Q1

BRES : 44099 Model7 pp:� 128ðcol:fig: : NILÞ

121122123124125126127128129130131132133134135136137138139140141142143144145146147148149150151152153154155156157158159160161162163164165166167168169170171172173174175176177178179180

181

Available online at www.sciencedirect.com 182183184185186 www.elsevier.com/locate/brainres

b r a i n r e s e a r c h ] ( ] ] ] ] ) ] ] ] – ] ] ]

http://dx.doi.org/100006-8993/& 2015 Pu

nCorresponding annCorresponding auE-mail addresseURL: http://listo1Equal contribut

Please cite this arprotein-deficient

187188189

Research Report 190191192193194

Transcriptional upregulation of myelin componentsin spontaneous myelin basic protein-deficient mice

195196197198199200201202203204205206207208209

Kim A. Staatsa,b, Diana Pombala,b, Susann Schonefeldta,b,Lawrence Van Helleputtec,d, Herve Maurine, Tom Dresselaersf,Kristof Govaertsf, Uwe Himmelreichf, Fred Van Leuvene,Ludo Van Den Boschc,d, James Dooleya,b,Stephanie Humblet-Barona,b,n,1, Adrian Listona,b,nn,1

aAutoimmune Genetics Laboratory, VIB, Leuven, BelgiumbDepartment of Microbiology and Immunology, University of Leuven, Leuven, BelgiumcLaboratory of Neurobiology and Leuven Research Institute for Neuroscience and Disease (LIND),KU Leuven, Leuven, BelgiumdVIB Vesalius Research Center, VIB, Leuven, BelgiumeExperimental Genetics Group LEGTEGG, University of Leuven, Leuven, BelgiumfBiomedical MRI, Department of Imaging and Pathology, University of Leuven, Leuven, Belgium

210211

2213214

a r t i c l e i n f o

Article history:

215 Accepted 12 February 2015

Myelin is essential for efficient signal transduction in the nervous system comprising of

multiple proteins. The intricacies of the regulation of the formation of myelin, and its

216217218219220221222223

Keywords:

Myelin basic protein

Myelin

Oligodendrocytes

Knockout

Connectivity

Murine MRI

224225226227228229230231

.1016/j.brainres.2015.02.02blished by Elsevier B.V.

uthor at: VIB and Univerthor. Fax: þ32 163 30591.s: stephanie.humbletbarn.vib.be (A. Liston).ing authors.

ticle as: Staats, K.A., etmice. Brain Research (

a b s t r a c t

components, are not fully understood. Here, we describe the characterization of a novel

myelin basic protein (Mbp) mutant mouse, mbpjive, which spontaneously occurred in our

mouse colony. These mice displayed the onset of a shaking gait before 3 weeks of age and

seizure onset before 2 months of age. Due to a progressive increase of seizure intensity,

mbpjive mice experienced premature lethality at around 3 months of age. Mbp mRNA

transcript or protein was undetectable and, accordingly, genetic analysis demonstrated a

homozygous loss of exons 3 to 6 of Mbp. Peripheral nerve conductance was mostly

unimpaired. Additionally, we observed grave structural changes in white matter predo-

minant structures were detected by T1, T2 and diffusion weighted magnetic resonance

imaging. We additionally observed that Mbp-deficiency results in an upregulation of Qkl,

Mag and Cnp, suggestive of a regulatory feedback mechanism whereby compensatory

increases in Qkl have downstream effects on Mag and Cnp. Further research will clarify the

role and specifications of this myelin feedback loop, as well as determine its potential role

in therapeutic strategies for demyelinating disorders.

& 2015 Published by Elsevier B.V.

222222222

1

sity of Leuven, Leuven, Belgium.

on@med.kuleuven.be (S. Humblet-Baron), adrian.liston@vib.be (A. Liston).

al., Transcriptional upregulation of myelin components in spontaneous myelin basic2015), http://dx.doi.org/10.1016/j.brainres.2015.02.021

12

323334353637383940

BRES : 44099

241242243244245246247248249250251252253254255256257258259260261262263264265266267268269270271272273274275276277278279280281282283284285286287288289290291292293294295296297298299300

b r a i n r e s e a r c h ] ( ] ] ] ] ) ] ] ] – ] ] ]2

301302303304305306307308309310311312313314315316317318319320321322323324325326327328329

1. Introduction

The myelin sheath is an insulating layer covering the axon ofneurons, which is essential for efficient signal transduction inthe nervous system. This white matter sheath is produced byeither oligodendrocytes in the central nervous system or bySchwann cells in the peripheral nervous system. Recent workhas shown that the intricacies of myelin formation allow forcomplex networks in the mammalian brain (Fields, 2014;Tomassy et al., 2014).

Myelin is constituted by a complex mixture of proteins,lipids and small molecules (such as cholesterol), with a differentcomposition in the central versus peripheral nervous system. Inthe central nervous system, proteolipid protein (PLP) andmyelin basic protein (MBP) are the most abundant proteins inmyelin. MBP has been described as the ‘executive molecule ofmyelin’, as it is the only component of myelin that appearsessential for myelin function (reviewed in Boggs, 2006).

Defects in myelin have been associated with a varietyof complex neurological disorders such as schizophrenia andbipolar disorder (Yu et al., 2014), but also alcoholism (Leveyet al., 2014). In schizophrenia a loss of white matter is describedas one of the earliest measurable effects and genetic poly-morphisms in MBP are associated with the disease (reviewed inRoussos and Haroutunian, 2014). A number of spontaneousmutant rodents have been discovered with mutations affectingmyelin components. The effect of such mutations vary widely:from lethal in the Long Evans shaker rat (Carre et al., 2002) and

Fig. 1 – Characterization of mbpjive mice. (A) Kaplan–Meier curveseizures of the mice (n¼8) and the survival of the mice (n¼16).(right) mice at 4 weeks of age (n¼5, 7), 5 weeks of age (n¼7, 8) andmice (n¼6, 12, n¼6, 13 and n¼3, 11, respectively). (C) Locomoto6 min. The pink line denotes the route of gait and the mouse en(F) mobility during 6 min by wildtype mice (n¼5) and mbpjive mic**po0.01, ***po0.001. (For interpretation of the references to colorof this article.)

Please cite this article as: Staats, K.A., et al., Transcriptional upreprotein-deficient mice. Brain Research (2015), http://dx.doi.org/1

the shiverer mouse (Chernoff, 1981), because of large scalehypomyelination, to mice that do not display a dysmyelinatingphenotype despite lacking PLP. Here we discovered and char-acterized a novel spontaneous mbp-deficient mouse strain andprovide evidence for a compensation feedback loop from Mbpto Mag (myelin-associated glycoprotein) and Cnp (cyclic nucleo-tide phosphodiesterase).

2. Results

2.1. Discovery of a spontaneous mutant mouse strainwith neurological manifestations

During routine breeding a severe shaking phenotype wasobserved in young C57BL/6 mice of common descent, denoted“jive” mice after their jive dance-like gait. Further breedingof the parents of such mice resulted in �25% of the micemanifesting this phenotype, suggestive of a spontaneousrecessive mutation. The jive mice, retrospectively identifiedas “mbpjive”, developed the shaking phenotype before weaningat 3 weeks of age (Fig. 1A). This phenotype was followed bysilent seizures around 50 days of age, progressing into tonicseizures and premature death around 75 days of age (Fig. 1A).The shaking phenotype occurred upon locomotion (Supple-mental video 1) and the seizures upon external stimuli suchas cage opening and researcher interference in the cage(Supplemental video 1). Mbpjive mice also display decr-

330331332333334335336337338339340341342343344345346347348349350351352353354355356357

for the onset of shaking of the mice (n¼16), the onset of(B) Weight measurements of mbpjive female (left) and male8 weeks of age (n¼6, 8) compared to these ages for wildtype

r tracking of a wildtype mouse and (D) mbpjive mouse overd point is shown in black. (E) Average distance moved ande (n¼5; unpaired t-test). Mean7standard deviation. *po0.05,in this figure legend, the reader is referred to the web version

gulation of myelin components in spontaneous myelin basic0.1016/j.brainres.2015.02.021

BRES : 44099

358359360361362363364365366367368369370371372373374375376377378379380381382383384385386387388389390391392393394395396397398399400401402403404405406407408409410411412413414415416417

418419420421422423424425426427428429430

b r a i n r e s e a r c h ] ( ] ] ] ] ) ] ] ] – ] ] ] 3

eased absolute body weight at young ages (Fig. 1B). We ass-essed the mice at approximately 50 days of age with the6-min open field test. The gait of wildtype (Fig. 1C) and mbpjive

mice (Fig. 1D) was distinctly different, with less locomotionof the mbpjive mice (Fig. 1E) despite similar mobility (Fig. 1F)and time spent in the different areas of the open field(Supplemental Fig. 1).

2.2. Spontaneous loss-of-function mutation caused bydeletion of exons 3–6 of Mbp

Due to the similarities of the jive phenotype to other mousestrains with spontaneous (Roach et al., 1985) or designed

Fig. 2 – Genomic deletion of exons 3–6 in mbpjive mice. The brainMbp expression using qPCR assays spanning (A) exons 1–3 and (tubulin loading control (bottom) on the brains of adult jive and wpresence of each exon and 4 intronic segments in Mbp. (E) PreseMean7standard deviation. *po0.05.

Please cite this article as: Staats, K.A., et al., Transcriptional upreprotein-deficient mice. Brain Research (2015), http://dx.doi.org/1

(Akowitz et al., 1987) deficiencies in Mbp, we investigated thepotential for the jive phenotype to be caused by a Mbp mutation.Relative gene expression measurements did not detect any Mbptranscript in jive mice when testing 2 different qPCR assaysspanning alternative exons (Fig. 2A and B). This loss of mbpmRNA resulted in complete Mbp protein deficiency, as demon-strated byWestern blot analysis of brain tissue of adult wildtypeandmbpjive mice (Fig. 2C). For the loading control tubulin and fullblot images, please see Supplemental Fig. 2A and B. Genotypingfor previously described Mbp mutations ruled out knownmutations, so we assessed each exon of the Mbp gene for theirpresence in thembpjive genome (strategy depicted in Fig. 2D). Theresult of this exon testing was the discovery that exons 3 to 6 of

431432433434435436437438439440441442443444445446447448449450451452453454455456457458459460461462463464465466467468469470471472473474475476477

and spinal cord of jive and wildtype mice were assessed forB) exons 9–10 (n¼3/group). (C) Western blot of Mbp (top) andildtype mice. (D) Deletion detection strategy for assessing thence of gene segment in wildtype (WT) and mbpjive mice (M).

gulation of myelin components in spontaneous myelin basic0.1016/j.brainres.2015.02.021

BRES : 44099

478479480481482483484485486487488489490491492493494495496497498499500501502503504505506507508509510511512513514515516517518519520521522523524525526527528529530531532533534535536537

538539540541542543544545546547548549550551552553554555556557558559560561562563564565566567568

b r a i n r e s e a r c h ] ( ] ] ] ] ) ] ] ] – ] ] ]4

the Mbp gene were homozygously deleted (Fig. 2E). As we wereunable to bridge the deleted junction with extensive efforts, wesuspect that this genetic variation may include a translocationor inversion. Retrospective genotyping of all previous jive miceand wildtype siblings demonstrated 100% concordance of theMbp exon 3–6 deletion with the jive phenotype, confirming theidentification of a novel Mbp mutant mouse strain.

2.3. Mbpjive mice maintain normal peripheral neurologicalresponses despite altered structure of the central nervoussystem

To fully characterize the effects of the jive phenotype in mbpjive

mice, we performed nerve conductance measurements oversciatic nerve and the dorsal caudal nerve to assess integrityand functionality of the peripheral nervous system. Measure-ments of sensory nerve action potential (SNAP) only showed aslight decrease of the latencies at 8 weeks (Fig. 3A), while theshaking phenotype was present from 3 weeks of age on. SNAPamplitude, compound muscle action potential (CMAP) latencyand CMAP amplitude measurements (Fig. 3B–D) all showedno differences between the shaking mice and wildtype age-matched controls at three different time points following theonset of shaking.

To assess the effect of the mbpjive mutation on the centralnervous system T2-weighted imaging and T2 relaxometry wasperformed (Fig. 4A). Here, we discovered an increase in the T2-weighted contrast and a significant increase in the T2 relaxa-tion times for the corpus callosum in mbpjive mice (Fig. 4B), butnot in the more prominent grey matter structures such as thecortex and hippocampus (Fig. 4C and D). Contrast changes were

Fig. 3 – Unaltered nerve conductance in mbpjive mice. (A) Sensory(C) compound muscle action potential (CMAP) latency and (D) Cmice at 4, 5 and 8 weeks of age over the musculus gastrocnemmultiple testing). Mean7standard deviation. *po0.05.

Please cite this article as: Staats, K.A., et al., Transcriptional upreprotein-deficient mice. Brain Research (2015), http://dx.doi.org/1

also apparent on T1-weighted images in the corpus callosumand cerebellum. Finally, diffusion tensor imaging further sup-ported the white matter alterations through significant changesin fractional anisotropy and radial diffusivity (see supplemen-tary methods). The lack of differences in the grey matter inthese mice is in accordance with the relative gene expressionresults for (motor) neuronal markers in brain and spinal cord,which showed no striking decrease of (motor) neuronal geneexpression (Supplemental Fig. 3A and B). Together, these resultsimplicate defects in the white matter of the central nervoussystem as the origin of the neurological manifestations of thembpjive phenotype.

2.4. Myelin basic protein deficiency may drive atranscriptional feedback loop inducing compensatory geneexpression of other myelin components

To assess the role of mbp-deficiency on the regulation of myelinproduction, we investigated the expression of additional myelincomponents in mbpjive mice. Multiple myelin components (Plp1,Pmp22, Mpz) showed no alteration in expression in either thebrain or spinal cord between wildtype andmbpjive mice (Fig. 5A–C).However, the gene expression of two prominent components ofmyelin, Mag and Cnp, were substantially upregulated in mbpjive

(Fig. 5C and D), suggesting that a compensatory feedback loopwasinduced by Mbp-deficiency. As mbp, mag and cnp are all regulatedby the RNA-binding regulator QkI (reviewed in Zearfoss et al.,2008), we investigated expression of Qkl in the mbpjive mice. Wefound increased gene expression in both the spinal cord and brainof mbpjive mice (Fig. 5F), proportional to the increase observed inMag and Cnp. This implies the presence of the feedback loop to

569570571572573574575576577578579580581582583584585586587588589590591592593594595596597

nerve action potential (SNAP) latency, (B) SNAP amplitude,MAP amplitude measurements of wildtype mice and mbpjive

ius (n¼5/group; t-test with Sidak–Bonferroni correction for

gulation of myelin components in spontaneous myelin basic0.1016/j.brainres.2015.02.021

BRES : 44099

598599600601602603604605606607608609610611612613614615616617618619620621622623624625626627628629630631632633634635636637638639640641642643644645646647648649650651652653654655656657

658659660661662663664665666667668669670671672673674675676677678679680681682683684

Fig. 4 – Altered white matter structures in mbpjive mouse brains. (A) Representative magnetic resonance images of the brain ofwildtype and mbpjive mice at 45 days and 65 days. Arrows indicate an increase in signal intensity in the area of corpuscollosum on T2-weighted images. (B) Spin–spin relaxation time (T2) of the corpus callosum, (C) cortex, (D) hippocampus, ofwildtype mice and mbpjive at 45 days (n¼2, 3) and 65 days (n¼3, 3) (unpaired t-tests). Mean7standard deviation. npo0.05,nnpo0.01.

b r a i n r e s e a r c h ] ( ] ] ] ] ) ] ] ] – ] ] ] 5

regulate the relative proportions of mbp, mag and cnp, viasuppressive feedback of mbp on qkl expression.

685686687688689690691692693694695696697698699700701702703704705706707708709710711712713714715716717

3. Discussion

Mbp is a very abundant component of central nervous systemmyelin (Jacobs, 2005). Here, we describe a novel spontaneous Mbpmutation, which resulted in severe neurological defects andpremature death. The phenotype of mbpjive mice is similar to thatof other mbp-deficient mice previously described. Both shiverer(Chernoff, 1981) and myelin-deficient (shimld/shimld) (Doolittle andSchweikart, 1977) mice display young onset of tremors, seizuresand premature death, although the shimld/shimld mice have amilder phenotype. The severity of the phenotype in these miceis in accordance with the level of mbp deficiency. Mbp-deficiencyis pathogenic due to the combination of impairedmyelin functionand the loss of thembp function in promoting neuritogenesis andcell survival (Lutz et al., 2014). The timing of the onset ofsymptoms in the mbpjive mice and other mbp-deficient micedescribed above coincides with the timing ofmbp gene expressionin the central nervous system (Jacobs et al., 2005; Novak et al.,2013). The MRI signature based on the T1 and T2 contrast changesand the diffusion alterations noted correspond also closely towhat has been previously reported in shiverer mice (Song et al.,2002; Nair et al., 2005; Ou et al., 2009). In particular the significantlyincreased radial diffusivity observed here has been associatedwith demyelineation the shiverer mice and therefore suggestssimilar degradation in the mbpjive mice. Notably, mbp has moreimportant functions in the central nervous system then theperipheral nervous system (Boggs, 2006), corresponding with thephenotype we observed in mbpjive mice.

The serendipitous discovery of a novel Mbp mutant mouseallowed us to observe a potential component of the regulatorynetwork controlling myelin protein components. Qkl has been

Please cite this article as: Staats, K.A., et al., Transcriptional upreprotein-deficient mice. Brain Research (2015), http://dx.doi.org/1

described as a key regulatory mechanism controlling theexpression of Mbp (Li et al., 2000), Mag (Inuzuka et al., 1987;Bo et al., 1995) and Cnp (Inuzuka et al., 1987). Here,we observed that Mbp-deficiency resulted in an upregulation ofQkl, Mag and Cnp, suggestive of a regulatory feedback mechan-ism whereby compensatory increases in Qkl have downstreameffects on Mag and Cnp. Interestingly, an increase of QkI geneexpression is not observed in jimpy myelin synthesis deficiencymice (jpmsd mutation also inducing severe hypomyelination) (Luet al., 2003), and other myelin components tested here were notupregulated by mbp-deficiency. This implies a potential closedfeedback loop in the central nervous system between Mbp andQkI regulating Cnp and Mag, but not regulating other myelincomponents. Varying gene expression of Mbp may be efficientlycounteracted to maintain myelin integrity by such a feedbackloop, although this is not sufficient in the complete absence ofMbp. Additionally, transferrin (Tf) may be a (co-)regulator of thisprocess, as it has been shown to regulate the gene expression ofa number of myelin components in the rat striatum (Novak et al.,2013). This feedback loop may be altered in the peripheralnervous system, where the role of Mbp is not as essential(Martini et al., 1995; Smith-Slatas and Barbarese, 2000). Furtherresearch will clarify the role and specifics of this myelin feedbackloop, as well as determine its potential role in therapeuticstrategies for demyelinating disorders.

4. Experimental procedure

4.1. Animal studies

Mbpjive mice arose as a spontaneous mutation in our C57BL/6breeding colony, and weremaintained by heterozygous breeding.Chow and water were provided ad libitum and mice werehoused in the specific pathogen free animal facility of KU

gulation of myelin components in spontaneous myelin basic0.1016/j.brainres.2015.02.021

BRES : 44099

718719720721722723724725726727728729730731732733734735736737738739740741742743744745746747748749750751752753754755756757758759760761762763764765766767768769770771772773774775776777

778779780781782783784785786787788789790791792793794795796797798799800801802803804805806807808809810811812813814815816817818819820

Fig. 5 – Altered expression of multiple myelin components in the central nervous system of mbpjive mice. Relative geneexpression in the spinal cord and brain of wildtype and mbpjive mice was assessed for (A) Plp1, (B) Pmp22, (C) Mpz, (D) Mag,(E) Cnp and (F) QkI (n¼3/group; unpaired t-tests). Values are normalized separately for the wildtype group per tissue type to 1.Mean7standard deviation. *po0.05, **po0.01, ***po0.001.

b r a i n r e s e a r c h ] ( ] ] ] ] ) ] ] ] – ] ] ]6

Leuven, with a standard light/dark cycle and under standardconditions according to the guidelines of the KU Leuven. Micewere assessed daily. No adverse health problems were observedin themutant animals; they appeared well groomed, except theirstriking phenotype. To facilitate food intake for themice with theshaking gait, food pellets are provided on the cage floor. Humaneendpoints included poor grooming or a 20% decrease of bodyweight, but these were not observed. Euthanasia of miceoccurred by carbon dioxide inhalant. 16 mice were included inthe survival study. All experiments were carried out in accor-dance with the EU Directive 2010/63/EU on the protection ofanimals used for scientific purposes, as well as with the approvalof the Animal Ethics Committee of KU Leuven (P119/2013 andP185/2012) and every effort was made to minimize suffering.

821822823824825826827828829830831832833834835836837

4.2. Locomotor tracking analysis

The open-field task was performed as previously described(Terwel et al., 2008; Maurin et al., 2013). Briefly, mice wereplaced in a corner of a perspex box (52�52�40 cm) withblack walls and translucent floor, dimly illuminated fromunderneath. The activity of individual mice, over a 6 minobservation period, was video-recorded and analyzed usingdedicated software (EthoVisionXT 7.0; Noldus, Wageningen,The Netherlands). Automated analysis allowed analysis ofthe following parameters: (i) time spent in defined areas ofthe open field (periphery, center, corners), (ii) total distancemoved, (iii) relative time of mobility (Terwel et al., 2008;Maurin et al., 2013).

Please cite this article as: Staats, K.A., et al., Transcriptional upreprotein-deficient mice. Brain Research (2015), http://dx.doi.org/1

4.3. Nerve conductance analysis

Mice were anaesthetized under a continuous flow of 1.5–2%isoflurane carried in oxygen and placed on a heating padduring the measurements to maintain body temperature.Nerve conduction studies were performed using sub-dermalneedle electrodes (Technomed Europe, The Netherlands) anda Medelec EMG monitor with integrated software (MedelecVickers/Modul USA, Brooksville, USA). Sensory nerve actionpotentials (SNAPs) were recorded in the dorsal caudal nerveby stimulating at the base of the tail and recording theresponse 4 cm more distally. For the compound muscleaction potentials (CMAPs), stimulation was performed at thesciatic notch and the response was measured at the gastro-cnemius muscle. An average of 3 measurements was calcu-lated for each mouse.

4.4. Quantitative PCR

Isolation of mRNA was performed by the TriPure (Roche,Basel, Switzerland) method and the RNeasy kit (Qiagen,Venlo, The Netherlands). Reverse transcriptase PCR usedrandom hexamers (Life Technologies, Carlsbad, USA) andMoloney Murine Leukaemia Virus Reverse Transcriptase(MMLV RT; Invitrogen, Carlsbad, USA). Quantitative PCR wasperformed with the StepOnePlus (Life Technologies) andTaqMan Universal PCR Master Mix (Life Technologies). Geneexpression assays were purchased from Life Technologiesand IDT DNA (Coralville, USA). Relative gene expression wascalculated with the ddCT method and the data presented is

gulation of myelin components in spontaneous myelin basic0.1016/j.brainres.2015.02.021

BRES : 44099

838839840841842843844845846847848849850851852853854855856857858859860861862863864865866867868869870871872873874875876877878879880881882883884885886887888889890891892893894895896897

898899

b r a i n r e s e a r c h ] ( ] ] ] ] ) ] ] ] – ] ] ] 7

the average when normalizing against 3 housekeeping genes(Actb, Gapdh and Hprt).

900901902903904905906907908909910911912913914915916917918919920921922923

4.5. Western blot

Tissues were homogenized in RIPA buffer complementedwith a protease inhibitor cocktail (Roche, Basel, Swiss) usingLysing Matrix D beads (MP biomedicals, Santa Ana, USA) anda MagNA Lyser instrument (Roche, Basel, Swiss). Proteinconcentrations were determined by use of the Micro BCA kit(Thermo Fisher Scientific Inc., Waltham, USA) according tothe manufacturer’s instructions. 60 mg of protein sampleswere diluted in 20% sample buffer, boiled for 10 min at95 1C, loaded on a fresh 15% Tris-Glycine gel and then blottedon Immonbilon-P transfer membrane (Millipore, Billerica,USA). Membranes were blocked with 5% Bovine SerumAlbumin for 1 h at room temperature. The following primaryantibodies were used: goat anti-MBP (1:500, Santa Cruz (sc-13914), Dallas, USA) and mouse anti-α-tubulin (1:10,000,Sigma (T6199), St. Louis, USA). ECF substrate (GE Healthcare,Little Chalfont, UK) was used to generate the fluorescencesignal, which was detected with a LAS 4000 Image Analyser(GE Healthcare, Little Chalfont, UK). Intensities were analyzedwith ImageQuant TL software (GE Healthcare, Little Chalfont,UK). Signal intensities were normalized to α-tubulin expres-sion to correct for unequal loading.

Q2

924925926927928929930931932933934935936937938939940941942943944945946947948949950951952953954

4.6. Magnetic resonance imaging

MR images were acquired using a 9.4 T Biospec small animalMR system (Bruker Biospin, Ettlingen, Germany) equippedwith a 117 mm inner diameter actively shielded gradient setof 600 mT m�1 using a 7 cm linearly polarized resonator fortransmission and an actively-decoupled dedicated mousebrain surface coil for receiving (Rapid Biomedical, Rimpar,Germany). To determine the presence of white mater altera-tions anatomical T1 and T2-weighted imaging and diffusiontensor imaging was performed. For T2 relaxometry thefollowing parameters were used: repetition time (TR) 2.9 s,10 evenly spaced echo times (TE) from 12 to 120 ms, 256�256matrix, 2.5�2.5 cm field-of-view (FOV), 13 0.6 mm thick sliceswith an interslice distance of 0.72 mm) with data processingin Paravision 5.1 (Bruker). T1-weighted images were obtainedusing a 3-dimensional inversion prepared fast low angle shotmethod with parameters: TR 3.5 s, TE 3.3 ms, 6 segments, aninversion time of 1075 ms, flip angle of 201 and 2 averages.Scan parameters for the diffusion tensor imaging (DTI) were:(TR 1.0 s, TE 27.9 ms, single shot echo planar readout, FOV2.0�1.5�2.0, 30 isotropically distributed diffusion directions,b-value of 2500 s/mm2, a gradient duration of 5 ms andseparation of 12 ms with a matrix of 96�72�32 applyingzerofilling and partial FT acceleration resulting in a resolutionof 156�156�312 μm and a 20 min acquisition time. For DTIprocessing, first an eddy current correction was applied usingthe FSL module (Jenkinson et al., 2012) followed by an in-house developed Python (PSF, Beaverton, USA) script

Please cite this article as: Staats, K.A., et al., Transcriptional upreprotein-deficient mice. Brain Research (2015), http://dx.doi.org/1

incorporating the Dipy toolkit (Garyfallidis et al., 2014) andusing the standard diffusion tensor model. Regions weremanually delineated based on T2 or diffusion weightedcontrast.

4.7. Genetic variation analysis

The confirmation of the deletion and determination of its lengthwas preformed by amplifying several regions of the Mbp-1 gene.First, primers were designed to target several Mbp-1 exons in orderto roughly determine the location and extent of the deletion. Next,primers were designed to flank the deletion to determine itslocation and lengthwithmore precision. The amplification reactionwas performed using the GoTaqs Flexi DNA Polymerase (Promega)and specific reverse and forward primers (IDT). Per reaction of 25 mLwas used 1�Green GoTaqs Flexi buffer, 2mM MgCl2, 0.2mMdNTPs (Thermo Scientific), 0,4 mM Primers, 1,25U GoTaqs DNAPolymerase. Primers used for this analysis are: Exon 1 (ampliconlength 364 bp): GCGCGTTTACCTGCTTTC & CCCTTCTTTCGGCTCTCAA; Exon 2 (amplicon length 221 bp): TCAAAGCCCTCCAGAAG-TATT & CCATTCAGGAACTGTCCTTGTTA; Intron 2–3 A (ampliconlength 186 bp): CAAAGTAAGAGCAGCCCAGGTGG & GGGCTTCTACCCCACCTTAG; Intron 2–3 B (amplicon length 165 bp): GGCACT-GAGAGCTTTGAGGGTAG& CACCCAGTGATGCTTTGTTGTGG; Exon3 (amplicon length 294 bp): CTACGGCAGAGCAAAGGAG & CCCAGGCCTCTGAAATACAA; Exon 4 (amplicon length 522 bp): CGTA-CAGGCCCACATTCATAT & CTCTCCTTCCTTTCCGCATTTA; Exon 5(amplicon length 388 bp): CTGGCAAACTGGTGGTTATG & GAGAAGGATCCATGGAGGTTAG; Exon 6 (amplicon length 263 bp): CTTCTGATGCCTGGTAGATTGG & CCTTGAGCCCAGTTCCATTT; Intron6–7 A (amplicon length 450 bp): GGAGGGAATGGGGTGGTTGTATC& GCCAGGATCGACACTGATGAGC & Intron 6–7 B (amplicon length291 bp): TGATGGCAGATGAGACTTGC & GGATGACACATGCCACA-GAGCC; Exon 7 (amplicon length 596 bp): CGACACCTCCTTATCCCTCTA & ACATCACCTCTACTCCATCTTC.

4.8. Statistical analysis

Analyses were performed with the statistical software pack-age Prism Origin version 6 (GraphPad Software, La Jolla, USA).Survival and disease onset were analyzed by Log–Rank test-ing. Differences over 2 groups with comparable variance wereanalyzed by Student’s t-test. Significance was assumed atpo0.05. Data are presented as mean7standard deviation.

Acknowledgments

We thank Nancy Florenty, Jeason Haughton and Benoit Lechatfor technical support and Roel Ophoff for supportive assistance.Stephanie Humblet-Baron is supported by an FWO post-doctoral fellowship. This research was supported by the VIB.Kristof Govaerts is supported by a doctoral mandate of theResearch Foundation Flanders (FWO aspirant).

955956957

gulation of myelin components in spontaneous myelin basic0.1016/j.brainres.2015.02.021

BRES : 44099

958959960961962963964965966967968969970971972973974975976977978979980981982983984985986987988989990991992993994995996997998999

1000100110021003100410051006100710081009101010111012

101310141015101610171018

b r a i n r e s e a r c h ] ( ] ] ] ] ) ] ] ] – ] ] ]8

Appendix A. Supporting information

Supplementary data associated with this article can be foundin the online version at http://dx.doi.org/10.1016/j.brainres.2015.02.021.

10191020102110221023102410251026102710281029103010311032103310341035103610371038103910401041104210431044104510461047104810491050105110521053105410551056105710581059106010611062106310641065

r e f e r e n c e s

Akowitz, A.A., Barbarese, E., Scheld, K., Carson, J.H., 1987.Structure and expression of myelin basic protein genesequences in the mld mutant mouse: reiteration andrearrangement of the MBP gene. Genetics 116, 447–464.

Bo, L., Quarles, R.H., Fujita, N., Bartoszewicz, Z., Sato, S., Trapp, B.D.,1995. Endocytic depletion of L-MAG from CNSmyelin in quakingmice. J. Cell Biol. 131, 1811–1820.

Boggs, J.M., 2006. Myelin basic protein: a multifunctional protein.Cell. Mol. Life Sci.: CMLS 63, 1945–1961.

Carre, J.L., Goetz, B.D., O’Connor, L.T., Bremer, Q., Duncan, I.D.,2002. Mutations in the rat myelin basic protein gene areassociated with specific alterations in other myelin geneexpression. Neurosci. Lett. 330, 17–20.

Chernoff, G.F., 1981. Shiverer: an autosomal recessive mutantmouse with myelin deficiency. J. Hered. 72, 128.

Doolittle, D.P., Schweikart, K.M., 1977. Myelin deficient, a newneurological mutant in the mouse. J. Hered. 68, 331–332.

Fields, R.D., 2014. Neuroscience. Myelin—more than insulation.Science 344, 264–266.

Garyfallidis, E., Brett, M., Amirbekian, B., Rokem, A., van derWalt, S.,Descoteaux, M., Nimmo-Smith, I., Dipy, C., 2014. Dipy, a libraryfor the analysis of diffusion MRI data. Front. Neuroinform. 8, 8.

Inuzuka, T., Johnson, D., Quarles, R.H., 1987. Myelin-associatedglycoprotein in the central and peripheral nervous system ofquaking mice. J. Neurochem. 49, 597–602.

Jacobs, E.C., 2005. Genetic alterations in the mouse myelin basicproteins result in a range of dysmyelinating disorders.J. Neurol. Sci. 228, 195–197.

Jacobs, E.C., Pribyl, T.M., Feng, J.M., Kampf, K., Spreur, V.,Campagnoni, C., Colwell, C.S., Reyes, S.D., Martin, M., Handley, V.,Hiltner, T.D., Readhead, C., Jacobs, R.E., Messing, A., Fisher, R.S.,Campagnoni, A.T., 2005. Region-specific myelin pathology inmicelacking the golli products of the myelin basic protein gene. theofficial journal of the Society for NeuroscienceJ. Neurosci. 25,7004–7013.

Jenkinson, M., Beckmann, C.F., Behrens, T.E., Woolrich, M.W.,Smith, S.M., 2012. Fsl. NeuroImage 62, 782–790.

Levey, D.F., Le-Niculescu, H., Frank, J., Ayalew, M., Jain, N., Kirlin, B.,Learman, R., Winiger, E., Rodd, Z., Shekhar, A., Schork, N.,Kiefe, F., Wodarz, N., Muller-Myhsok, B., Dahmen, N.,Consortium, G., Nothen, M., Sherva, R., Farrer, L., Smith, A.H.,Kranzler, H.R., Rietschel, M., Gelernter, J., Niculescu, A.B., 2014.Genetic risk prediction and neurobiological understanding ofalcoholism. Transl. Psychiatry 4, e391.

Li, Z., Zhang, Y., Li, D., Feng, Y., 2000. Destabilization andmislocalization of myelin basic protein mRNAs in quakingdysmyelination lacking the QKI RNA-binding proteins. theofficial journal of the Society for NeuroscienceJ. Neurosci. 20,4944–4953.

Please cite this article as: Staats, K.A., et al., Transcriptional upreprotein-deficient mice. Brain Research (2015), http://dx.doi.org/1

Lu, Z., Zhang, Y., Ku, L., Wang, H., Ahmadian, A., Feng, Y., 2003.The quakingviable mutation affects qkI mRNA expressionspecifically in myelin-producing cells of the nervous system.Nucleic Acids Res. 31, 4616–4624.

Lutz, D., Loers, G., Kleene, R., Oezen, I., Kataria, H.,Katagihallimath, N., Braren, I., Harauz, G., Schachner, M.,2014. Myelin basic protein cleaves cell adhesion molecule l1and promotes neuritogenesis and cell survival. J. Biol. Chem.289, 13503–13518.

Martini, R., Mohajeri, M.H., Kasper, S., Giese, K.P., Schachner, M.,1995. Mice doubly deficient in the genes for P0 and myelinbasic protein show that both proteins contribute to theformation of the major dense line in peripheral nerve myelin.the official journal of the Society for NeuroscienceJ. Neurosci.15, 4488–4495.

Maurin, H., Lechat, B., Dewachter, I., Ris, L., Louis, J.V., Borghgraef, P.,Devijver, H., Jaworski, T., Van Leuven, F., 2013. Neurologicalcharacterization of mice deficient in GSK3alpha highlightpleiotropic physiological functions in cognition and pathologicalactivity as Tau kinase. Mol. Brain 6, 27.

Nair, G., Tanahashi, Y., Low, H.P., Billings-Gagliardi, S., Schwartz, W.J.,Duong, T.Q., 2005. Myelination and long diffusion times alterdiffusion-tensor-imaging contrast in myelin-deficient shiverermice. NeuroImage 28, 165–174.

Novak, G., Fan, T., O’Dowd, B.F., George, S.R., 2013. Striataldevelopment involves a switch in gene expression networks,followed by a myelination event: implications forneuropsychiatric disease. Synapse 67, 179–188.

Ou, X., Sun, S.W., Liang, H.F., Song, S.K., Gochberg, D.F., 2009. TheMT pool size ratio and the DTI radial diffusivity may reflectthe myelination in shiverer and control mice. NMR Biomed.22, 480–487.

Roach, A., Takahashi, N., Pravtcheva, D., Ruddle, F., Hood, L., 1985.Chromosomal mapping of mouse myelin basic protein geneand structure and transcription of the partially deleted genein shiverer mutant mice. Cell 42, 149–155.

Roussos, P., Haroutunian, V., 2014. Schizophrenia: susceptibilitygenes and oligodendroglial and myelin related abnormalities.Front. Cell. Neurosci. 8, 5.

Smith-Slatas, C., Barbarese, E., 2000. Myelin basic protein genedosage effects in the PNS. Mol. Cell. Neurosci. 15, 343–354.

Song, S.K., Sun, S.W., Ramsbottom, M.J., Chang, C., Russell, J.,Cross, A.H., 2002. Dysmyelination revealed through MRI asincreased radial (but unchanged axial) diffusion of water.NeuroImage 17, 1429–1436.

Terwel, D., Muyllaert, D., Dewachter, I., Borghgraef, P., Croes, S.,Devijver, H., Van Leuven, F., 2008. Amyloid activates GSK-3betato aggravate neuronal tauopathy in bigenic mice. Am. J.Pathol. 172, 786–798.

Tomassy, G.S., Berger, D.R., Chen, H.H., Kasthuri, N., Hayworth, K.J.,Vercelli, A., Seung, H.S., Lichtman, J.W., Arlotta, P., 2014.Distinct profiles of myelin distribution along single axons ofpyramidal neurons in the neocortex. Science 344, 319–324.

Yu, H., Bi, W., Liu, C., Zhao, Y., Zhang, D., Yue, W., 2014. Ahypothesis-driven pathway analysis reveals myelin-relatedpathways that contribute to the risk of schizophrenia andbipolar disorder. Prog. Neuropsychopharmacol. Biol.Psychiatry 51, 140–145.

Zearfoss, N.R., Farley, B.M., Ryder, S.P., 2008. Post-transcriptionalregulation of myelin formation. Biochim. Biophys. Acta 1779,486–494.

1066

gulation of myelin components in spontaneous myelin basic0.1016/j.brainres.2015.02.021