minor introns vs major introns

Download Minor Introns vs Major Introns

Post on 30-Dec-2016

213 views

Category:

Documents

1 download

Embed Size (px)

TRANSCRIPT

  • introduction two different types classification of minor introns results

    .

    .

    . ..

    .

    .

    Minor Introns vs Major Introns

    Sebastian Bartschat

    Bioinformatics, Leipzig

    October 2009

  • introduction two different types classification of minor introns results

    table of content

    .. .1 introduction

    .. .2 two different types

    .. .3 classification of minor introns

    .. .4 results

  • introduction two different types classification of minor introns results

    reminder

    non-coding regions, interrupting two exons

    most genes in higher eukaryotes contain introns

    intron removal and ligation of 2 consecutive exons is calledsplicing

    2 trans-esterifications carried out by the spliceosome

  • introduction two different types classification of minor introns results

    reminder

    non-coding regions, interrupting two exons

    most genes in higher eukaryotes contain introns

    intron removal and ligation of 2 consecutive exons is calledsplicing

    2 trans-esterifications carried out by the spliceosome

  • introduction two different types classification of minor introns results

    major introns (U2-dependent)

    found in all eukaryotes

    excision is dependent on U2 snRNA

    poly-pyrimidine tract upstream of 3splice site

    more degenerate splice site signals

    GT-AG, AT-AC and GC-AG

  • introduction two different types classification of minor introns results

    minor introns (U12-dependent)

    found in plants and most metazoan taxa

    no evidence found in simple eukaryotes like S.cerevisiae,C.elegans or protists

    excision of minor introns is dependent on U12 snRNA

    frequency in vertebrates in the range of 0.15 0.34%conserved splice site sequences

    lack of poly-pyrimidine tract

    GT-AG, AT-AC, other RT-AN(R is purine, N is any nucleotide)

  • introduction two different types classification of minor introns results

    comparison

    Steitz et al. [3]

  • introduction two different types classification of minor introns results

    Steitz et al. [3]

  • introduction two different types classification of minor introns results

    getting started

    focusing on T.spiralis and C.elegans

    using ESTs and BLAST to get possible splice sites

    GCAGATGAGG TGAGCTTTTA...ATTTTCAATGCAGG GCAAAGGTTTTGCAGATGAG GTGAGCTTTT...TATTTTCAATGCAG GGCAAAGGTTTTGCAGATGA GGTGAGCTTT...TTATTTTCAATGCA GGGCAAAGGT

    PWMs to determine the correct splice site

    frequency matrices were used for classification

  • introduction two different types classification of minor introns results

    getting started

    focusing on T.spiralis and C.elegans

    using ESTs and BLAST to get possible splice sites

    GCAGATGAGG TGAGCTTTTA...ATTTTCAATGCAGG GCAAAGGTTTTGCAGATGAG GTGAGCTTTT...TATTTTCAATGCAG GGCAAAGGTTTTGCAGATGA GGTGAGCTTT...TTATTTTCAATGCA GGGCAAAGGT

    PWMs to determine the correct splice site

    frequency matrices were used for classification

  • introduction two different types classification of minor introns results

    intron scoring

    PU5ss(X ) =12i=0

    pixi , with U either U2 or U12

    PUbps(X ) calculated for each 13nt segment in the range of(-40, -5) upstream of 3ss

    computation of log-odd ratios

    L5ss = log2

    (PU12

    5ssPU2

    5ss

    )and Lbps = log2

    (PU12bpsPU2bps

    )transformation into z-Scores S5ss and Sbps by subtracting thesample mean an dividing by the standard deviation

  • introduction two different types classification of minor introns results

    intron scoring

    PU5ss(X ) =12i=0

    pixi , with U either U2 or U12

    PUbps(X ) calculated for each 13nt segment in the range of(-40, -5) upstream of 3ss

    computation of log-odd ratios

    L5ss = log2

    (PU12

    5ssPU2

    5ss

    )and Lbps = log2

    (PU12bpsPU2bps

    )transformation into z-Scores S5ss and Sbps by subtracting thesample mean an dividing by the standard deviation

  • introduction two different types classification of minor introns results

    separation

    often there is no obvious cluster

    same importance of 5splice site and branch site

    usage of a reference set of 27 minor introns [1]

    minimum values of their 5ss and branch site scores asappropriate threshold

  • introduction two different types classification of minor introns results

    finding homologous introns

    ...1 identifying the T.spiralis genes containing minor introns

    ...2 homology search using BLASTX for detection of C.elegansproteins

    ...3 reconstruction of genomic structure with TBLASTN

    ...4 analysing the introns (with respect to their positions andtypes)

  • introduction two different types classification of minor introns results

    -6 -4 -2 0 2 4 6 85 splice site score

    -4

    -2

    0

    2

    4

    6

    bran

    ch s

    ite s

    core

    burge (control)gt-ag typeat-ac typegc-ag type

    discrimination of introns of T.spiralis

  • introduction two different types classification of minor introns results

    evolution of introns

    loss of intron

    conversion to U2 introns

    shift of splice sites, including a change of type

  • introduction two different types classification of minor introns results

    references

    C B Burge, R A Padgett, and P A Sharp.Evolutionary fates and origins of u12-type introns.Mol Cell, 2(6):77385, Dec 1998.

    M Davila Lopez, M A Rosenblad, and T Samuelsson.Computational screen for spliceosomal rna genes aids in defining thephylogenetic distribution of major and minor spliceosomal components.Nucleic Acids Res, 36(9):300110, May 2008.

    A A Patel and J A Steitz.Splicing double: insights from the second spliceosome.Nat Rev Mol Cell Biol, 4(12):96070, Dec 2003.

    N Sheth, X Roca, M L Hastings, T Roeder, A R Krainer, and R Sachidanandam.Comprehensive splice-site analysis using comparative genomics.Nucleic Acids Res, 34(14):395567, 2006.

  • introduction two different types classification of minor introns results

    the end

    Thank you for your attention!

    introductiontwo different typesclassification of minor intronsresults

Recommended

View more >