escherichia coli Competent Cells (Promega, USA) for

cloning. 352 clones were picked, of which 96 were selected for sequencing (from 175

shown to have an insert). I then designed primers from 39 sequences using the

program OLIGO v4.0 (Molecular Biology Insights, USA). These candidate

microsatellite loci were selected based on the availability of flanking regions suitable

for primer design.

A partial genomic library was constructed for the isolation of microsatellite loci

in M. pyriformis. Approximately 2 µg of purified genomic DNA was double digested

with restriction enzymes HaeIII and Sau3AI. Digests were run on a 1% agarose gel,

and digest products ranging in size from 300 to 800 bp were excised from the gel.

Size-selected digest products were then ligated into a BamHI and HincII digested

pUC19 vector. Ligations were desalted and transformed into electrocompetent E. coli

JM109 cells (Promega). E. coli colonies were grown on LB plates with

ampicillin/IPTG/X-Gal media. Colonies were lifted onto N+ hybond membranes.

Microsatellite probes (AC)10 and (AG)10 were end-labelled with [c33P] adenosine

triphosphate (ATP) and hybridized to membranes overnight at 55ºC. Membranes were

exposed to a autoradiograph film, and the film was aligned back to colonies after

exposure. Positive colonies were re-screened to confirm their status. Positive clones

were sequenced using an fmol sequencing kit (Promega, USA), and 12 primers were

designed using OLIGO v4.0.

In addition, 14 previously published microsatellites, developed for N. macrops

(Sanetra & Crozier 2000), were tested in this study, to check their cross-taxa

16

transferability and utility in the two target species. The forward primer of each locus

was synthesized with a 5’-end 17-base tag to enable the labelling strategy of Shimizu

et al. (2002) (Table 3.1).

PCR amplification and genotyping analysis

In all, 65 microsatellite loci (39 isolated from M. brevinoda; 12 from M. pyriformis;

14 from N. macrops) were assayed against 20 individuals from 20 nests of M.

brevinoda and 16 individuals from 16 nests of M. pilosula. The resultant polymorphic

loci were also examined for their amplifiability in two individuals from a single nest

of M. pyriformis. PCR amplifications were performed in the thermal cycler GeneAmp

PCR System 9700 (PE Applied Biosystems, USA), using the following protocol: a

final volume of 15 μL containing 1× PCR buffer, ~50 ng of genomic DNA, 1.35 mM

MgCl2, 0.2 mM each of dNTPs, 0.3 U Taq polymerase (Invitrogen, USA), 0.4 μM

universal fluorescent primer (GGTGGCGACTCCTGGAG, 5’ labelled with TET,

HEX or FAM), 0.1 μM tagged primer and 0.4 μM untagged primer. The PCR profile

was as follows: initial denaturation at 94 °C for 3 min; followed by 35 cycles of 94°C

for 30 s, appropriate annealing temperature (see Table 3.1 for details) for 30 s, 72°C

for 45 s, and last synthesis at 72°C for 7 min. Fluorolabelled PCR products were

cleaned by centrifugation through 300 μL of Sephadex G-50 and multiplexed, and

ET-400R size standard was added before genotyping on MegaBACE 1000

(Amersham Biosciences, USA).

Data analysis

The program PowerMarker v3.0 (Liu & Muse 2005) was employed to estimate

various parameters: the number of alleles per locus (NA), observed (HO) and expected

(HE) heterozygosities, deviation from Hardy-Weinberg equilibrium (HWE) and

linkage disequilibrium (LD). For the detection of LD and the deviation from HWE,

the sequential Bonferroni correction for multiple comparisons was applied at the

significance level of 0.05 (Holm 1979). Besides, the possible presence of null alleles

was checked using the program Micro-Checker v2.2.3 (van Oosterhout et al. 2004).

17

Table 3.1 Characterization of polymorphic microsatellite loci in M. brevinoda and M. pilosula, and amplifiability in M. pyriformis

Locus ID Source species GenBank acc. no.

Primer sequences (5’-3’) Repeat motif Expected size (bp)

M. brevinoda (n = 20, i = 20) / M. pilosula (n = 16, i = 16) M. pyriformis (n = 1, i = 2)

TA (ºC) NA Size range (bp) HO HE P-value (SB) TA (ºC) PCR

Mbre9 M. brevinoda GQ379208 F: *ACTTTGTGCCGGATGTGAAC (TC)37 249 56 / 55 18 / 6 226-308 / 244-256 0.8500 / 0.6250

0.9200 / 0.5723

0.1490 (0.0057) / 0.6570 (0.0170)

55 +

R: CTGACAAGCCATAGTTTGTAATG

Mbre11 M. brevinoda GQ379209 F: *CCGTTCTCCGACCGTGTATAATG (TC)36 301 - / 55 - / 4 - / 272-286 - / 0.6875 - / 0.5898 - / 0.4400 (0.0064) 55 +

R: ACATGCCCAATATGAAGAACGCA

Mbre16 M. brevinoda GQ379210 F: *TCACCTCCCCTCCACTTCC (TC)28 302 55 / - 12 / - 289-333 / - 0.8000 / - 0.8535 / - 0.1800 (0.0073) / - 55 +

R: TGCTTACTCGCTGAATC

Mbre17 M. brevinoda GQ379211 F: *ACGAACACCAGGATGCAGC (GA)29 186 - / 55 - / 8 - / 156-202 - / 0.8125 - / 0.7129 - / 0.6010 (0.0127) 55 +

R: GTCTTAACGAGGACTCTTC

Mbre36 M. brevinoda GQ379212 F: *TTACACGACAGTCTGATAG (CT)17GTCC(CT)4 143 55 / 52 16 / 1(M) 173-208 / 131 0.8500 / (M) 0.8975 / (M)

0.1000 (0.0051) / (M)

60 +

R: GCCGTGCATCAGCGCCAGC

Mbre40 M. brevinoda GQ379213 F: *CGTAAAACCGCACACTCGC (TC)24 144 55 / 56 6 / 11 144-162 / 181-206 0.8000 / 0.8125

0.8000 / 0.8652

0.9020 (0.0500) / 0.3030 (0.0073)

60 +

R: GCGACGATGGTGAAGGGAG

Mbre41 M. brevinoda GQ379214 F: *CGTTCACAGCGCAAGCAAG (TC)39 290 50 / 50 7 / 3 266-317 / 249-253 0.6000 / 0.5625

0.7425 / 0.4863

0.0350 (0.0043) / 1.0000 (0.0500)

50 +

R: GTTATAAATTTAATTAGCC

Mbre56 M. brevinoda GQ379215 F: *TCGTGGGAGTTGCGGGCAG (CT)4C(CT)31 265 58 / - 13 / - 246-315 / - 0.7500 / - 0.8800 / - 0.1540 (0.0064) / - 60 +

R: GAAGCCGAATAATGATACG

Mbre67 M. brevinoda GQ379216 F: *ATAGTCAGCCAGGATTCGG (TC)38TT(TC)4 247 - / 60 - / 12 - / 272-334 - / 0.8125 - / 0.8652 - / 0.5350 (0.0102) 60 +

R: TGCGAACGTGAAGAGCGAG

Mbre78 M. brevinoda GQ379217 F: *GTCCAAATTAGCGAACGGC (TC)27 271 69 / 55 9 / 1(M) 259-287 / 249 0.9000 / - 0.8538 / - 0.6450 (0.0127) / - 60 +

R: AGTCGTTGCTCGGATCGGC

Mpyr22 M. pyriformis GQ379218 F: *GCACAGGGTCAAAGGGAG (CT)4TT(CT)2TT (CT)4CG(CT)3

295 - / 55 - / 12 - / 330-381 - / 0.9375 - / 0.8711 - / 0.0110 (0.0057) 60 +

R: CTAATCGTTTCTCATCGCAG

18

(Continued …)

Locus ID Source species GenBank acc. no.

Primer sequences (5’-3’) Repeat motif Expected size (bp)

M. brevinoda (n = 20, i = 20) / M. pilosula (n = 16, i = 16) M. pyriformis (n = 1, i = 2)

TA (ºC) NA Size range (bp) HO HE P-value (SB) TA (ºC) PCR

Mpyr38 M. pyriformis GQ379219 F: *TCACCGTTTGTCCTCCTTCAC (GA)8AA(GA)12

AA(GA)3 259 65 / 55 12 / 6 260-298 / 317-326 0.7500 /

0.7500 0.8150 / 0.6875

0.5600 (0.0085) / 0.4720 (0.0085)

60 +

R: CGAAGAATGGAGGCGAAGTG

Mpyr57 M. pyriformis GQ379220 F: *GTGTGTACCTGGGGCTGC (AG)25 298 55 / 55 13 / 1(M) 274-307 / 255 1.0000 / - 0.8738 / - 0.8730 (0.0253) / - 60 +

R: TTCTCTACCTTTCTCCTTCC

Nmac18 N. macrops AF264866 F: *CCAATTCGTGCGTCCCCAT (TC)4TTTG(TC)2

(N)9(TC)11(AC)4T CTT(TC)2

283 57 / 55 8 / 5 243-289 / 243-257 0.8000 / 0.8125

0.7900 / 0.7402

0.5980 (0.0102) / 0.9520 (0.0253)

60 +

R: GGCGAGGGTTATTTCTTACG

Nmac43 N. macrops AF264871 F: *GTTCGTGGCAGCAGTCGG (CT)23 126 50 / - 8 / - 97-117 / - 0.8500 / - 0.8013 / - 0.8530 (0.0170) / - - -

R: CTCCGTGCTTTCCAGAACG

Nmac47 N. macrops AF264873 F: *GATGTCGTTGGGTTCGTATC (GA)24 307 55 / 55 3 / 1(M) 309-325 / 313 0.4000 / - 0.5413 / - 0.0490 (0.0047) / - 60 +

R: GAAACTTCGGCAGGGACTC

Mean 10.42 / 7.44 0.7792 / 0.7569

0.8141 / 0.7101

Fluorolabels with asterisks (*): 5’-GGTGGCGACTCCTGGAG-3’; TA, annealing temperature (°C); NA, number of alleles; HO, observed heterozygosity; HE, expected heterozygosity; P, exact P-value for Hardy-Weinberg equilibrium

(HWE) test; SB, sequential Bonferroni threshold at the significance level 0.05; n, number of nests analyzed; i, number of individuals assayed; -, failed amplification or failed genotyping due to stutter bands; M, monomorphic locus.

Monomorphic loci were excluded from the calculation of mean values. All loci were examined for their amplifiability in two samples of M. pyriformis (+, successful; -, failed amplification). Loci starting with ‘Nmac’ were previously

published by Sanetra & Crozier (2000).

19

Table 3.2 Transferability and utility of candidate microsatellite loci in M. brevinoda and M. pilosula

Source species No. of loci assayed

Transferability and utility (M. brevinoda / M. pilosula)

Failed PCR Stuttering Transferable loci Polymorphic loci

M. brevinoda 39 24 / 25 8 / 2 - / 12(30.76) 7(17.95) / 6(15.38)

M. pyriformis 12 3 / 6 3 / 1 6(50.00) / 5(41.67) 2(16.67) / 2(16.67)

N. macrops 14 0 / 1 5 / 3 9(64.29) / 10(71.43) 3(21.43) / 1(7.14)

-, not applicable. Transferable loci were loci that could be successfully amplified in another taxon than the one they had been isolated from. Polymorphic loci were a subset of the transferable loci. Both transferable and polymorphic loci are given as absolute numbers followed by % values in parentheses.

Results

Forty-nine loci were discarded due to poor amplification, severe stuttering or

monomorphism (at the 95% criterion). Sixteen loci (10 isolated from M. brevinoda; 3

from M. pyrifomis; 3 from N. macrops) yielded clear and interpretable peaks and were

polymorphic in at least one of the two target species, M. brevinoda and M. pilosula

(Table 3.1; Table 3.2). Of these loci, 12 and 9 generated polymorphic products in M.

brevinoda and M. pilosula, respectively, with 5 of them proving useful in both species.

Notably, 64.29% (9/14) and 71.43% (10/14) of the candidate loci originally isolated

from N. macrops were successfully amplified in M. brevinoda and M. pilosula,

respectively (Table 3.2). In addition, 15 out of the 16 loci (93.75%) proved

amplifiable in M. pyriformis (Table 3.1), the failed locus being one developed for N.

macrops.

In M. brevinoda, the 12 polymorphic microsatellites yielded a total of 125 alleles,

ranging from 3 (Nmac47) to 18 (Mbre9) with an average of 10.42 per locus; the

observed and expected heterozygosities ranged from 0.4000 to 0.9000 and from

0.5413 to 0.9200, with an average of 0.7792 and 0.8141, respectively. In M. pilosula,

the 9 polymorphic loci generated a total of 67 alleles, ranging from 3 (Mbre41) to 12

(Mbre67 / Mpyr22) with an average of 7.44 per locus; the observed and expected

heterozygosities ranged from 0.5625 to 0.9375 and from 0.4863 to 0.8711, with an

average of 0.7569 and 0.7101, respectively. Following the sequential Bonferroni

correction, no significant deviation from HWE or LD was observed in any of the 16

loci in any of the species. Possible occurrence of null alleles was suggested in one

locus (Nmac47) for M. brevinoda, but not in any locus for M. pilosula.

20

Discussion

In this study, I have collated a set of polymorphic dinucleotide microsatellite loci

suitable for population genetic studies of Myrmecia brevinoda and M. pilosula. The

levels of heterozygosity reported here were comparable to those previously reported

for the consubfamilial dinosaur ant Nothomyrmecia macrops (Myrmeciinae) (Sanetra

& Crozier 2000) and one species of the subfamily Ponerinae s.str. (Bolton 2003),

which diverged early from other ants (Moreau 2009), i.e., Diacamma cyaneiventre

(Ponerinae) (Doums 1999). The heterozygosity levels I found were higher, however,

than those for the only other ant from Ponerinae for which microsatellite data are

available, i.e., Diacamma ceylonense (Gopinath et al. 2001).

The success rates in screening the candidate microsatellites in M. brevinoda and

M. pilosula were rather low. Interestingly, those loci originally isolated from N.

macrops displayed a high level of cross-generic transferability, which was

substantially higher than that reported in the cross-subfamilial transferability of

EST-derived microsatellites from Solenopsis invicta (Myrmicinae) to M. brevinoda

(16.67%, 2/12) (see Chapter 2 for details). Likely, this reflects the much closer

phylogenetic relatedness among the genera of the same subfamily as compared to that

of genera from different subfamilies. However, out of the 10 transferable loci, only

one proved polymorphic in M. pilosula, in line with the widely held viewpoint that the

allelic diversity of transferable microsatellites is closely correlated with the

phylogenetic relatedness between the donor and acceptor species (Decroocq et al.

2003). In addition, 15 out of the 16 loci were successfully amplified in M. pyriformis,

suggesting the potential applicability in this species. Considering the usefulness of the

loci in two different Myrmecia species groups (M. gulosa species group: M. brevinoda,

M. pyriformis; M. pilosula species group: M. pilosula), which are relatively distant

phylogenetically (Hasegawa & Crozier 2006), the loci may also be applicable to other

species groups of the genus.

It should be noted that I used constant PCR conditions to evaluate the cross-taxa

transferability and utility of these microsatellites in the target species. Further

optimization of the PCR protocol might potentially increase the success rate of marker

development. These polymorphic loci will be employed to investigate the population

and colony genetic structure in M. brevinoda and M. pilosula.

21

CHAPTER 4: Intraspecific Support for the Polygyny-vs.-Polyandry Hypothesis

in the Bulldog Ant Myrmecia brevinoda

Abstract

The number of queens per colony and the number of matings per queen are the most

important determinants of the genetic structure of ant colonies, and understanding

their interrelationship is essential to the study of social evolution. The

polygyny-vs.-polyandry hypothesis argues that polygyny and polyandry should be

negatively associated since both can result in increased intracolonial genetic

variability and have costs. However, evidence for this long-debated hypothesis has

been lacking at the intraspecific level. Here, I investigated the colony genetic structure

in the Australian bulldog ant Myrmecia brevinoda. The numbers of queens per colony

varied from 1 to 6. Nestmate queens within polygynous colonies were on average

related (rqq = 0.171±0.019), but the overall relatedness between queens and their

mates was indistinguishable from zero (rqm = 0.037±0.030). Queens were inferred to

mate with 1 to 10 males. A lack of genetic isolation by distance among nests indicated

the prevalence of independent colony foundation. In accordance with the

polygyny-vs.-polyandry hypothesis, the number of queens per colony was

significantly negatively associated with the estimated number of matings (Spearman

rank correlation R = -0.490, P = 0.028). This study thus provides the rare intraspecific

evidence for the polygyny-vs.-polyandry hypothesis. I suggest that the high costs of

multiple matings and the strong effect of multiple mating on intracolonial genetic

diversity may be essential to the negative association between polygyny and

polyandry, and that any attempt to empirically test this hypothesis should place

emphasis upon these two key underlying aspects.

22

Introduction

Eusocial insect colonies with the simplest relatedness structure are headed by a single,

once-mated queen, which is considered ancestral in the evolution of insect eusociality

(Hughes et al. 2008a). However, multiple queens per colony (polygyny) and multiple

paternity (polyandry) are not rare at all, especially in ants (reviewed by Baer 2011;

Crozier & Pamilo 1996; Keller & Reeve 1994; Schmid-Hempel & Crozier 1999). As

estimated from the dataset of Hughes et al. (2008b), 41.54% and 44.62% of formicid

species show some level of polygyny and polyandry, respectively. The number of

queens per colony has received significant attention (e.g., Hölldobler & Wilson 1977;

Keller 1993, 1995), since it affects the relatedness among colony members and thus

the indirect benefits workers gain by helping to raise the brood (Heinze & Keller

2000). It is to a queen’s disadvantage to share the colony with other (especially

unrelated) queens due to a decrease in individual reproductive output (i.e., individual

fitness), and to the workers’ disadvantage to raise queens that are unrelated (or

distantly related) to them (Craig & Crozier 1979). Additional disadvantages proposed

for polygyny include an increased energetic burden it imposes on the colony

especially during the colony’s early growth, potential for parasitism by queens

producing more sexuals and less workers than other queens, and an increased

accessibility of the colony and its resources to non-colony members (Bourke &

Franks 1995; Buschinger 2009; Elmes 1991; Hölldobler & Wilson 1977) . However,

polygyny is thought to be adaptive in situations of environmental stresses such as

nest-site limitation or high risks associated with independent colony foundation

(Bourke & Franks 1995; Keller 1995).

The evolution of polyandry is also a challenging puzzle, and a variety of

hypotheses have been proposed (reviewed by Crozier & Fjerdingstad 2001; Trontti et

al. 2007). Polyandry, for example, has been associated with extended colony

longevity due to an increased lifetime supply of sperm (Cole 1983; Schlüns et al. 2005b), and the convenience polyandry hypothesis proposes that females accept

additional copulations due to the higher cost of resistance than that of compliance

(Thornhill & Alcock 1983). The most prominent hypotheses to explain polyandry are,

however, genetic in nature, i.e., they emphasize the selective benefits of increased

genetic variability of offspring. Thus, polyandry has been hypothesized to increase the

resistance of colonies to pathogens or diseases, to enhance the expression of

23

genetically-based caste systems, to reduce the among-colony variance of diploid male

production, and to alleviate genetic drift and inbreeding within local populations

(reviewed by Crozier & Fjerdingstad 2001). On the other hand, polyandry is also

known to have costs, such as the increased energetic loss or the increased risk of

predation or sexually transmitted diseases (Crozier & Fjerdingstad 2001; Keller &

Reeve 1995).

Since both polygyny and polyandry can result in increased intracolonial genetic

variability and have costs, their relationship has long been of wide general interest.

Keller & Reeve (1994) hypothesized that polygyny should be negatively associated

with polyandry due to their costs and the benefits of the resultant genetic variability

(hereby termed polygyny-vs.-polyandry hypothesis). This hypothesis has raised

considerable attention as well as controversy ever since its emergence (e.g., Boomsma

& Ratnieks 1996; Pedersen & Boomsma 1999b; Schmid-Hempel & Crozier 1999). An

important step to test this hypothesis is to examine the variation in mating frequency

among closely related species differing in queen numbers or among colonies within

facultatively polygynous species (Holbrook et al. 2007). So far, to my knowledge, it

has only been supported by two comparative analyses of queen-mating frequency

across species (Hughes et al. 2008b; Kronauer & Boomsma 2007). At the intraspecific

level, this hypothesis has yet to gain any empirical support. One reason for this may

be that pronounced variability in mating frequency has been only known from

monogynous colonies of ants (Hughes et al. 2008b). In this study, I present the rare

intraspecific evidence for the polygyny-vs.-polyandry hypothesis by examining

colonies of the Australian bulldog ant Myrmecia brevinoda.

The bulldog ant M. brevinoda, together with its congeners, has retained many

ancestral formicid characteristics (Dietemann et al. 2004; Hölldobler & Wilson 1990;

Haskins & Haskins 1950), and is thus considered significant in studies of social

evolution. On the other hand, it displays advanced traits like large colonies with up to

a few thousand workers and complex nest architecture (Higashi & Peeters 1990).

However, little is known about various aspects of its colony genetic structure, such as

the number of queens per colony, the number of matings per queen, the relatedness


(reproductive skew). To my knowledge, the only report has been made by Higashi &

Peeters (1990), who excavated a nest of M. brevinoda and reported the presence of a

single queen.

24

Table 4.1 Characteristics of the colonies used to study colony genetic structure in Myrmecia brevinoda

Colony code Ncol Qest Mest Me,p rqq rqm RS-Q RS-M HE B01 11 1 7.00 11.16 - 0.127 - -0.064 0.667 B02 12 1 5.00 5.15 - -0.162 - -0.017 0.700 B03 23 4 [1a2b2c3d] 2.00 1.88 0.200 0.096 -0.012 0.017 0.730 B04 24 1 2.00 1.09 - 0.105 - 0.399** 0.501 B05 21 1 5.00 4.22 - -0.025 - 0.032 0.697 B06 23 4 [1a2b3c6d] 3.00 3.22 0.235 0.183 0.052 -0.023 0.779 B07 20 1 5.00 4.44 - 0.068 - 0.020 0.658 B08 21 1 6.00 4.49 - 0.134 - 0.050 0.645 B09 20 1 4.00 1.39 - -0.169 - 0.443** 0.590 B10 20 1 4.00 1.75 - -0.193 - 0.303** 0.617 B11 21 2 [1a4b] 2.50 2.50 0.050 0.027 0.032 0.005 0.702 B12(2) 35(20+15) 6 [2a2b2c3d4e5f] 3.00 3.18 0.122 0.094 -0.005 -0.008 0.751 B13 23 1 7.00 5.91 - 0.027 - 0.022 0.700 B14(3) 88(22+23+43) 5 [2a3b4c8d8e] 5.20 3.79 0.005 0.091 0.017* 0.016** 0.790 B15 28 1 10.00 9.02 - 0.080 - 0.008 0.657 B16 27 3 [3a3b6c] 4.00 4.57 0.196 0.077 0.011 -0.009 0.714 B17 22 1 6.00 2.80 - -0.066 - 0.180** 0.681 B18 21 4 [1a2b3c4d] 2.50 2.59 0.335 -0.140 -0.002 -0.009 0.793 B19 21 4 [1a1b2c2d] 1.50 1.29 0.146 -0.103 -0.002 0 0.743 B20 21 2 [6a10b] 8.00 13.75 0.476 0.110 -0.014 -0.023 0.756 Population-level 25.10 ± 15.63 2.25 ± 1.65 4.64 ± 2.34 4.41 ± 3.35 0.171 ± 0.019 0.037 ± 0.030 0.008 0.067** 0.694 ± 0.072

Ncol denotes the sample size of each colony. The number and sample sizes of member nests are indicated in parentheses for polydomous colonies. The estimated numbers of functional queens per colony (Qest) and of males per queen (Mest) were based on the analytical results of the program COLONY v2.0 (Jones & Wang 2010). For polygynous colonies, the Mest value for each nestmate queen is presented in parentheses. The pedigree-effective number of mates per queen (Me,p) was estimated using the method of Nielsen et al. (2003). Relatedness coefficients between nestmate queens (rqq) and between queens and their mate(s) (rqm) were calculated using the algorithm of Queller & Goodnight (1989) as implemented in the program RELATEDNESS v5.0.8; standard errors (SE) were obtained by jackknifing over loci. Maternity (RS-Q) and paternity (RS-M) skews were estimated using the B index of Nonacs (2000) as implemented in the program SKEW CALCULATOR 2003. The observed skew values were tested for significant differences from zero, the expected value under random reproduction (*P < 0.05, **P < 0.01). Expected heterozygosity (HE) was presented for each colony. Arithmetic means (± standard deviation, SD) were calculated for the first four parameters and HE at the population level. The hyphen (‘-’) denotes ‘not applicable’.

25

Here, I present the application of highly variable microsatellite markers to

explore colony genetic structure in M. brevinoda. The specific objectives were to: (i)

obtain data on the number of queens per colony and the number of matings per queen;

(ii) estimate the relatednesses among colony members; (iii) examine the reproductive

skew; (iv) infer the mode of colony foundation; and (v) provide an empirical test for

Keller & Reeve’s (1994) prediction of a negative association between the number of

queens per colony and the number of matings per queen.

Fig. 4.1 Schematic map of Myrmecia brevinoda colonies. Filled triangles denote the sampled nests. Those within a single ellipse represent nests belonging to the same polydomous colony. Colony codes

are as shown in Table 4.1.


Insect samples and DNA extraction

M. brevinoda is widely distributed in New South Wales and Queensland, Australia

(Lester & Keall 2005). Twenty-three nests were sampled from a population of M.

brevinoda in Paluma (Queensland, Australia; 19.02°S / 146.14°E) on 21-22 February

2010 (Table 4.1; Fig. 4.1). Workers were collected into 100% ethanol. Genomic DNA

was extracted with PUREGENE DNA Isolation Kit (Gentra Systems, USA) following

the manufacturer’s protocol.

Microsatellite genotyping

26

A total of 502 workers from 23 nests (Table 4.1) were genotyped at ten microsatellite

loci (Mbre9, Mbre36, Mbre40, Mbre41, Mbre56, Mbre78, Mpyr38, Mpyr57, Nmac18

& Nmac43) (see Chapter 3 for details). The forward primer of each locus was

synthesized with a 5’-end 17-base tag (5’-GGTGGCGACTCCTGGAG-3’) to enable

the labelling strategy of Shimizu et al. (2002). Fluorolabelled PCR products were

cleaned by centrifugation through Sephadex G-50 (GE Healthcare, UK) and

multiplexed before genotyping on MegaBACE 1000 (Amersham Biosciences, UK).

Statistical analyses

The microsatellite loci were evaluated for departure from Hardy-Weinberg

equilibrium (HWE), linkage disequilibrium (LD), allelic richness and expected

heterozygosity (HE) using the program PowerMarker v3.2.5 (Liu & Muse 2005).

Estimates of HE were also calculated for each colony and at the population level. To

circumvent possible problems that may arise from non-independence of genoytpes

within colonies, a subset of the original dataset comprising individuals randomly

sampled from each colony was employed for the tests of HWE and LD. In addition,

the sequential Bonferroni correction for multiple comparisons was applied at the

significance level of 0.05 (Holm 1979).

To estimate the degree of isolation by distance (Wright 1943), the program

GenAlEx v6.3 (Peakall & Smouse 2006) was employed to perform a Mantel test to

reveal the correlation between Nei’s (1972) genetic and geographic distances for pairs

of nests.

The program COLONY v2.0 (Jones & Wang 2010), which implements a

maximum likelihood method and can accommodate genotyping errors that occur

commonly in microsatellite assays (Pompanon et al. 2005), was employed to group

workers into matrilines (offspring from the same mother) and patrilines (offspring

from the same father), and to infer the genotypes of both reproductive queens and

their mates. To confirm the reliability of the analytical results, I performed multiple

runs with different random number seeds and checked their convergence. The

genotypes of queens and their mates with the highest likelihood were used for the

calculations of relatedness coefficient and reproductive skew. Based on the above

results, I was also able to detect any possible occurrence of polydomy, i.e., one colony

occupying multiple socially interconnected but spatially separated nests (Hölldobler

27

& Wilson 1977). In this study, nests that apparently mutually exchanged workers were

considered as belonging to a single polydomous colony; otherwise, any unidirectional

occurrence of alien worker(s) in a certain nest was treated as occassional worker

drifting.

Weir & Cockerham’s (1984) estimator of population-specific inbreeding

coefficient FIT was calculated from genotypes of workers using the program FSTAT

v2.9.3 (Goudet 1995); colonies were entered as populations. Estimates of regression

relatedness (r) were obtained by the program RELATEDNESS v5.0.8 (Keith F.

Goodnight; http://www.gsoftnet.us/GSoft.html), which implements the algorithms of

Queller & Goodnight (1989); individuals were weighted equally. Relatedness

estimates were calculated between various parties at different levels: (1) among

nestmate queens in polygynous colonies; (2) among workers at the colony level,

within monogynous colonies, within polygynous colonies and within matrilines; (3)

among mates of a single queen or of multiple coexisting queens in polygynous

colonies; and (4) among queens and their mates. For both inbreeding and relatedness

coefficients, standard errors (SE) were obtained by jackknifing over loci, and their

departures from hypothetical values were tested using t-tests. All t-tests were

two-tailed unless stated otherwise.

One factor which may cause the underestimation of queen mating frequencies is

sampling error. I evaluated the sufficiency of the sample sizes by examining the

association between the estimated number of mating males and the sample size per

colony; a nonassociation indicates that the sample sizes are sufficient to detect all

patrilines (Trontti et al. 2007).

I also calculated the pedigree-effective number of matings per queen corrected

for sample size (Me,p) following Nielsen et al. (2003):

k

ii

pe

nnnp

nM

1

2

2

,

3)2)(1(

)1(

where n is the sample size and pi is the estimated contribution of the ith male that

mated with the queen.

Another factor which may cause the underestimation of queen-mating

28

frequencies is the nondetection error, i.e., two males may bear the same genotype at

all loci. I estimated the nondetection error (Pnondetection) at the population level,

following the method of Boomsma & Ratnieks (1996):

k

j

a

iij

j

qP1 1

2onnondetecti )(

where qij is the frequencies of the aj alleles (j = 1 to k) at each of the k loci.

Paternity (RS-M) and maternity (RS-Q) skews were estimated using the B index

(Nonacs 2000) as implemented in the program SKEW CALCULATOR 2003 (Peter

Nonacs; http://www.eeb.ucla.edu/Faculty/Nonacs/shareware.htm). This program also

estimates the possibility level that the observed value differs from zero, i.e., that the

reproduction is not randomly distributed among nestmate queens in a polygynous

colony or among multiple mates of a single queen.

Finally, I tested Keller & Reeve’s (1994) hypothesis by looking at the relationship

between the estimated number of functional queens per colony and the average

number of matings per queen in a given colony. Both the estimated and

pedigree-effective numbers of matings per queen were examined for such an

association using Spearman rank correlation as implemented in the program

STATISTICA v6.0 (StatSoft Inc., USA).

Fig. 4.2 Correlation between geographic and genetic distances for pairs of Myrmecia brevinoda nests (r = 0.013, P = 0.420; 9999 permutations)

29

Results

Basic population genetics and identification of colony boundaries

The ten polymorphic microsatellites yielded a total of 167 alleles, ranging from 8 to

30 with an average of 16.70 alleles per locus. The expected heterozygosity (HE) for

each locus ranged from 0.7044 to 0.9136, with an average of 0.8374. The HE

estimates also indicated high intracolonial genetic diversity, ranging from 0.501 to

0.793 with an average of 0.694 (Table 4.1). Following the sequential Bonferroni

correction, I detected no significant departure from HWE or LD. The population

inbreeding coefficient FIT (mean ± SE) was 0.030 ± 0.016, which was

indistinguishable from zero (t9 = 1.774, P = 0.110). No significant correlation was

found between Nei’s (1972) genetic and geographic distances between pairs of nests

(r = 0.013, P = 0.420, 9999 permutations; Fig. 4.2).

The COLONY program grouped the 23 nests (502 workers) into 20 colonies,

with two polydomous colonies comprising two and three member nests, respectively

(Table 4.1; Fig. 4.1). The results from different replicate runs strongly converged,

suggesting that the marker information was sufficient for robust inferences of the

genetic structure. A small proportion of workers (2.39%) failed to be assigned to the

colonies from which they were sampled. Following the criterion employed in this

study (see ‘Materials and methods’), these workers were treated as intercolonial

drifters.

Table 4.2 Relatedness among workers in the colonies of Myrmecia brevinoda.

Relatedness ± SE

Over all colonies Monogynous colonies

Polygynous colonies Within matrilines

Worker-worker 0.290 ± 0.009 0.430 ± 0.018 0.180 ± 0.009 0.435 ± 0.008

Relatedness coefficients were calculated using the algorithm of Queller & Goodnight (1989) as implemented in the program RELATEDNESS v5.0.8; standard errors (SE) were obtained by jackknifing over loci.

30

Fig. 4.3 Estimated (a) and pedigree-effective (b) number of matings per queen in Myrmecia brevinoda

31

Queen mating frequency and paternity skew

Queens were inferred to mate with 1 to 10 males (Mest) (Fig. 4.3a), and the

pedigree-effective number of matings per queen (Me,p) ranged from 1.00 to 22.22 (Fig.

4.3b). The arithmetic means ± standard deviation (SD) of the two estimates were Mest

= 4.64 ± 2.34 and Me,p = 4.41 ± 3.35, respectively (Table 4.1). The estimated number

of mating males per colony was not significantly associated with sample size

(Spearman rank correlation R = -0.076, n = 20, P = 0.7488), indicating that the sample

sizes were sufficient to detect all patrilines. The nondetection error due to two males

bearing the same genotype at all loci was extremely low (Pnondetection = 0.0000000046).

Significant paternity skew was observed in 5 out of the 20 colonies (P < 0.01)

(Table 4.1). At the population level, male reproduction was significantly skewed (P <

0.01), in line with the apparent discrepancy between the estimated and effective

numbers of matings.

Intracolonial relatedness

Regression relatedness values (arithmetic mean ± SE) calculated between various

parties are presented in Table 4.1 and Table 4.2. Nestmate queens in polygynous

colonies were on average related (rqq = 0.171 ± 0.019; t8 = 4.091, P = 0.004), and the

estimate was indistinguishable from the minimum value of 0.25 that is expected for

half sisters (with the same mother but different fathers; t8 = 1.127, P = 0.292). The

relatedness between queens and their mates was indistinguishable from zero (rqm =

0.037 ± 0.030; t19 = 0.694, P = 0.496), in accordance with the negligible inbreeding

inferred via FIT (see above). Multiple males that mated to the same queen were found

to be on average unrelated (rmm = 0.011 ± 0.011, t38 = 0.580, P = 0.565). The same held for the males that mated to different queens from the same polygynous colony

(rmm = 0.020 ± 0.012, t8 = 1.512, P = 0.169).

The worker-worker relatedness at the colony level was significantly higher in

monogynous colonies (rww = 0.430 ± 0.018) than in polygynous colonies (rww = 0.180 ± 0.009) (one-tailed independent-samples t-test; t18 = 4.659, P < 0.0001). Nestmate

workers were related by rww = 0.288 ± 0.008 over all colonies, which was

indistinguishable from the minimum value of 0.25 for half sisters (t19 = 2.021, P =

0.058). At the matriline level, sister workers were more related than half sisters (rww =

0.435 ± 0.008; one-tailed t-test, t44 = 9.048, P < 0.0001) (Table 4.2).

32

Fig. 4.4 The relationship across colonies of Myrmecia brevinoda between polygyny, measured as the

number of queens per colony, and polyandry, measured as the mean estimated (a) or pedigree-effective

(b) number of matings per queen. Unfilled circles represent colonies in which significant paternity

skew occurs.

33

Number of queens and maternity skew

In all, 45 queens were inferred from all 20 colonies. The estimated number of

functional queens per colony varied from 1 to 6, with 9 out of the 20 colonies being

polygynous (Table 4.1). For the overall population, the mean number (± SD) of

queens per colony was 2.25 ± 1.65.

Significant maternity skew was only detected in 1 out of the 9 polygynous

colonies (P < 0.05). At the population level, the reproduction was randomly

distributed among nestmate queens (P > 0.05).

Polygyny vs. polyandry

I tested Keller & Reeve’s (1994) hypothesis. The estimated number of queens per

colony was found to be significantly negatively associated with the estimated number

of matings per queen (Spearman rank correlation R = -0.490, n = 20, P = 0.028), but

not with the pedigree-effective number of matings per queen (R = -0.300, n = 20, P =

0.277) (See also: Fig. 4.4).

Discussion

Queen number, mating frequency and dispersal

Although multiple mating by females is widespread in the eusocial Hymenoptera,

high levels of polyandry have thus far been mostly known from a few genera with

strictly monogynous colonies, such as the honey bee (Apis) (Page 1980; Palmer &

Oldroyd 2000; Schlüns et al. 2005b; Schlüns et al. 2005a; Tarpy et al. 2004), army

ants (Dorylus and Eciton) (Denny et al. 2004; Kronauer et al. 2004), harvester ants

(Pogonomyrmex) (Rheindt et al. 2004; Wiernasz et al. 2004), and the leaf-cutting ants

(Atta and Acromyrmex) (Sumner et al. 2004; Villesen et al. 2002). In this study, I

revealed high levels of polyandry (Me,p = 1.00-22.22; arithmetic mean Me,p = 4.41 ±

3.35) in the facultatively polygynous bulldog ant M. brevinoda, with 57.8% of

functional queens having > 2 effective mates (compared with 62.2% having > 2

inferred mates). Surprisingly, the level of polyandry was extremely high in a very few

cases, with 4.44% (2/45) of queens having > 8 inferred and effective mates. Generally,

such extremely high polyandry has been mostly known from species with very large

colony sizes and special life history, like army ants (Denny et al. 2004; Kronauer et al.

2004). Its adaptive advantage in M. brevinoda is still unknown. Despite being

34

interesting, this issue is beyond the scope of the present study, and thus remains to be

investigated. The overall level of polyandry in M. brevinoda is higher than those

reported in the congeneric bulldog ant M. pyriformis (Sanetra 2011) and the

consubfamilial dinosaur ant Nothomyrmecia macrops (Sanetra & Crozier 2001). From

a comparative analysis of queen-mating frequencies in 267 hymenopteran species,

Hughes et al. (2008a) concluded that high levels of polyandry (> 2 effective mates)

occur exclusively in species with reproductively non-totipotent workers. Workers of

some Myrmecia species do have large functional ovaries and a spermatheca (Crosland

et al. 1988b), and Dietemann et al. (2004) reported the first occurrence of gamergates

(i.e., mated reproductive workers) in the genus Myrmecia. However, workers of M.

brevinoda are known to have relatively degenerate ovaries and a rarely identifiable

spermatheca, and lay no eggs in queenless laboratory colonies (Crosland et al. 1988b;

Crosland 1989). The high level of polyandry in M. brevinoda can be viewed as in

support of the general pattern found in the large-scale comparative analysis of Hughes

et al. (2008a).

In ants, young queens of monogynous species normally disperse to mate and

found their own colony independently either alone or together with other foundresses

(‘independent colony foundation’ / ICF), while those of polygynous species usually

mate in or near their maternal nests, and establish new colonies with the help of

workers from their natal colonies (‘dependent colony foundation’ / DCF) (Reber et al.

2010). However, there are exceptions to this general rule, i.e., some species are

monogynous but exhibit DCF (e.g., Pearcy et al. 2006; reviewed by Peeters & Molet

2009). In facultatively polygynous species, ICF and DCF may co-occur (Heinze

2008). In the present study, I detected no significant correlation between the genetic

and geographic distances between nests, suggesting the prevalence of ICF in M.

brevinoda. ICF has been argued to be largely associated with nuptial flights and

subsequent dispersal on the wing, since inseminated gynes that perform such flights

are not very likely to return to their natal nest (Crozier & Pamilo 1996; Peeters &

Molet 2009). The genetic data suggest that this also applies to M. brevinoda, whose

queens have well-developed wings and are able to fly (Z-Q Qian, personal

observation); the data are also consistent with the early idea that the genus Myrmecia

represents the most generalized form of ICF (Dumpert 1981). Nuptial flights and ICF

have been reported in at least five Myrmecia species, including M. forficata (Clark

35

1934), M. pyriformis (Tepper 1882), M. gulosa (Wheeler 1933), M. inquilina and M.

vindex (Haskins & Haskins 1964). The genus Myrmecia is phylogenetically

subclassified into nine recognized species groups (Hasegawa & Crozier 2006; Ogata

1991). Interestingly, all the above species belong to the M. gulosa species group

where M. brevinoda also resides, and thus are phylogenetically closely related. In this

study, multiple males that mated either to the same queen or to different nestmate

queens from the same polygynous colony were found to be generally unrelated, and

the inbreeding in this population was negligible. This further corroborated the rarity

of local mating in this species.

I cannot, however, completely rule out the possible occurrence of DCF in M.

brevinoda. In ants, polydomy is frequently associated with polygyny (Crozier &

Pamilo 1996), and is considered to possibly result from colony budding with

incomplete separation (Steiner et al. 2009) as in the mound-building ant Formica

polyctena (Rosengren & Pamilo 1983). Thus, the various nests of a polydomous

colony may still retain some identity with the maternal colony (Crozier & Pamilo

1996). In this study, two out of the twenty colonies were found to be polydomous and

polygynous, and the genotypes were unevenly distributed among member nests. This

colony attribute appears to fit the above scenario well.

M. brevinoda is facultatively polygynous, and the polygyny in those colonies

appears to be permanent. In ants, multiple queens per colony can arise in different

ways (reviewed by Steiner et al. 2009). When colonies are founded independently,

two or more queens may cooperate in nest building and brood rearing (‘pleometrosis’)

(Hölldobler & Wilson 1977). In most cases, such pleometrotic associations do not

lead to true polygyny, and only a single egg-laying queen remains after the eclosion of

the first workers (‘secondary monogyny’) (Oliveira et al. 2010). However, multiple

queens may persist in a few species (‘primary polygyny’) (e.g., Heinze et al. 2001;

Kellner et al. 2007). The studied population of M. brevinoda has been under survey

for many years, and the sampled colonies represent mature ones. Moreover, worker

production is randomly distributed among nestmate queens at the colony (except one

colony) and the population level (see Table 4.1 for details); this is quite unlikely in

colonies which are transiting from polygyny (‘pleometrosis’) to monogyny (resulting

from the elimination of extra queens).

36


The relationship between the number of queens per colony and the number of matings

per queen has long been the focus of attention and controversy. Keller & Reeve’s

(1994) polygyny-vs.-polyandry hypothesis failed to be supported by two subsequent

comparative studies (Boomsma & Ratnieks 1996; Schmid-Hempel & Crozier 1999).

However, another two recent comparative analyses did find a clear and negative

relationship between the number of queens per colony and the number of matings per

queen, namely that by Kronauer & Boomsma (2007) using five species of army ants,

and that by Hughes et al. (2008b) using 241 hymenopteran species. At the

intraspecific level, this hypothesis has been rejected by a series of empirical studies,

e.g., in Acromyrmex echinatior (Bekkevold et al. 1999), A. heyeri and A. striatus

(Diehl et al. 2001), Formica paralugubris (Chapuisat 1998), Leptothorax acervorum

(Hammond et al. 2001), Myrmica sulcinodis (Pedersen & Boomsma 1999b),

Oecophylla smaragdina (Schlüns et al. 2009), Pachycondyla inversa and P. villosa

(Kellner et al. 2007) and Plagiolepis pygmaea (Trontti et al. 2007). In essence, it has

thus far been considered unlikely that the polygyny-vs.-polyandry hypothesis applies

at the colony level, and this somewhat reduced its direct explanatory power for social

evolution. As noted by Hughes et al. (2008b), one reason for the lack of statistical

support at the intraspecific level may have been the limited variability in

queen-mating frequency in association with that of colony queen number. However,

this explanation obviously doesn’t apply to the cases of P. inversa and P. villosa,

where queens were estimated to mate with 1-7 and 1-9 males, respectively (Kellner et

al. 2007). The support for the polygyny-vs.-polyandry hypothesis found in the case of

M. brevinoda is in agreement with the previous comparative analyses (Hughes et al.

2008b; Kronauer & Boomsma 2007), but in conflict with the other intraspecific

studies.

How then to reconcile, on the one hand, the support from the comparative

analyses and the present case of M. brevinoda and, on the other hand, the rejective

evidence from other intraspecific studies? I hypothesize that the negative association

between polygyny and polyandry may be a conditional one. The two key factors

underlying this association are the costs of additional mating and the benefits of

increased intracolonial genetic diversity, and both factors are closely linked with

mating strategies in eusocial Hymenoptera. On the one hand, the costs of multiple

37

matings in terms of energetic loss and predation risks are usually significantly lower

in species whose gynes mate near or within their natal colony than in those with gynes

that mate in swarms (Trontti et al. 2007). Restricted dispersal of gynes may promote

both polygyny and polyandry simultaneously, and multiple paternity may be a

consequence of low mating costs and/or mating in swarms with a highly male-biased

sex ratio (Pedersen & Boomsma 1999b). On the other hand, additional matings may

not necessarily contribute substantially to the intracolonial genetic diversity, if the

queen and their mates, or different mating males, are significantly related as in M.

sulcinodis (Pedersen & Boomsma 1999b) and in P. pygmaea (Trontti et al. 2007).

Where the costs of multiple mating are low and/or the effect of polyandry on the

intracolonial genetic diversity is limited, other mechanisms may prevail and lead to a

significant deviation from the assumed negative association between polygyny and

polyandry. This new view is supported by both the rejective intraspecific cases and

the present case of M. brevinoda presented here. In all those of the species without

negative association for which such data are readily available, either low mating costs

(associated with local mating) or significant relatedness between mating partners or

the different mating males were observed (Kellner et al. 2007; Pedersen & Boomsma

1999b; Trontti et al. 2007). In M. brevinoda, no significant relatedness was detected

between queens and their mates and between different mating males, and the costs of

multiple mating are probably high due to the nuptial flights of queens. The new

hypothesis should be tested in future research by examining species having similar

life-history characteristics.

Queens’ mating strategies appear to play a key role in the negative association

between polygyny and polyandry, since they directly determine the mating costs and

the effect of polyandry on intracolonial genetic variability. DCF is always linked with

local matings, and thus mating costs are usually low; by contrast, ICF is frequently

associated with nuptial flights and hence higher mating costs (Peeters & Molet 2009).

In addition, because aerial dispersal significantly avoids inbreeding (Amor et al.

2011), the strong effect of polyandry on intracolonial genetic variability can be better

guaranteed in ant species performing ICF than in those performing DCF. Thus,

ecological factors that favor ICF may also favor such a negative association. DCF

does confer advantages, since it eliminates the dangerous solitary founding stage and

allows the foundress to specialize in egg-laying (Peeters & Ito 2001). However, under

38

certain circumstances, ICF appears to be advantageous (reviewed by Peeters & Molet

2009). For example, when environments are unstable, ICF may confer better survival

via aerial dispersal. On an evolutionary timescale, the level of polyandry likely

depends on the level of polygyny, as suggested by comparative analyses (Hughes et al.

2008b; Keller & Reeve 1994). The present case of M. brevinoda rather is informative

on an ecological timescale, and here, by contrast, the level of polygyny may in fact be

determined by the level of polyandry. Young queens likely make the decision about

polygyny after the nuptial flight I have inferred and thus after they have information

about their mating frequencies.

It should be noted that I detected no significant association between the number

of queens per colony and the effective number of matings per queen (as opposed to

the estimated number of matings). This can also be viewed as in support of the

conditionality of the association. Mating costs should be directly associated with the

actual rather than the effective number of matings per queen. The pedigree-effective

number of matings per queen, which takes into account the differential contributions

of reproductive males, may deviate significantly from the actual number of matings if

high paternity skew occurs, and hence the assumed negative association could be

violated. In other words, this non-association may reflect that costs of multiple

matings may be more essential to such a negative association.

In conclusion, I suggest that the high mating costs and the strong effect of

polyandry on intracolonial genetic diversity may be essential to a negative association

between polygyny and polyandry at the intraspecific level, and any attempt to

empirically test this hypothesis should place emphasis upon these two key underlying

aspects.

39

CHAPTER 5: Nestmate Recognition in the Facultatively Polygynous Bulldog

Ant Myrmecia brevinoda

Abstract

In social insects, the ability to discriminate colony members from aliens (both

conspecific and allospecific) is crucial for maintaining colony integrity. Nestmate

recognition in the facultatively polygynous bulldog ant Myrmecia brevinoda was

evaluated using behavioural assays with three alternative estimators of aggression:

aggression index (AI), mean aggression index (MAI) and mean aggression score

(MAS). Although the absolute measure of aggression provided by each estimator

differed (AI was consistently higher), the pictures of aggression depicted by these

three estimators were the same. No aggression was observed among nestmates, but

workers of this species acted either aggressively or non-aggressively towards alien

conspecifics. These results suggest that they are able to discriminate between

nestmates and non-nestmates. Mantel tests revealed no significant impact of genetic

and spatial distances on nestmate discrimination. Moreover, the data appear to lend no

support to the hypothesis that colony social structure (queen number) variation

significantly affects nestmate recognition and aggression. Thus, the actual mechanism

underlying nestmate recognition in this species remains to be resolved.

40

Introduction

In social insects, the basic functional social unit is the colony (Crozier & Pamilo

1996). The ability to discriminate colony members from aliens is crucial for

maintaining colony integrity, since it prevents robbery, predation and parasitism from

outside (Hölldobler & Wilson 1990). Such nestmate discrimination is typically

reflected by the action of rejecting aggressively alien intruders, i.e., individuals that

are either from the other colonies of the same species or from colonies of other

species.

Cuticular hydrocarbons (CHCs) have been widely considered as major nestmate

recognition cues (d'Ettorre & Lenoir 2009; Hefetz 2007; Newey 2011; van Zweden &

d'Ettorre 2010). These substances can be acquired from environmental sources, like

food and nest materials (Liang & Silverman 2000; Liang et al. 2001; Obin & Vander

Meer 1988), or have a significant genetic component (Vander Meer & Morel 1998).

They are commonly exchanged among nestmates via trophallaxis, allogrooming

and/or passive physical contact, resulting in a uniform colony or ‘Gestalt’ odour

(Crozier & Dix 1979; Rosset et al. 2007; Soroker et al. 1998). Nestmate recognition

in ants appears to be mostly based on a ‘phenotype matching’ model (d'Ettorre &

Lenoir 2009; van Zweden & d'Ettorre 2010). An individual worker learns cues to

build an internal template which represents the colony odour profile, and may update

the template continuously throughout its adult life (Bos et al. 2011; Holzer et al.

2006). When two individuals encounter, they detect the odour cues on each other and

compare the odour profile to their own internal template; following that, an

appropriate behavioural response would be triggered based on the degree of similarity

between the detected cues and the template (Rosset et al. 2007; van Wilgenburg

2007).

At least in ants, the relative importance of genetic and environmental factors in

shaping nestmate recognition cues appears to be closely linked to the life histories of

different species and their ecological contexts (reviewed by d'Ettorre & Lenoir 2009).

The presence of multiple queens in the same colony (polygyny) increases the diversity

of genetically derived recognition cues, resulting in a broader template of recognition

cues; therefore, it has been hypothesized that workers from polygynous colonies have

less efficient recognition abilities than those from monogynous colonies (Hölldobler

41

& Wilson 1977; Vander Meer & Morel 1998). However, a higher diversity of

recognition cues may also enhance nestmate recognition, if the specific genotypic

composition of a colony creates a ‘unique’ recognition cue combination and workers

can discriminate these complex cues (Beye et al. 1998; Pirk et al. 2001). It has also

been suggested that workers may be able to detect a signal specific to the colony

social structure (monogyny vs. polygyny), resulting in a higher level of aggression

between than within social forms (Rosset et al. 2007). Multiple paternity (polyandry)

probably has a similar effect on nestmate recognition, since it also increases the

intracolonial genetic diversity and hence the diversity of genetically derived

recognition cues. In addition, aggression is known to vary temporally, which may be

determined by extrinsic environmental factors (e.g., temporal variation in avaiability

and/or quality of food, temperature, or moisture) and/or intrinsic factors (e.g.,

reproductive cycle, local worker density, and intracolonial patterns of relatedness)

(Katzerke et al. 2006; Thurin & Aron 2008). In homogeneous habitats where

suitable environmentally derived cues are unavailable, genetically derived cues may

be more important (Beye et al. 1997; Beye et al. 1998). By contrast, heterogeneous

habitats may provide a high variance in both diet and nest material; thus, diverse

environmentally derived recognition cues would allow for a stronger environmental

effect on nestmate recognition (Pirk et al. 2001; cf. Katzerke et al. 2006).

The bulldog or jumper ant genus Myrmecia (Formicidae: Myrmeciinae)

comprises 90 described species, and is endemic to the Australian zoogeographic

region (Bolton et al. 2007; Hasegawa & Crozier 2006). Ants of this genus display

many ancestral biological traits, such as the relatively unsophisticated chemical

communication system (Hölldobler & Wilson 1990) and the solitary foraging

behavior using primarily visual and tactile cues (Hölldobler & Wilson 1990; Haskins

& Haskins 1950). Thus, they are considered valuable in investigating the origin and

evolution of more derived social behaviors, life histories and morphologies as found

in other ants (Haskins 1970). The bulldog ant M. brevinoda is among the larger

species of Myrmecia, and is mainly found in New South Wales and Queensland,

Australia (Lester & Keall 2005). It is known to construct imposing nest mounds with

complex internal architecture, and a single nest may include up to a few thousand

workers (Higashi & Peeters 1990). In my recent assay of its colony structure, I

revealed that M. brevinoda is facultatively polygynous, polyandrous and polydomous

42

(see Chapter 4 for details).

In this study, nestmate recognition in M. brevinoda was evaluated using

behavioural assays. I also investigated the impacts of colony social structure (queen

number), intracolonial worker-worker relatedness, genetic and spatial distances on

nestmate discrimination. Although aggression assays have been widely used to

investigate nestmate recognition in social insects, their reliability still remains to be a

focus of concern (Roulston et al. 2003). While previous studies have dealt with the

effects of human handling (Robinson & Visscher 1984; Tanner 2009; Wilson et al.

2006) and bioassays (e.g., duration, arena size, number and physical state of

experimental subjects) (Roulston et al. 2003) on aggression behaviour, no report is

available about the impact of different estimators of aggression levels on the

analytical result. Here, three estimators were compared and evaluated for their utilities

using the present case of M. brevinoda.

Fig. 5.1 Schematic map of Myrmecia brevinoda colonies Triangles denote the sampled nests, and the unfilled ones denote the nests sampled for assays of

nestmate recognition. Triangles within a single ellipse represent nests belonging to the same

polydomous colony as revealed by the previous genetic assay (see Chapter 4 for details)


Ant sampling

In late February 2010, I studied a population of M. brevinoda located in Paluma

(Queensland, Australia; 19.02°S / 146.14°E). The social organization of 20 colonies

43

(23 nests) from this population was later determined unambiguously by analyzing

variation at ten microsatellite loci (Fig. 5.1) (see Chapter 4 for details). Live workers

were collected from nine of these studied colonies (B05, B06, B08, B11, B12, B14,

B17, B18 & B19) (Fig. 5.1), kept in plastic jars with fluon-coated walls, and

transported back to the laboratory immediately. The internest spatial distances ranged

from 4 to 455 m (Fig. 5.1). Following Via (1977), the ants were regularly fed with

honey water until the subsequent assays.

Behavioural assays

Each aggression assay involved two approximately equal-sized workers randomly

selected from two paired nests, respectively. The ants were confined by a fluon-coated

PVC (polyvinyl chloride) ring (diameter: 25 cm), and were separated from each other

by a smaller fluon-coated cylinder (diameter: 6 cm) for 20 s to let them calm down

before the bioassay started. The transfer of ants from plastic jars to the arena was

gently carried out using a thin wood stick. The arena was carefully cleaned with

acetone after each assay to remove potential chemical contamination.

I tested all pairwise combinations of the nine nests, and worker pairs from the

same nest served as controls. Interactions lasted 5 min. All individuals were used only

once, and for each pair of nests, the aggression tests were replicated five times with

different individuals. A total of 225 aggression tests were conducted and recorded

using SONY Digital Video Camera Recorder (Model No. DCR-SR100E, SONY

Corporation, Japan). The observer who scored the interactions did not know the

identity of the interacting colonies.

Table 5.1 Aggression scale used to score interactions among workers of Myrmecia brevinoda

Behavior Description Score

Ignore No contact, or brief contact in which neither ant shows any interest 0

Antennation Repeated physical contact with the antennae tapping somewhere on the other ant

1

Avoidance One or both ants quickly retreating in opposite directions after contact 2

Intimidation Mandible opening and/or dorsal flexion of the gaster 3

Aggression Brief bouts of biting or pulling 4

Fighting Body tangling involving biting, gaster application and prolonged aggression

5

Note: Modified from Steiner et al. (2007).

44

Statistical analyses

The aggression scale used in this study was modified from Steiner et al. (2007) (Table

5.1). Levels 0-2 were referred to as nonaggressive behaviour, and levels 3-5 as

aggressive behaviour. Biting exceeding 10 s was scored anew for each period of 10 s.

I employed three estimators of aggression levels: (1) Aggression index (AI), defined

as the highest interaction score for each pair of workers (Rosset et al. 2007); (2) Mean

aggression index (MAI), calculated by averaging the ten highest scores which were

sequentially recorded for each pair of workers for every period of 30 s; and (3) Mean

aggression score (MAS), calculated by averaging the first ten scores for each pair of

workers (Beye et al. 1998; Sorvari et al. 2008).

The aggression level between each pair of nests was estimated by averaging the

levels (as defined by AI, MAI and MAS) from each of the five replicates. The

associations among the internest aggression, genetic and spatial distance matrices

were investigated using Mantel tests as implemented in the program GenAlEx v6.41

(Peakall & Smouse 2006). Both genetic and spatial distances were obtained from my

previous genetic assay of these colonies (see Chapter 4 for details).

If colony social structure (queen number) variation does significantly affect the

nestmate recognition and aggression, the internest aggression levels would be

expected to differ among various social form combinations (i.e., monogyny vs.

monogyny, monogyny vs. polygyny and polygyny vs. polygyny). I also investigated

the impacts of intracolonial worker-worker relatedness on nestmate recognition and

aggression by classifying the assayed nests into two types, i.e., nests with higher

worker-worker relatedness (‘H’, rww > 0.3) and those with lower relatedness (‘L’, rww

< 0.2), and examining the differences among various nest combinations, i.e., higher vs.

higher (HH), higer vs. lower (HL) and lower vs. lower (LL). Nest B19 was excluded

for such an analysis due to its intermediate worker-worker relatedness (rww = 0.2656).

In this study, both effects were examined using two-tailed independent-samples t-tests

as implemented in the program GraphPad InStat v3.05 (GraphPad Software, USA). In

addition, the utilities of the three different estimators of aggression levels (AI, MAI

and MAS) were further compared and evaluated via two methods, i.e., Mantel test

using GenAlEx v6.41 (Peakall & Smouse 2006) and the paired t-test as implemented

in GraphPad InStat v3.05 (GraphPad Software, USA).

45

Results

In this study, three different estimators (AI, MAI & MAS) were employed to evaluate

the aggression behaviour in M. brevinoda, and the results converged strongly (see

below). The aggression levels as measured by these estimators were significantly

associated with one another, although the association between MAI and MAS (r =

0.993, P < 0.001) was slightly higher than those between AI and the other two

estimators (AI vs. MAI: r = 0.884, P < 0.001; AI vs. MAS: r = 0.896, P < 0.001)

(Table 5.2, Fig. 5.2). The MAI- and MAS-based aggression levels were not

significantly different from each other (two-tailed paired t-test, t35 = 1.172, P = 0.249),

but both were significantly lower than the AI-based level (one-tailed paired t-test; AI

vs. MAI: t35 = 12.270, P < 0.0001; AI vs. MAS: t35 = 12.801, P < 0.0001).

Table 5.2 Mantel’s correlations among internest distance and aggression matrices

AI MAI MAS GD SD

AI ****

MAI r = 0.884 (P < 0.001)

****

MAS r = 0.896 (P < 0.001)

r = 0.993 (P < 0.001)

****

GD r = 0.072 (P = 0.332)

r = -0.036 (P = 0.457)

r = 0.005 (P = 0.452)

****

SD r = -0.102 (P = 0.291)

r = -0.022 (P = 0.539)

r = 0.012 (P = 0.378)

r = -0.040 (P = 0.381)

****

Notes: AI, aggression index; MAI, mean aggression index; MAS, mean aggression score; GD, genetic

distance; SD, spatial distance. Levels of significance (P-values) are based on 9999 permutations. For

details, see ‘Materials and methods’.

While no aggression was observed among nestmates (AI: 0.600~1.000; MAI:

0.511~0.925; MAS: 0.440~0.813), workers of this species acted either aggressively or

non-aggressively towards non-nestmates (AI: 1.800~5.000; MAI: 0.777~4.840; MAS:

0.672~4.860) (Fig. 5.3; Appendices I, II & III), suggesting that they are generally able

to discriminate nestmates from alien conspecifics.

46

Fig. 5.2 Mantel’s correlations among internest distance and aggression matrices Best-fit regression lines are only shown for significant correlations. For more details, see Table 5.2 and

‘Materials and methods’.

47

Fig. 5.3 Observed within- (a) and between-nest (b) aggression levels in Myrmecia brevinoda The number of nest pairs (n) is indicated in parentheses. Three estimators are presented, i.e., aggression

index (AI), mean aggression index (MAI) and mean aggression score (MAS). For details, see ‘Materials and methods’.

48

Internest aggression was not significantly associated with either spatial distance

(AI vs. SD: r = -0.102, P = 0.291; MAI vs. SD: r = -0.022, P = 0.539; MAS vs. SD: r

= 0.012, P = 0.378) or genetic distance (AI vs. GD: r = 0.072, P = 0.332; MAI vs. GD:

r = -0.036, P = 0.457; MAS vs. GD: r = 0.005, P = 0.452) (Table 5.2, Fig. 5.2). A

non-association was also detected between spatial and genetic distances (r = -0.040, P

= 0.381) (Table 5.2, Fig. 5.2).

Table 5.3 Pairwise comparisons of internest aggression levels among various social form combinations using two-tailed independent-samples t-tests

MM vs. MP MM vs. PP MP vs. PP

AI t19 = 1.159, P = 0.261 t16 = 1.355, P = 0.194 t31 = 0.056, P = 0.955

MAI t19 = 0.436, P = 0.668 t16 = 0.129, P = 0.899 t31 = 0.919, P = 0.365

MAS t19 = 0.932, P = 0.363 t16 = 1.110, P = 0.283 t31 = 0.073, P = 0.942

Notes: MM, MP and PP represent three different social form combinations, i.e., monogyny vs. monogyny (MM), monogyny vs. polygyny (MP) and pologyny vs. polygyny (PP). AI, MAI and MAS denote three estimators of aggression levels, i.e., aggression index (AI), mean aggression index (MAI) and mean aggression score (MAS). For details, see ‘Materials and methods’.

Table 5.4 Pairwise comparisons of internest aggression levels among nests with various worker-worker relatedness using two-tailed independent-samples t-tests

HH vs. HL HH vs. LL HL vs. LL

AI t20 = 0.912, P = 0.373 t10 = 1.699, P = 0.120 t20 = 1.217, P = 0.238

MAI t20 = 0.482, P = 0.635 t10 = 0.371, P = 0.718 t20 = 0.057, P = 0.955

MAS t20 = 0.589, P = 0.562 t10 = 0.501, P = 0.628 t20 = 0.019, P = 0.985

Notes: The assayed nests were classified into two types, i.e., nests with higher (H, rww > 0.3) or lower

(L, rww < 0.2) intracolonial worker-worker relatedness. Nest B19 with intermediate relatedness (rww =

0.2656) was excluded from the analysis. HH, HL and LL represent three different nest type

combinations, i.e., between nests with higher worker-worker relatedness (HH), between those with

higher and those with lower relatedness (HL), and between those with lower relatedness (LL).

Internest aggression levels did not differ significantly between any two of the

three social form combinations (Table 5.3) or between any two of the three nest type

combinations (Table 5.4) (two-tailed independent-samples t-tests, with all P > 0.1),

suggesting no significant impacts of colony social structure (queen number) or

intracolonial worker-worker relatedness on nestmate recognition and aggression.

49

Discussion

Aggression assays have proven useful to investigate nestmate recognition in social

insects (Gamboa 1986; Roulston et al. 2003). Different researchers frequently use

different estimators to evaluate aggression behaviour, and thus the impact of different

estimators on the analytical results remains to be a focus of concern. Here, I compared

and evaluated the utilites of three estimators of aggression levels (AI, MAI and MAS)

using the present case of M. brevinoda. The results based on these estimators

converged strongly, suggesting their comparable utilities for investigating nestmate

recognition in ants. However, the AI-based aggression level was significantly higher

than the MAI- and MAS-based ones. Two reasons may explain this discrepancy. On

the one hand, in the majority of the aggression assays, workers tended to decrease

their aggression towards each other with the time. AI reflects only the highest

interaction score, while MAI and MAS are calculated by averaging the scores of a

series of interactions. Thus, AI intrinsically tends to be higher than its two

counterparts. On the other hand, AI should be more susceptible to, and be more likely

inflated by human handling, although such an effect appears minimal in this study

given its highly significant association with the other two estimators.

Workers of M. brevinoda are able to discriminate nestmates from alien

conspecifics. This finding conflicts with the previous report of fatal intra-colony

aggression in this species (Crosland 1989), as no aggression was observed among

nestmates in the present study. The present case of M. brevinoda also contrasts with

the congeneric bulldog ant M. nigriceps whose workers are known to always act

non-aggressively towards non-nestmates (van Wilgenburg et al. 2007).

Based on the current evidence, it seems safe to assume that nestmate recognition

relies on both genetic and environmental components to varying degrees (cf. Pirk et al.

2001). Spatial and/or genetic distances have been frequently reported to affect

nestmate recognition in ants (e.g., Beye et al. 1997; Beye et al. 1998; Pirk et al. 2001;

Stuart & Herbers 2000). By contrast, the aggression between non-nestmates was not

significantly associated with either spatial distance or genetic distance in M.

brevinoda, as found in the ponerine ant Streblognathus aethiopicus (Schlüns et al.

2006). The association between aggression and spatial distance has been widely

employed to evaluate the impact of environmentally derived cues on nestmate

50

recognition (e.g., Beye et al. 1998; Schlüns et al. 2006). Two reasons may explain the

non-association between aggression and spatial distance in M. brevinoda. Likely,

suitable environmentally derived cues are available, but change discontinuously

throughout the study site, rendering impossible a significant association between

aggression and spatial distance (Schlüns et al. 2006). Alternatively, given the small

spatial scale in this study, the habitat may have been too homogeneous to reflect the

possible impact of environmentally derived cues. Under such circumstances,

genetically derived cues may play a more important role (Pirk et al. 2001). However, I

also detected no significant impact of genetic distance on nestmate recognition and

aggression in this species. The scenario appears that both environmental and genetic

factors affect nestmate recognition but other factors may have disguised their impacts.

Colony social structure is generally considered to influence abilities of workers

to discriminate nestmates from non-nestmates (Meunier et al. 2011). The presence of

multiple queens in the same colony (polygyny) results in a broader template of

recognition cues, and thus has been hypothesized to enhance or decrease workers’

nestmate recognition abilities depending on the recognition mechanism used (Beye et

al. 1998; Pirk et al. 2001). However, such an effect failed to be detected in the ant

Formica selysi; instead, workers of this species seem able to detect a signal specific to

the colony social structure (monogyny vs. polygyny) given the higher level of

aggression between than within social forms (Rosset et al. 2007). In this study, the

levels of aggression did not differ significantly between any two of the three social

form combinations (i.e., monogyny vs. monogyny, monogyny vs. polygyny, and

polygyny vs. polygyny). Thus, it appears that the data lend no support to the

hypothesized role of colony social structure (queen number) in nestmate recognition.

However, such a conclusion should be drawn with great caution. Multiple paternity

(polyandry), for example, may have a similar effect on nestmate recognition, since it

also increases the diversity of genetically derived recognition cues. The colonies in

the studied population of M. brevinoda have been characterized by high intracolonial

genetic variability, which has resulted either from the presence of multiple queens

(polygyny) or from multiple paternity (polyandry) (see Chapter 4 for details).

Probably, the variation in colony queen number does affect nestmate recognition, but

such an effect has been disguised by other factors like polyandry in this species.

Although I also detected no significant effect of intracolonial worker-worker

51

relatedness on nestmate recognition, this finding should be interpreted with caution

and should not be considered as strong rejective evidence against the hypothesized

impact of intracolonial genetic diversity, since all the nests had lowly related workers

and high intracolonial genetic diversity. A detailed investigation into the impact of

intracolonial genetic diversity on nestmate recognition would help to illuminate this

issue, but a distinction between evaluators and cue-bearers would be necessary

(Rosset et al. 2007). Despite being interesting, this issue is beyond the scope of the

present study.

In conclusion, I report that workers of M. brevinoda have nestmate recognition

abilities. Nestmate recognition is not significantly affected by colony social structure

(queen number), genetic or spatial distances. Further studies are needed to reveal the

actual mechanism underlying nestmate recognition in this species.

52

CHAPTER 6: Colony Genetic Structure in the Australian Jumper Ant Myrmecia

pilosula

Abstract

Eusocial insects vary significantly in colony queen number and mating frequency,

resulting in a wide range of social structures. Detailed studies of colony genetic

structure are essential to elucidate how various factors affect the relatedness and the

sociogenetic organization of colonies. In this study, I investigated the colony structure

of the Australian jumper ant Myrmecia pilosula using polymorphic microsatellite

markers. Nestmate queens within polygynous colonies, and queens and their mates,

were generally unrelated. The number of queens per colony ranged from 1 to 4.

Queens were estimated to mate with 1-9 inferred and 1.00-11.41 effective mates. This

is the first time that the rare co-occurrence of polygyny and high polyandry has been

found in the M. pilosula species group. Significant maternity and paternity skews

were detected at the population level. I also found an isolation-by-distance pattern,

and together with the occurrence of polygynous polydomy this suggests the

occurrence of dependent colony foundation in M. pilosula; however, independent

colony foundation may co-occur since queens of this species have fully developed

wings and can fly. The predicted negative association between polygyny and

polyandry in ants was not supported by the present case of M. pilosula.

53

Introduction

Knowledge of sociogenetic organization is fundamental to understand the evolution of

insect eusociality (Seppä & Walin 1996), in which close relatedness has long been

considered as a critical factor (Abbot et al. 2011; Hamilton 1964; Hughes et al.

2008a). In eusocial Hymenoptera, colony structure is defined demographically and

genealogically by the numbers and identities of reproductive females and males, and

spatially by the nest number, size and architecture (Steiner et al. 2009). The former

class of factors, i.e., colony queen number, queen mating frequency, relatedness


(reproductive skew), together determine the degree of intracolonial relatedness. Thus,

detailed studies of colony genetic structure help to elucidate how these factors affect

the relatedness and the sociogenetic organization of colonies.

As the most important determinants of colony structure in eusocial insects, the

relationship between colony queen number and queen-mating frequency has long

been the focus of much attention in evolutionary biology. On the one hand, polygyny

(multiple queens per colony) undermines a queen’s individual fitness by sharing her

colony’s reproductive output with other queens, while polyandry (multiple paternity)

involves increased energetic loss, higher risk of predation and/or sexually transmitted

diseases (reviewed by Hughes et al. 2008b). On the other hand, both polygyny and

polyandry can result in increased intracolonial genetic diversity which has been

hypothesized to increase the resistance of colonies to pathogens or diseases, to

enhance the expression of genetically-based caste systems, to reduce the

among-colony variance of diploid male production, and to alleviate genetic drift and

inbreeding within local populations (reviewed by Crozier & Fjerdingstad 2001).

Keller & Reeve (1994) hypothesized that polyandry and polygyny should be

negatively associated since both have benefits and costs. Despite being supported by

two recent comparative analyses across species (Hughes et al. 2008b; Kronauer &

Boomsma 2007), this hypothesis has so far rarely gained any empirical evidence at

the intraspecific level (Bekkevold et al. 1999; Chapuisat 1998; Hammond et al. 2001;

Kellner et al. 2007; Pedersen & Boomsma 1999b; Schlüns et al. 2009; Trontti et al.

2005). One reason for this may be that the variation in queen-mating frequency is

frequently limited in association with that of colony queen number (Hughes et al.

2008b).

54

The bulldog or jumper ant genus Myrmecia Fabricius (Hymenoptera: Formicidae:

Myrmeciinae) comprises nine recognized species groups and 90 described species,

and is restricted to the Australian zoogeographic region (Bolton et al. 2007; Hasegawa

& Crozier 2006). Despite being recently rejected as among the most basal formicids

(Brady et al. 2006; Moreau et al. 2006; Moreau 2009; Ward & Brady 2003),

Myrmecia ants show many archaic biological traits, such as a limited queen-worker

divergence (Dietemann et al. 2004) and solitary foraging behavior using primarily

visual and tactile cues (Hölldobler & Wilson 1990). In addition, this genus has long

been considered as representing the most generalized form of independent colony

foundation (ICF) (reviewed by Dumpert 1981), which is also widely believed to be

ancestral in ants (Peeters & Molet 2009). Studies of such ‘primitive’ ants may yield

valuable insights into the origin and evolution of more derived social behaviors, life

histories and morphologies as found in other ants (Haskins 1970).

The black jumper ant Myrmecia pilosula belongs to the M. pilosula species group

(Hasegawa & Crozier 2006), and is well-known for its jumping behavior and painful

(and occasionally lethal) sting (Crosland et al. 1988a). Originally described as a single

biological species (Smith 1858), it is now known to include multiple morphologically

similar sibling species differing in karyotypes and mtDNA haplotypes (reviewed by

Lorite & Palomeque 2010; Seifert 2009), here referred to as Myrmecia pilosula

species complex. To date, most studies of the M. pilosula species complex have

focused on its karyology (e.g., Crosland et al. 1988a; Imai et al. 1994), phylogeny

(Crozier et al. 1995) and venom immunology (reviewed by Schlüns & Crozier 2009);

little is known about its colony structure (Craig & Crozier 1979). Using one

polymorphic allozyme locus, Craig & Crozier (1979) investigated the colony genetic

structure in an unknown species of the M. pilosula complex, and indicated the

occurrence of multiple related functional queens in single colonies. However, largely

due to the low resolution of the single allozyme locus, no further details were made

available about the other aspects of that species’ colony structure, e.g., the nest

number (monodomy vs. polydomy), queen-mating frequency (monoandry vs.

polyandry) and the queen-male / male-male relatedness.

In this paper, I present the first empirical effort to investigate the fine-scale

sociogenetic organization of the M. pilosula species complex. A set of highly

polymorphic microsatellite loci was employed to determine colony kin structure,

55

mating frequency and mode of colony foundation in M. pilosula (the nominotypical

member of the species complex). Keller & Reeve’s (1994) hypothesis of a negative

association between polygyny and polyandry was also tested by examining the

present case.

Fig. 6.1 Schematic map of Myrmecia pilosula colonies Filled circles denote the sampled nests. Those within a single ellipse represent nests belonging to the

same polydomous colony. Colony codes are as shown in Table 6.1.


Field sampling, DNA extraction and microsatellite genotyping

Sixteen nests were sampled from a population of M. pilosula in Mongarlowe (NSW,

Australia; 35.46°S / 149.94°E) on 9th February 2008 (Table 6.1, Fig. 6.1). Species

identity was determined by Dr. Robert W. Taylor. Workers were collected into 100%

ethanol. Extraction of genomic DNA was carried out with PUREGENE DNA

Isolation Kit (Gentra Systems, USA) following the manufacturer’s protocol.

A total of 319 workers, which comprised 17-36 workers from each nest (Table

6.1), were genotyped at nine recently developed microsatellite loci (Mbre9, Mbre11,

Mbre17, Mbre40, Mbre41, Mbre67, Mpyr22, Mpyr38 & Nmac18) (see Chapter 3 for

56

Table 6.1 Characteristics of the colonies used to study colony genetic structure in Myrmecia pilosula

Colony code Ncol Qest Mest Me,p rqq rqm RS-Q RS-M

P01 14 1 2.00 1.96 - 0.444 - 0.005

P02 24 3 [2a2b3c] 2.33 2.16 -0.009 -0.051 -0.004 -0.002

P03 19 3 [1a1b2c] 1.33 1.40 -0.126 -0.196 0.017 0.029

P04 21 2 [4a9b] 6.50 8.71 0.155 0.045 0.168* -0.023

P05(2) 36(21+15) 3 [3a3b5c] 3.67 3.04 0.372 -0.140 0.023 0.026*

P06 15 2 [1a1b] 1.00 1.00 0.515 0.069 -0.013 -0.013

P07(2) 58(36+22) 4 [1a1b4c5d] 2.75 1.60 0.109 -0.100 0.217** 0.095**

P08 18 2 [1a3b] 2.00 1.62 -0.316 0.349 0.127* 0.048

P09 18 1 2.00 1.88 - 0.006 - 0.028

P10 17 2 [1a2b] 1.50 1.16 0.291 -0.094 -0.028 0.081*

P11 16 2 [2a2b] 2.00 1.90 -0.064 0.031 0 0.039

P12 22 2 [2a3b] 2.50 2.17 0.453 -0.173 -0.019 0.016

P13 19 2 [1a2b] 1.50 1.16 -0.412 0.095 0.141* 0.155**

P14 22 1 4.00 3.22 - 0.098 - 0.055*

Population-level 22.79 ± 11.48 2.14 ± 0.86 2.51 ± 1.42 2.36 ± 1.94 0.088 ± 0.041 -0.022 ± 0.018 0.057** 0.038**

The number and sample sizes of member nests are indicated in parentheses for polydomous colonies. Colony sizes (Ncol, the number of genotyped colony members) and the estimated numbers of functional queens per colony (Qest) and of mates per queen (Mest) were based on the analytical results of the program COLONY v2.0 (Jones & Wang 2010). For polygynous colonies, the Mest value for each nestmate queen is presented in parentheses. The pedigree-effective number of mates per queen (Me,p) were estimated using the method of Nielsen et al. (2003). Relatedness coefficients between nestmate queens (rqq) and between queens and their mate(s) (rqm) were calculated using the algorithm of Queller & Goodnight (1989) as implemented in the program RELATEDNESS v5.0.8; standard errors (SE) were obtained by jackknifing over loci. Maternity (RS-Q) and paternity (RS-M) skews were estimated using B index of Nonacs (2000) as implemented in the program SKEW CALCULATOR 2003. The observed skew values were tested for significant differences from zero, the expected value under random reproduction (*P < 0.05; **P < 0.01). Arithmetic means ± standard deviation (SD) were calculated for the first four parameters at the population level. The hyphen (‘-’) denotes ‘not applicable’.

57

details). I added a 17-base tag (5’-GGTGGCGACTCCTGGAG-3’) to the 5’-end of

the forward primer of each locus to enable the labelling strategy of Shimizu et al.

(2002). PCR products were cleaned through Sephadex G-50 (GE Healthcare, UK)

before genotyping on MegaBACE 1000 sequencer (Amersham Biosciences, USA).

Marker evaluation and population genetic estimates

The program PowerMarker v3.2.5 (Liu & Muse 2005) was employed to evaluate the

microsatellite loci for departure from Hardy-Weinberg equilibrium (HWE), for

linkage disequilibrium (LD), allelic richness and expected heterozygosity (HE). For

the tests of HWE and LD, I employed a subset of the original dataset comprising

workers randomly sampled from each colony, since members in an ant colony may

not be independent of one another. To correct for multiple comparisons, the sequential

Bonferroni correction was applied at the significance level of 0.05 (Holm 1979).

I calculated Weir & Cockerham’s (1984) estimator of population-specific

inbreeding coefficient FIT from genotypes of workers using the program FSTAT

v2.9.3 (Goudet 1995). Colonies were entered as populations, and standard errors (SE)

were obtained by jackknifing over loci. The inbreeding coefficient was evaluated for

its departures from zero using t-tests.

Workers were grouped into matrilines (offspring from the same mother) and

patrilines (offspring from the same father) using the program COLONY v2.0 (Jones &

Wang 2010), with both allelic dropout rates and error rates set to 0.05; the genotypes

of both functional queens and their mates were also inferred at the same time. As

suggested by the user’s manual, I performed three replicate runs with different

random number seeds, and their convergence was checked to confirm the reliability of

the results. In the case of any disagreement among replicate runs, the assignments that

were supported by any two runs were used for the subsequent assays. The genotypes

of queens and their mates with the highest likelihood were used to calculate

relatedness coefficient and reproductive skew. The above analysis also enabled the

58

detection of any possible occurrence of polydomy. In this study, I applied the

following criterion in identifying colony boundaries: only nests that apparently

mutually exchanged workers were considered as belonging to a single polydomous

colony, while any unidirectional occurrence of alien worker(s) in a certain nest was

considered as occasional worker drifting.

To estimate the degree of isolation by distance (IBD) (Wright 1943), Mantel tests

were conducted to examine the association between the FST genetic and geographic

distances for pairs of nests. Two FST genetic distance matrices were calculated from

the genotypes of workers and inferred functional queens, respectively, and employed

to examine such an association. All these calculations were done using the program

GenAlEx v6.41 (Peakall & Smouse 2006).

Estimation of relatedness

Regression relatedness (r) was estimated following the algorithm of Queller &

Goodnight (1989) as implemented in the program RELATEDNESS v5.0.8 (Keith F.

Goodnight; http://www.gsoftnet.us/GSoft.html); individuals were weighted equally

and standard errors (SE) were obtained by jackknifing over loci. Relatedness

estimates were calculated between various parties (i.e., workers, functional queens

and males) at different levels (i.e., matriline, colony and population), and evaluated

for their departures from hypothetical values using t-tests.

Queen numbers, queen-mating frequencies and reproductive skew

The estimated numbers of functional queens (Qest) and mates (Mest) were obtained as

inferred by the program COLONY v2.0. I also calculated the pedigree-effective

number of mates per queen corrected for sample size (Me,p) using the formula of

Nielsen et al. (2003). The effective number of mates (Me,p) can be larger than the

corresponding estimated number of mates (Mest), if the sample size for a given

matriline is relatively low with respect to a high queen-mating frequency.

The nondetection error, i.e., two males may have identical genotypes, causes the

59

underestimation of mating frequencies. In the present study, the nondetection error

(Pnondetection) was quantified at the population level, following the method of Boomsma

& Ratnieks (1996).

Paternity (RS-M) and maternity (RS-Q) skews were calculated using the B index

(Nonacs 2000) in the program SKEW CALCULATOR 2003 (Peter Nonacs;

http://www.eeb.ucla.edu/Faculty/Nonacs/shareware.htm). This program returns both

the individual value for each colony and the mean value across all colonies, and also

estimates the possibility level that the observed B values differ from zero, i.e., that

reproduction is not randomly distributed among nestmate queens or among multiple

mates of a single queen.

In addition, Keller & Reeve’s (1994) hypothesis was tested by examining the

association between the estimated number of queens per colony and the number of

mates per queen. In this study, both the estimated and the pedigree-effective numbers

of mates per queen were evaluated for such an association using Spearman rank

correlation as implemented in the program STATISTICA v6.0 (StatSoft Inc., USA).

Results

Basic population genetics and identification of colony boundaries

The nine polymorphic microsatellites yielded a total of 97 alleles, ranging from 4 to

21 with an average of 10.8 alleles per locus. Heterozygosity ranged from 0.5126 to

0.8980, with an average of 0.7246. No significant departure from HWE or LD was

detected after the sequential Bonferroni correction. The population inbreeding

coefficient FIT (mean ± SE) was -0.009 ± 0.023, which was not significantly different

from zero (t8 = 0.777, P = 0.459, 95%CI: -0.066~0.033).

The COLONY program grouped the 16 nests (319 workers) into 14 colonies, with

two of them being polydomous (Table 6.1, Fig. 6.1). The results from different

replicate runs converged strongly, indicating the sufficiency of marker information for

robust inferences of genetic structure. A tiny portion of individuals (5/319, 1.57%)

60

Fig. 6.2 Correlation between geographic and FST genetic distances for pairs of Myrmecia pilosula nests

(r = 0.324, P = 0.046; 9999 permutations). The FST genetic distances were calculated from the

genotypes of workers.

Fig. 6.3 Correlation between geographic and FST genetic distances for pairs of Myrmecia pilosula nests

(r = 0.403, P = 0.040, 9999 permutations). The FST genetic distances were calculated from the

genotypes of inferred queens.

61

were assigned to different matrilines by different runs, and the assignments supported

by any two runs were used for the subsequent assay of genetic structure. In addition, a

small portion of workers (14/319, 4.39%) failed to be assigned to the colonies from

which they were sampled. Following the criterion employed in this study (see

‘Materials and methods’), such cases were treated as intercolonial worker drifting.

The pairwise geographic distances were significantly associated with both the FST

genetic distances calculated from the genotypes of workers (r = 0.324, P = 0.046,

9999 permutations, Fig. 6.2) and those from the genotypes of functional queens (r =

0.403, P = 0.040, 9999 permutations, Fig. 6.3), indicating a significant IBD pattern.

Queen-mating frequency and paternity skew

Queens were inferred to mate with 1-9 males (Mest), and the pedigree-effective

number of mates per queen (Me,p) ranged from 1.00 to 11.41. The arithmetic means ±

standard deviation (SD) of the two estimates were Mest = 2.51 ± 1.42 and Me,p = 2.36 ±

1.94, respectively (Table 6.1, Fig. 6.4). For six out of the 30 inferred queens (20%),

the Mest value was smaller than the corresponding Me,p value. However, the

discrepancy between Mest and Me,p was minimal in most of these cases, implying that

the sample sizes were generally sufficient for the inference of genetic structure in this

population. Significant paternity skew was detected in 5 out of the 14 colonies (three

colonies at P < 0.05, and two at P < 0.01) (Table 6.1). At the population level, male

reproduction was significantly skewed (P < 0.01). The nondetection error (Pnondetection

= 2.27×10-6) due to two males bearing identical genotypes was negligible.

Intracolonial relatedness

Estimates of regression relatedness (arithmetic mean ± SE) among reproductive

individuals are presented in Table 6.1. Nestmate queens in polygynous colonies, and

queens and their mates, were found to be on average unrelated (rqq = 0.088 ± 0.041;

t10 = 0.956, P = 0.362, and rqm = -0.022 ± 0.018; t29 = 0.191, P = 0.850, respectively).

Multiple males that mated either to the same queen or to different queens from the

same polygynous colony were generally unrelated (rmm = 0.006 ± 0.011, t20 = 0.199, P

62

Fig. 6.4 Estimated (a) and pedigree-effective (b) number of matings per queen in Myrmecia pilosula

63

= 0.845, and rmm = 0.012 ± 0.014, t10 = 0.250, P = 0.808, respectively).

The worker-worker relatedness at the colony level was significantly higher in

monogynous colonies (rww = 0.486 ± 0.045) than in polygynous colonies (rww = 0.280

± 0.017) (one-tailed independent-samples t-test, t12 = 4.037, P = 0.0008). Nestmate

workers were related by rww = 0.310 ± 0.012 and rww = 0.521 ± 0.012 over all

colonies and at the matriline level, respectively.

Number of queens and maternity skew

In all, 30 functional queens were inferred from the microsatellite analysis. The

estimated colony queen numbers varied between 1 and 4, and 11 out of the 14

colonies (78.57%) were polygynous. For the overall population, the mean colony

queen number ± SD was 2.1 ± 0.9 (Table 6.1). Significant maternity skew was

detected in 4 out of the 11 polygynous colonies (three colonies at P < 0.05 and one at

P < 0.01) (Table 6.1). At the population level, reproduction was significantly skewed

among nestmate queens (P < 0.01).


The colony queen number was not significantly associated with either the estimated or

the pedigree-effective number of mates per queen (Spearman rank correlation R =

0.046, n = 14, P = 0.877, and R = -0.154, n = 14, P = 0.599, respectively).

Discussion

Queen mating frequency and dispersal

Variation in queen mating frequency in eusocial Hymenoptera has been the subject of

long-standing interest to evolutionary biologists because of its effect on the colony kin

structure and the evolution of social behavior (Boomsma & Ratnieks 1996). In the

family Formicidae, high polyandry appears to be mostly restricted to a few species

with strictly monogynous colonies (e.g., Kronauer et al. 2004; Kronauer et al. 2007;

64

Pol et al. 2008; Rheindt et al. 2004; Sumner et al. 2004), while in a very few cases

polygyny and high polyandry co-occur (e.g., Kellner et al. 2007; Trontti et al. 2007).

In this study, the majority of queens were found to mate with 1-2 males. However,

high polyandry was also revealed in some cases (i.e., 36.67% of queens having > 2

inferred mates and 46.67% having > 2 effective mates) (Fig. 6.4). It is the first time

that the rare co-occurrence of polygyny and high polyandry has been found in the M.

pilosula species group. The overall level of polyandry is lower than that in the

congeneric giant bulldog ant M. brevinoda (see Chapter 4 for details), comparable to

that in the congeneric brown bulldog ant M. pyriformis (Sanetra 2011), but higher

than that in the monogynous consubfamilial dinosaur ant Nothomyrmecia macrops

(Sanetra & Crozier 2001).

In ants, there are two main strategies of colony foundation, i.e., independent

colony foundation (ICF) by solitary queens and dependent colony foundation (DCF)

when the queen starts a colony with the help of workers from her natal colony

(reviewed by Fernández-Escudero et al. 2001; Johnson 2010; Peeters & Molet 2009).

Despite a few exceptions (e.g., Pearcy et al. 2006), ICF and DCF are typically

associated with monogyny and polygyny, respectively, while both strategies may

co-occur in facultatively polygynous species (reviewed by Heinze 2008; Keller 1991;

Peeters & Molet 2009). Traditionally, the genus Myrmecia is considered as

representing the most generalized form of ICF, and ICF has been reported in all seven

Myrmecia species whose strategies of colony foundation were investigated (reviewed

by Dumpert 1981). But some Myrmecia species are known to have wingless (ergatoid)

queens (Ogata & Taylor 1991), and despite a few exceptions (Haskins & Haskins

1955; Johnson 2010; Taylor 1978; Villet 1991; Villet 1999), such queens are generally

assumed to display obligatory DCF (Peeters & Ito 2001; Peeters & Molet 2009). Thus,

DCF probably also occurs in this genus.

Isolation by distance (IBD) has been reported in many ants (e.g., Fournier et al.

2002; Giraud et al. 2000; Liautard & Keller 2001; Pedersen & Boomsma 1999b;

Zinck et al. 2007), and has been generally attributed to restricted queen dispersal

65

and/or DCF. In this study, I revealed a significant IBD pattern in M. pilosula, i.e.,

spatially close nests tend to be more genetically similar than distant ones. Queens of

M. pilosula have fully developed wings and can fly (Crosland M.W.J., personal

communication), and thus ICF associated with nuptial flight probably occurs in this

species. However, I consider ICF associated with nuptial flight unlikely to contribute

to the present pattern given the high nest density in the study population (Fig. 6.1).

One theoretically possible explanation would be ICF associated with restricted

dispersal, i.e., the queens of M. pilosula could mate close to their natal nests, disperse

on foot to a nearby nest site, and then found a new colony solitarily. This strategy is

somewhat similar to DCF, but appears less adaptive than the latter since the foundress

would lack the help of workers. Another possible explanation would be the restricted

dispersal of queens between neighbouring nests as suggested in the wood ant Formica

exsecta (Liautard & Keller 2001), but mitochondrial genetic analysis would be

required to confirm this hypothesis. Here, I suggest that the IBD pattern in M. pilosula

may be significantly attributed to DCF, which is also evidenced by the occurrence of

polygynous polydomy in this species. In ants, polygynous polydomy has long been

considered to result from colony budding with incomplete separation (Pedersen &

Boomsma 1999a; Steiner et al. 2009). A daughter nest may stay socially connected to

the mother nest for a certain period after budding, before it becomes a socially

independent colony when the exchange of workers and food ceases. In this study, two

out of the 14 colonies were found to be both polydomous and polygynous (Fig. 6.1,

Table 6.1), and the genotypes were unevenly distributed among member nests, in line

with the dynamic process of budding via polygynous polydomy. Since the inference

of DCF in this study is largely based on genetic data, further studies (including field

surveys) will be necessary for an in-depth evaluation of the various possibilities. It

should be noted that all those seven species with ICF as their strategy of colony

foundation belong to the M. gulosa species group, and thus are relatively distantly

related to M. pilosula (belonging to the M. pilosula species group) (Hasegawa &

Crozier 2006).

66

The IBD pattern is, in any case, quite weak in M. pilosula. In addition to the

possible ICF with nuptial flight, this weak pattern may be closely associated with the

fact that nestmate queens in polygynous colonies are generally unrelated in this

species. It is likely that newly inseminated gynes may seek adoption into alien

colonies when a suitable nest site for ICF is unavailable (‘nest-site limitation

hypothesis’) (Foitzik & Heinze 1998; Foitzik et al. 2003; Herbers 1986); alternatively,

they could try to return to their natal nests after the nuptial flight, but end up in a

different nest. In either case, the strength of the IBD pattern depends on the dispersal

distance of the queens. If the dispersal of queens is restricted to movements among

neighbouring nests, the IBD pattern will be more pronounced; in contrast, the pattern

will be weaker if the queens move farther (e.g., via aerial dispersal), and this may at

least partially explain the present significant but weak IBD pattern in M. pilosula.


The relationship between polygyny and polyandry has long been the focus of attention

of evolutionary biologists. Keller & Reeve (1994) for the first time hypothesized that

they should be negatively associated since both can result in increased intracolonial

genetic diversity and have costs. This hypothesis has been controversial largely

because it has rarely gained any empirical support at the intraspecific level

(Bekkevold et al. 1999; Chapuisat 1998; Hammond et al. 2001; Kellner et al. 2007;

Pedersen & Boomsma 1999b; Schlüns et al. 2009; Trontti et al. 2005), findings

consistent with this study of M. pilosula. However, I did find such a significantly

negative association in my recent investigation into the colony genetic structure of the

congeneric bulldog ant M. brevinoda (see Chapter 4 for details). By reviewing all

available empirical tests of this hypothesis, I proposed that the high mating costs and

the strong effect of multiple matings on intracolonial genetic diversity may be

essential to such a negative association at the intraspecific level. The study of M.

pilosula reported here supports this view. Restricted dispersal of gynes (frequently

associated with DCF; (Peeters & Molet 2009) and the consequent low costs of

multiple matings (in terms of predation risk) may promote both polygyny and

67

polyandry simultaneously (Pedersen & Boomsma 1999b). Thus, the non-association

between polygyny and polyandry in M. pilosula can be at least partially explained by

local matings (and hence low mating costs) as suggested by the inferred DCF in this

species.

In conclusion, I report facultative polygyny and polyandry in the Australian

jumper ant M. pilosula. I also infer that ICF and DCF co-occur in this species, but

further data will be needed to confirm this hypothesis. The lack of a negative

association between polygyny and polyandry is consistent with a broader view that

places the association between polygyny and polyandry within the context of the

modes of colony foundation used by individual species. Further studies of the

distribution of these traits in other species of Myrmecia would be informative.

68

CHAPTER 7: General Discussion

In this research, a novel set of microsatellites was developed (Chapter 3), and

employed to investigate colony kin structure, queen-mating frequency and mode of

colony foundation in the bulldog ant M. brevinoda (Chapter 4) and the jumper ant M.

pilosula (Chapter 6). I also evaluated nestmate recognition in M. brevinoda, and

investigated whether colony social structure, intracolonial worker-worker relatedness,

genetic and spatial distances significantly affect recognition and aggression in this

species (Chapter 5). Here, a general discussion of the major findings is presented.

Summary of key findings


While polygyny and polyandry are not rare in ants, the co-occurrence of polygyny and

high levels of polyandry has thus far been only known from a very few species, e.g.,

Myrmecia pyriformis (Sanetra 2011), Pachycondyla inversa and P. villosa (Kellner et

al. 2007). In this research, such a co-occurrence pattern was revealed in both M.

brevinoda (Chapter 4) and M. pilosula (Chapter 6), which thus provide a good

opportunity for testing the polygyny-vs.-polyandry hypothesis at the intraspecific

level.

The present case of M. brevinoda provides the rare intraspecific evidence for the

polygyny-vs.-polyandry hypothesis (Chapter 4). Although the case of M. pilosula

lends no support (Chapter 6), together with both the support from M. brevinoda and

the rejective evidence from other intraspecific studies, it contributes to the notion that

the assumed negative association between polygyny and polyandry may be

conditional. The high costs of multiple matings and the strong effect of multiple

matings on intracolonial genetic diversity may be essential to such an association, and

any attempt to empirically test this hypothesis should place emphasis on these two

underlying aspects.

69

Queen dispersal and colony foundation

The genus Myrmecia has long been considered as representing the most generalized

form of independent colony foundation (ICF) (reviewed by Dumpert 1981). In this

research, spatial and genetic distances were not significantly associated in M.

brevinoda whose queens have fully developed wings and can fly, suggesting the

prevalence of ICF in this species (Chapter 4).

But some Myrmecia species are known to have wingless (ergatoid) queens

(Ogata & Taylor 1991), and such queens are generally assumed to display obligatory

DCF (Peeters & Ito 2001; Peeters & Molet 2009). Thus, DCF probably also occurs in

this genus. In this research, a significant association was detected between spatial and

genetic distances in M. pilosula. Together with the occurrence of polygynous

polydomy which has long been considered to result from colony budding with

incomplete separation (Pedersen & Boomsma 1999a; Steiner et al. 2009), it suggests

that DCF may occur in this species (Chapter 6).

ICF and DCF may co-occur in facultatively polygynous species (reviewed by

Heinze 2008; Keller 1991; Peeters & Molet 2009). In this research, both M. brevinoda

and M. pilosula were found to be facultatively polygynous. Moreover, polygynous

polydomy was also found in M. brevinoda (Chapter 4), while queens of M. pilosula

have fully developed wings and can fly (Chapter 6). Thus, it appears likely that both

ICF and DCF occur in these two species to varying extents. But further studies are

needed to confirm this possibility.

Nestmate recognition

In eusocial insects, the ability to discriminate colony members from aliens is crucial

for maintaining colony integrity. Nestmate recognition cues can be acquired from

environmental sources (Liang & Silverman 2000; Liang et al. 2001; Obin & Vander

Meer 1988) or have a significant genetic component (Vander Meer & Morel 1998),

while the relative importance of genetic and environmental factors appears to be

closely linked to the life histories of different species and their ecological contexts

70

(reviewed by d'Ettorre & Lenoir 2009). The socially polymorphic bulldog ant M.

brevinoda provides a good model for investigating the impacts of various life history

traits and ecological factors on nestmate recognition.

In this research, I evaluated nestmate recognition in M. brevinoda using

behavioural assays (Chapter 5). Workers of this species are able to discriminate

nestmates from alien conspecifics. However, I detected no significant impacts of

colony social structure (queen number), spatial and genetcic distances on recognition

and aggression. While the nonsignificant impact of spatial distance can be attributed

to the environmental homogeneity or the discontinuous distribution of

environmentally derived cues, the impact of colony social structure (queen number)

may have been disguised by other factors such as polyandry in this species. Further

studies are needed to resolve the actual mechanism underlying nestmate recognition

in this species.

Future directions

In this thesis, I present fine-scale sociogenetic organizations in two species of the

genus Myrmecia. I also present a test of the polygyny-vs.-polyandry hypothesis using

both cases, and suggest the conditionality of this hypothesis. In addition to the present

cases of M. brevinoda and M. pilosula, the co-occurrence of polygyny and (high)

polyandry is also known from M. pyriformis, the third Myrmecia species whose

colony genetic structure has been unambiguously determined (Sanetra 2011). Thus,

such a co-occurrence pattern may not be rare in this genus, and examining other

congeners may provide further tests of this hypothesis. It should be noted that the

conclusions have been largely based on the genetic data. Further studies including

field surveys may enhance the arguments regarding the issues such as the mode of

colony foundation.

I also report that workers of M. brevinoda have nestmate recognition abilities,

and that nestmate recognition in this species is not significantly affected by colony

social structure (queen number), genetic or spatial distances. To reveal the actual

71

mechanism underlying nestmate recognition, future efforts can be directed at

characterizing the relationships among cuticular hydrocarbon profiles, genetic

distance, spatial distance, aggression behaviour and intracolonial genetic diversity,

and investigating their temporal changes. In addition, given the potential limitations

of laboratory aggression assays (d'Ettorre & Lenoir 2009), field surveys may enhance

the conclusions.

Nowadays, our knowledge of the genus Myrmecia is still rather limited, and

many issues remain to be resolved. For example, the M. pilosula species complex is

known to include multiple karyologically distinct sibling species (2n = 2-32)

(Crosland et al. 1988a; Imai et al. 1990; Imai et al. 1994), and has been consider as of

particular significance in studies of chromosomal evolution (Crosland & Crozier

1986). However, its taxonomy has proven difficult due to the closely similar

morphology of its members, and no taxonomic note is publicly available for direct

species identification, except the two described members M. pilosula and M.

croslandi (Taylor 1991). Recent advances in molecular biology techniques may

provide insights into this issue. Using both mitochondrial cytochrome c oxidase

subunit I (COI) and nuclear microsatellite markers, I do have recently revealed the

co-occurrence of a genetically distinct but closely related sibling species in the

population of M. pilosula studied in this project (data not shown), indicating the

potential utility of such techniques in dentification and discovery of cryptic diversity

in this species complex. I suggest that extensive sampling, karyotypic determination,

molecular biology techniques and fine-scale morphological examination together may

provide powerful tools for revolving such taxonomic issues in this genus.

Other fundamental questions, e.g., niche evolution, speciation and the

accumulation of ecological diversity, have attracted considerable attention (Warren et

al. 2008), and can also be investigated in the genus Myrmecia. During the past decade,

ecological niche modelling (also known as species distribution modelling), together

with phylogenetic data, has proved to be a powerful tool for investigating such issues

(e.g., Lawson 2010; Makowsky et al. 2010; McCormack et al. 2010; Pearman et al.

72

2010). Testing relevant hypotheses in this genus (and/or the nine species groups) may

provide further insights into its evolutionary and speciation patterns.

73

REFERENCES

Abbot P, Abe J, Alcock J, et al. (2011) Inclusive fitness theory and eusociality. Nature,

471, E1-E4.

Allen CR, Forys EA, Rice KG, Wojcik DP (2001) Effects of fire ants (Hymenoptera:

Formicidae) on hatching turtles and prevalence of fire ants on sea turtle

nesting beaches in Florida. Florida Entomologist, 84, 250-253.

Amor F, Ortega P, Jowers M, Cerdá X, Billen J, Lenoir A, Boulay R (2011) The

evolution of worker–queen polymorphism in Cataglyphis ants: interplay

between individual- and colony-level selections. Behavioral Ecology and

Sociobiology, 65, 1473-1482.

Baer B (2011) The copulation biology of ants (Hymenoptera: Formicidae).

Myrmecological News, 14, 55-68.

Bay LK, Crozier YC, Crozier RH (2007) Isolation and characterization of eight

microsatellite loci in the mangrove mud-nesting ant, Polyrhachis sokolova.

Molecular Ecology Notes, 7, 1239-1241.

Bekkevold D, Frydenberg J, Boomsma JJ (1999) Multiple mating and facultative

polygyny in the Panamanian leafcutter ant Acromyrmex echinatior. Behavioral

Ecology and Sociobiology, 46, 103-109.

Benjamini Y, Liu W (1999) A distribution-free multiple test procedure that controls

the false discovery rate. Department of Statistics and O.R., Tel Aviv University,

Tel Aviv.

Beye M, Neumann P, Chapuisat M, Pamilo P, Moritz RFA (1998) Nestmate

recognition and the genetic relatedness of nests in the ant Formica pratensis.

Behavioral Ecology and Sociobiology, 43, 67-72.

74

Beye M, Neumann P, Moritz RFA (1997) Nestmate recognition and the genetic gestalt

in the mound-building ant Formica polyctena. Insectes Sociaux, 44, 49-58.

Bloor PA, Barker FS, Watts PC, Noyes HA, Kemp SJ (2001) Microsatellite libraries

by enrichment. School of Biological Sciences, University of Liverpool,

Liverpool (UK). Available online: http://www.genomics.liv.ac.uk/animal/

Protocol1.html

Bolton B (2003) Synopsis and classification of Formicidae. Memoirs of the American

Entomological Institute, 71, 1-370.

Bolton B, Alpert G, Ward PS, Naskrecki P (2007) Bolton's Catalogue of Ants of the

World 1758-2005. Harvard University Press, Cambridge (MA, USA).

Boomsma JJ, Ratnieks FLW (1996) Paternity in eusocial Hymenoptera. Philosophical

Transactions of the Royal Society of London B: Biological Sciences, 351,

947-975.

Bos N, Grinsted L, Holman L (2011) Wax on, wax off: nest soil facilitates indirect

transfer of recognition cues between ant nestmates. PLoS ONE, 6, e19435.

Bourke AFG, Franks NR (1995) Social Evolution in Ants. Princeton University Press,

Princeton (NJ, USA).

Brady SG, Schultz TR, Fisher BL, Ward PS (2006) Evaluating alternative hypotheses

for the early evolution and diversification of ants. Proceedings of the National

Academy of Sciences of the United States of America, 103, 18172-18177.

Buschinger A (2009) Social parasitism among ants: a review (Hymenoptera:

Formicidae). Myrmecological News, 12, 219-235.

Callcott AMA, Collins HL (1996) Invasion and range expansion of imported fire ants

(Hymenoptera: Formicidae) in North America from 1918-1995. Florida

Entomologist, 79, 240-251.

75

Chapuisat M (1998) Mating frequency of ant queens with alternative dispersal

strategies, as revealed by microsatellite analysis of sperm. Molecular Ecology,

7, 1097-1105.

Clark J (1934) Notes on Australian ants, with descriptions of new species and a new

genus. Memoirs of the National Museum Victoria, 8, 5-20.

Cole BJ (1983) Multiple mating and the evolution of social behavior in the

Hymenoptera. Behavioral Ecology and Sociobiology, 12, 191-201.

Craig R, Crozier RH (1979) Relatedness in the polygynous ant Myrmecia pilosula.

Evolution, 33, 335-341.

Crosland MWJ (1989) Intraspecific aggression in the primitive ant genus Myrmecia.

Insectes Sociaux, 36, 161-172.

Crosland MWJ, Crozier RH (1986) Myrmecia pilosula, an ant with only one pair of

chromosomes. Science, 231, 1278.

Crosland MWJ, Crozier RH, Imai HT (1988a) Evidence for several sibling biological

species centred on Myrmecia pilosula (F. Smith) (Hymenoptera: Formicidae).

Journal of the Australian Entomological Society, 27, 13-14.

Crosland MWJ, Crozier RH, Jefferson E (1988b) Aspects of the biology of the

primitive ant genus Myrmecia F. (Hymenoptera: Formicidae). Journal of the

Australian Entomological Society, 27, 305-309.

Crozier RH, Dix MW (1979) Analysis of two genetic models for the innate

components of colony odor in social Hymenoptera. Behavioral Ecology and

Sociobiology, 4, 217-224.

Crozier RH, Dobric N, Imai HT, Graur D, Cornuet JM, Taylor RW (1995)

Mitochondrial-DNA sequence evidence on the phylogeny of Australian

jack-jumper ants of the Myrmecia pilosula complex. Molecular Phylogenetics

76

and Evolution, 4, 20-30.

Crozier RH, Fjerdingstad EJ (2001) Polyandry in social Hymenoptera - disunity in

diversity? Annales Zoologici Fennici, 38, 267-285.

Crozier RH, Pamilo P (1996) Evolution of Social Insect Colonies: Sex Allocation and

Kin Selection. Oxford University Press, New York (NY, USA).

d'Ettorre P, Lenoir A (2009) Nestmate recognition. In: Ant Ecology (eds. Lach L, Parr

CL, Abbott KL), pp. 194-209. Oxford University Press, New York (NY, USA).

Decroocq V, Favé MG, Hagen L, Bordenave L, Decroocq S (2003) Development and

transferability of apricot and grape EST microsatellite markers across taxa.

Theoretical and Applied Genetics, 106, 912-922.

Denny AJ, Franks NR, Powell S, Edwards KJ (2004) Exceptionally high levels of

multiple mating in an army ant. Naturwissenschaften, 91, 396-399.

Diehl E, de Araújo AM, Cavalli-Molina S (2001) Genetic variability and social

structure of colonies in Acromyrmex heyeri and A. striatus (Hymenoptera:

Formicidae). Brazilian Journal of Biology, 61, 667-678.

Dietemann V, Peeters C, Hölldobler B (2004) Gamergates in the Australian ant

subfamily Myrmeciinae. Naturwissenschaften, 91, 432-435.

Doums C (1999) Characterization of microsatellite loci in the queenless ponerine ant

Diacamma cyaneiventre. Molecular Ecology, 8, 1957-1959.

Du Y-Z, Gu J, Guo J-B, Dai L, Ju R-T, Hu X-N (2007) Study on the potential

distribution area of invasive alien pest red imported fire ant, Solenopsis invicta

Buren in China. Scientia Agricultura Sinica, 40, 99-106.

Dumpert K (1981) The Social Biology of Ants. Pitman Publishing Limited, Bath

(UK).

77

Ellis JR, Burke JM (2007) EST-SSRs as a resource for population genetic analyses.

Heredity, 99, 125-132.

Elmes GW (1991) The social biology of Myrmica ants. Actes des Colloques Insectes

Sociaux, 7, 17-34.

Fernández-Escudero I, Seppä P, Pamilo P (2001) Dependent colony founding in the

ant Proformica longiseta. Insectes Sociaux, 48, 80-82.

Foitzik S, Heinze J (1998) Nest site limitation and colony takeover in the ant

Leptothorax nylanderi. Behavioral Ecology, 9, 367-375.

Foitzik S, Strätz M, Heinze J (2003) Ecology, life history and resource allocation in

the ant, Leptothorax nylanderi. Journal of Evolutionary Biology, 16, 670-680.

Fournier D, Aron S, Milinkovitch MC (2002) Investigation of the population genetic

structure and mating system in the ant Pheidole pallidula. Molecular Ecology,

11, 1805-1814.

Gamboa GJ (1986) The evolution and ontogeny of nestmate recognition in social

wasp. Annual Review of Entomology, 31, 431-454.

Giraud T, Blatrix R, Poteaux C, Solignac M, Jaisson P (2000) Population structure

and mating biology of the polygynous ponerine ant Gnamptogenys striatula in

Brazil. Molecular Ecology, 9, 1835-1841.

Gopinath A, Gadagkar R, Rao MRS (2001) Identification of polymorphic

microsatellite loci in the queenless, ponerine ant Diacamma ceylonense.

Molecular Ecology Notes, 1, 126-127.

Goudet J (1995) FSTAT (Version 1.2): a computer program to calculate F-statistics.

Journal of Heredity, 86, 485-486.

Hölldobler B, Wilson EO (1977) The number of queens: an important trait in ant

78

evolution. Naturwissenschaften, 64, 8-15.

Hölldobler B, Wilson EO (1990) The Ants. Harvard University Press, Cambridge (MA,

USA).

Hamilton WD (1964) The genetical evolution of social behaviour. Journal of

Theoretical Biology, 7, 1-52.

Hammond RL, Bourke AFG, Bruford MW (2001) Mating frequency and mating

system of the polygynous ant, Leptothorax acervorum. Molecular Ecology, 10,

2719-2728.

Hasegawa E, Crozier RH (2006) Phylogenetic relationships among species groups of

the ant genus Myrmecia. Molecular Phylogenetics and Evolution, 38, 575-582.

Haskins CP (1970) Researches in the biology and social behavior of primitive ants. In:

Development and Evolution of Behavior (eds. Aronson LR, Tobach E,

Lehrman DS, Rosenblatt JS), pp. 355-388. W. H. Freeman and Company, San

Francisco (CA, USA).

Haskins CP, Haskins EF (1950) Notes on the biology and social behaviour of the

archaic ponerine ants of the genera Myrmecia and Promyrmecia. Annals of the

Entomological Society of America, 43, 461-491.

Haskins CP, Haskins EF (1955) The pattern of colony foundation in the archaic ant

Myrmecia regularis. Insectes Sociaux, 2, 115-126.

Haskins CP, Haskins EF (1964) Notes on the biology and social behavior of

Myrmecia inquilina, the only known myrmeciine social parasite. Insectes

Sociaux, 61, 267-282.

Hefetz A (2007) The evolution of hydrocarbon pheromone parsimony in ants

(Hymenoptera: Formicidae) - interplay of colony odor uniformity and odor

idiosyncrasy. A review. Myrmecological News, 10, 59-68.

79

Heinze J (2008) The demise of the standard ant (Hymenoptera: Formicidae).


Heinze J, Keller L (2000) Alternative reproductive strategies: a queen perspective in

ants. Trends in Ecology & Evolution, 15, 508-512.

Heinze J, Trunzer B, Hölldobler B, Delabie JHC (2001) Reproductive skew and queen

relatedness in an ant with primary polygyny. Insectes Sociaux, 48, 149-153.

Henshaw MT, Kunzmann N, Vanderwoude C, Sanetra M, Crozier RH (2005)

Population genetics and history of the introduced fire ant, Solenopsis invicta

Buren (Hymenoptera: Formicidae), in Australia. Australian Journal of

Entomology, 44, 37-44.

Herbers JM (1986) Nest site limitation and facultative polygyny in the ant

Leptothorax longispinosus. Behavioral Ecology and Sociobiology, 19,

115-122.

Higashi S, Peeters CP (1990) Worker polymorphism and nest structure in Myrmecia

brevinoda Forel (Hymenoptera: Formicidae). Journal of the Australian

Entomological Society, 29, 327-331.

Holbrook C, Strehl C-P, Johnson R, Gadau J (2007) Low queen mating frequency in

the seed-harvester ant Pogonomyrmex (Ephebomyrmex) pima: implications for

the evolution of polyandry. Behavioral Ecology and Sociobiology, 62,

229-236.

Holm S (1979) A simple sequentially rejective multiple test procedure. Scandinavian

Journal of Statistics, 6, 65-70.

Holzer B, Chapuisat M, Kremer N, Finet C, Keller L (2006) Unicoloniality,

recognition and genetic differentiation in a native Formica ant. Journal of

Evolutionary Biology, 19, 2031-2039.

80

Hughes WOH, Oldroyd BP, Beekman M, Ratnieks FLW (2008a) Ancestral

monogamy shows kin selection is key to the evolution of eusociality. Science,

320, 1213-1216.

Hughes WOH, Ratnieks FLW, Oldroyd BP (2008b) Multiple paternity or multiple

queens: two routes to greater intracolonial genetic diversity in the eusocial

Hymenoptera. Journal of Evolutionary Biology, 21, 1090-1095.

Imai HT, Taylor RW, Crozier RH (1994) Experimental bases for the minimum

interaction theory. 1. Chromosome evolution in ants of the Myrmecia pilosula

species complex (Hymenoptera, Formicidae, Myrmeciinae). Japanese Journal

of Genetics, 69, 137-182.

Imai HT, Taylor RW, Kubota M, Ogata K, Wada MY (1990) Notes on the remarkable

karyology of the primitive ant Nothomyrmecia macrops, and of the related

genus Myrmecia (Hymenoptera: Formicidae). Psyche, 97, 633-140.

Johnson R (2010) Independent colony founding by ergatoid queens in the ant genus

Pogonomyrmex: queen foraging provides an alternative to dependent colony

founding. Insectes Sociaux, 57, 169-176.

Jones OR, Wang J (2010) COLONY: a program for parentage and sibship inference

from multilocus genotype data. Molecular Ecology Resources, 10, 551-555.

Kalinowski ST, Taper ML, Marshall TC (2007) Revising how the computer program

CERVUS accommodates genotyping error increases success in paternity

assignment. Molecular Ecology, 16, 1099-1106.

Katzerke A, Neumann P, Pirk C, Bliss P, Moritz R (2006) Seasonal nestmate

recognition in the ant Formica exsecta. Behavioral Ecology and Sociobiology,

61, 143-150.

Keller L (1991) Queen number, mode of colony founding, and queen reproductive

81

success in ants (Hymenoptera Formicidae). Ethology Ecology & Evolution, 3,

307 - 316.

Keller L (1993) Queen Number and Sociality in Insects, p. 439. Oxford University

Press, Oxford (UK).

Keller L (1995) Social life: the paradox of multiple-queen colonies. Trends in Ecology

& Evolution, 10, 355-360.

Keller L, Reeve HK (1994) Genetic variability, queen number, and polyandry in

social Hymenoptera. Evolution, 48, 694-704.

Keller L, Reeve HK (1995) Why do females mate with multiple males? The sexually

selected sperm hypothesis. In: Advances in the Study of Behavior (eds. Slater

PJB, Rosenblatt JS, Snowdon CT, Milinski M), pp. 291-315. Academic Press,

London (UK).

Kellner K, Trindl A, Heinze J, D'ettorre P (2007) Polygyny and polyandry in small ant

societies. Molecular Ecology, 16, 2363-2369.

Kofler R, Schlötterer C, Lelley T (2007) SciRoKo: a new tool for whole genome

microsatellite search and investigation. Bioinformatics, 23, 1683-1685.

Krieger MJB, Keller L (1997) Polymorphism at dinucleotide microsatellite loci in fire

ant Solenopsis invicta populations. Molecular Ecology, 6, 997-999.

Krieger MJB, Ross KG, Chang CWY, Keller L (1999) Frequency and origin of

triploidy in the fire ant Solenopsis invicta. Heredity, 82, 142-150.

Kronauer DJC, Boomsma JJ (2007) Multiple queens means fewer mates. Current

Biology, 17, R753-R755.

Kronauer DJC, Johnson RA, Boomsma JJ, Mueller U (2007) The evolution of

multiple mating in army ants. Evolution, 61, 413-422.

82

Kronauer DJC, Schöning C, Pedersen JS, Boomsma JJ, Gadau J (2004) Extreme

queen-mating frequency and colony fission in African army ants. Molecular

Ecology, 13, 2381-2388.

Lawson LP (2010) The discordance of diversification: evolution in the

tropical-montane frogs of the Eastern Arc Mountains of Tanzania. Molecular

Ecology, 19, 4046-4060.

Lester PJ, Keall JB (2005) The apparent establishment and subsequent eradication of

the Australian giant bulldog ant Myrmecia brevinoda Forel (Hymenoptera:

Formicidae) in New Zealand. New Zealand Journal of Zoology, 32, 353-357.

Liang D, Blomquist GJ, Silverman J (2001) Hydrocarbon-released nestmate

aggression in the Argentine ant, Linepithema humile, following encounters

with insect prey. Comparative Biochemistry and Physiology Part B:

Biochemistry and Molecular Biology, 129, 871-882.

Liang D, Silverman J (2000) “You are what you eat”: diet modifies cuticular

hydrocarbons and nestmate recognition in the Argentine ant, Linepithema

humile. Naturwissenschaften, 87, 412-416.

Liautard C, Keller L (2001) Restricted effective queen dispersal at a microgeographic

scale in polygynous populations of the ant Formica exsecta. Evolution, 55,

2484-2492.

Liu K, Muse SV (2005) PowerMarker: an integrated analysis environment for genetic

marker analysis. Bioinformatics, 21, 2128-2129.

Lorite P, Palomeque T (2010) Karyotype evolution in ants (Hymenoptera:

Formicidae), with a review of the known ant chromosome numbers.


Lucas ER, Martins RP, Field J (2011) Reproductive skew is highly variable and

83

correlated with genetic relatedness in a social apoid wasp. Behavioral Ecology,

22, 337-344.

Makowsky R, Marshall Jr JC, McVay J, Chippindale PT, Rissler LJ (2010)

Phylogeographic analysis and environmental niche modeling of the

plain-bellied watersnake (Nerodia erythrogaster) reveals low levels of genetic

and ecological differentiation. Molecular Phylogenetics and Evolution, 55,

985-995.

McCormack JE, Zellmer AJ, Knowles LL (2010) Does niche divergence accompany

allopatric divergence in Aphelocoma jays as predicted under ecological

speciation?: Insights from tests with niche models. Evolution, 64, 1231-1244.

Meunier J, Delémont O, Lucas C (2011) Recognition in ants: social origin matters.

PLoS ONE, 6, e19347.

Miao X-X, Li W-H, Li M-W, Zhao Y-P, Guo X-R, Huang Y-P (2008) Inheritance and

linkage analysis of co-dominant SSR markers on the Z chromosome of the

silkworm (Bombyx mori L.). Genetics Research, 90, 151-156.

Moilanen A, Sundstrom L, Pedersen JS (2004) MATESOFT: a program for deducing

parental genotypes and estimating mating system statistics in haplodiploid

species. Molecular Ecology Notes, 4, 795-797.

Moreau CS (2009) Inferring ant evolution in the age of molecular data (Hymenoptera:

Formicidae). Myrmecological News, 12, 201-210.

Moreau CS, Bell CD, Vila R, Archibald SB, Pierce NE (2006) Phylogeny of the ants:

diversification in the age of angiosperms. Science, 312, 101-104.

Nei M (1972) Genetic distance between populations. The American Naturalist, 106,

283-292.

Newey P (2011) Not one odour but two: A new model for nestmate recognition.

84

Journal of Theoretical Biology, 270, 7-12.

Nielsen R, Tarpy DR, Reeve HK (2003) Estimating effective paternity number in

social insects and the effective number of alleles in a population. Molecular

Ecology, 12, 3157-3164.

Nonacs P (2000) Measuring and using skew in the study of social behavior and

evolution. The American Naturalist, 156, 577-589.

Obin MS, Vander Meer RK (1988) Sources of nestmate recognition cues in the

imported fire ant Solenopsis invicta Buren (Hymenoptera: Formicidae).

Animal Behaviour, 36, 1361-1370.

Ogata K (1991) Ants of the genus Myrmecia Fabricius: a review of the species groups

and their phylogenetic relationships (Hymenoptera: Formicidae: Myrmeciinae).

Systematic Entomology, 16, 353-381.

Ogata K, Taylor RW (1991) Ants of the genus Myrmecia Fabricius: a preliminary

review and key to the named species (Hymenoptera: Formicidae:

Myrmeciinae). Journal of Natural History, 25, 1623-1673.

Oliveira PS, Camargo RX, Fourcassié V (2010) Nesting patterns, ecological correlates

of polygyny and social organization in the neotropical arboreal ant

Odontomachus hastatus (Formicidae, Ponerinae). Insectes Sociaux, 58,

207-217.

Page RE, Jr. (1980) The evolution of multiple mating behavior by honey bee queens

(Apis mellifera L.). Genetics, 96, 263-273.

Palmer KA, Oldroyd BP (2000) Evolution of multiple mating in the genus Apis.

Apidologie, 31, 235-248.

Pascoe A (2002) Strategies for managing incursions of exotic animals to New Zealand.

Micronesia, 6, 129-135.

85

Peakall R, Smouse PE (2006) GENALEX 6: genetic analysis in Excel. Population

genetic software for teaching and research. Molecular Ecology Notes, 6,

288-295.

Pearcy M, Hardy O, Aron S (2006) Thelytokous parthenogenesis and its

consequences on inbreeding in an ant. Heredity, 96, 377-382.

Pearman PB, D'Amen M, Graham CH, Thuiller W, Zimmermann NE (2010)

Within-taxon niche structure: niche conservatism, divergence and predicted

effects of climate change. Ecography, 33, 990-1003.

Pedersen JS, Boomsma JJ (1999a) Genetic analysis of colony structure in polydomous

and polygynous ant populations. Biological Journal of the Linnean Society, 66,

115-144.

Pedersen JS, Boomsma JJ (1999b) Positive association of queen number and

queen-mating frequency in Myrmica ants: a challenge to the

genetic-variability hypotheses. Behavioral Ecology and Sociobiology, 45,

185-193.

Peeters C, Ito F (2001) Colony dispersal and the evolution of queen morphology in

social Hymenoptera. Annual Review of Entomology, 46, 601-630.

Peeters C, Molet M (2009) Colonial reproduction and life histories. In: Ant Ecology

(eds. Lach L, Parr CL, Abbott KL), pp. 159-176. Oxford University Press,

New York (NY, USA).

Pimentel D, Lach L, Zuniga R, Morrison D (2000) Environmental and economic costs

of nonindigenous species in the United States. BioScience, 50, 53-65.

Pirk CWW, Neumann P, Moritz RFA, Pamilo P (2001) Intranest relatedness and

nestmate recognition in the meadow ant Formica pratensis (R.). Behavioral


86

Pol RG, de Casenave JL, Feldhaar H, Milesi FA, Gadau J (2008) Polyandry in two

South American harvester ants. Insectes Sociaux, 55, 91-97.

Pompanon F, Bonin A, Bellemain E, Taberlet P (2005) Genotyping errors: causes,

consequences and solutions. Nature Reviews Genetics, 6, 847-859.

Queller DC, Goodnight KF (1989) Estimating relatedness using genetic markers.

Evolution, 43, 258-275.

Rabeling C, Brown JM, Verhaagh M (2008) Newly discovered sister lineage sheds

light on early ant evolution. Proceedings of the National Academy of Sciences

of the United States of America, 105, 14913-14917.

Reber A, Meunier J, Chapuisat M (2010) Flexible colony-founding strategies in a

socially polymorphic ant. Animal Behaviour, 79, 467-472.

Rheindt FE, Gadau J, Strehl C-P, Hölldobler B (2004) Extremely high mating

frequency in the Florida harvester ant (Pogonomyrmex badius). Behavioral


Robinson GE, Visscher PK (1984) Effect of low temperature narcosis on honey bee

(Hymenoptera: Apidae) foraging behavior. The Florida Entomologist, 67,

568-570.

Rosengren R, Pamilo P (1983) The evolution of polygyny and polydomy in

mound-building Formica ants. Acta Entomologica Fennica, 42, 65-77.

Ross KG, Shoemaker DD, Krieger MJ, DeHeer CJ, Keller L (1999) Assessing genetic

structure with multiple classes of molecular markers: a case study involving

the introduced fire ant Solenopsis invicta. Molecular Biology and Evolution,

16, 525-543.

Ross KG, Vander Meer RK, Fletcher DJC, Vargo EL (1987a) Biochemical phenotypic

and genetic studies of two introduced fire ants and their hybrid (Hymenoptera:

87

Formicidae). Evolution, 41, 280-293.

Ross KG, Vargo EL, Fletcher DJC (1987b) Comparative biochemical genetics of three

fire ant species in North America, with special reference to the two social

forms of Solenopsis invicta (Hymenoptera: Formicidae). Evolution, 41,

979-990.

Rosset H, Schwander T, Chapuisat M (2007) Nestmate recognition and levels of

aggression are not altered by changes in genetic diversity in a socially

polymorphic ant. Animal Behaviour, 74, 951-956.

Roulston TH, Buczkowski G, Silverman J (2003) Nestmate discrimination in ants:

effect of bioassay on aggressive behavior. Insectes Sociaux, 50, 151-159.

Ruger MH, Heinze J, Foitzik S (2005) Polymorphic microsatellite loci in the ponerine

ant, Hypoponera opacior (Hymenoptera, Formicidae). Molecular Ecology

Notes, 5, 236-238.

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Laboratory Manual,

2nd edn. Cold Spring Harbor Laboratory Press, New York (NY, USA).

Sanetra M (2011) Nestmate relatedness in the Australian ant Myrmecia pyriformis

SMITH, 1858 (Hymenoptera: Formicidae). Myrmecological News, 15, 77-84.

Sanetra M, Crozier RH (2000) Characterization of microsatellite loci in the primitive

ant Nothomyrmecia macrops Clark. Molecular Ecology, 9, 2169-2170.

Sanetra M, Crozier RH (2001) Polyandry and colony genetic structure in the primitive

ant Nothomyrmecia macrops. Journal of Evolutionary Biology, 14, 368-378.

Schlüns EA, Neumann P, Schlüns H, Hepburn HR, Moritz RFA (2006) Nestmate

recognition and genetic variability among individuals from nests of the

queenless ponerine ant, Streblognathus aethiopicus Smith (Hymenoptera:

Formicidae). African Entomology, 14, 95-102.

88

Schlüns EA, Wegener B, Schlüns H, Azuma N, Robson SKA, Crozier RH (2009)

Breeding system, colony and population structure in the weaver ant

Oecophylla smaragdina. Molecular Ecology, 18, 156-167.

Schlüns H, Crozier RH (2009) Molecular and chemical immune defenses in ants

(Hymenoptera: Formicidae). Myrmecological News, 12, 237-249.

Schlüns H, Moritz RFA, Lattorff HMG, Koeniger G (2005a) Paternity skew in seven

species of honeybees (Hymenoptera: Apidae: Apis). Apidologie, 36, 201-209.

Schlüns H, Moritz RFA, Neumann P, Kryger P, Koeniger G (2005b) Multiple nuptial

flights, sperm transfer and the evolution of extreme polyandry in honeybee

queens. Animal Behaviour, 70, 125-131.

Schmid-Hempel P, Crozier RH (1999) Polyandry versus polygyny versus parasites.

Philosophical Transactions of the Royal Society of London B: Biological

Sciences, 354, 507-515.

Seifert B (2009) Cryptic species in ants (Hymenoptera: Formicidae) revisited: we

need a change in the alpha-taxonomic approach. Myrmecological News, 12,

149-166.

Seppä P, Walin L (1996) Sociogenetic organization of the red ant Myrmica rubra.

Behavioral Ecology and Sociobiology, 38, 207-217.

Shimizu M, Kosaka N, Shimada T, Nagahata T, Iwasaki H, Nagai H, Shiba T, Emi M

(2002) Universal fluorescent labeling (UFL) method for automated

microsatellite analysis. DNA Research, 9, 173-178.

Shoemaker DD, Ross KG, Arnold ML (1994) Development of RAPD markers in two

introduced fire ants, Solenopsis invicta and S. richteri, and their application to

the study of a hybrid zone. Molecular Ecology, 3, 531-539.

Smith F (1858) Catalogue of Hymenopterous Insects in the Collection of the British

89

Museum. Part VI. Formicidae. Taylor and Francis, London (UK).

Soroker V, Fresneau D, Hefetz A (1998) Formation of colony odor in ponerine ant

Pachycondyla apicalis. Journal of Chemical Ecology, 24, 1077-1090.

Sorvari J, Theodora P, Turillazzi S, Hakkarainen H, Sundström L (2008) Food

resources, chemical signaling, and nest mate recognition in the ant Formica

aquilonia. Behavioral Ecology, 19, 441-447.

Steiner FM, Crozier RH, Schlick-Steiner BC (2009) Colony structure. In: Ant Ecology

(eds. Lach L, Parr CL, Abbott KL), pp. 177-193. Oxford University Press,

New York (NY, USA).

Steiner FM, Schlick-Steiner BC, Moder K, Stauffer C, Arthofer W, Buschinger A,

Espadaler X, Christian E, Einfinger K, Lorbeer E, Schafellner C, Ayasse M,

Crozier RH (2007) Abandoning aggression but maintaining self-nonself

discrimination as a first stage in ant supercolony formation. Current Biology,

17, 1903-1907.

Stuart RJ, Herbers JM (2000) Nest mate recognition in ants with complex colonies:

within- and between-population variation. Behavioral Ecology, 11, 676-685.

Sumner S, Hughes WOH, Pedersen JS, Boomsma JJ (2004) Ant parasite queens revert

to mating singly. Nature, 428, 35-36.

Tanner C (2009) Chill out: cooling promotes aggressive behavior in the ant Formica

xerophila. Insectes Sociaux, 56, 64-69.

Tarpy DR, Nielsen R, Nielsen DI (2004) A scientific note on the revised estimates of

effective paternity frequency in Apis. Insectes Sociaux, 51, 203-204.

Taylor RW (1978) Nothomyrmecia macrops: A living-fossil ant rediscovered. Science,

201, 979-985.

90

Taylor RW (1991) Myrmecia croslandi sp.n., a karyologically remarkable new

Australian jack-jumper ant (Hymenoptera: Formicidae: Myrmeciinae).

Journal of the Australian Entomological Society, 30, 288-288.

Tepper JGO (1882) Observations about the habits of some South Australian ants.

Transactions and Proceedings of the Royal Society of South Australia, 5,

24-26.

Thornhill R, Alcock J (1983) The Evolution of Insect Mating Systems. Harvard

University Press, Cambridge (MA, USA).

Thurin N, Aron S (2008) Seasonal nestmate recognition in the polydomous ant

Plagiolepis pygmaea. Animal Behaviour, 75, 1023-1030.

Thurin N, Sery N, Guimbretiere R, Aron S (2011) Colony kin structure and breeding

system in the ant genus Plagiolepis. Molecular Ecology, 20, 3251-3260.

Trontti K, Aron S, Sundström L (2005) Inbreeding and kinship in the ant Plagiolepis

pygmaea. Molecular Ecology, 14, 2007-2015.

Trontti K, Thurin N, Sundström L, Aron S (2007) Mating for convenience or genetic

diversity? Mating patterns in the polygynous ant Plagiolepis pygmaea.

Behavioral Ecology, 18, 298-303.

Tschinkel WR (2006) The Fire Ants. Harvard University Press, Cambridge, MA.

Tsutsui ND, Suarez AV (2003) The colony structure and population biology of

invasive ants. Conservation Biology, 17, 48-58.

van Oosterhout C, Hutchinson WF, Wills DPM, Shipley P (2004)

MICRO-CHECKER: software for identifying and correcting genotyping

errors in microsatellite data. Molecular Ecology Notes, 4, 535-538.

van Wilgenburg E (2007) The influence of relatedness, neighbourhood and overall

91

distance on colony mate recognition in a polydomous ant. Ethology, 113,

1185-1191.

van Wilgenburg E, Dang S, Forti A-L, Koumoundouros T, Ly A, Elgar M (2007) An

absence of aggression between non-nestmates in the bull ant Myrmecia

nigriceps. Naturwissenschaften, 94, 787-790.

van Zweden JS, d'Ettorre P (2010) Nestmate recognition in social insects and the role

of hydrocarbons. In: Insect Hydrocarbons: Biology, Biochemistry, and

Chemical Ecology (eds. Blomquist GJ, Bagneres A-G), pp. 222-243.

Cambridge University Press, New York (NY, USA).

Vander Meer R, Morel L (1998) Nestmate recognition in ants. In: Pheromone

Communication in Social Insects (eds. Vander Meer R, Breed M, Winston M,

Espelie KE), pp. 79-103. Westview Press, Boulder (CO, USA).

Varshney RK, Graner A, Sorrells ME (2005) Genic microsatellite markers in plants:

features and applications. Trends in Biotechnology, 23, 48-55.

Via S (1977) Visually mediated snapping in the bulldog ants: a perceptual ambiguity

between size and distance. Journal of Comparative Physiology A, 121, 33-51.

Villesen P, Murakami T, Schultz TR, Boomsma JJ (2002) Identifying the transition

between single and multiple mating of queens in fungus-growing ants.

Proceedings of the Royal Society of London. Series B: Biological Sciences,

269, 1541-1548.

Villet MH (1991) Colony foundation in Plectroctena mandibularis F. Smith, and the

evolution of ergatoid queens in Plectroctena (Hymenoptera: Formicidae).

Journal of Natural History, 25, 979 - 983.

Villet MH (1999) Reproductive behaviour of Plectroctena mandibularis F. Smith

(Hymenoptera: Formicidae), a ponerine ant with ergatoid queens. African

92

Entomology, 7, 289-291.

Wang J, Jemielity S, Uva P, Wurm Y, Gräff J, Keller L (2007) An annotated cDNA

library and microarray for large-scale gene-expression studies in the ant

Solenopsis invicta. Genome Biology, 8, R9.

Wang J, Santure AW (2009) Parentage and sibship inference from multilocus

genotype data under polygamy. Genetics, 181, 1579-1594.

Ward PS, Brady SG (2003) Phylogeny and biogeography of the ant subfamily

Myrmeciinae (Hymenoptera: Formicidae). Invertebrate Systematics, 17,

361-386.

Warren DL, Glor RE, Turelli M (2008) Environmental niche equivalency versus

conservatism: quantitative approaches to niche evolution. Evolution, 62,

2868-2883.

Weir BS, Cockerham CC (1984) Estimating F-statistics for the analysis of population

structure. Evolution, 38, 1358-1370.

Wheeler WM (1933) Colony Founding among the Ants, with an Account of Some

Primitive Australian Species. Harvard University Press, Cambridge (MA,

USA).

Wiernasz DC, Perroni CL, Cole BJ (2004) Polyandry and fitness in the western

harvester ant, Pogonomyrmex occidentalis. Molecular Ecology, 13,

1601-1606.

Wilson EE, Holway D, Nieh JC (2006) Cold anaesthesia decreases foraging

recruitment in the New World bumblebee, Bombus occidentalis. Journal of

Apicultural Research, 45, 169-172.

Wojcik DP, Allen CR, Brenner RJ, Forys EA, Jouvenaz DP, Lutz RS (2001) Red

imported fire ants: impact on biodiversity. American Entomologist, 47, 16-23.

93

Wright S (1943) Isolation by distance. Genetics, 28, 114-138.

Zinck L, Jaisson P, Hora RR, Denis D, Poteaux C, Doums C (2007) The role of

breeding system on ant ecological dominance: genetic analysis of Ectatomma

tuberculatum. Behavioral Ecology, 18, 701-708.

94

APPENDICES

Appendix I: AI-based internest aggression matrix in M. brevinoda

Notes: m, monogynous; p, polygynous. * Nests with higher worker-worker relatedness (rww > 0.3); † nests with lower worker-worker relatedness (rww < 0.2). For details about the assayed nests, see Table 4.1 (Chapter 4, p24).

Nest ID B05(m)* B06(p)† B08(m)* B11(p)* B12(p)† B14(p)† B17(m)* B18(p)† B19(p)

B05(m)* 1.000

B06(p)† 3.400 1.000

B08(m)* 3.600 3.400 1.000

B11(p)* 4.400 3.800 4.200 0.800

B12(p)† 4.800 4.000 4.800 2.800 1.000

B14(p)† 2.600 1.800 2.600 4.200 3.400 1.000

B17(m)* 2.800 3.600 4.200 4.200 4.800 2.800 0.600

B18(p)† 2.600 1.800 2.200 4.600 4.600 2.200 3.600 0.800

B19(p) 5.000 4.400 4.400 2.200 2.000 4.800 4.600 5.000 1.000

95

Appendix II: MAI-based internest aggression matrix in M. brevinoda



B05(m)* 0.761

B06(p)† 0.996 0.793

B08(m)* 1.703 1.357 0.855

B11(p)* 2.984 2.900 3.429 0.832

B12(p)† 4.556 2.957 4.000 1.224 0.925

B14(p)† 0.777 0.849 1.389 2.917 2.309 0.804

B17(m)* 1.356 1.579 1.441 2.963 3.414 1.076 0.762

B18(p)† 0.969 0.909 1.025 2.911 3.940 1.525 1.687 0.511

B19(p) 4.840 3.800 2.913 1.446 1.187 3.867 4.200 4.444 0.778

96

Appendix III: MAS-based internest aggression matrix in M. brevinoda



B05(m)* 0.688

B06(p)† 0.780 0.703

B08(m)* 1.800 1.514 0.808

B11(p)* 2.960 2.529 3.440 0.644

B12(p)† 4.640 2.880 3.840 1.347 0.813

B14(p)† 0.672 0.780 1.327 3.260 2.473 0.720

B17(m)* 1.358 1.400 1.694 2.880 3.680 0.915 0.726

B18(p)† 0.900 0.710 1.100 3.000 4.040 1.324 1.460 0.440

B19(p) 4.860 3.680 2.920 1.391 1.060 3.840 4.000 4.280 0.777

[email protected]/25180/2/02whole.pdf · crozier rh (2012) colony genetic...

Documents