THE J O U R N A L OF BIOLOGICAL CHEMISTRY a:: 1991 by The American Society for Biochemistry and Molecular Biology, Inc.

Val. 266, No. 34, Issue of December 5, pp. 22948-22953, 1991 Printed in U. S. A.

GATA-binding Transcription Factors in Mast Cells Regulate the Promoter of the Mast Cell Carboxypeptidase A Gene*

(Received for publication, June 15, 1991)

Leonard 1. Zon$§lI((, Michael F. Gurish 11 **, Richard L. Stevens(( **$$, Cheri Mathers, Dale S. Reynolds**, K. Frank AustenII**, and Stuart H. Orkin$§lllI~~II From the Departments of $Pediatrics and IIMedicine, Harvard Medical School, the §Division of Hematology-Oncology, ChildrenS Hosoital, the **Department of Rheumatolom and Immunology, Brigham and Women’s Hospital, and nnthe Howard Hughes Medical Institute, Boston, Massachusetts &“115

The transcription factors GATA-1, GATA-2, and GATA-3 were found to be expressed in several mouse and rat mast cell lines that contain mast cell carboxy- peptidase A (MC-CPA) and other proteases in their cytoplasmic granules. GATA-1 mRNA was not de- tected in P815 cells, an immature mouse mastocytoma- derived cell line that lacks electron-dense granules and has low levels of secretory granule proteases. Because the 5”flanking regions of the mouse and human MC- CPA genes contained a conserved GATA-binding motif 51 base pairs upstream of their translation initiation sites, the ability of GATA-binding proteins to regulate the promoter activity of the MC-CPA gene was exam- ined in rat basophilic leukemia cells, mouse P815 cells, and transfected mouse P815 cells that expressed GATA-1. In all three mast cell lines, the promoter activity of the MC-CPA gene depended on the GATA binding site. GATA-1, GATA-2, and GATA-3 are thus the first DNA-binding proteins identified in mast cells which regulate the promoter activity of a gene that encodes a secretory granule protease.

Mast cells play a central effector role in the pathophysiology of human inflammatory disorders such as bronchial asthma, cutaneous urticaria, and acute allergic reactions. Mast cells are readily distinguished from other hematopoietic cells by their characteristic secretory granules, which contain multiple cell-specific serine proteases (1-7) and a carboxypeptidase (designated mast cell carboxypeptidase A (MC-CPA’)) (8, 9)

* This work was supported by National Institutes of Health Grants AI-22531, AI-23483, HL-02347, HL-32259, HL-33262, and HL-36110. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “aduertisement” in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequencefs) reported in this paper has been submitted to the GenBankl”/EMBL Data Bank with accession numberls) M 7655 7.

7 Harvard Medical School-Hoffman LaRoche Investigator. To whom correspondence should be sent: Dept. of Pediatrics, 300 Long- wood Ave., Division of Hematology/Oncology, Children’s Hospital, Enders 761, Boston, MA 02115. Tel.: 617-735-7707; Fax: 617-735- 7262.

$$ Established Investigator of the American Heart Association. (1 )I Howard Hughes Medical Institute Investigator. ’ The abbreviations used are: MC-CPA, mast cell carboxypeptidase

A; BMMC, bone marrow-derived mast cells; bp, base pair; hGH, human growth hormone; KiSV-MC, Kirsten sarcoma virus-immor- talized mast cells; MMCP, mouse mast cell protease; PCR, polymer- ase chain reaction; pGT, GATA-1-containing-plasmid; RBL, rat ba- sophilic leukemia; kb, kilobase(s); HEPES, 4-(2-hydroxyethyl)-l- piperazineethanesulfonic acid.

bound to highly sulfated proteoglycans (8, 10, 11). Mucosal mast cells present in the gastrointestinal tracts of helminth- infected mice express mouse mast cell protease (MMCP)-1 and MMCP-2, but not MMCP-5 or MMCP-6, and little, if any, MC-CPA. In contrast, mouse serosal mast cells express MC-CPA, MMCP-3, MMCP-4, MMCP-5, and MMCP-6, but not MMCP-1 or MMCP-2.

An immature population of mast cells can be obtained by culturing mouse bone marrow cells for 1-3 weeks in the presence of interleukin-3-rich conditioned medium (12-16). These in uitro differentiated bone marrow-derived mast cells (BMMC) can give rise to both mucosal mast cells and serosal mast cells when injected into mast cell-deficient W / W mice (17). Mouse BMMC contain abundant levels of MC-CPA, MMCP-5, and MMCP-6 mRNAs, but do not contain MMCP- 2 or MMCP-4 mRNAs. Thus, BMMC must express MMCP- 4 when they differentiate into serosal-type mast cells. They cease to express MC-CPA and MMCP-5 and begin to express MMCP-1 and MMCP-2 when they differentiate into mucosal mast cells. Kirsten sarcoma virus-immortalized mast cells (KiSV-MC) (18) express proteases of both subclasses (3-7, 9).

The MC-CPA gene is expressed relatively early2 along with FctRI (19) when progenitor cells differentiate into BMMC. Inspection of the 5’-flanking region of the human MC-CPA gene (20) revealed a potential binding motif for the transcrip- tion regulatory factor GATA-1, which is expressed in mouse BMMC (21). GATA-1 is also expressed in erythroid cells, megakaryocytes, eosinophils, and basophils of various species (22-31). Based on gene targeting in mouse embryo-derived stem cells (32), GATA-1 has been found to be an essential transcription factor for normal erythroid development. GATA-1 is a member of a highly conserved vertebrate family of a t least three transcription factors related by a homologous zinc finger, DNA-binding domain. GATA-1, GATA-2, and GATA-3 all bind the consensus sequence (A/T)GATA(A/G), a motif present in the promoter and enhancer elements of a number of erythroid and megakaryocytic genes. GATA-2 mRNA is present in erythroid cells and in several different tissues (29). In contrast, GATA-3 mRNA has been detected in immature and mature T lymphocytes and in embryonic brain cells (29, 33).

In this study we demonstrate that a number of different populations of mouse and rat mast cells express not only GATA-1 but also GATA-2 and GATA-3. We also show that these DNA-binding proteins regulate the promoter activity of the MC-CPA gene.

’ R. L. Stevens, unpublished data.

22948

Transcriptional Regulation by GATA 22949

EXPERIMENTAL PROCEDURES

Cells-Mouse erythroid leukemia MEL cells (line 745) were ob- tained from the NIGMS Human Genetic Mutant Cell Repository (Camden, NJ). Mouse mastocytoma P815 cells (line TIB-64), mouse myelomonocytic WEHI-3 cells (line TIR-68). mouse 3T3 fibroblasts (line CRL-1658), mouse lymphoma EL-4 cells (line TIR-39), and rat basophilic leukemia (RRL) cells (line CRL-1378) were obtained from the American Type Culture Collection. The derivation and properties of mouse KiSV-MC (line MC4) have been described (18). All cell lines were grown in enriched medium (Dulbecco's modified Eagle's medium containing 10% heat-inactivated fetal calf serum, 10 mM HEPES, 2 mM glutamine, 50 units/ml penicillin, and 50 pg/ml streptomycin). Primary cultures of mouse RMMC were obtained by culturing bone marrow cells from the femurs and tibias of BALB/c mice for 4 weeks in the presence of 50% WEHI-3 cell-conditioned medium and 50% enriched medium (13).

RNA Blot Analysis-Total RNA (-10 pg) was prepared from the different populations of rat and mouse cells by the method of Chom- czynski and Sacchi (34). RNA was denatured in formamide/formal- dehyde and then was electrophoresed in 1% agarose/formaldehyde gels. After electrophoresis, RNA was transferred (35) to Magnagraph nylon membranes, and the blots were probed with radiolabeled cDNAs that encode mouse GATA-1 (27), GATA-2, GATA-3 (36) , or (+actin (37). The mouse GATA-2 probe was obtained by screening a cDNA library, prepared from mRNA isolated from a 6.5-day-old whole mouse embryo, under conditions of low stringency with a human GATA-2 cDNA prohe. All hybridizations were performed with random-primed cDNA probes a t 42 "C for 18 h in 50% formamide, 5 X SSC, 2 X Denhardt's buffer, 0.1% sodium dodecyl sulfate, and 100 pg/ml single-stranded herring sperm DNA. The RNA blots were washed a t 37 "C in 0.1 X SSC and 0.1% sodium dodecyl sulfate, and autoradiography was performed with Kodak XAR-5 film. RNA sam- ples from 3T3 fibroblasts, MEL erythroid cells, and EL-4 lymphoma cells were run in parallel as controls.

Construction of a GATA-I-containing Plasmid and Expression of GATA-I in Transfected Mastocytoma P81.5 Cells-A cassette (38) containing the thymidine kinase promoter and the neomycin resist- ance gene was introduced into a pXM/GATA-1 expression plasmid (27). This new expression plasmid (designated pGT) contains the adenovirus major late promoter and therefore provides constitutive expression of GATA-1 mRNA in neomycin-resistant, transfected cells. COS-1 cells express abundant levels of GATA-1 mRNA and protein when transiently transfected with pGT (27).

For transfection of P815 cells, 2 X 10' cells were washed twice in HEPES-buffered saline and were incubated for 10 min on ice in this buffer with 100 pgof pGT that had been linearized with the restriction enzyme NdeI. Electroporations (960 micro-Farads, 280 V) were per- formed with a Bio-Rad gene pulser. After a second 10-min incubation on ice, the transfected P815 cells were placed in fresh enriched medium and cultured for 18 h a t 37 "C in a humidified atmosphere of 5% CO?. The transfected cells were centrifuged the next day a t 500 X g, placed in fresh enriched medium containing 1 mg/ml of the antibiotic G418, serially diluted into 24-well tissue culture plates, and cultured at 37 "C. Fourteen days later, a stably transfected cell clone (designated P815/pGTG) was isolated by aspiration. An expression plasmid containing the adenovirus major late promoter but lacking a cDNA insert was also electroporated in replicate P815 cells to obtain the control cell line, P815/tk-neo (38).

Isolation of the Mouse MC-CPA Gene and Anal.vsis of Its Pro- moter-A mouse liver genomic library (Clontech) was probed under conditions of high stringency using a KiSV-MC-derived MC-CPA cDNA (9) to isolate a clone that contained exon 1 and the 5"flanking region of the mouse MC-CPA gene. Two oligonucleotide primers were synthesized which contained HamHI-susceptible linkers. One primer corresponded to residues -160 to -143 of the MC-CPA gene whereas the other primer corresponded to residues -9 to +9. With polymerase chain reaction (PCR) methodology (39), the 169-base pair (bp) region of the genomic clone that contained the 5'-untranslated region of exon 1 and the putative promoter of this carbox-ypeptidase gene was prepared. A DNA construct was obtained by ligating this 169-hp DNA into the RamHI cloning site of pBGH, a plasmid from Nichols Institute Diagnostics (San duan Capistrano, CA) that contains a promoterless human growth hormone (hGH) gene (40). A plasmid (pTKGH) that contains an enhancerless thymidine kinase promoter ligated to the hGH gene (40) was used as a control plasmid in the preliminary DNA transfections.

A PCR, site-directed mutagenesis strategy (41) was used to intro-

duce a point mutation at residue -45 in the promoter of the mouse MC-CPA gene, thereby converting the nucleotide sequence in this region from AGATAA to AGTTAA. Two complementary %-mer oligonucleotides were synt.hesized which, except for the point muta- tion, corresponded exactly to residues -62 to -27 of the promoter of the MC-CPA gene. The first PCR was performed with the wild-type MC-CPA promoter/hGH gene construct as a template, one of the 36- mer oligonucleotides that contained the point mutation, and an oligonucleotide that corresponds to residues -160 to -148 of the MC- CPA gene. The latter oligonucleotide also contained a terminal nu- cleotide sequence that was susceptible to RamHI. The second PCR used the other mutated %mer oligonucleotide and an oligonucleotide (5'-GCCATTGCAGCTAGGTGAGCTGTCCACAGG-3') that corre- sponded to the complementary strand of the hGH gene in p0GH. The purified DNAs generated from these two reactions were mixed together, and then a third PCR was performed with the above hGH gene-derived primer and the primer that corresponded to residues -160 to -143 of the MC-CPA gene. The resulting mutated 169-bp DNA from the third PCR was ligated into the HamHI cloning site of p0GH.

The relevant nucleotide sequences within the two constructs were verified by dideoxy sequencing of the plasmid DNAs, as described by Sanger and Coulson (42), with modifications essential for double- stranded sequencing (43). Various amounts of the two constructs were introduced by electroporation into RRL cells, P815 cells, and the P815/pGTG cell line as described above. Approximately 70 h after the transfection, 0.1 ml of medium was removed from each culture, and the level of hGH was determined with a radioimmunoassay kit from Nichols Institute Diagnostics. The amount of hGH in the culture medium was determined by assaying the amount of absorbed ' 9 - labeled anti-hGH antibody in the sandwich assay.

Primer extension analysis (44) was performed to confirm that the authentic transcription initiation site of the hGH gene was used by RRL cells transfected with the MC-CPA promoter/hGH gene re- porter plasmid construct. Poly(A)+ RNA was prepared from 2 X 10' RBL cells transfected with the construct containing the wild-t.ype MC-CPA promoter using a single step extraction kit (Invitrogen, CA). RNA was incubated for 1 h a t 37 "C in a reaction buffer containing Moloney murine virus reverse transcriptase (Bethesda Research Laboratories) and a 30-bp :'2P-labeled oligonucleotide de- rived from exon l of the hGH gene. After phenol/chloroform extrac- tion and ethanol precipitation, the sample was electrophoresed on an 8% polyacrylamide gel, and the size of the prominent radiolabeled DNA fragment extended onto the primer was determined.

Gel Mobility Shift Analyis of Nuclear Extracts Derived from Mast Cell Lines-Nuclear extracts were prepared from -10' P815 cells, P815/pGT6 cells, and RBL cells using a rapid micropreparation

GATA-1 0

GATA-3

FIG. 1. GATA-1 mRNA, GATA-2 mRNA, and GATA-3 mRNA leve ls in d i f fe ren t mouse and rat cells. An RNA blot containing -10 pg/lane of' total cellular RNA from mouse erythroid leukemia MEL cells, mouse 3T3 fibroblasts, mouse RMMC, mouse KiSV-MC (line MC4), RRL cells, mouse EL-4 cells, mouse masto- cytoma P81.5 cells, mouse mastocytoma P815/pGT6 cells, and mouse mastocytoma P815/tk-neo cells was prohed under conditions of high stringency with mouse GATA-1, GATA-2, GATA-3, or &actin cDNAs. In a second experiment using another set of cultures (not shown), more GATA-1 mRNA was detected in KiSV-MC and RBL cells than the levels depicted in this figure.

22950 Transcriptional Regulation by GATA modification (45) of a procedure described by Dignam and co-workers (46). The extraction buffer contained the following protease inhibi- tors: 0.4% aprotonin, 2 pg/ml pepstatin, 2 pg/ml leupeptin, 0.2 mM phenylmethylsulfonyl fluoride, and 1 mM dithiot,hreitol. For each gel mobility shift assay, a 2-6-pg portion of nuclear protein was incubated in a total volume of 20 p1 of buffer containing 1 pg of poly(d1-dC) and 5-10 X 10:' cpm of a ."P-labeled oligonucleotide (-3 x 1 0 cpm/ng). '"P-Labeled DNA-protein complexes were resolved from unbound radiolabeled DNA on 5% polyacrylamide gels run in 1.25 mM EDTA and 4.5 mM Tris borate, pH 8.2. The gels were dried under vacuum and autoradiographed for -24 h.

RESULTS

GATA-binding Proteins in Mouse and Rat Mast Cells-As assessed by RNA blot analysis, mouse erythroid leukemia MEL cells, mouse BMMC, mouse KiSV-MC, and RBL cells

A 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2

GATA-l",

w w c

- B 1 2 3 4 5 6 7 8 9 1 0 1 1 1 2

C S P l

G A T A - 2 - b G A T A - 1 - b

-7"-

4 - S P l

FIG. 2. Gel mobil i ty shif t analysis of nuc lea r ex t r ac t s de- rived from cell l ines. A, nuclear extracts from P815 cells (lanes l , 4 , and 7), P815/pGT6 cells (lanes 2, 5 , and 8 ) , RBL cells (lanes IO- 12), and MEL cells (lanes 3,6, and 9 ) were incubated with "'P-labeled oligonucleotides corresponding to a fragment (nucleotides -2 to -38) of the erythropoietin receptor promoter which contains a SP-1 site (lanes 7-9 and 12), a fragment (nucleotides -27 to -62) of the native promoter of the mouse MC-CPA gene (lanes 1-3 and IO), or a fragment (nucleotides -27 to -62) of the MC-CPA promoter in which the GATA site had been mutated to GTTA (lanes 4-6 and 11). All assays were performed in the presence of 1 pg of poly(d1-dC). R, nuclear extracts from P815 cells (lanes 1-3 and IO), P815/pGT6 cells (lanes 4-6 and I 1 ), and MEL cells (lanes 7-9 and 12) were incubated with ."P-labeled oligonucleotides corresponding to a fragment of the native promoter of the mouse MC-CPA gene (lanes 1-9) or a fragment of the erythropoietin receptor promoter which contains an SP-1 site (lanes 10-12). Assays were performed in the presence of 0.500 pg (lanes 1, 4, 7, and IO), 0.250 pg (lanes 2, 5, 8, and I I ) , or 0.125 pg ( lanm 3 , 6, 9, and 12) of poly(d1-dC).

ATAAGTAGCATGT-GCTTGGTGGGTTAGTGTTmCCCTCTC-CAGCTGGAAAAAAAAAACCTGGTCT

(-160) AGAAGTAGAGAGAGGCCTGGATATTCACAACCCTGCCCGCTCTCAACTCMTA------.-TGA * ****** * ** *** * * *** *w ** *** ***** * **

GGGGGAAGAAGGGGAAGAGTTTGTGCAACAGAACCCTAAGCA AGATAA ** **** * ** *** * * ***** ** ************* ** ** ****** ( - 9 5 ) GGTGGAA------GGACTGTTCATCCCCAGGAACCACAA-AGGAAATCAGCTG~CGTCG 1 , AGATAA I

Ttanslation-initiation site I

GGGCTGAGGCATAMACTGCCAGAGGGTCTC#AGGCAGGCAAAGAAGAACCATG (Human Gene)

( - 4 1 ) AAGCTGAGGTATAMACCCGTATAGGGGTCAGATCAAGCCAA-GMCATG (House Gene) x****** ******* * **** * ** ** ** ** ***

+1 t

Transcription-initlation site

FIG. 3. Nucleot ide sequence comparison of the 5"f lanking reg ions of t h e h u m a n ( top nucleotide sequence) and mouse (bottom nucleotide sequence) MC-CPA genes. Identical nucleo- tides are indicated by asterisks. The negatioe numbers on the left indicate the nucleotides upstream of the transcription initiation site of the mouse gene. The conserved GATA binding motifs of the human gene and mouse gene are boxed. The adenosine ( 6 ) a t residue -45 of the mouse gene that was mutated to thymidine for the hGH gene transfection experiments is indicated. The nucleotide sequence of the human MC-CPA gene is from Reynolds et al. (20).

contained the 1.8-kb mRNA that encodes the transcription factor GATA-1 (Fig. 1). In contrast, no GATA-1 mRNA was detected in mouse 3T3 fibroblasts, mastocytoma P815 cells, or mastocytoma P815 cells transfected with a control plasmid, tk-neo. To determine the significance of the lack of GATA-1 expression in P815 cells, a mammalian expression vector containing a mouse GATA-1 cDNA (pGT) was stably intro- duced into this cell line to obtain a new line, designated P815/ pGT6, that expressed abundant levels of GATA-1 mRNA (Fig. 1). The GATA-1 transcript in P815/pGT6 cells is larger than 1.8 kb because of the dicistronic RNA generated from the expression vector used in the transfection. BMMC, KiSV- MC, RBL cells, P815 cells, P815/pGT6 cells, and P815/tk- neo cells all contained the 3.0- and 3.7-kb GATA-2 mRNAs (Fig. 1). No GATA-3 mRNA was detected in the parent P815 cell line, and a very small amount of GATA-3 mRNA was detected in P815/pGT6 cells. The EL-4 lymphoma cell line contained abundant amounts of this 3.5-kb transcript whereas KiSV-MC, RBL cells, and BMMC contained lesser amounts of the transcript.

Gel mobility shift analysis using a fragment of the MC- CPA promoter containing the GATA binding site (Fig. 2 A ) revealed that the nuclear extracts of P815/pGT6 cells (lune 2 ) and RBL cells (lane 10) but not P815 cells (lune 1 ) contained a factor that comigrated with authentic GATA-1 derived from MEL cells (lane 3) . This protein-DNA complex was not evident with use of the corresponding fragment of the MC-CPA promoter which contained the single nucleotide mutation within the GATA binding site (Fig. 2 A , lanes 4, 5, 6, and 11 ). Both P815 cells (Fig. 2 A , lane 1 ) and P815/pGT6 cells (Fig. 2 A , lane 2 ) also contained a less evident activity which migrated slightly slower than GATA-1 in the same assay. A clearer representation of this GATA-2-like activity in P815 cells (Fig. 2B, lanes 1-3) and P815/pGT6 cells (Fig. 2B, lanes 4-6) was obtained in subsequent gel mobility shift experiments in which decreasing amounts of poly(d1-dC) were used as nonspecific DNA competitors. This activity was not found in MEL cells (Fig. 2B, lanes 7-9) which express ex- tremely low levels of GATA-2 mRNA (data not shown).

Functional Analysis of a GATA-binding Element Present in the promoter of the Mouse MC-CPA Gene-To determine if the GATA-binding element detected in the 5"flanking region of the human MC-CPA gene (20) was conserved, a DNA fragment was isolated from a mouse MC-CPA genomic clone

Transcriptional Regulation by G A T A 22951 30

A

Wild Type (GATA)

Mutant (GTTA)

Amount Plasmid Transfected ( P 9 )

C ’ 2 3 4

c-

FIG. 4. Functional analysis in RBI, cells ( A a n d C) a n d mouse mastocytoma P815 cells ( B ) of a putat ive GATA bind- ing motif in the 5”flanking region of t he MC-CPA gene. Two hGH gene constructs were prepared, one containing the wild-type promoter of the mouse MC-CPA gene, the other containing the mutated promoter. Fifteen micrograms of these DNA constructs were electroporated into RBL cells ( A ) , or 10-60 pg of the constructs were electroporated into P815 cells or P815/pGT6 cells ( R ) . The amount of hGH was measured in the culture medium 3 days later. The depicted hGH data in panel A are the mean 2 S.D. of three experi- ments, each performed in duplicate; in panel I3 they are from one of two experiments. The activity of the wild-type MC-CPA promoter (closed symbols) and the GATA-mutated MC-CPA promoter (open symbok) was assessed in P815/pGT6 cells (boxes) and P815 cells (triangles). The results of primer extension analyses of RBL cells

that contained the 9-bp 5”untranslated region of exon 1 and 160 bp of flanking DNA. As can be seen in Fig. 3, the GATA- binding element beginning 51 bp upstream of the translation initiation site and 42 bp upstream of the transcription initi- ation site of the mouse gene was conserved.

To determine if this region of the mouse MC-CPA gene had promoter activity that was dependent on the conserved motif, two DNA constructs were prepared which contained this 5”flanking region of the mouse MC-CPA gene ligated to the hGH gene. Site-directed mutagenesis was performed on one of the constructs, converting the GATA sequence (Fig. 3) to GTTA. RBL cells transiently transfected with the con- struct that contained the native MC-CPA promoter produced 17.5-fold more hGH than cells transfected with a construct containing the GATA mutation (Fig. 4A). Primer extension analysis confirmed the authentic transcription initiation site of hGH gene in the wild-type MC-CPA promoter/hGH re- porter gene construct (Fig. 4C, lunes 3 and 4 ) .

The two hGH gene constructs were then transfected into P815 cells and into P815/pGT6 cells expressing GATA-1 to determine if the activity of the MC-CPA promoter depends on the GATA site in P815 cells and if increased GATA-1 expression would result in increased promoter activity. When 2 X 10’ P815 cells were transiently transfected with 10-60 pg of the construct containing the wild-type promoter of the mouse MC-CPA gene, the amount of hGH in the culture medium was substantially higher than in the culture medium of cells transfected with a MC-CPA promoter/hGH gene plasmid containing the mutated GATA site (Fig. 4B). Two- to 4-fold more hGH (Fig. 4B) was produced by the P815/ pGT6 mastocytoma cell line that had been induced to express high levels of GATA-1 compared with the parent P815 mas- tocytoma cell line (Figs. 1 and 2B). These findings indicated that the promoter activity of the 5”flanking region of the MC-CPA gene in P815 cells, P815/pGT6 cells, and RBL cells was dependent on the GATA-binding site.

DISCUSSION

A complex differentiation program must ensue when bone marrow cells mature into diverse mast cell populations in varied tissue microenvironments (17). This tissue-directed program is ultimately regulated by nuclear transcription fac- tors. Because GATA-binding proteins play a prominent role in hematopoietic differentiation (22-33, 36) and because GATA-1 mRNA has been found in BMMC (21), we examined the expression of three GATA-binding proteins in different populations of mouse and rat mast cells. Mouse BMMC, mouse KiSV-MC, and the transformed rat mucosal mast cell- like RBL cells (47) were each found to contain various levels of GATA-1 mRNA, GATA-2 mRNA, and GATA-3 mRNA (Fig. 1). In contrast, the mouse mastocytoma P815 cells did not contain GATA-1 mRNA or GATA-3 mRNA but did contain GATA-2 mRNA (Figs. 1 and 2). The P815 cell line, established in 1957 during a tumor induction experiment involving the painting of methylcholanthrene on a DBAf/2 male mouse (48), has dedifferentiated to such an extent that these cells no longer express FctRIa mRNA and no longer

transfected with the wild-t.yp MC-CPA promoter/hGH reporter gene construct are shown in panel C. The hGH gene-derived primer was incubated in the reaction with 10 pg of tRNA (lane 2). 10 pg of poly(A)’ RNA isolated from RRL cells transfected with 15 pg of the construct (lane 3 ) , or 5.5 pg of poly(A)+ RNA isolated from RHL cells transfected with 100 pg of the construct (lane 4 ) . As expected, 49 nucleotides were extended onto the primer, resulting in a DNA product of -7.7 nucleotides (arrow). A DNA molecular weight marker consisting of -55 nucleotides from an Hinfl digest of pHR.722 was run in lane I.

22952 Transcriptional Regulation by GATA

contain electron-dense granules that can be stained with toluidine blue or Wrights/Giemsa. However, they do express low levels of the mast cell-specific gene MC-CPA (data not shown).

Because of the immature nature of the GATA-1- P815 cells, we speculated that GATA-binding proteins might regulate the expression of at least one of the secretory granule protease genes in mature mast cells. Based on the primary structures of their cDNAs, -85% of the nucleotide sequences within the exons of the human and mouse MC-CPA genes are identical (9, 20). Despite the fact that only 64% of the nucleotides within the 160-bp region immediately upstream of the tran- scription initiation sites of the two MC-CPA genes are iden- tical, a possible GATA binding motif that resides between residues -42 and -47 is conserved (Fig. 3). Gel mobility shift experiments revealed that the nuclear extracts of P815 cells contained low but detectable levels of a protein that bound to this region of the promoter of the mouse MC-CPA gene (Fig. 2 A ) . The protein in this complex most likely is GATA-2 because P815 cells express abundant levels of GATA-2 mRNA (Fig. 1) and because GATA-2 is a slightly larger polypeptide than GATA-1. P815 cells, which do not express GATA-1 or GATA-3, were stably transfected with a plasmid (pGT) that encodes mouse GATA-1 to yield the mastocytoma cell line P815/pGT6. As assessed by RNA blot analysis, this cell line expressed very low levels of GATA-3 mRNA but relatively high levels of GATA-1 mRNA and GATA-2 mRNA (Fig. 1). Gel mobility shift experiments revealed that P815/pGT6 cells contained substantially more nuclear GATA-binding proteins than the parent cell line (Fig. 2 A , lanes 1 and 2). Based on its faster mobility in the gel mobility shift assay (Fig. 2, lune Z) , most of the GATA binding activity in the nuclear extracts of P815/pGT6 cells was attributed to GATA-1. However, the possibility exists that some of the GATA binding activity in P815/pGT6 cells might be caused by GATA-2 or GATA-3, inasmuch as these cells contain GATA-2 mRNA and low levels of GATA-3 mRNA (Fig. 1).

Transient transfection experiments in RBL cells with a hGH gene reporter construct revealed that the 160-bp 5’- flanking region of the mouse MC-CPA gene functions as a promoter. Because substantially less hGH was produced by RBL cells transfected with a construct in which the GATA site was mutated to GTTA (Fig. 4A), it was concluded that the promoter activity of this region of the mouse MC-CPA gene was dependent on the GATA site. Even though RBL cells have GATA-1, GATA-2, and GATA-3 mRNA (Fig. 11, the gel shift mobility analyses (Fig. 2 A ) suggested that the MC-CPA promoter is regulated in these cells predominately by GATA-1. Although some GATA-dependent activity was obtained when P815 cells were transfected with the MC- CPA/hGH gene constructs, substantially more activity was obtained in the P815/pGT6 cell line expressing GATA-1. Based on the high relative level of GATA-2 mRNA in the parent P815 cell line (Fig. 1) and the pattern obtained in the gel mobility shift assay (Fig. 2), it was concluded that GATA- 2 regulates the activity of the MC-CPA promoter in these cells. However, as demonstrated in the P815/pGT6 cells, GATA-1 is also capable of increasing the activity of the MC- CPA promoter construct. Mast cells can express multiple GATA-binding proteins, and thus it is possible that each factor stimulates MC-CPA transcription a t different stages of mast cell development. Because GATA-2 mRNA is present in all four populations of mast cells (Fig. l ) , including the most primitive P815 cells, GATA-2 probably is the first GATA-binding protein expressed during the differentiation of bone marrow progenitor cells into mast cells. Based on the

relative levels of GATA-1 mRNA and GATA-3 mRNA (Fig. 1) in BMMC and in the more mature KiSV-MC (18), GATA- 1 probably is expressed before GATA-3 in this maturation process. GATA-binding proteins were initially identified based on their ability to regulate erythroid differentiation. The discovery that GATA-binding proteins not only are pres- ent in mast cells but also regulate the promoter activity of the MC-CPA gene indicates that these nuclear proteins serve broader roles than previously recognized by regulating tran- scription of diverse genes in different hematopoietic cells.

REFERENCES 1. DuBuske, L., Austen, K. F., Czop, J., and Stevens, R. L. (1984)

J. Zmmunol. 133, 1535-1541 2. Le Trong, H., Newlands, G. F. J., Miller, H. R. P., Charbonneau,

H., Neurath, H., and Woodbury, R. G. (1989) Biochemistry 28 ,

3. Serafin, W. E., Reynolds, D. S., Rogelj, S., Lane, W. S., Conder, G. A,, Johnson, S. S., Austen, K. F., and Stevens, R. L. (1990) J. Biol. Chem. 265,423-429

4. Serafin, W. E., Sullivan, T. P., Conder, G. A., Ebrahimi, A., Marcham, P., Johnson, S. S., Austen, K. F., and Reynolds, D. S. (1991) J. Biol. Chem. 266 , 1934-1941

5. Reynolds, D. S., Stevens, R. L., Lane, W. S., Carr, M. H., Austen, K. F., and Serafin, W. E. (1990) Proc. Natl. Acad. Sci. U. S. A.

6. Reynolds, D. S., Gurley, D. S., Austen, K. F., and Serafin, W. E. (1991) J. Biol. Chem. 266,3847-3853

7. McNeil, H. P., Austen, K. F., Somerville, L. L., Gurish, M. F. and Stevens, R. L. (1991) J. Bid. Chem., in press

8. Serafin, W. E., Dayton, E. T., Gravallese, P. M., Austen, K. F., and Stevens, R. L. (1987) J. Immunol. 139,3771-3776

9. Reynolds, D. S., Stevens, R. L., Gurley, D. S., Lane, W. S., Austen, K. F., and Serafin, W. E. (1989) J. Biol. Chem. 264,

10. Razin, E., Stevens, R. L., Akiyama, F., Schmid, K., and Austen, K. F. (1982) J . Biol. Chem. 257 , 7229-7236

11. Serafin, W. E., Katz, H. R., Austen, K. F., and Stevens, R. L. (1986) J. Biol. Chem. 261,15017-15021

12. Razin, E., Cordon-Cardo, C., and Good, R. A. (1981) Proc. Natl. Acad. Sci. U. S. A. 78, 2559-2561

13. Razin, E., Ihle, J. N., Seldin, D., Mencia-Huerta, J-M., Katz, H. R., LeBlanc, P. A., Hein, A., Caulfield, J. P., Austen, K. F., and Stevens, R. L. (1984) J. Immunol. 132 , 1479-1486

14. Schrader, J. W., Lewis, S. J., Clark-Lewis, I., and Culvenor, J. G. (1981) Proc. Natl. Acad. Sci. U. S. A. 78, 323-327

15. Tertian, G., Yung, Y-P., Guy-Grand, D., and Moore, M. A. S. (1981) J. ZmmunoE. 127 , 788-794

16. Nabel, G., Galli, S. J., Dvorak, A. M., Dvorak, H. F., and Cantor, H. (1981) Nature 291 , 332-334

17. Nakano,T., Sonoda, T., Hayashi, C., Yamatodani, A., Kanayama, Y., Yamamura, T., Asai, H., Yonezawa, T., Kitamura, Y., and Galli, S. J. (1985) J. Exp. Med. 162,1025-1043

18. Reynolds, D. S., Serafin, W. E., Faller, D. V., Wall, D. A., Abbas, A. K., Dvorak, A. M., Austen, K. F., and Stevens, R. L. (1988) J. Biol. Chem. 263, 12783-12791

19. Thompson, H. L., Metcalfe, D. D., and Kinet, J-P. (1990) J. Clin. Inuest. 85, 1227-1233

20. Reynolds, D. S., Gurley, D. S., Stevens, R. L., Sugarbaker, D. J., Austen, K. F., and Serafin, W. E. (1989) Proc. Natl. Acad. Sci.

21. Martin, D. I. K., Zon, L. I., Mutter, G., and Orkin, S. H. (1990)

22. Wall, L., deBoer, E., and Grosveld, F. (1989) Genes & Deu. 2,

23. Evans, T., Reitman, M., and Felsenfeld, G. (1988) Proc. NatL

24. Evans, T., and Felsenfeld, G. (1989) Cell 58,877-885 25. Perkins, N. D., Nicolas, R. H., Plumb, M. A., and Goodwin, G.

26. Martin, D. I. K., Tsai, S-F., and Orkin, S. H. (1989) Nature 338,

27. Tsai, S-F., Martin, D. I. K., Zon, L. I., D’Andrea, A. D., Wong,

28. Romeo, P-H., Prandini, M-H., Joulin, V., Mignotta, V., Prenant,

391-395

87,3230-3234

20094-20099

U. S. A. 86,9480-9484

Nature 344,444-447

1089-1100

Acad. Sci. U. S. A. 8 5 , 5976-5980

H. (1989) Nucleic Acids Res. 17, 1299-1314

435-438

G. G., and Orkin, S. H. (1989) Nature 339,446-451

Transcriptional Regulation by GATA 22953

M., Vainchenker, W., Marguerie, G., and Uzan, G. (1990) 38. Tsai, S-F., Strauss, E., and Orkin, S. H. (1991) Genes & Deu. 5, Nature 344,447-449 919-931

29. Yamamoto, M., KO, L. J., Leonard, M. W., Beug, H., Orkin, S. 39. Saiki, R. K., Gelfand, D. H., Stoffel, S., Scharf, S. J., Higuchi, H., and Engel, J. D. (1990) Genes & Deu. 4, 1650-1662 R., Horn, G. T., Mullis, K. B., and Erlich, H. A. (1988) Science

30. Zon, L. I., Rosenberg, H. F., Bennett, H. C., Orkin, S. H., and 239,487-490 Ackerman, S. (1991) J . Allergy Clin. Imnunol. 87, 350 (abstr.) 40. Selden, R. F., Burke Howie, K., Rowe, M. E., Goodman, H. M.,

31. Zon, L. I., Tsai, S-F., Burgess, S., Matsudaira, P., Bruns, G. A. and Moore, D. D. (1986) Mol. Cell. Biol. 6, 3173-3179 P., and Orkin, S. H. (1990) Proc. Natl. Acad. Sci. U. S. A . 87, 41. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, 668-672 L. R. (1989) Gene (Arnst.) 77, 51-59

32. Pevny, L., Simon, M. C., Robertson, E., Klein, W. H., Tsai, S-F., 42. Sanger, F., and Coulson, A. R. (1975) J . Mol. Biol. 94, 441-448 D’Agati, V., Orkin, S. H., and Costantini, F. (1991) Nature 43. Chen E. Y., and Seeburg, P. H. (1985) D N A ( N Y ) 4, 165-170 349,257-260 44. Lee, J. L., Calzone, F. J., Britten, R. J., Angerer, R. C., and

33. Ho, I. C., Vorhees, P., Marin, N., Oakley, B. K., Tsai, S-F., Orkin, Davidson, E. H. (1986) J . Mol. Bid. 188, 173-183 S. H., and Leiden, J. M. (1991) EMBO J. 10, 1187-1192 45. Andrews, N. C., and Faller, D. V. (1991) Nucleic Acids Res. 19,

34. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochern. 162, 2499 156-159 46. Dignam, J. D., Lebowitz, R. M., and Roeder, R. G. (1983) Nucleic

35. Thomas, P. S. (1980) Proc. Natl. Acad. Sci. U. S. A . 77, 5201- Acids Res. 11, 1475-1489 5205 47. Seldin, D. C., Adelman, S., Austen, K. F., Stevens, R. L., Hein,

36. KO, L. J., Yamamoto, M., Leonard, M. W., George, K. M., Ting, A., Caulfield, J. P., and Woodbury, R. G. (1985) Proc. Natl. P., and Engel, J. D. (1991) Mol. Cell. Biol. 11, 2778-2784 Acad. Sci. U. S . A . 82, 3871-3875

37. Spiegelman, B. M., Frank, M., and Green, H. (1983) J. Biol. 48. Dunn, T. B., and Potter, M. (1957) J . Natl. Cancer Inst. 18, 587- Chem. 258, 10083-10089 601