lable at ScienceDirect

Plant Physiology and Biochemistry 49 (2011) 862e872

Contents lists avai

Plant Physiology and Biochemistry

journal homepage: www.elsevier .com/locate/plaphy

Research article

The changes in pectin metabolism in flax infected with Fusarium

Wioleta Wojtasik, Anna Kulma*, Kamil Kostyn, Jan SzopaFaculty of Biotechnology, University of Wroclaw, Przybyszewskiego 63/77, 51-148 Wroclaw, Poland

a r t i c l e i n f o

Article history:Received 20 September 2010Accepted 27 February 2011Available online 8 March 2011

Keywords:Flax resistanceFormate metabolismFusarium culmorumFusarium oxysporumPathogen infectionPectin metabolism

Abbreviations: FALDH, gluthatione-dependent foFDH, formate dehydrogenase; GAE, UDP-D-glucuronacturonic acid; HGA, homogalacturonan; PG, polygaplants overexpressing polygalacturonase; PME, pectinogalacturonase; RGA, rhamnogalacturonan; RHAexpressing rhamnogalacturonase; qRT-PCR, quantitatiRT-PCR, real-time PCR; SFGH, s-formylglutxylogalacturonan.* Corresponding author. Tel.: þ48 713756326; fax:

E-mail address: kulma@ibmb.uni.wroc.pl (A. Kulm

0981-9428/$ e see front matter � 2011 Elsevier Masdoi:10.1016/j.plaphy.2011.03.002

a b s t r a c t

Fusarium culmorum and Fusarium oxysporum are the most common fungal pathogens of flax (Linumusitatissimum L.), thus leading to the greatest losses in crop yield. A subtractive cDNA library was con-structed from flax seedlings exposed for two days to F. oxysporum. This revealed a set of genes that arepotentially involved in the flax defense responses. Two of those genes directly participate in cell wallsugar polymer metabolism: UDP-D-glucuronate 4-epimerase (GAE; EC 5.1.3.6) and formate dehydroge-nase (FDH; EC 1.2.1.2). GAE delivers the main substrate for pectin biosynthesis, and decreases weredetected in its mRNA level after Fusarium infection. FDH participates in the metabolism of formic acid,and the expression level of its gene increased after Fusarium infection. However, metabolite profilinganalysis disclosed that the pectin content in the infected plants remained unchanged, but that there werereductions in both the levels of the soluble sugars that serve as pectin precursors, and in the level offormic acid. Since formic acid is the product of pectin demethylesterification, the level of mRNAs codingfor pectin methylesterase (EC 3.1.1.11) in the infected flax was measured, revealing a decrease in itsexpression upon plant infection. Transgenic flax plants overexpressing fungal polygalacturonase (EC3.2.1.15) and rhamnogalacturonase (EC 3.2.1 .-) showed a decrease in the pectin content and an elevatedlevel of formic acid, but the level of expression of the FDH gene remained unchanged. It is suspected thatthe expression of the formate dehydrogenase gene is directly controlled by the pathogen in the earlystage of infection, and additionally by pectin degradation in the later stages.

� 2011 Elsevier Masson SAS. All rights reserved.

1. Introduction

Flax (Linum usitatissimum) is used in the food, chemical,cosmetics, pharmaceutical, and paper industries. Flax seeds havea fatty acid content of up to 45%, and most of these are unsaturated.They are also a valuable source of lignans, phytosterols, and vita-mins A and D. Flax oil is used for the treatment of many diseases,including respiratory system and gastrointestinal tract illnesses.Flax fibres are also valuable: in addition to cellulose, they, unlikecotton fibres, contain important antioxidant components.

The greatest losses in flax crops are caused by fungal diseases,which account for 20% of the production loss. Fusarium culmorum

rmaldehyde dehydrogenase;ate-4-epimerase; GalUA, gal-lacturonase; PGI, transgenicn methylesterase; RG, rham-, transgenic plants over-ve reverse transcription PCR;athione hydrolase; XGA,

þ48 713252930.a).

son SAS. All rights reserved.

and Fusarium oxysporum are soil-borne phytopathogenic fungalpathogens that cause the most severe and contagious infections offlax, such as seedling blight, foot rot, ear blight, stalk rot and rootrot. These pathogens infect plants through the roots, colonizingtissues causing necrosis, and weakening the vascular tissues [1e4].It is vital to identify and investigate the most important genesparticipating in the defense of flax plant against pathogens in orderto create transgenic plants resistant to various diseases.

The early stage of infection involves pectin degradation, leadingto the breakdown of the cell wall. The pectin are a structurallycomplex family of polysaccharides and components of all higherplant cell walls (up to 35% of the primary cell wall components).Pectin play a crucial role in plant growth, development, morpho-genesis, defense, cellecell adhesion, signaling, cell expansion, andin many other processes [5e7]. Pectin generally consists of fourpectin domains: homogalacturonan (HGA), rhamnogalacturonan I(RGI), rhamnogalacturonan II (RGII), and xylogalacturonan (XGA),with their galacturonic acids (GalUA) residues constituting up to70% of the overall structure [5,8]. Based on polysaccharidesconnections, pectin are divided into three groups: thewater solublefraction (WSF), CDTA soluble fraction (CSF) and Na2CO3 solublefraction (NSF). The WSF pectin are loosely associated with the cellwall, whereas the CSF and NSF fractions are enriched in ions and

W. Wojtasik et al. / Plant Physiology and Biochemistry 49 (2011) 862e872 863

covalently bound pectin, respectively. The changes in pectin solu-bilization occur in fruit ripening and also in other developmentalprocesses. During the pathogen infection (processes where enzymedegrading cell wall are involved) the loosening of the cell wallsstructure can be observed [9].

Pectin is synthesized in the Golgi vesicles, and a large number ofenzymes are involved in this process. Sugar units must be activatedby binding nucleotides, and then glycosyl residues are transferredto the non-reducing side of the polysaccharide acceptor by manydifferent glycosyltransfereses. The biosynthesis of pectin alsorequires acetyl-, methyl-, and feruloyltransferases. UDP-D-glucur-onate 4-epimerase (GAE) catalyses the interconversion of UDP-GlcUA and UDP-GalUA, delivering key activated sugar donors forpectin biosynthesis [10]. In the wall, the degree of methylester-ification (DM) of pectin is modified by pectin methylesterases,which catalyse a specific demethylesterification of HGA, releasingmethanol, protons and the remaining pectin with negativelycharged carboxyl groups [11,12]. Many physiological processes areregulated by changes in the degree of methylesterification of pectin[13]. Beside their role in remodeling the plant cell wall duringgrowth and development, PMEs participate in the defense mech-anism of plant against pathogens. It is important to note thatchanges in the degree of methylesterification of pectin influencethe susceptibility of plants to pathogens and other abiotic stresses.A lower DM contributes to the reduction of resistance of a plant topathogen infection by making the pectin susceptible to hydrolysisby pathogens’ cell wall-degrading proteins [13e17].

Methanol, which is released during the demethylesterificationof pectin by PMEs, is oxidized to formaldehyde by methanoloxidases. Due to its high degree of reactivity with proteins, nucleicacids and lipids, formaldehyde is a toxic compound that needs to beremoved quickly from the organism. Formaldehyde dehydrogenaseis responsible for processing the formaldehyde to s-for-mylglutathione, which serves as a substrate for s-formylgluthationehydrolase in a reaction producing formate [19,20]. Formate plays an

Fig. 1. The simplified pathway of pectin synthesis, degradation and formate metabolism. UDPdelivering precursors for the biosynthesis of pectin. Pectin methylesterase is responsible forpolygalacturonases and rhamnogalacturonases to degrade pectin. Methanol, a side product oCO2 by formate dehydrogenase or can be turned into amino acids, purines and organic acid

important role as a source of the C1 unit in higher plants underenvironmental conditions, but in excess, it can inhibit wateroxidation reaction on the donor side and electron transfer on theacceptor side of photosystem II [21]. The amount of formateincreases in response to stress and then serves as a substrate toproduce NADH to feed the respiratory chain. This suggests thatNAD-dependent formate dehydrogenase (FDH), which catalysesformate to carbon dioxide and reduces NADþ to NADH in themitochondria in higher plants, is regulated by various stresses suchas drought, chilling, hypoxia, darkness, wounding, and pathogeninfection. Under the influence of these stresses, the expression levelof the formate dehydrogenase gene is elevated. The rapid oxidationby FDH results from a toxic property of formate. In higher plants,formate can be utilized through oxidation to carbon dioxide byformate dehydrogenase or for the synthesis of amino acids (serine,methionine, glycine), purines, thymidylate and formylmethionyl-tRNA, which is involved in translation initiation, and vitamins(pantothenate) that are a part of C1 metabolism [22e24]. Previ-ously described pectin and formic acid metabolism is presented inthe form of the simplified pathway in Fig. 1.

In this study, we focused on the first step of the flax response tostress conditions for two reasons. First, we expected to be able ofidentifying genes involved in pectin metabolism, since pectin is thiscell wall constituent that is primarily attacked by pathogens, andsecond, because the levels of this compound affect flax fibre qualityduring the retting process. Therefore, from the subtractive library,weselected the genes that take part in pectin synthesis and formatemetabolism. The aim of this study was to determine the expressionlevels of the UDP-D-glucuronate 4-epimerase and formate dehydro-genase genes, and the contents of pectin and formate after treatmentwith Fusarium. The findings of the metabolite profiling via GCeMSanalysis included interesting data concerning the levels of aminoacids and sugars. Our research revealed changes in the expressionlevels of the selected genes and in the contents of importantmetabolites as a result of pathogen attacks on flax seedlings. The

-D-glucuronate-4-epimerase catalyses the interconversion of UDP-GalUA to UDP-GlcUAthe demethylesterification of pectin, and this makes it possible for other enzymes likef pectin demethylesterification, is converted into formate which can be transformed tos.

W. Wojtasik et al. / Plant Physiology and Biochemistry 49 (2011) 862e872864

obtained data was compared with the results of the analysis oftransgenic plants overexpressing fungal pectin-degrading enzymes.

2. Results

2.1. Fusarium culmorum and Fusarium oxysporum infection affectthe expression levels of genes involved in the defense mechanisms offlax seedlings

The subtractive cDNA library was developed to study genesassociated with Fusarium infection in flax seedlings. To identifyunique sequences represented in the library, 490 clones werescreened. Subtractive screening led to the isolation of 47 genes, theexpression levels of which were changed in comparison to thecontrol (Supplemental Table 1). To summarize, we identified genesthat produce enzymes, which participate in a range of biologicalpathways of both theprimaryand secondarymetabolisms, includingRubisco activase, glucose-6-phosphate dehydrogenase (G6PDH),xylulose-5-phosphate synthase and glyceraldehyde-3-phosphatedehydrogenase (GPD), and enzymes involved in phenylpropanoid,terpenoid, polyamine, andpectin biosynthesis pathways. Among theother enzymes, there are those that directly relate to pathogenesis(ABC transporter, protease inhibitor, endopeptidase, endonuclease,P450 monooxygenase), and regulators of the defense response(SGT1, E2-like protein), defense signaling (kinases) and stressresponse (methionine sulfoxide reductase, dehydration-responsiveprotein, DRM1 dormancy-associated protein) protein.

The aim of our research was to elucidate how changes in pectinsynthesis and degradation correlates with the early stage ofF. culmorum and F. oxysporum infection.

Inorder to ascertain theearlystageof infectionanddetermine thepresence of fungi in plant’s tissues in the stagewhen nomacroscopiceffects were observed, we performed PCR reactions with two sets ofprimers designed for F. culmorum and F. oxysporum mRNAs: ABCtransporter and beta-1,6-galactanase genes respectively. Theobtained results confirmed our assumption that pathogens pene-trated into plants tissues after 48 h (data not shown). In order tocorrelate pathogen infection with pectin metabolism genes, theywere selected among those found during the screening of thesubtractive library (F. oxysporum-treated vs. non-treated plants).Those were the genes for UDP-D-glucuronate 4-epimerase andformate dehydrogenase. Additionally, we checked the majority ofremaining genes potentially participating in the investigated path-ways (Fig. 1), such as pectin methylesterases, formaldehyde dehy-drogenase, and s-formylglutathione hydrolase. Of exceptionalinterest for us were pectin methylesterases due to their directparticipation in the response to pathogen infection. We used semi-quantitative reverse transcription PCR and real-time PCR to deter-mine the changes in expression of these genes after pathogeninfection. There were no significant differences between the resultsobtained using those two methods (Fig. 2A and Fig. 2B). Theexpression level of theUDP-D-glucuronate 4-epimerase gene slightlydecreased in theflax seedlings infected by Fusarium in relation to thecontrol plants. Furthermore, F. oxysporum had a more pronouncedinfluence on seedlings, leading to a higher reduction in the expres-sion of this gene. Significant differences that resulted from the stressof pathogen infections were observed in the expression levels of theformate dehydrogenase gene. In comparison with the control, theflax seedlings after F. oxysporum treatment showed an over 3-foldhigher expression of the formate dehydrogenase gene, whileF. culmorum treatment caused a 2.5-fold increase. In flax, there arethree knownpectinmethylesterase genes [25], andeach of themwasanalyzed for possible changes in the levels of expression duringpathogen stress. Two of them, pectin methylesterase 3 and pectinmethylesterase 5, reacted in a similar way to infection with both

F. culmorum and F. oxysporum: there was a reduction in the expres-sion levels of these genes in comparison with the control plants.There were no significant changes in the expression levels of pectinmethylesterase 1. In order to complete the formate metabolismpathway, we decided to find the previously unknown genesequences of enzymes required for the conversion frommethanol toformate, such as methanol oxidase, formaldehyde dehydrogenaseand s-formylglutathione hydrolase. Partial cDNA sequences offormaldehyde dehydrogenase and s-formylglutathione hydrolasewere pulled out from the flax genome, and on the basis of those, theprimers for the qRT-PCR were designed. The expressions of formal-dehyde dehydrogenase and s-formylglutathione hydrolase wererepressed in the seedlings after F. oxysporum treatment. There wereno statistically significant changes in the expression levels of thosegenes in flax seedlings infected with F. culmorum.

2.2. Pathogen infection does not significantly affectthe content of pectin in flax seedlings

There were no significant changes in the content of pectin in theinfected flax relative to the control plants (Fig. 3A). However, thedifferences were revealed when the pectin were fractionated intowater soluble(WSF), CDTA soluble (CSF) and Na2CO3 soluble (NSF)fractions (Fig. 3B). The content of NSF pectins did not change afterFusarium treatment, whereas there was an increase in the WSF anda reduction in CSF level in flax after infection in comparison tocontrol plants. This suggests that in the early stage of pathogeninfection, the described changes did not result from UDP-D-glu-curonate 4-epimerase gene expression, but could be caused by theactivity of fungal cell wall-degrading enzymes, which lead to theloosening of the cell wall structure.

2.3. The impact of the fungal enzymes polygalacturonase andrhamnogalacturonase on the expression level of investigated genes

Recently, transgenic plants overexpressing fungal pectin-degrading enzymes (PG and RG) were created in our laboratory.Beside lowered pectin levels, these plants displayed a higherresistance to pathogen infection [26]. Therefore, we decided tocheck how the overexpression of polygalacturonase and rhamno-galacturonase, and thus the increased level of pectin degradation,influences the currently investigated pathway.

There were no significant changes in the expression level of theUDP-D-glucuronate 4-epimerase gene in the transgenic plantsoverexpressing both polygalacturonase and rhamnogalacturonase(Fig. 4.). Similar findings were obtained for the formate dehydro-genase gene, except the slight, but not statistically significantdecrease in the case of transgenic plants with rhamnogalactur-onase overexpression. In RHA plants, a slight, but significantreduction in the expression levels of pectin methylesterase 5 wasobserved in comparison to the control plants and plants with theoverexpression of the polygalacturonase gene. The levels of boththe formaldehyde dehydrogenase and s-formylglutathione hydro-lase genes in the PGI and RHA transgenic plants remainedunchanged relative to the control plants (Fig. 4.). This indicates thatthere is no connection between the early stage of pathogen infec-tion and the more successive pectin degradation resulting from theoverexpression of the enzymes involved in this process.

2.4. The reduction in formic acid content in flax seedlings infectedby pathogens and the increase in formic acid content in flaxoverexpressing PG and RG

In order to ascertain the significance of the overexpression offormate dehydrogenase in flax seedlings after Fusarium treatment,

Fig. 2. The levels of gene expression in flax seedlings infected with Fusarium culmorum (F.c.) or Fusarium oxysporum (F.ox.) in comparison with the control plants (C). 7-day old flaxseedlings were transferred onto fungal cultures and then grown for 2 days. The expressions of the investigated genes are presented as the x-fold levels of actin gene expression,obtained via densitometric analysis and from the semi-quantitative reverse transcription PCR products of cDNA on a 1.5% agarose gel electrophoresis (A) and via real-time PCR (B).Actin gene was used as a reference gene. Data represent the mean � standard deviations from three independent experiments.

W. Wojtasik et al. / Plant Physiology and Biochemistry 49 (2011) 862e872 865

Fig. 3. A. The pectin content and B. the distribution of uronic acids in pectin fractions (WSF e water soluble fraction; CSF e CDTA soluble fraction; NSF e Na2CO3 soluble fraction) inflax seedlings infected with Fusarium culmorum (F.c.) or Fusarium oxysporum (F.ox.) relative to the control plants (C). 7-day old flax seedlings were transferred onto fungal culturesand then grown for 2 days. Data represent the mean � SD from four independent measurements.

W. Wojtasik et al. / Plant Physiology and Biochemistry 49 (2011) 862e872866

we investigated the content of formic acid, which is the substratefor FDH. The level of formic acid was reduced in flax seedlingsinfectedwith F. culmorum and F. oxysporum compared to the controlplants (Fig. 5A). It is worth noting that the infection withF. oxysporum caused a greater decrease in the formic acid content,and this was confirmed by the higher overexpression of the formatedehydrogenase gene.

The formic acid content was also determined in 9-day oldtransgenic flax seedlings overexpressing the pectin-degradingenzymes polygalacturonase and rhamnogalacturonase to confirmthe source of formate in plants. The data showed a higher formicacid content in the transgenic plants in comparison to the controlplants and plants after infection with Fusarium (Fig. 5B). The 2-foldhigher amount of formic acid was correlated with a reduced level ofpectin and a lack of significant change in the expression level of theformate dehydrogenase gene. Our findings suggest that the formicacid content depended on pectin degradation or methanol-releasing demethylesterification.

2.5. The identification of the partial cDNA sequences of SFGH andFALDH genes

Themissing cDNA sequences of SFGH and FALDH genes from theformate metabolism pathway were identified. The comparison ofisolated partial cDNAswith other sequences from the GenBank database (http://www.ncbi.nlm.nih.gov/blast/) was performed. The firstverified nucleotide sequence shows a high degree of similarity tothe s-formylglutathione hydrolase sequence of Gossypium hirsutum(82% identity) and the second glutathione-dependent formalde-hyde dehydrogenase sequence of Populus trichocarpa (85%identity).

2.6. Changes in the levels of sugars, which serve as precursors inpectin biosynthesis in flax seedlings after Fusarium treatment

To accurately recognize the influence of the pathogens on flaxseedling metabolisms, metabolite profiling was performed usingthe GCeMSmethod. The most interesting results were the changesin levels of soluble sugars that are substrates for nucleotide sugardonor production, from which glycosyl residues are transferred topolysaccharides during pectin synthesis. The data showing thecontents of individual sugars in flax seedlings infected with Fusa-rium is presented in Fig. 6. The level of galacturonic acid, whichforms HGA structure and is the major component of the main chainof the remaining pectin domains, was significantly reduced (up to50%) in the infected flax plants in comparison with the controlplants. A similar decrease was observed for the rest of the investi-gated sugars, such as galactose, xylose, rhamnose, and gluconicacid, but not in the case of arabinose, the content of which was

elevated in the flax seedlings after pathogen treatment. Thissuggests that the access to the structural units for pectin synthesisand other biological processes were restricted, which can be con-nected to pathogen penetration and its cell wall sugar usage asnutrient source.

2.7. Fusarium infection influences the levels of amino acidsand pantothenic acid in flax seedlings

Amino acids and pantothenic acid constituted the next inter-esting group of metabolites delivered from GCeMS analysis. Alongwith purines and formate, amino acids and pantothenic acid aremain components of the C1metabolism in higher plants. Therefore,we checked the contents of selected amino acids and pantothenicacid in the flax seedlings after Fusarium treatment in order toinvestigate an alternative formate metabolism pathway. Data pre-sented in Fig. 7 shows that the level of serine content decreased inthe flax seedlings after pathogen treatment compared with thecontrol plants, and that the reduction in the serine level washighest after F. oxysporum treatment. Similarly, in the case of theremaining analyzed compounds, like methionine, glycine, adenine,and pantothenic acid, there was a slight increase in their levels inflax seedlings infected with F. oxysporum relative to the controlplants, although after F. culmorum treatment the levels of theanalyzed metabolites significantly increased. These findings reflectdifferences in the influences of pathogens on plant metabolism.

3. Discussion

It is common knowledge that flax is a valuable source of fibreenriched in antioxidants and of linseed oil, which is an excellentsource of omega-3 fatty acids. Flaxen products are used not only asfood or a source of fabric, but also as bandages, which are applied inthe treatment of different diseases. The yield of these essentialcomponents is restricted by fungal diseases that negatively affectthe flax harvest. Fungi of the Fusarium family are the mostdangerous flax pathogens, causing numerous diseases. Therefore, itis important to broaden our knowledge regarding the mechanismof pathogen infection and plant defense mechanisms in order tocreate transgenic plants characterized by a higher resistance topathogen infection.

In the first stage of plant infection, the pathogen secretesenzymes such as pectin methylesterases, polygalacturonase,rhamnogalacturonase, and pectin lyase, which degrade pectin andare responsible for the cell wall degradation [13,17]. Sugars,released in those processes, serve as source of nutrient for patho-gens [14]. In this way, the fungi overcome the first and the mostimportant protective barrier of the infected plant.

Fig. 4. The levels of gene expression in flax seedlings from transgenic lines overexpressing polygalacturonase (PGI 11, PGI 13) and rhamnoglucuronase (RHA 7, RHA 9) in comparisonwith the control plants (C). The flax seeds were germinated and grown for 9 days on MS medium. The expressions of the investigated genes are presented as the x-fold levels of actingene expression, obtained via densitometric analysis and from the semi-quantitative reverse transcription PCR products of cDNA on a 1.5% agarose gel electrophoresis. Actin genewas the reference gene as its level did not changes in the various tissues during the development of the plant. Data represent the mean � standard deviations from threeindependent experiments.

W. Wojtasik et al. / Plant Physiology and Biochemistry 49 (2011) 862e872 867

3.1. The content of pectin is not reflected in the level of GEA genetranscript after Fusarium infection

The synthesis of pectin is highly complicated and requiresparticipation of many enzymes. One of these is UDP-D-glucuronate4-epimerase, which was separated from a subtractive libraryprepared after Fusarium oxysporum treatment, and is responsiblefor the conversion of UDP-GlcUA to UDP-GalUA. As UDP-GalUA isa crucial substrate for pectin chain synthesis, UDP-D-glucuronate

4-epimerase plays an essential role in pectin synthesis [10]. Theexpression level of this gene or the activity of the enzyme limitsthe access to substrates. Our data show that the expression level ofthe UDP-D-glucuronate 4-epimerase gene was reduced in flaxseedlings infected with Fusarium in comparison to the controlplants, but it is interesting that the content of pectin remainedunchanged. This could suggest that in the early stage of pathogeninfection, we are not capable of observing changes in the amountof pectin, even though changes in the expression level of the

Fig. 5. The formic acid content in wild-type flax seedlings (A) infected with F. culmorum (F.c.) or F. oxysporum (F.ox.) and (B) in transgenic lines overexpressing polygalacturonase(PGI 11, PGI 13) and rhamnoglucuronase (RHA 7, RHA 9) compared to (C) the control plants. 7-day old flax seedlings were transferred onto fungal cultures (F. culmorum,F. oxysporum) and then grown for 2 days. Flax seeds from the transgenic lines (PGI 11, PGI 13, RHA 7, RHA 9) were germinated and grown for 9 days on MS medium. Data representthe mean � SD from four independent measurements.

W. Wojtasik et al. / Plant Physiology and Biochemistry 49 (2011) 862e872868

investigated gene occur. We can speculate that this enzymeactivity is regulated by the availability of sugar donors for pectinsynthesis. In fact, the levels of the sugar substrates for thenucleotide sugar donors were changed after infection especiallythose of GalUA (a nutrient for pathogens), the content of whichdecreased two-fold in seedlings after F. culmorum andF. oxysporum treatment.

3.2. The looseness of the structure of pectin results from thepresence of exogenous fungal pectin methyloesterases, whichcompensate the reduction of mRNA levels of endogenous PME genes

It is certain that the first stage of pectin degradation is thechange in the degree of HGA methylesterification [12]. Theseparation of methyl groups from the main chains of the pectindomain via the activity of pectin methylesterases (PMEs) leads

Fig. 6. The levels of soluble sugars that are active nucleotide sugar donors in the formation o(F.ox.) in comparison with the control plants (C). 7-day old flax seedlings were transferredfrom the GCeMS analysis and results were presented by the average � SD from three inde

to loosening of the structure of pectin, a step necessary forpectin hydrolysis by pathogens enzymes. It is known thatoverexpression of the pectin methylesterase inhibitor in Arabi-dopsis restricts fungal infection through the impediment ofpectin demethylesterification and consequently the limitationof fungal CWDPs accessibility to substrates [13,18]. Analyses oftotal pectin and its separate fractions revealed changes in levelsof particular fractions to leave the content of total pectinwithout variation. The increased amount of WSF and a reductionin CSF indicated activity of pathogen enzymes leading to loos-ening of the cell wall structure through breaking the ion bondsin pectin structure [9]. Endogenous PMEs play an important rolein plant growth and development, whereas exogenous PMEssecreted by pathogens have a detrimental function because theyweaken the cell wall [12,15]. It is possible that in the presence ofexogenous fungal PMEs, the expression levels of endogenous

f pectin in flax seedlings infected with Fusarium culmorum (F.c.) or Fusarium oxysporumonto fungal cultures and then grown for 2 days. The metabolite profiles were obtainedpendent measurements.

Fig. 7. The levels panthotenic acid and amino acids that are products of an alternative pathway in formate metabolism in flax seedlings infected with Fusarium culmorum (F.c.) orFusarium oxysporum (F.ox.) in comparison with the control plants (C). 7-day old flax seedlings were transferred onto fungal cultures and then grown for 2 days. The metaboliteprofiles were obtained from the GCeMS analysis and results were presented by the average � SD from three independent measurements.

W. Wojtasik et al. / Plant Physiology and Biochemistry 49 (2011) 862e872 869

PME genes are reduced, preventing excessive pectin degradationand thus limiting the spread of pathogens in plants. Thishypothesis was confirmed by our findings, in which theexpression levels of the three isoforms of the PME genes weredecreased in flax seedlings infected with Fusarium in compar-ison to the control plants. This is supported by the data obtainedfor transgenic plants with the overexpression of poly-galacturonase and rhamnogalacturonase, where there were nosignificant changes or slight reduction, respectively, in theexpression levels of the endogenous PME genes in the absenceof exogenous fungal PMEs.

3.3. Expression levels of genes coding for enzymes leading toformate synthesis are not changed in the course of pectindegradation caused by Fusarium infection

Pectin methylesterases catalyse the process of pectin deme-thylesterification releasing methanol and protons, and leavingnegative charges on the pectin chains [12]. The free protons have aninfluence on pH changes, which regulate the activity of PMEs.Environmental acidification causes the reduction in PME activity,which can be restored by polyamines [27]. Methanol releasedduring the demethylesterification process and pectin degradationis converted to formaldehyde by methanol oxidase. The toxicity offormaldehyde is the cause for its quick conversion by formaldehydedehydrogenase to s-formylglutathione, a direct substrate for s-formylglutathione hydrolase, which produces formate [20,28]. Theanalysis of the expression level of the formaldehyde dehydrogenaseand s-formylglutathione hydrolase genes, partial sequences of

which had been obtained from the cDNA pool, showed no signifi-cant changes in the flax seedlings infected by F. culmorum relativeto the control plants. Changes in methanol oxidase expressionwerenot determined for its sequence in flax remains unrecognized. Onlythe influence of F. oxysporum disclosed a significant reduction ofthese genes in comparison to the control plants. Similar findingswere obtained for transgenic plants overexpressing PG and RG,fungal pectin-degrading enzymes. This shows that the conversionof methanol to formate does not depend on pathogen infection inthe plants. The lack of changes in the expression levels of thesegenes does not necessarily mean no changes in their activity,because in the case of the transgenic plants with the over-expression of PG or RG, a 2-fold decrease in the pectin content, anda 2-fold increase in formate was observed in the absence of changesin the PMEmRNA level. This can suggest the induced increase in theactivity of these genes during accelerated pectin degradation.

3.4. The expression of FDH gene is induced by pathogen infection,not by the level of formate

Formate is an important source of carbon for the C1 metabolismin higher plants, but in excess, it can be harmful due to the possi-bility of blocking of donor and acceptor sites of photosystem II. Inorder to avoid the accumulation of formate to a dangerous level,which can become a toxic metabolite in plants under the influenceof biotic or abiotic stresses, the expression level of formate dehy-drogenase (FDH) increases significantly [21]. Formate dehydroge-nase is responsible for the conversion of formate to carbon dioxideand also for the generation of NADH, which can serve as a source of

W. Wojtasik et al. / Plant Physiology and Biochemistry 49 (2011) 862e872870

energy in the respiratory chain [22,23]. The elevation in theexpression level of the FDH gene is visible in the case of variousstresses, as confirmed by our findings, where the expression level ofthis gene increased over three-fold in flax seedlings after Fusariumtreatment relative to the control plants. In the case of the transgenicplants overexpressing PG or RG with increased pectin degradation,the expected increase in FDH was not observed. In the transgenicplants with overexpression of polygalacturonase, the level of FDHwas unchanged, whereas in RHA transgenic plants, a slight, butinsignificant repression of this gene was observed. This leads us toconclude that formate does not have a direct influence on theexpression level of the formate dehydrogenase gene.

3.5. After infection, formate is converted into CO2 by formatedehydrogenase, at the expense of the synthesis of other metabolites,in order to generate NADH

It is certain that formate is catabolised not only to carbondioxide by formate dehydrogenase, but also serves as valuablesource of carbon for amino acid, purine, and pantothenic acidsynthesis in the C1 metabolism in higher plants. The first step inthis pathway is the conversion of formate to serine, which is thenconverted to methionine, glycine, alanine, pantothenic acid, andpurines [24,29]. The data received from GCeMS analysis showa high reduction of the serine content in the flax seedlings infectedwith Fusarium. In the content of the other metabolites mentionedabove, the changes were clearly visible, especially after F. culmorumtreatment. The suggestion is that the loss of serine caused bypathogen infection might result from the conversion of serine intoother metabolites, and apparently the conversion of formate toserine is not activated during infection to compensate for itsmetabolism. By contrast, the degradation pathway, where a crucialstep is a catalysis to carbon dioxide by FDH, is activated. Thisreaction generates NADH, which may be needed for other defensemetabolite synthesis. We came to the conclusion that duringpathogen infection, formate metabolism switches toward CO2,whereas under normal conditions, the plants also use formate formetabolite synthesis.

The aim of this study was to correlate the expression of severalgenes involved in pectin and formate metabolism with changes inthose metabolite levels after Fusarium infection, and to comparethem with results obtained from transgenic flax overexpressingfungal pectin-degrading enzymes.

Our findings yield valuable information about pectin andformate metabolism in the early stage of pathogen infection, whichmight serve as an important starting point to generate transgenicflax plants with improved resistance to biotic stress.

4. Materials and methods

4.1. Plant materials and growth conditions

Flax seeds (Linum usitatissimum L., Nike) were obtained from theFlax and Hemp Collection of the Institute of Natural Fibres inPoland. Fusarium culmorum and Fusarium oxysporum strains wereprovided by Dr M. Starzycki (Plant Breeding and AcclimatizationInstitute).

The transgenic flax lines PGI and RHA, overexpressing the fungalpectinase enzymes polygalacturonase PG and rhamnogalactur-onase RG, respectively, were created previously in our laboratoryand have been extensively described [26]. Briefly, the flax plantswere transformed with the PG or RG gene under the 35S promoterand the empty plasmid alone (transformation control) using theAgrobacterium method. The selection of plants was based on theintroduced gene expression, pectin level and susceptibility to

infection and two lines with the different gene expression level ofeach transgene (PGI lines 11 and 13, RHA lines 7 and 9) were takenfor further analyses. Both lines within each transgene differ in thelevel of gene expression, i.e. the transcript for RHA is 40-folde100-fold overproduced in transgenic plants, while for PGI plants, 600-fold and 1530-fold overproduction of the introduced gene wereobserved. The levels of pectin followed the gene expression andwas over 2 times lower in all analyzed plants.

The plants were grown in Murashige and Skoog mediumsolidified with 0.8% agar and supplemented with 1% sucrose. Theseed germination was carried out in a regime of 16 h light (21 �C),8 h darkness (16 �C) for 7 days in in vitro cultures on Petri dishes.For the induction, one-week old seedlings were transferred ontoa medium grown in the presence of Fusarium oxysporum andFusarium culmorum fungi. After two days, the treated and non-treated seedlings were collected separately, frozen with liquidnitrogen, and stored in a deep freezer (�70 �C) before use. Bio-logical material was prepared in three independent replications.

4.2. Suppression subtractive hybridization and differentialscreening

Suppression subtractive hybridization is a technique thatcompares two mRNA pools to find the genes that are expressed inone population, but not in the other. The procedure was carried outusing a PCR-Select cDNA Subtraction Kit (Clontech, cat. no. 637401).To select the pathogen-responsive genes, induction with Fusariumoxysporum was used. Suppression subtractive hybridization wasperformed with driver cDNA prepared from 2 mg of mRNA fromuninfected plants. A tester cDNA was prepared from the sameamount of mRNA isolated from Fusarium oxysporum-treated plants.The resulting PCR mixture, enriched for differentially expressedcDNAs, was directly inserted into the T/A cloning vector pCR2.1-TOPO (Invitrogen) and transformed into E. coli DH10B (Invitrogen)by electroporation. A total of 490 bacterial transformants wereblotted onto ten 137-mm IMMOBILON-NYþ discs (Millipore, cat.no. INYC 13750) for differential screening with 32P-labelledunsubtracted and forward- and reverse-subtracted probes. Theforward-subtracted probe was made with tester cDNA from Fusa-rium oxysporum-treated plants and driver cDNA from the controlplants. For the reverse-subtracted probe, cDNA from the controlplants was used as the tester and cDNA from the induced plants asthe driver. For the unsubtracted probes, cDNAs from the control andinduced plants were labelled separately. Forty-seven clones werefinally selected based on the presence and absence of the signal onX-ray film. The nucleotide sequences of the cDNA fragments weredetermined by sequencing in both directions. The homology searchwas performed with the GenBank data base (http://www.ncbi.nlm.nih.gov/blast/).

4.3. Semi-quantitative reverse transcription PCR expressionanalysis

The level of transcript was determined using semi-quanti-tative reverse transcription PCR. The total RNA was isolatedusing an Invisorb Spin Plant RNA Mini Kit (Invitrogen) followingmanufacturer’s protocol and the RNA integrity was checked bygel electorphoresis on 1.5% (w/v) agarose containing 15% (v/v)formaldehyde. The remaining DNA was removed via DNaseI(Invitrogen) treatment. Then RNA was used as a template forcDNA synthesis using a High Capacity cDNA Reverse Transcrip-tion Kit (Applied Biosystems). The primer sequences used forthe PCR reactions are presented in Table 1. They were designedon the basis of the nucleotide sequences of clones obtained fromthe subtractive cDNA library for GAE and FDH, the previously

Table 1The primer sequences, annealing temperatures (Ta) and number of cycles for semi-quantitative and real-time reverse transcription PCR reactions. AKT e actin; FDH e formatedehydrogenase; GAE e UDP-D-glucuronate-4-epimerase; PME1, PME2, PME3 e pectin methylesterases; SFGH e s-formylglutathione hydrolase; FALDH e gluthatione-dependent formaldehyde dehydrogenase.

Gene Forward primer Reverse primer Ta Cycle

AKT 50 ACACAGATCATGTTCGAGAC 30 50 AGAGCATACCCTTCGTAGA 30 55 �C 22FDH 50 GGCAGGTACTCCTTTCTTCATCTT 30 50 TACCGTTGGCTGTGGACGGATT 30 59 �C 25GAE 50 GGTACGCTGCGACAAAGAAG 30 50 GCCGAGGTACTCTTTCCTGAAG 30 58 �C 25PME1 50 GACCGACGTCCAAACGTG 30 50 GGAAGCTGTTATTAACGGAGG 30 65 �C 30PME3 50 TATCGCTCAACACCCAGATG 30 50 GCCGGTTCGTGTCGAGAAG 30 65 �C 30PME5 50 TTAGCCTGACGAAGCGGGAG 30 50 AGGATGGTTGGCCGCGGT 30 65 �C 30SFGH 50 AGCAGTTCGAAGATGTTCGG 30 50 AGGTAGCATCATACTCTTCCCAG 30 63 �C 30FALDH 50 ATTGTTGAGAGTGTTGGAGAAGG 30 50 ATGATCCTTGAAGCACCAGC 30 63 �C 35

W. Wojtasik et al. / Plant Physiology and Biochemistry 49 (2011) 862e872 871

described nucleotide sequences from the flax genome for threeknown isoforms of PME [25], and the nucleotide sequences ofhomological genes for SFGH and FALDH from other plants.

The PCR conditions were 94 �C for 3 min, and 22 cycles of 94 �Cfor 45 s, 55 �C for 30 s, and 72 �C for 20 s and 72 �C for 5 min. Thenumber of cycles was determined depending on the transcriptionlevel to keep the reaction in the logarithmic stage (Table 1). The PCRproducts were electrophoresed on 1.5% agarose gels with ethidiumbromide, and visualized under UV light. The levels of PCR productswere measured by the densitometry analysis of the gel image usingthe Bio 1D program. Actin gene was used as a reference gene,because its level did not change in the various tissues during thedevelopment of the plant.

4.4. Real-time PCR expression analysis

In order to determine the quantitative levels of gene expression,a real-time PCR analysis via a Light Cycler (Roche Applied Science)was used. The template used for semi-quantitative PCR was diluted10 times for the qRT-RT analysis. The primer sequences remainedunchanged, while the annealing temperature was reduced by 4 �C(Table 1).

4.5. The identification of the partial cDNA sequences of some genes

We identified the unknown cDNA sequences with the aid ofrightly designed primers. Nucleotides sequences of primers(Table 1) were chosen from the most homological places findingin the alignment of respective genes from other plants. cDNAwas used as the template to receive PCR product, which laterwas checked by means of an electrophoresis. Cleaned DNA wascloned using TOPO TA Cloning Kit (Invitrogen) in order to verifythe DNA sequences, which was carried out by Laboratory forDNA Sequencing and Oligonucleotide Synthesis IBB PAN. Thehomology search was performed with the GenBank data base(http://www.ncbi.nlm.nih.gov/blast/).

4.6. Isolation and fractionation of cell walls

The isolation and fractionation of a cell wall components wasperformed using modification of a method described by Man-ganaris [9] and Vincente [30].

Infected and non-infected flax seedlings (150 mg frozen groundplant tissue) were boiled in 96% ethanol for 30 min to inactiveenzymes, extract lowmolecular weight components and to preventautolysis. The material was filtered though Whatman GF/C filterand then sequentially washed with 80% ethanol, chloroform :methanol (1:1 v/v), acetone and allowed to dry at 37 �C, receivingalcohol insoluble residue (AIR).

6 mg of AIR residue from each samples were suspended in1 ml of water and then stirred at RT for 12 h. After centrifugation

(6000 � g, 4 �C, 10 min) the pellet was washed with water andboth supernatants were collected for the water soluble fraction(WSF) determination. The remaining material was resuspendedin 50 mM CDTA (trans-1,2-diaminocyclohexane-N,N,N_,N_-tet-raacetic acid), ph 6.5 and stirred (RT, 12 h). After the centrifu-gation and the wash (as above) the extracted solutions werecollected and designed CDTA soluble fraction (CSF). The pelletwas resuspended in 50 mM Na2CO3 with 20 mM NaBH4, stirredat 4 �C for 12 h, washed and then supernatants were neutralizedwith glacial acetic acid. These samples were designed Na2CO3soluble fraction (NSF). Supernatants from CSF and NSF fractionswere extensively dialyzed against water (with a 3.5 kDa cut off)and additionally all fractions were lyophilized before use.

4.7. Uronic acids measurement

The content of pectin was determined by the biphenylmethod [31] after the hydrolysis the polysaccharides in sulfuricacid [19]. The samples were suspended in 0.1 ml sulfuric acidand stirred in an ice bath for 5 min and sequentially added0.1 ml sulfuric acid, 0.05 ml water, 0.05 ml water and 0.7 mlwater with stirring between next solution. Diluted materialswere centrifuged for 10 min at 2000 � g in RT and supernatantswere used for the measurement. 0.1 ml of this solution wastaken and added to 0.6 ml of 0.0125 M Na2B4O7 in sulfuric acidfor the reaction. Then the samples were shaken and incubated at100 �C for 5 min. After cooling, 10 ml of m-hydroxy-biphenyl(0.15%) in 0.5% NaOH was added to each sample, and incubatedin RT for 10 min. The pectin content was measured witha spectrophotometer at 540 nm. Galacturonic acid was used forthe calibration curve.

4.8. Analysis of formic acid content

The determination of the total amount of formic acid in thefrozen plant tissues (flax seedlings) was achieved using a “Formicacid” Kit (Megazyme). Plant tissue (20 mg) was extracted withwater for 20 min at room temperature, and the supernatant, afteran adjustment to a pH between 7 and 8, was used for themeasurement. The samples were diluted twice and ten times. Theformic acid content was measured spectrophotometricaly at340 nm according to the manufacturer’s protocol. The formic acidsupplied by the manufacturer was used as the standard.

4.9. Determination of metabolite levels (sugars, amino acids andpanthotenic acids) by GCMS

150 mg of F. oxysporum- and F. culmorum-infected flax(L. usitatissimum, cv. Nike) seedlings and non-infected controlseedlings were grinded in liquid nitrogen and extracted withmethanol (14 ml/g FW) with the addition of 120 mg/g of rybitol as

W. Wojtasik et al. / Plant Physiology and Biochemistry 49 (2011) 862e872872

an internal standard. The samples were incubated at 70 �C for15 min, and centrifuged for 10 min at 14000 rpm. The pellet wassaved for the isolation of the cell wall-bound compounds.1500 ml ofwater was added to the methanol, and a further extraction with750 ml chloroform was performed. 150 ml of the polar phase wasdried under a vacuum prior to derivatisation. The dried extract wasdissolved in pyridine/methoxylamine hydrochloride (20 mg/ml) at37 �C for 120 min, and then incubated with N-Methyl-N-(trime-thylsilyl)trifluoroacetamide (MSTFA) at 37 �C for 30 min. Thesamples were analyzed via GCeMS in a system consisting of a GC8000 gas chromatograph, an AS 2000 autosampler and a Voyagerquadropole mass spectrometer (ThermoQuest, Manchester, UK).The chromatograms and mass spectra were evaluated using MAS-SLAB software (ThermoQuest, Manchaster, UK).

4.10. Statistical analysis

All experiments were independently repeated at least threetimes. Results are presented by means of the average of indepen-dent replicates � standard deviations. Statistical analysis was per-formed using Statistica 9 software (Statsoft, USA). The significanceof the differences between means was determined by Tukey’s test(* - P < 0.05, ** - P < 0.01).

Acknowledgements

This paper is supported by grants no PBZ-MNiI-2/1/2005 and NN302 101136 from the Ministry of Science and Higher Education.

Appendix. Supplementary material

Supplementary material associated with this paper can befound, in the online version, at doi:10.1016/j.plaphy.2011.03.002.

References

[1] M. Berrocal-Lobo, A. Molina, Arabidopsis defense response against Fusariumoxysporum, Trends Plant Sci. 13 (2008) 145e150.

[2] C. Olivain, S. Trouvelot, M.-N. Binet, C. Cordier, A. Pugin, C. Alabouvette,Colonization of flax roots and early physiological responses of flax cellsinoculated with pathogenic and nonpathogenic strains of Fusarium oxy-sporum, Appl. Environ. Microbiol. 69 (2003) 5453e5462.

[3] M.I. Roncero, A. Di Pietro, M.C. Ruiz-Roldan, M.D. Huertas-Gonzalez,F.I. Garcia-Maceira, E. Meglecz, A. Jimenez, Z. Caracuel, R. Sancho-Zapatero,C. Hera, E. Gomez-Gomez, M. Ruiz-Rubio, C.I. Gonzalez-Verdejo, M.J. Paez,Role of cell wall-degrading enzymes in pathogenicity of Fusarium oxysporum,Rev. Iberoam Micol 17 (2000) S47eS53.

[4] M. Zieli�nska, M. Michniewicz, The effect of calcium on the production ofethylene and abscisic acid by fungus Fusarium culmorum and by wheatseedlings infected with that pathogen, Acta Physiologiae Plantarum 23 (2001)79e85.

[5] D. Mohnen, Pectin structure and biosynthesis, Curr. Opin. Plant Biol. 11 (2008)266e277.

[6] B.L. Ridley, M.A. O’Neill, D. Mohnen, Pectins: structure, biosynthesis, and oli-gogalacturonide-related signaling, Phytochemistry 57 (2001) 929e967.

[7] W.G. Willats, L. McCartney, W. Mackie, J.P. Knox, Pectin: cell biology andprospects for functional analysis, Plant Mol. Biol. 47 (2001) 9e27.

[8] H.V. Scheller, J.K. Jensen, S.O. Sørensen, J. Harholt, N. Geshi, Biosynthesis ofpectin, Physiologia Plantarum 129 (2007) 283e295.

[9] G.A. Manganaris, A.R. Vicente, C.H. Crisosto, J.M. Labavitch, Cell wall modifi-cations in chilling-injured plum fruit (Prunus salicina), Postharvest Biol.Technol. 48 (2008) 77e83.

[10] Q. Zhang, M. Hrmova, N.J. Shirley, J. Lahnstein, G.B. Fincher, Gene expressionpatterns and catalytic properties of UDP-D-glucose 4-epimerases from barley(Hordeum vulgare L.), Biochem. J. 394 (2006) 115e124.

[11] F. Micheli, Pectin methylesterases: cell wall enzymes with important roles inplant physiology, Trends Plant Sci. 6 (2001) 414e419.

[12] J. Pelloux, C. Rustérucci, E.J. Mellerowicz, New insights into pectin methyl-esterase structure and function, Trends Plant Sci. 12 (2007) 267e277.

[13] V. Lionetti, A. Raiola, L. Camardella, A. Giovane, N. Obel, M. Pauly, F. Favaron, F.Cervone, D. Bellincampi, Overexpression of Pectin Methylesterase Inhibitorsin Arabidopsis Restricts Fungal Infection by Botrytis Cinerea1[C][W], vol. 143,American Society of Plant Biologists, 2007, pp. 1871e1880.

[14] D. Cantu, A.R. Vicente, J.M. Labavitch, A.B. Bennett, A.L. Powell, Strangers in thematrix: plant cell walls and pathogen susceptibility, Trends Plant Sci. 13(2008) 610e617.

[15] M. Fries, J. Ihrig, K. Brocklehurst, V.E. Shevchik, R.W. Pickersgill, Molecularbasis of the activity of the phytopathogen pectin methylesterase, EMBO J. 26(2007) 3879e3887.

[16] M.-T. Esquerré-Tugayé, G. Boudart, B. Dumas, Cell wall degrading enzymes,inhibitory proteins, and oligosaccharides participate in the molecular dialoguebetween plants and pathogens, Plant Physiol. Biochem. 38 (2000) 157e163.

[17] S. Vorwerk, S. Somerville, C. Somerville, The role of plant cellwall polysaccharidecomposition in disease resistance, Trends Plant Sci. 9 (2004) 203e209.

[18] D. Cantu, A.R. Vicente, L.C. Greve, F.M. Dewey, A.B. Bennett, J.M. Labavitch,A.L.T. Powell, The intersection between cell wall disassembly, ripening, andfruit susceptibility to Botrytis cinerea, Proc. Natl. Acad. Sci. 105 (2008)859e864.

[19] A.E.R. Ahmed, J.M. Labavitch, A simplified method for accurate determinationof cell wall uronide content, J. Food Biochem. 1 (1978) 361e365.

[20] C. Frenkel, J.S. Peters, D.M. Tieman, M.E. Tiznado, A.K. Handa, Pectin methyl-esterase regulates methanol and ethanol accumulation in ripening tomato(Lycopersicon esculentum) fruit, J. Biol. Chem. 273 (1998) 4293e4295.

[21] P.L. Herman, H. Ramberg, R.D. Baack, J. Markwell, J.C. Osterman, Formatedehydrogenase in Arabidopsis thaliana: overexpression and subcellular local-ization in leaves, Plant Sci. 163 (2002) 1137e1145.

[22] F. Ambard-Bretteville, C. Sorin, F. Rebeille, C. Hourton-Cabassa, C. Colas desFrancs-Small, Repression of formate dehydrogenase in Solanum tuberosumincreases steady-state levels of formate and accelerates the accumulation ofproline in response to osmotic stress, Plant Mol. Biol. 52 (2003) 1153e1168.

[23] N.V. Bykova, A. Stensballe, H. Egsgaard, O.N. Jensen, I.M. Moller, Phosphory-lation of formate dehydrogenase in potato tuber mitochondria, J. Biol. Chem.278 (2003) 26021e26030.

[24] A.U. Igamberdiev, N.V. Bykova, L.A. Kleczkowski, Origins and metabolism offormate in higher plants, Plant Physiol, Biochem 37 (1999) 503e513.

[25] S.Al-Qsous, E. Carpentier,D.Klein-Eude,C.Burel, A.Mareck,H.Dauchel,V.Gomord,A. Balangé, Identification and isolation of a pectin methylesterase isoform thatcould be involved in flax cell wall stiffening, Planta 219 (2004) 369e378.

[26] M. Musialak, M. Wróbel-Kwiatkowska, A. Kulma, E. Starzycka, J. Szopa,Improving retting of fibre through genetic modification of flax to expresspectinases, Transgenic Res. 17 (2008) 133e147.

[27] D. Charnay, J. Nari, G. Noat, Regulation of plant cell-wall pectin methylesterase by polyamineseinteractions with the effects of metal ions, Eur. J.Biochem. 205 (1992) 711e714.

[28] H. Achkor, M. Diaz, M.R. Fernandez, J.A. Biosca, X. Pares, M.C. Martinez,Enhanced formaldehyde detoxification by overexpression of glutathione-dependent formaldehyde dehydrogenase from Arabidopsis, Plant Physiol. 132(2003) 2248e2255.

[29] A.D. Hanson, D.A. Gage, Y. Shachar-Hill, Plant one-carbon metabolism and itsengineering, Trends Plant Sci. 5 (2000) 206e213.

[30] R. Ariel Vicente, Ann Powell, L. Carl Greve, M. John Labavitch, Cell WallDisassembly Events in Boysenberry (Rubus idaeus L. x Rubus ursinus Cham. &Schldl.) Fruit Development. Commonwealth Scientific and Industrial ResearchOrganization, Collingwood, AUSTRALIE, 2007.

[31] N. Blumenkrantz, G. Asboe-Hansen, New method for quantitative determi-nation of uronic acids, Anal. Biochem. 54 (1973) 484e489.