minor introns vs major introns

introduction two different types classification of minor introns results

.

.

. ..

.

.

Minor Introns vs Major Introns

Sebastian Bartschat

Bioinformatics, Leipzig

October 2009

introduction two different types classification of minor introns results

table of content

.. .1 introduction

.. .2 two different types

.. .3 classification of minor introns

.. .4 results

introduction two different types classification of minor introns results

reminder

non-coding regions, interrupting two exons

most genes in higher eukaryotes contain introns

intron removal and ligation of 2 consecutive exons is calledsplicing

2 trans-esterifications carried out by the spliceosome

introduction two different types classification of minor introns results

reminder

non-coding regions, interrupting two exons

most genes in higher eukaryotes contain introns

intron removal and ligation of 2 consecutive exons is calledsplicing

2 trans-esterifications carried out by the spliceosome

introduction two different types classification of minor introns results

major introns (U2-dependent)

found in all eukaryotes

excision is dependent on U2 snRNA

poly-pyrimidine tract upstream of 3splice site

more degenerate splice site signals

GT-AG, AT-AC and GC-AG

introduction two different types classification of minor introns results

minor introns (U12-dependent)

found in plants and most metazoan taxa

no evidence found in simple eukaryotes like S.cerevisiae,C.elegans or protists

excision of minor introns is dependent on U12 snRNA

frequency in vertebrates in the range of 0.15 0.34%conserved splice site sequences

lack of poly-pyrimidine tract

GT-AG, AT-AC, other RT-AN(R is purine, N is any nucleotide)

introduction two different types classification of minor introns results

comparison

Steitz et al. [3]

introduction two different types classification of minor introns results

Steitz et al. [3]

introduction two different types classification of minor introns results

getting started

focusing on T.spiralis and C.elegans

using ESTs and BLAST to get possible splice sites

GCAGATGAGG TGAGCTTTTA...ATTTTCAATGCAGG GCAAAGGTTTTGCAGATGAG GTGAGCTTTT...TATTTTCAATGCAG GGCAAAGGTTTTGCAGATGA GGTGAGCTTT...TTATTTTCAATGCA GGGCAAAGGT

PWMs to determine the correct splice site

frequency matrices were used for classification

introduction two different types classification of minor introns results

getting started

focusing on T.spiralis and C.elegans

using ESTs and BLAST to get possible splice sites

GCAGATGAGG TGAGCTTTTA...ATTTTCAATGCAGG GCAAAGGTTTTGCAGATGAG GTGAGCTTTT...TATTTTCAATGCAG GGCAAAGGTTTTGCAGATGA GGTGAGCTTT...TTATTTTCAATGCA GGGCAAAGGT

PWMs to determine the correct splice site

frequency matrices were used for classification

introduction two different types classification of minor introns results

intron scoring

PU5ss(X ) =12i=0

pixi , with U either U2 or U12

PUbps(X ) calculated for each 13nt segment in the range of(-40, -5) upstream of 3ss

computation of log-odd ratios

L5ss = log2

(PU12

5ssPU2

5ss

)and Lbps = log2

(PU12bpsPU2bps

)transformation into z-Scores S5ss and Sbps by subtracting thesample mean an dividing by the standard deviation

introduction two different types classification of minor introns results

intron scoring

PU5ss(X ) =12i=0

pixi , with U either U2 or U12

PUbps(X ) calculated for each 13nt segment in the range of(-40, -5) upstream of 3ss

computation of log-odd ratios

L5ss = log2

(PU12

5ssPU2

5ss

)and Lbps = log2

(PU12bpsPU2bps

)transformation into z-Scores S5ss and Sbps by subtracting thesample mean an dividing by the standard deviation

introduction two different types classification of minor introns results

separation

often there is no obvious cluster

same importance of 5splice site and branch site

usage of a reference set of 27 minor introns [1]

minimum values of their 5ss and branch site scores asappropriate threshold

introduction two different types classification of minor introns results

finding homologous introns

...1 identifying the T.spiralis genes containing minor introns

...2 homology search using BLASTX for detection of C.elegansproteins

...3 reconstruction of genomic structure with TBLASTN

...4 analysing the introns (with respect to their positions andtypes)

introduction two different types classification of minor introns results

-6 -4 -2 0 2 4 6 85 splice site score

-4

-2

0

2

4

6

bran

ch s

ite s

core

burge (control)gt-ag typeat-ac typegc-ag type

discrimination of introns of T.spiralis

introduction two different types classification of minor introns results

evolution of introns

loss of intron

conversion to U2 introns

shift of splice sites, including a change of type

introduction two different types classification of minor introns results

references

C B Burge, R A Padgett, and P A Sharp.Evolutionary fates and origins of u12-type introns.Mol Cell, 2(6):77385, Dec 1998.

M Davila Lopez, M A Rosenblad, and T Samuelsson.Computational screen for spliceosomal rna genes aids in defining thephylogenetic distribution of major and minor spliceosomal components.Nucleic Acids Res, 36(9):300110, May 2008.

A A Patel and J A Steitz.Splicing double: insights from the second spliceosome.Nat Rev Mol Cell Biol, 4(12):96070, Dec 2003.

N Sheth, X Roca, M L Hastings, T Roeder, A R Krainer, and R Sachidanandam.Comprehensive splice-site analysis using comparative genomics.Nucleic Acids Res, 34(14):395567, 2006.

introduction two different types classification of minor introns results

the end

Thank you for your attention!

introductiontwo different typesclassification of minor intronsresults