Suitability of Molecular Markers for Selection of PotatoesResistant to Globodera spp

Dorota Milczarek & Bogdan Flis & Anna Przetakiewicz

Published online: 27 February 2011# Potato Association of America 2011

Abstract Globodera rostochiensis and Globodera pallidaare parasitic root cyst nematodes of potato (PCN), whichsignificantly reduce yield and quality. The genetics andavailable molecular markers should make resistance tonematodes an excellent candidate for marker assistedselection. The study presents results of testing the suitabil-ity of known molecular markers for detection of resistancein a set of cultivars. We revealed some inconsistencies ingenealogical data of the cultivars and showed inconsistentusefulness in detecting resistant cultivars. The markerTG689 was identified in almost all cultivars resistant toG. rostochiensis and together with other markers was usedfor verifying the resistance in a group of breeding lines. Themarker TG689 was the most effective. However, theefficiency of tested markers in selecting resistant individ-uals might be inadequate. In the case of quantitativeresistance to G. pallida, marker SPUD1636 was found inresistant cultivars, and not in susceptible cultivars, butturned out to be inefficient in selecting resistant breedinglines.

Resumen Globodera rostochiensis y Globodera pallidason nematodos de quiste parásitos de la raíz de la papa(PCN) que reducen significativamente el rendimiento y lacalidad. La genética y los marcadores moleculares dis-

ponibles, deberían de hacer de la resistencia a nematodosun excelente candidato para selección asistida con marca-dores. El estudio presenta resultados de probar lo deseablede los marcadores moleculares conocidos para la detecciónde resistencia en un grupo de variedades. Revelamosalgunas inconsistencias en datos genealógicos de lasvariedades y mostramos uso inconsistente en la detecciónde variedades resistentes. El marcador TG689 se identificóen casi todas las variedades resistentes a G. rostochiensis yjunto con otros marcadores se usó para verificar laresistencia en un grupo de líneas de mejoramiento. Elmarcador TG689 fue el más efectivo. No obstante, podríaser inadecuada la eficiencia de los marcadores probados enla selección de individuos resistentes. En el caso deresistencia cuantitativa a G. pallida, se encontró elmarcador SPUD1636 en variedades resistentes y no en lossusceptibles, pero resultó ser ineficiente en la selección delíneas de mejoramiento resistentes.

Keywords Potato . Solanum tuberosum . MAS .Globoderarostochiensis .Globodera pallida

Introduction

The potato cyst nematodes (PCN) Globodera rostochiensisand Globodera pallida are the most important pests feedingon potato roots (Evans and Trudgill 1992). The symptomsof infection are not specific and are similar to those causedby other biotic or abiotic stress agents. Attacked potatoplants are smaller, tubers are much smaller and their yield ismuch lower than that obtained from healthy plants. Yieldlosses caused by PCN are estimated up to 30% worldwide(Oerke et al. 1994). PCN are introduced into clean fieldswith seed tubers and with soil. In infected fields, production

D. Milczarek (*) : B. FlisPlant Breeding and Acclimatization Institute,Research Centre Młochów,Platanowa 19,05-831 Młochów, Polande-mail: d.milczarek@ihar.edu.pl

A. PrzetakiewiczPlant Breeding and Acclimatization Institute,Research Centre Radzików,05-870 Błonie, Poland

Am. J. Pot Res (2011) 88:245–255DOI 10.1007/s12230-011-9189-0

of seed potato is forbidden and tubers of ware productionare only marketable after washing. Both PCN species areincluded in the list of quarantine pathogens in manycountries (Smith et al. 1992).

PCN can be controlled chemically (by applyingnematicides) or biologically or by crop rotation and trapcropping. However, growing resistant cultivars is be-lieved to be economically the most effective andenvironmentally safe method of protecting potato cropsagainst PCN (EPPO/OEPP 2004). Therefore, breeding forresistance is among the major aims of potato breedingprogrammes.

Historically, the resistance against nematodes wasintroduced to potato cultivars from Solanum tuberosumssp. andigena, S. vernei and S. spegazzini (Ross 1979).Many other wild species were found to be sources of PCNresistance genes: S. gourlayi (Uhrig and Wenzel 1981), S.sparsipilum (Caromel et al. 2005), S. multidissectum, S.kurtzianum, S. michoacanum, S. oplocense, S. chacoenseand others screened by Ruiz de Galarreta et al. (1998) andCastelli et al. (2003). Resistance to Globodera spp., whichis conferred by already localized genes, could be expressedas partial or nearly extreme.

Many PCN resistance loci have been already identified(Gebhardt and Valkonen 2001). Most of them are QTLregions conferring partial resistance, while some are majorgenes conferring nearly extreme resistance to one or morepathotypes of Globodera spp. (Table 1). The gene Gpa2from S. tuberosum ssp. andigena CPC 1673, whichconfers resistance to G. pallida pathotype Pa2, has beenlocalized on chromosome XII at a distance of 0.8 cM tothe marker GP34 (van der Voort et al. 1997; van derVossen et al. 2000). Another single dominant gene H1from S. tuberosum ssp. andigena CPC 1673 confersresistance to G. rostochiensis pathotypes Ro1 and Ro4.This gene was mapped on chromosome V and is linked tothe markers CP113 (distance less than 1 cM) (Gebhardt etal. 1993; Niewöhner et al. 1995), 239E4leftCAPS (0.8 cM)(Bakker et al. 2004) and CD78 (2.7 cM) (Pineda et al.1993). In S. tuberosum ssp. tuberosum with resistancederived from S. vernei, in the same region of chromosomeV, the gene GroV1 was found at a distance of 4 cM to themarker X02 and 19 cM to the marker U14 (Jacobs et al.1996). This gene controls resistance to G. rostochiensispathotype Ro1. In S. spegazzini, the gene Gro1-4 in locusGro1 confers resistance to pathotypes Ro1 and Ro5 of G.rostochiensis. The Gro1 is a locus of clustered family ofgenes (Paal et al. 2004) and was mapped on chromosomeVII (Barone et al. 1990).

Molecular markers linked to the loci of interest can beused in potato breeding for the selection of resistantgenotypes. The phenotypic evaluation of resistance toGlobodera spp. is costly and time consuming. DNA

markers can reduce costs, which additionally can beoptimized by consecutive screening or by multiplex PCRassays (Gebhardt et al. 2006). Using molecular markersenables selecting of resistant genotypes at early stages ofpotato breeding scheme, which leads to rapid reduction inthe number of individuals under selection in further steps.To be suitable for marker assisted selection (MAS), themarker should be inexpensive, convenient in use, repro-ducible and specific for the trait. Nowadays the mostwidely used are CAPS and SCAR markers (Barone 2004).The following markers are recommended as a good tool forselection genotypes resistant to PCN: U14 and X02 (Jacobset al. 1996), CP113 (Niewöhner et al. 1995, Skupinová etal. 2002), TG689 (Sagredo et al. 2004; Biryukova et al.2008), Gro 1,4 (Paal et al. 2004; Gebhardt et al. 2006), 77R(van der Voort et al. 1999), SPUD1636 (Bryan et al. 2002)and SNP marker named HC (Sattarzadeh et al. 2006).

The practical use of molecular markers encounters somedifficulties, that depend on marker type and technique,inheritance of the gene and expression of the trait. Firstly,the procedures of applying molecular marker often need tobe adapted to conditions of specific laboratory, whichmeans that published markers are not always broadlyapplicable. Secondly, marker presence is not alwaysconnected with nematode resistance. This might result fromrecombination events, which occurred during breeding

Table 1 Genes conferring resistance to Globodera spp

Chromosome Gene Resistance Reference

III Gro1-4 Ro1 Kreike et al. 1996

IV Gpa4_QTL Pa2,3 Bradshawet al. 1998

V H1 Ro1,4 Gebhardtet al. 1993

GroV1 Ro1 Jacobs et al., 1996

Gpa_QTL Pa2,3 Kreike et al. 1994

Grp1_QTL Ro5,Pa2,3

Van der Voortet al. 1998

Gpa5_QTL Pa2,3 Van der Voortet al. 2000

GpaM1_QTL Pa2,3 Caromel et al. 2003

GpaVsspl_QTL Pa2,3 Caromel et al. 2005

GpaXIsspl_QTL Pa2,3 Caromel et al. 2005

VI GpaM2_QTL Pa2,3 Caromel et al. 2003

VII Gro1 Ro1,5 Paal et al. 2004

IX Gpa6_QTL Pa2,3 Van der Voortet al. 2000

X Gro1.2_QTL Pa2,3 Kreike et al. 1993

Gro1.3_QTL Pa2,3 Kreike et al. 1993

XII Gpa2 Pa2,3 Van der Voortet al. 1997

GpaM3_QTL Pa2,3 Caromel et al. 2003

246 Am. J. Pot Res (2011) 88:245–255

process. Moreover, markers are identified in experimentallycreated populations, which might not reflect germplasmactually present in breeding programs.

The major aim of our research was to examinepossibilities of using different published markers for genescontrolling resistance to PCN in a group of potato cultivars.These cultivars differed in level, specificity and origin ofresistance. The effectiveness of markers was tested by thecomparison between results of phenotypic evaluation ofresistance and marker detection. This was performed in agroup of breeding lines, which were previously screenedfor phenotypic resistance and meet basic agronomicalcriteria.

Materials and Methods

Plant Material

The possibility of detecting resistance genes by usingmolecular markers was tested in the collection of potatocultivars with known resistance against Globodera spp. Thecollection of 61 resistant tetraploid potato cultivars included12 cultivars, which have S. tuberosum ssp. andigena CPC1673 in their pedigree, namely Agria, Carrera, Cherie,Elkana, Fox, Garant, Hopehely, Inwestor, Jasia, Klara,Mara, White Lady (group Adg). The other 7 cultivars, i.e.Benol, Karnico, Korona, Nadine, Neptun, Padea, and Utehave S. vernei in their pedigree (group Vrn). CultivarsAjiba, Ballade, Biogold, Darwina, Innovator, Kartel,Palladia, Pansta, Ponto, Producent, Proton and Sante haveboth of these sources of resistance in their pedigree (groupAdg+Vrn). The next four cultivars, i.e. Bettina, Franzi,Hilta and Panda have S. spegazzini in their parentage(group Spg). For the group of 26 cultivars sources of PCNresistance are unknown. This group comprised cultivarsBellarosa, BF 15, Blaue Schweden, Bryza, Colette, Delica,Denar, Dorett, Edzell Blue, Felka Bona, Gesa, Inova, Jelly,Juliette, Justa, Laura, Lord, Molli, Nicola, Pino, Roxana,Sonda, Salad Blue, Sissi, Valor, Zeus. The pedigree of allthese cultivars was established according to Świeżyński etal. 1997. All mentioned cultivars are resistant to G.rostochiensis (pathotype Ro1) with exception of cv. Innova-tor (from Adg+Vrn group), which is only resistant topathotypes Pa2 and Pa3 of G. pallida. Apart from resistantcultivars, a group of standard cultivars susceptible to all PCNpathotypes was examined, i.e. cvs Bila, Bzura, Desirée,Estima, Glada, Hinga, Kolia, Ornela, Pentland Dell, RussetBurbank and Tábor. Additionally, cv. Innovator was used assusceptible standard for tests with G. rostochiensis.

Besides cultivars, breeding lines generated in a crossingprogramme were tested for PCN resistance. These linesoriginated from crossing of two breeding lines, i.e. PS-1763

resistant to pathotype Ro1, belonging to group Adg+Vrn,and susceptible PS-1761 with set of cultivars (Bettina,Darwina, Dorett, Karnico, Nadine, Palladia, Pino, Producent,Proton, Sante and Ute), which served as donors of resistanceto different PCN pathotypes. One progeny was derived fromcross between two cultivars, i.e. Sante and Innovator.

All progeny individuals were examined for the relation-ship between phenotypically expressed resistance and thepresence of molecular markers linked to the resistance gene(s), which were identified in parental forms. At earlierstages of breeding all these individuals were selected tomeet agronomic criteria for tuber yield, tuber morphology,content of starch and cooking characteristics.

Diagnostic PCR Marker Assays

For PCR assays markers were chosen, which wererecommended for selection of genotypes resistant toGlobodera spp. or were just mapped at a small distancefrom resistance genes.

All used markers are described in Table 2.Total genomic DNA was extracted from frozen leaves

using the GenElute Plant Genomic DNA Miniprep Kit(Sigma, Germany).

PCR was performed in a total volume of 20μl containing0.2 mM dNTPs; 0.4 mM, 0.3 mM (CP113, Gro1-4, TG432,U14, X02), 0.2 mM (TG689) and 0.1 mM (HC,SPUD1636, BCH) of each primer and 1U Allegro TaqDNA polymerase in the reaction buffer provided by themanufacturer (Novazym, Poland). The PCR temperatureparameters and primers sequences for amplifying all usedmarkers are described in Table 2. Parameters of PCR werechanged for markers CP113, TG432, U14 and X02.Touchdown PCR was performed. Annealing temperaturewas initially increased by 10°C and decreased by 1°C percycle. Amplified markers were analyzed in 1% agarose.

Test for Nematode Resistance

The test was performed in pots with one litre of soil containingnematode cysts. There were four replicates per combination ofPCN pathotype (Ro1, 4, 5 and/or Pa2, 3) and tested potatobreeding lines. Plants were grown in glasshouse for six weeks,then plants with soil were taken out and the cysts werecounted. The relative susceptibility of tested cultivars/breed-ing lines was calculated according to the formula:

ðPf of tested sampleÞ=ðPf of susceptible standard cultivarÞ� 100%

(Pf stands for the mean number of cysts determined bycounting all cysts from all replicates; cv. Desirèe was asusceptible standard).

Am. J. Pot Res (2011) 88:245–255 247

Tab

le2

Detailsof

used

markers

Marker

Gene

Typ

e/Enzym

eSize(bp)

Primer

sequ

ence

(5′-3

′)PCRcond

ition

sReferences

TG43

2Grp1

CAPS/RsaI

190

0GGACAGTCATCAGATTGTGG/

GTA

CTCCTGCTTGAGCCATT

94°C

,3min;35

×(94°C,30

s;66

°C,45

s;72

°C,2min

30s);72

°C,3min

Finkers-Tom

czak

etal.20

09

SPUD16

36PCRmarker/−

226

GTGCGCACAGGGTA

AAACC/

ACCTTA

GCGGATGAAAGCC

94°C

,3min;94

°C,30

s;65

°C,1min;72

°C,1min;5×

(94°C,30

s;65

°Cdecreasing

theannealingtemp.

to61

°Cby

1°Cpercycle,

30s;72

°C,30

s);24

×(94°C,

30s;60

°C,30

s;72

°C,30

s);72

°C,5min.

Bryan

etal.20

02

HC

SNP/−

276

ACACCACCTGTTTGATA

AAAAACT/

GCCTTA

CTTCCCTGCTGAAG

94°C

,5min;94

°C,1

min;65

°C,1

min;72

°C,1

min;6×

(94°C,30

s;65

°Cdecreasing

theannealingtemp.

to60

°Cby

1°Cpercycle,

30s;72

°C,30

s);30

×(94°C,

30s;60

,5°C

,30

s;72

°C,30

s);72

°C,5min

Sattarzadeh

etal.20

06

Gro1-4

Gro1-4

SCAR/−

602

TCTTTGGAGATA

CTGATTCTCA/

CGACCTA

AAATGAAAAGCATCT

94°C

,3min;35

×(92°C,45

s;58

°C,45

s;72

°C,1min);

72°C

,10

min

Gebhardtet

al.20

06

U14

GroV1

SCAR/−

366

GGGCTTGTA

TAAGACCTCCGAGAGG/

CCCTTCCTTGGGTAGTTTGAGCG

92°C

,7min;25

×(92°C,1min;57

°C,1min;72

°C,

2min);72

°C,5min

Jacobs

etal.19

96

X02

GroV1

SCAR/−

854

CCACCAAACCCATA

AAGCTGC/

TGTGAATTGGTA

TGAATCTGCAACC

92°C

,7min;25

×(92°C,1min;50

°C,1min;72

°C,

2min);72

°C,5min

Jacobs

etal.19

96

TG68

9H1

SCAR/−

141

TAAAACTCTTGGTTA

TAGCCTA

T/

CAATA

GAATGTGTTGTTTCACCAA

94°C

,2min;35

×(94°C,20

s,55

°C,20

s,72

°C,30

s);

72°C

,5min

deJong

(unp

ublished)

CP113

H1

SCAR/−

760

GCGTTA

CAGTCGCCGTA

T/

GTTGAAGAAATA

TGGAATCAAA

93°C

,3min;35

×(93°C,30

s;51

°C,45

s;72

°C,1min

30s);72

°C,3min

Sku

pino

váet

al.20

02

GCCTTA

CAGTCGCCGTA

T/

GTTGAAGAAATA

TGGAATCAAA

93°C

,3min;5×(93°C,30

s;60

,6°C

,45

s;72

°C,1min

30);30

×(93°C,30

s;58

,6°C

,45

;75

°C,1min

30);

72°C

,5min

Niewöh

neret

al.19

95

239E

4left

H1

CAPS/AluI

230;

120

GGCCCCACAAACAAGAAAAC/

AGGTA

CCTCCATCTCCATTTTGTA

AG

94°C

,3min;35

×(94°C,30

s;51

°C,30

s;72

°C,1min

30s);72

°C,5min

Bakkeret

al.20

04

77R

Gpa

2CAPS/HaeIII

750

CTCGAGGGATTGAATCCAAATTA

T/

GGAAGCAGAATA

CTCCTGACTACT

94°C

,3min;35

×(94°C,15

s;57

°C,15

s;72

°C,1min);

72°C

,5min

vanderVoo

rtet

al.19

99

GP34

Gpa

2CAPS/TaqI

495

CGTTGCTA

GGTA

AGCATGAAGAAG/

GTTA

TCGTTGATTTCTCGTTCCG

94°C

,3min;35

×(94°C,15

s;62

°C,15

s;72

°C,1min);

72°C

,5min

Bendahm

aneet

al.19

97

248 Am. J. Pot Res (2011) 88:245–255

Table 3 Presence of markers linked to major genes conferring resistance to Globodera rostochiensis in 60 resistant cultivars with known andunknown sources of resistance

Cultivar Declared (catalogue)resistance

Source of resistance Presence of marker a

TG689 239E4left Gro1,4 Any marker

Agria Ro1,4 S. tuberosum ssp. andigena CPC 1673(Adg group)

+ − − +

Carrera Ro1 − − − −Cherie Ro1,4 + − − +

Elkana Ro1,2,3 + − − +

Fox Ro1,2,3,5 − − + +

Garant Ro1,5 + − − +

Hopehely Ro1 + + − +

Inwestor Ro1 + − − +

Jasia Ro1 Pa3 + − + +

Klara Ro1 + + − +

Mara Ro1,2,3 − − − −White Lady Ro1 + − − +

Number of cvs with marker 9 2 2 10

Benol Ro1-5 Pa1,2 S. vernei (Vrn group) + − − +

Karnico Ro1-4 Pa2 + + + +

Korona Ro1 + − − +

Nadine Ro1 Pa1,2 + − − +

Neptun Ro1 + − − +

Padea Ro1-5 Pa3 + − + +

Ute Ro1,2,3,5 − − + +

Number of cvs with marker 7 1 4 7

Ajiba Ro1 S. tuberosum ssp. andigena CPC 1673 andS. vernei (Adg+Vrn group)

+ − − +

Ballade Ro1,4 + + − +

Biogold Ro1 + − − +

Darwina Ro1-5 Pa2 + − − +

Kartel Ro1,2,3 Pa2,3 − + − +

Palladia Ro1-5 Pa2,3 + − − +

Pansta Ro1-3 Pa2 + − − +

Ponto Ro1-5 + − + +

Producent Ro1-4 Pa2 + − − +

Proton Ro1,2,3,5 Pa2 + − + +

Sante Ro1 + + − +

Number of cvs with marker 9 3 2 11

Bettina Ro1,2,3,5 S. spegazzini (Spg group) + + + +

Franzi Ro1-5 + + + +

Hilta Ro1,2,3,5 − − + +

Panda Ro1,4,5 + + − +

Number of cvs with marker 3 3 3 4

Bellarosa Ro1-5 Pa1,2 not known + − − +

BF 15 Ro1 − − − −Blaue Schweden Ro1 − − − −Bryza Ro1 + − − +

Colette Ro1 + − − +

Delica Ro1 + − − +

Denar Ro1 + − − +

Dorett Ro1-5 Pa2,3 + − − +

Am. J. Pot Res (2011) 88:245–255 249

Resistance was converted to 9-grade scale, where score 9indicates the highest level of resistance according to the EUCouncil Directive 2007/33/EC. A breeding line wasregarded as resistant, if the score was higher than 5.

Results

Screening of Cultivars

The collection of 72 cultivars was screened for presence ofgenes conferring resistance to Globodera spp. using thespecific marker assays (Tables 3, and 4, Fig. 1).

The first group consists of markers associated with genesconferring resistance to G. rostochiensis. Among them weremarkers TG689, 239E4left and CP113, which are linkedwith the gene H1.

Marker TG689 was amplified for 47 out of 60 resistantcultivars (Tables 3 and 4). The marker was not amplifiedfor susceptible cultivars. Marker 239E4left was amplifiedfor 14 resistant cultivars out of 60 tested and was notamplified for susceptible cultivars (Table 3). Marker CP113was amplified for all tested cultivars—resistant andsusceptible, irrespective of PCR conditions (not shown intables).

Applying the specific primers for the resistance geneGro1-4gave the expected product for 16 resistant cultivars out of 60tested, and was not amplified for susceptible cultivars (Table 3).

In some cultivars, the markers linked to both genes H1and Gro1-4 were identified (Table 3). Although markersTG689, 239E4left and Gro1,4 did not give expectedproducts in cvs Carrera, Mara, BF 15, Blaue Schweden,Edzell Blue, Salad Blue, they were found in cultivars fromall groups of origin resistance.

The next group of examined markers comprised thoselinked to the geneGroV1 (not shown in tables). Markers U14and X02 were amplified in PCR conditions recommended byJacobs et al. (1996). In such conditions, many non-specificbands for both the resistant and susceptible cultivars weregenerated. After changing the temperature conditions (asdescribed in Methods), markers U14 and X02 generatedexpected bands of size 366 and 854 bp respectively, whichdid not correlate with nematode resistance because they wereobserved in both resistant and susceptible cultivars.

Marker TG689 was the most effective, by itselfdetecting 47 of the 60 resistant cultivars. By using markersTG689 and Gro1,4 only five more resistant cultivars weredetected, and while testing markers TG689, Gro1,4 and239E4left only two more resistant cultivars were detected(Table 3).

Table 3 (continued)

Cultivar Declared (catalogue)resistance

Source of resistance Presence of marker a

TG689 239E4left Gro1,4 Any marker

Edzell Blue Ro1 − − − −Felka Bona Ro1 + − − +

Gesa Ro1 + − − +

Inova Ro1 + + − +

Jelly Ro1 − − + +

Juliette Ro1,4 − + − +

Justa Ro1 + + − +

Laura Ro1 + − + +

Lord Ro1 + − − +

Molli Ro1,2 + − + +

Nicola Ro1,4 + + + +

Pino Ro1-5 Pa2 + − − +

Roxana Ro1 − − + +

Salad Blue Ro1 − − − −Sissi Ro1,5 + + + +

Sonda Ro1 + − − +

Valor Ro1 + − − +

Zeus Ro1 + − − +

Number of cvs with marker 19 5 6 22

Total 47 14 17 54

11 susceptible cultivars − − − −

250 Am. J. Pot Res (2011) 88:245–255

The set of markers applied to 15 cultivars with theexpected resistance to G. pallida included markers 77Rand GP34 (associated with the gene Gpa2), markersTG432 and SPUD1636 (associated with QTLs) and theSNP marker HC. The marker 77R was amplified for cv.Nadine. Marker GP34 was amplified for 4 resistantcultivars. Markers 77R and GP34 were not amplified forsusceptible cultivars, which were tested. Marker TG432was amplified for some resistant and susceptible cultivarsirrespective of PCR conditions. Marker SPUD1636 wasamplified for 10 resistant cultivars and was not amplifiedfor tested susceptible cultivars (Table 4). The SNPmarker HC was amplified for three resistant cultivars.This marker was not amplified for tested susceptiblecultivars (Table 4).

By using markers HC, SPUD1636, 77R and GP34 14from 15 resistant cultivars were detected. However,SPUD1636 was by far the most efficient, detecting 10from 15 resistant cultivars by itself (Table 4).

Screening of Breeding Lines

Offspring generated in a crossing programme was previ-ously selected for agricultural traits and comprised 80

Fig. 1 PCR-based marker phenotypes chosen for test their usefulnessfor MAS. The resistance locus and the linked marker are shown on theleft of each panel. The diagnostic DNA fragment of each resistancelocus is indicated by its approximate size in base pairs shown on theright. The first lane shows bands of DNA Ladder. The remaining lanesshow the marker phenotypes of chosen varieties

Table 4 Presence of markers associated with resistance to Globodera pallida in 15 resistant cultivars

Cultivar Declared (catalogue)resistance

Source of resistance Presence of marker a

HC SPUD1636 77R GP34 Any marker

Jasia Ro1 Pa3 S. tuberosum ssp. andigena CPC 1673(Adg group)

+ − − − +

Number of cvs with marker 1 0 0 0 1

Benol Ro1-5 Pa1,2 S. vernei (Vrn group) − + − + +

Karnico Ro1-4 Pa2 − + − − +

Nadine Ro1 Pa1,2 − − + − +

Padea Ro1-5 Pa3 − + − − +

Number of cvs with marker 0 3 1 1 4

Darwina Ro1-5 Pa2 S. tuberosum ssp. andigena CPC 1673 andS. vernei (Adg+Vrn group)

+ + − + +

Innovator Pa2,3 + − − − +

Kartel Ro1,2,3 Pa2,3 − + − − +

Palladia Ro1-5 Pa2,3 − + − + +

Pansta Ro1-3 Pa2 − − − + +

Producent Ro1-4 Pa2 − + − − +

Proton Ro1,2,3,5 Pa2 − + − − +

Number of cvs with marker 2 5 0 3 7

Bellarosa Ro1-5 Pa1,2 not known − − − − −Dorett Ro1-5 Pa2,3 − + − − +

Pino Ro1-5 Pa2 − + − − +

Number of cvs with marker 0 2 0 0 2

Total 3 10 1 4 14

11 susceptible cultivars − − − − −

Am. J. Pot Res (2011) 88:245–255 251

breeding lines, which were screened for the presence ofmarkers identified in their parental forms.

Simultaneously with DNA screening, breeding lineswere tested for phenotypic resistance to relevant Globoderaspp pathotypes (Tables 5 and 6).

A total of 80 breeding lines were evaluated for resistanceto pathotype Ro1 and presence of the marker TG689. Fiftyof them were resistant and TG689-positive (Table 5). Asubgroup of 60 breeding lines was tested for resistance topathotype Ro4 according to resistance ascribed to parentalcultivars. In these individuals 35 were resistant and TG689-positive (Table 5).

Eighteen breeding lines were screened for the presenceof the marker 239E4left. Among them, accordance betweenthe resistance to pathotype Ro1 and the presence of themarker was observed for 9 breeding lines. A subgroup of10 lines was tested for the resistance to pathotype Ro4 andfor 4 of them were resistant and 239E4left -positive(Table 5).

Twenty-two breeding lines were tested for the presenceof the marker Gro1,4 and 8 of them were resistant topathotype Ro1 and marker Gro1,4-positive (Table 5). Asubgroup of 17 breeding lines was tested for resistance topathotype Ro5. Six of them were resistant and Gro1,4-positive (Table 5).

As far as resistance to G. pallida pathotype Pa2 isconcerned, the presence of marker SPUD1636 was evalu-ated in 56 lines and identified in 34 ones, among which 16forms were resistant (Table 6). Additionally, a subgroup of37 breeding lines was tested for resistance to pathotype

Pa3. Only 6 individuals from 22 SPUD1636-positive oneswere resistant (Table 6).

Twenty-one breeding lines were tested for the presenceof the marker GP34. Four of them were resistant to the G.pallida pathotype Pa2 and marker GP34-positive. Addi-tionally 6 individuals were resistant to the G. pallidapathotype Pa3 and marker GP34-positive (Table 6).

For presence of the marker HC, 3 breeding lines obtainedfrom crossing cv. Innovator were evaluated and all of themwere HC-positive. One clone showed a very high level ofresistance to pathotypes Pa2 and Pa3, one was resistant topathotype Pa3 and susceptible to pathotype Pa2, and the lastone was susceptible to both pathotypes (not shown in tables).

Three breeding lines obtained from crossing cv. Nadinewere evaluated for presence of the marker 77R. Two ofthem were 77R-positive, but susceptible to pathotype Pa2(not shown in tables).

Discussion

Some of the markers examined in our study proved to beunsuitable for selection of resistant clones in our conditions,as it was in the case of CP113 linked to the gene H1. In otherstudies, marker CP113 showed either weak (Niewöhneret al., 1995) or good (Skupinová et al., 2002) diagnosticsuitability. The markers U14 and X02 linked to the geneGroV1, marker 77R linked to Gpa2, marker TG432associated with QTL conferring resistance to G. pallidaand the SNP marker HC were unsuitable for diagnostic

Table 5 Apparent resistance phenotype of the clones in which the markers of genes conferring resistance to Globodera rostochiensis weredetected

Marker Ro1 Ro4 Ro5

Resistantmarkerpresent

Susceptiblemarkerpresent

Totaltested

Resistantmarkerpresent

Susceptiblemarkerpresent

Totaltested

Resistantmarkerpresent

Susceptiblemarkerpresent

Totaltested

TG689 50 1 80 35 2 60

239E4left 9 1 18 4 0 10

Gro1,4 8 0 22 6 2 17

Table 6 Apparent resistance phenotype of the clones in which the markers of genes conferring resistance to Globodera pallida were detected

Marker Pa2 Pa3

Resistantmarker present

Susceptiblemarker present

Total tested Resistantmarker present

Susceptiblemarker present

Total tested

SPUD1636 16 18 56 6 16 37

GP34 4 8 21 6 6 21

Markers 77R and HC are not presented because they were not detected in the parental forms of these tested clones

252 Am. J. Pot Res (2011) 88:245–255

purposes. All of them were amplified but not correlated withresistance and susceptibility to nematodes.

However some markers were useful for detection ofresistant cultivars or clones. The marker TG689 linked tothe gene H1 is the most common in resistant cultivars(Biryukova et al. 2008). Marker TG689 was already used inthe breeding programme, as in case of selection of thecultivar Missaukee (Douches et al. 2010). In our research,TG689 was the most effective. We found it in 50 breedinglines out of 67 that were tested and resistant and only oneTG689-positive breeding line was susceptible, which was apromising result. Marker 239Eleft, linked to the same gene,was found to be much less common in cultivars thanTG689. In nearly all 239Eleft-positive individuals themarker TG689 was present too. In addition, marker239Eleft is the CAPS marker and therefore much morelaborious than the SCAR marker TG689, which limits itsusefulness for MAS. Another marker that could be useful inselection of genotypes resistant to G. rostochiensis patho-type Ro1 is marker Gro 1,4 associated with locus Gro1-4,but it was less common than the marker TG689 too.

For cultivars with unknown origin of resistance, markersmay serve for identification of genes present in theirgenomes. Our study revealed cases of cultivars, for whichrelation between pedigree data or described resistance andmolecular characteristics was inconsistent.

Firstly, for some cultivars from Adg group and somewith not known origin, which are reported to be resistant,none of the markers TG689, 239E4left or Gro1,4 wasdetected. The discrepancy between declared resistance andmarker presence may be ascribed to recombination eventspreventing the detection of markers or existence of notdefined resistance genes. As for old and probably notcommonly grown cultivars with unknown origin, the wrongevaluation of resistance might be assumed.

Secondly, the markers associated with the gene H1 wereidentified not only in descendants of S. tuberosum ssp.andigena CPC 1673, but also in cultivars from the Spg andVrn groups. Resistance genes from S. vernei and S.tuberosum ssp. andigena are closely related (Jacobs et al.1996) and might be linked to the same markers. However,in some cultivars markers for the genes H1 and Gro1-4(from S. spegazzini) were identified and it was observed forcultivars from groups Adg, Vrn, Spg as well as for thosewith not known origin of resistance. This may indicate notdocumented introduction of the two resistance genestogether with marker sequence or introduction of themarker sequence alone.

Thirdly, for few cultivars, disagreement between docu-mented origin of resistance and identified marker wasobserved, namely for cvs Fox, Ute and Panda.

Markers TG689, 239E4left and Gro1,4 were used fordetecting resistant breeding lines and their presence was

compared with results of resistance tests. Markers wereinfrequently detected in susceptible forms (only two ones).However, resistant and “marker-negative” individuals oc-curred with various frequencies, which depended onapplied marker and tested pathotype of G. rostochiensis(e.g. 25% of resistant breeding lines resistant to Ro1 wereTG689–negative).

According to Bryan et al. (2002) marker SPUD1636 candetect the chromosomal segment carrying the S. vernei-derived QTL conferring resistance to G. pallida. However,in contrast to markers of the gene H1, SPUD1636 wasamplified for quite large number of breeding lines express-ing low level of resistance. The same applies to markerGP34, linked to the gene Gpa2. Similarly to SPUD1696,marker GP34 was amplified for many susceptible breedinglines. This indicates relatively poor suitability of bothmarkers for selection purposes.

Our study has showed that selection assisted withmolecular markers might encounter problems. The sourcesof resistance are complex and the application of molecularmarkers revealed that genealogical, genetic and phenotypicdata are not always coherent. However, this inconsistencyshould incline to use markers for evaluation of parents. Thismay give information on genetic composition of theresistance.

The inapplicability of published markers indicates thatthe genetic background is decisive in a tetraploid andhighly heterozygous S. tuberosum. The improvement ofmarker assisted selection may be expected if the resistancegene is cloned and can be used as a selection marker.

Acknowledgements This work was partly supported by the project4-3-00-7-02 of the Ministry of Agriculture and Rural Development.

References

Bakker, E., U. Achenbach, J. Bakker, J. van Vliet, J. Peleman, B.Segers, S. van der Heijden, P. van der Linde, R. Graveland, R.Hutten, H. van Eck, E. Coppoolse, E. van der Vossen, J. Bakker,and A. Goverse. 2004. A high-resolution map of the H1 locusharbouring resistance to the potato cyst nematode Globoderarostochiensis. Theoretical and Applied Genetics 109: 146–152.

Barone, A. 2004. Molecular marker-assisted selection for potatobreeding. American Journal of Potato Research 81: 111–117.

Barone, A., E. Ritter, U. Schachtschabel, T. Debener, F. Salamini, andC. Gebhardt. 1990. Localization by restriction fragment lengthpolymorphism mapping in potato of a major dominant geneconferring resistance to the potato cyst nematode Globoderarostochiensis. Molecular and General Genetics 224: 177–182.

Bendahmane, A., K. Kanyuka, and D.C. Baulcombe. 1997. High-resolution genetical and physical mapping of the Rx gene forextreme resistance to potato virus X in tetraploid potato.Theoretical and Applied Genetics 95: 153–162.

Biryukova, V.A., A.A. Zhuravlev, S.B. Abrosimova, L.I. Kostina,L.M. Khromova, I.V. Shmyglya, N.N. Morozova, and S.N.Kirsanova. 2008. Use of molecular markers of potato golden

Am. J. Pot Res (2011) 88:245–255 253

nematode resistance genes H1 and GRO1. Russian AgriculturalSciences 34: 365–368.

Bradshaw, J.E., C.A. Hackett, R.C. Meyer, D. Milbourne, J.W.McNicol, M.S. Phillips, and R. Waugh. 1998. Identification ofAFLP and SSR markers associated with quantitative resistance toGlobodera pallida (Stone) in tetraploid potato (Solanum tuber-osum subsp. tuberosum) with a view to marker-assisted selection.Theoretical and Applied Genetics 97: 202–210.

Bryan, G., K. McLean, J. Bradshaw, W. De Jong, M. Phillips, L. Castelli,and R. Waugh. 2002. Mapping QTLs for resistance to the cystnematode Globodera pallida derived from the wild potato speciesSolanum vernei. Theoretical and Applied Genetics 105: 68–77.

Caromel, B., D. Mugniéry, V. Lefebvre, S. Andrzejewski, D.Ellissèche, M.C. Kerlan, P. Rousselle, and F. Rousselle-Bourgeois. 2003. Mapping QTLs for resistance against Globo-dera pallida (Stone) Pa2/3 in a diploid potato progenyoriginating from Solanum spegazzini. Theoretical and AppliedGenetics 106: 1517–1523.

Caromel, B., D. Mugniéry, M.C. Kerlan, S. Andrzejewski, A. Palloix,D. Ellissèche, F. Rousselle-Bourgeois, and V. Lefebvre. 2005.Resistance quantitative trait loci originating from Solanumsparsipilum act independently on the sex ratio of Globoderapallida and together for developing a necrotic reaction. Molec-ular Plant-Microbe Interactions 18: 1186–1194.

Castelli, L., G. Ramsay, G. Bryan, S.J. Neilson, and M.S. Phillips.2003. New sources of resistance to the potato cyst nematodesGlobodera pallida and G. rostochiensis in the commonwealthpotato collection. Euphytica 129: 377–386.

Douches, D.S., J. Coombs, K. Felcher, W.W. Kirk, C. Long, andG. Bird. 2010. Missaukee: a round white potato varietycombining chip-processing with resistance to late blight, Verti-cillium Wilt and Golden Cyst Nematode. American Journal ofPotato Research 87: 10–18.

EPPO/OEPP. 2004. Diagnostic protocols for regulated pests, Europeanand Mediterranean plant protection organization. OEPP/EPPOBulletin 34: 309–314.

Evans, K., and D.L. Trudgill. 1992. Pest aspects of potato production.Part 1. The nematode pests of potato. In The potato crop, 2nd ed,ed. P. Harris, 438–475. London: Chapman and Hall.

Finkers-Tomczak, A., S. Danan, T. van Dijk, A. Beyene, L. Bouwman, H.Overmars, H. van Eck, A. Goverse, J. Bakker, and E. Bakker. 2009.A high-resolution map of the Grp1 locus on chromosome V ofpotato harbouring broad-spectrum resistance to the cyst nematodeGlobodera pallida and Globodera rostochiensis. Theoretical andApplied Genetics 119: 165–173.

Gebhardt, C., and J.P.T. Valkonen. 2001. Organization of genescontrolling disease resistance in the potato genome. AnnualReview of Phytopathology 39: 79–102.

Gebhardt, C., D. Mugniery, E. Ritter, F. Salamini, and E. Bonnel.1993. Identification of RFLP markers closely linked to the H1gene conferring resistance to Globodera rostochiensis in potato.Theoretical and Applied Genetics 85: 541–544.

Gebhardt, C., D. Bellin, H. Henselewski,W. Lehmann, J. Schwarzfischer,and J.P.T. Valkonen. 2006. Marker-assisted combination of majorgenes for pathogen resistance in potato. Theoretical and AppliedGenetics 112: 1458–1464.

Jacobs, J.M.E., H.J. van Eck, K. Horsman, P.F.P. Arens, B. Verkerk-Bakker, E. Jacobsen, A. Pereira, and W.J. Stiekema. 1996.Mapping of resistance to the potato cyst nematode Globoderarostochiensis from the wild potato species Solanum vernei.Molecular Breeding 2: 51–60.

Kreike, C.M., J.R.A. de Koning, J.H. Vinke, J.W. van Ooijen,C. Gebhardt, and W.J. Stiekema. 1993. Mapping of loci involvedin quantitatively inherited resistance to the potato cyst-nematodeGlobodera rostochiensis pathotype Ro1. Theoretical and AppliedGenetics 87: 464–470.

Kreike, C.M., J.R.A. de Koning, J.H. Vinke, J.W. van Ooijen, andW.J. Stiekema. 1994. Quantitatively-inherited resistance toGiobodera pallida is dominated by one major locus in Solanumspegazzinii theoretical and applied genetics 88: 764–769.

Kreike, C.M., A.A. Kok-Westeneng, J.H. Vinke, and W.J. Stiekema.1996. Mapping of QTLs involved in nematode resistance, tuberyield and root development in Solanum sp. Theoretical andApplied Genetics 92: 463–470.

Niewöhner, J., F. Salamini, and C. Gebhardt. 1995. Development ofPCR assays diagnostic for RFLP marker alleles closely linked toalleles Gro1 and H1, conferring resistance to the root cystnematode Globodera rostochiensis in potato. Molecular Breeding1: 65–78.

Oerke, E.C., H.W. Dehne, F. Schönbeck, and A. Weber. 1994. Cropproduction and crop protection: Estimated losses in major foodand cash crops. Amsterdam: Elsevier.

Paal, J., H. Henselewski, J. Muth, K. Meksem, C.M. Menéndez, F.Salamini, A. Ballvora, and C. Gebhardt. 2004. Molecular cloningof the potato Gro1-4 gene conferring resistance to pathotype Ro1of the root cyst nematode Globodera rostochiensis, based on acandidate gene approach. Plant Journal 38: 285–297.

Pineda, O., M.W. Bonierbale, R.L. Plaisted, B.B. Brodie, and S.D.Tanksley. 1993. Identification of RFLP markers linked to the H1gene conferring resistance to the potato cyst nematode Globoderarostochiensis. Genome 36: 152–156.

Ross, H. 1979. Wild species and primitive cultivars as ancestors ofpotato varieties. In Proc. Conf. Broadening Genet. Base Crops,237–244. Wageningen. Pudoc.

Ruiz de Galarreta, J.I., A. Carrasco, A. Salazar, I. Barrena, E. Iturritxa,R. Marquinez, F.J. Legorburu, and E. Ritter. 1998. Wild Solanumspecies as resistance sources against different pathogens ofpotato. Potato Research 41: 57–68.

Sagredo, B., M. Mathias, J. Kalazich, and W. De Jong. 2004. Gene H1detection of golden nematode (Globodera rostochiensis) resis-tance in INIA-Chile potato germoplasm using molecular markers.Suplemento Revista Latinoamericana de la Papa.

Sattarzadeh, A., U. Achenbach, J. Lübeck, J. Strahwald, E. Tacke,H.R. Hofferbert, T. Rothsteyn, and C. Gebhardt. 2006. Singlenucleotide polymorphism (SNP) genotyping as basis for devel-oping a PCR-based marker highly diagnostic for potato varietieswith high resistance to Globodera pallida pathotype Pa2/3.Molecular Breeding 18: 301–312.

Skupinová, S., P. Vejl, and J. Domkářová. 2002. Segregation of DNAmarkers of potato (Solanum tuberosum ssp. tuberosum L.)resistance against Ro1 pathotype Globodera rostochiensis inselected F1 progeny. Rostlinná Výroba 48: 480–485.

Smith, I.M., D.G. McNamara, P.R. Scott, and K.M. Harris. 1992.Quarantine pests for Europe. C.A.B. Int. &EPPO.

Świeżyński, K.M., K.G. Haynes, R.C.B. Hutten, M.T. Sieczka,P. Watts, and E. Zimnoch-Guzowska. 1997. Pedigree ofEuropean and North-American potato varieties. Plant Breedingand Seed Science, supplement to vol 41, nr 1.

Uhrig, H., and G. Wenzel. 1981. Solanum gourlayi Hawkes as a sourceof resistance against the white potato cyst nematode Globoderapallida Stone. Zeitschrift für Pflanzenzüchtg 86: 148–157.

van der Voort, J.R., P. Wolters, R. Folkertsma, R. Hutten, P. vanZandvoort, H. Vinke, K. Kanyuka, A. Bendahmane, E. Jacobsen,R. Janssen, and J. Bakker. 1997. Mapping of the cyst nematoderesistance locus Gpa2 in potato using a strategy based oncomigrating AFLP markers. Theoretical and Applied Genetics95: 874–880.

van der Voort, J.R., W. Lindeman, R. Folkertsma, R. Hutten, H.Overmars, E. van der Vossen, E. Jacobsen, and J. Bakker. 1998.A QTL for broad-spectrum resistance to cyst nematode species(Globodera spp.) maps to a resistance gene cluster in potato.Theoretical and Applied Genetics 96: 654–661.

254 Am. J. Pot Res (2011) 88:245–255

van der Voort, J.R., K. Kanyuka, E. van der Vossen, A. Bendahmane,P. Mooijman, R. Klein-Lankhorst, W. Stiekema, D. Baulcombe,and J. Bakker. 1999. Tight physical linkage of the nematoderesistance gene Gpa2 and the virus resistance gene Rx on a singlesegment introgressed from the wild species Solanum tuberosumsubsp. andigena CPC 1673 into cultivated potato. MolecularPlant-Microbe Interactions 12: 197–206.

van der Voort, J.R., E. van der Vossen, E. Bakker, H. Overmars, P. vanZandvoort, R. Hutten, R. Klein Lankhorst, and J. Bakker. 2000.

Two additive QTLs conferring broad-spectrum resistance inpotato to Globodera pallida are localized on resistance geneclusters. Theoretical and Applied Genetics 101: 1122–1130.

van der Vossen, E.A.G., J.R. van der Voort, K. Kanyuka, A.Bendahmane, H. Sandbrink, D.C. Baulcombe, J. Bakker, W.J.Stiekema, and R.M. Klein-Lankhorst. 2000. Homologues of asingle resistance-gene cluster in potato confer resistance todistinct pathogens: a virus and a nematode. Plant Journal 23:567–576.

Am. J. Pot Res (2011) 88:245–255 255