prame expression in hairy cell leukemia

L

A

CPqmP

K

1

wHmdaPahi[ctpll

oBf

0d

ARTICLE IN PRESSR-2964; No. of Pages 7

Available online at www.sciencedirect.com

Leukemia Research xxx (2008) xxx–xxx

PRAME expression in hairy cell leukemiaEvgeny Arons, Tara Suntum, Inger Margulies, Constance Yuan,

Maryalice Stetler-Stevenson, Robert J. Kreitman ∗Laboratories of Molecular Biology and Clinical Pathology, Center for Cancer Research, National Cancer Institute,

National Institutes of Health, United States

Received 15 October 2007; received in revised form 20 December 2007; accepted 20 December 2007

bstract

PRAME has been proposed as a useful marker for solid tumors and acute B-cell malignancies. Several studies demonstrate expression inLL. To further examine its B-cell tumor distribution, we studied PRAME in both CLL and hairy cell leukemia (HCL). While by conventional
CR only 8% of 37 HCL and 27% of 22 CLL patients were positive, nearly all patients and normal donors expressed PRAME by real-timeuantitative (TaqMan) PCR. We conclude that HCL and CLL differ in PRAME overexpression, and that basal normal expression of PRAMEay limit its usefulness for following patients with minimal residual CLL or HCL.ublished by Elsevier Ltd.
emia; P

mm

aniacana

nhb

eywords: Hairy cell leukemia; Real-time PCR; Chronic lymphocytic leuk

. Introduction

PRAME (Preferentially Expressed Antigen of Melanoma)as originally identified as a tumor antigen recognized byLA-A24- and HLA-A2-restricted cytotoxic T cells against aelanoma surface antigen [1,2]. It is considered a melanocyte

ifferentiation antigen which is overexpressed in both solidnd hematologic tumors. In normal tissue, a very low level ofRAME expression is found in normal testis, adrenals, ovarynd endometrium [1]. A high level of PRAME expressionas been reported for several solid tumors, including ovar-an cancer [3], breast cancer [4], lung cancer and melanomas1], medulloblastoma [5], sarcomas [6], head and neck can-ers [7], neuroblastoma [8], renal cancer [9], and Wilms’umor [10]. Hematologic malignancies reported to overex-

Please cite this article in press as: Arons E, et al., PRAMdoi:10.1016/j.leukres.2007.12.010

ress PRAME include acute lymphoblastic and myelogenouseukemias (ALL and AML) [1,11–18], chronic myelogenouseukemia (CML) [18–20], Hodgkin’s disease [21], multiple

∗ Corresponding author at: Clinical Immunotherapy Section, Laboratoryf Molecular Biology, 9000 Rockville Pike, Building 37, Room 5124b,ethesda, MD 20892-4255, United States. Tel.: +1 301 496 6947;

ax: +1 301 576 3920.E-mail address: [email protected] (R.J. Kreitman).

[Ptpca

sP

145-2126/$ – see front matter. Published by Elsevier Ltd.oi:10.1016/j.leukres.2007.12.010

RAME; TaqMan; Minimal residual disease

yeloma [22,23], chronic lymphocytic leukemia (CLL) andantle cell lymphoma (MCL) [12,24–26].PRAME gene is located on chromosome 22 (22Q11.22)

nd encodes a protein consisting of 509 amino acids. As auclear protein, it binds to retinoic acid receptor a, therebynhibiting retinoic acid induced differentiation, growth arrest,nd apoptosis [27,28]. Overexpression of PRAME is asso-iated with hypomethylation in its regulatory regions [29],nd in pediatric acute leukemias confers a favorable prog-osis, possibly by inhibiting tumorigenicity and enhancingpoptosis [28].

The strong expression of PRAME in acute B-cell malig-ancies compared to normal blood or bone marrow samplesas suggested real-time quantification of PRAME as a possi-le method for monitoring minimal residual disease (MRD)17,30]. Conventional RT-PCR studies with CLL showedRAME expression in 3–16% patients [12,26]. By quanti-

ative real-time PCR studies, 18–28% of CLL patients wereositive versus 0% of normal donors [24,25]. These studiesoncluded that PRAME may be a potential target for therapy

E expression in hairy cell leukemia, Leuk Res (2008),

nd a useful marker for MRD detection in CLL.Recent molecular studies with hairy cell leukemia (HCL)

how important differences compared to CLL [31,32].RAME expression has not been reported in patients with

dx.doi.org/10.1016/j.leukres.2007.12.010

mailto:[email protected]


INLR-2964; No. of Pages 7

2 a Resea

Htiwtn

2

2

Cm(i3

2

as(isdrpCC(

2

ICitppptdb7c97afitw[

GC

2

uf33T1lBpI(Pw0aw9

urrhGAGig[

3

3c

uEulcPcn

3

ARTICLEE. Arons et al. / Leukemi

CL. To determine if PRAME might be a useful marker forherapy or MRD detection in HCL, and to determine whetherts expression in this disease would be different than in CLL,e assessed PRAME expression by conventional and real-

ime quantitative PCR in patients with CLL and HCL, and inormal donors.

. Materials and methods

.1. Cell lines

The HCL cell lines HC1, Bonna-12, and Eskol, theML line K562, the Burkitt’s lymphoma line Raji, and theurine K1 cell line were maintained in RPMI 1640 medium

Biosource, Camarillo, CA) supplemented with 10% heat-nactivated fetal bovine serum (HyClone, Logan, UT) at7 ◦C in a humidified 5% CO2 atmosphere.

.2. Patients and controls

Blood collected in heparin and EDTA tubes was obtaineds part of sample acquisition protocols with informed con-ents approved by the NCI Investigator’s Review BoardIRB). Complete peripheral blood mononuclear cell (PBMC)mmunophenotypic analysis was performed as part of theirtandard evaluation. Flow cytometry was performed asescribed [33]. The diagnosis of HCL by flow cytometryequired demonstration of the typical immunophenotypicrofile of monoclonal lambda or kappa light chain, CD19,D103, and abnormally high levels of CD20, CD22 andD11c. Classic HCL expressed CD25 while the variant

HCLv) did not.

.3. RT-PCR

1 �g total RNA was reverse transcribed with SuperScriptII reverse transcriptase (Invitrogen Corporation, Carlsbad,A) and an oligo(dT)20 primer (Invitrogen). The result-

ng cDNAs were used as template to amplify PRAMEranscripts in a 50-�l reaction containing 0.4 �M forwardrimer (5′-GTCCTGAGGCCAGCCTAAGT-3′) and reverserimer (5′-GGAGAGGAGGAGTCTACGCA-3′) [14]. Theserimers were specific for human PRAME. Included inhe PCR reaction were 1.5 mM MgCl2, 200 �M of eachNTP, and 2.5 U of GoldTaq polymerase in supplieduffer from Applied Biosystems (Foster City, CA). The-min initial denaturation at 95 ◦C was followed by 35ycles of PCR, each consisting of 30 s denaturation at4 ◦C, 30 s annealing at 64 ◦C, and 1 min extension at2 ◦C. The PCR finished after a further 10-min extensiont 72 ◦C. Under similar conditions, GAPDH was ampli-


ed as an internal control for each human cDNA usinghe primers 5′-AGCCACATCGCTCAGACACC-3′ (for-ard) and 5′-GTACTCAGCGCCAGCATCG-3′ (reverse)

34] and murine cDNA using the primers 5′-TGCA-

T

t

PRESSrch xxx (2008) xxx–xxx

TGCCAGCCTCGTCCC-3′ (forward) and 5′-CATACT-AGCACCGGCCTCAC-3′ (reverse).

.4. Real-time quantitative PCR assay (TaqManTM)

The level of PRAME expression was determinedsing PRAME specific primers and probe as follows:orward primer, 5′-TCTTCCTACATTTCCCCGGA-′; reverse primer, 5′-GCACTGCAGACTGAGGAACTGA-′; and fluorescent probe, 5′-AAGGAAGAGCAGTA-ATCGCCCAGTTCACC-3′; amplicon boundaries,052–1126 nt; amplicon size 75 bp [18]. The probe wasabeled with the 5′-reporter dye FAM and the 3′-quencherHQ1. All primers and probes were human-specific andurchased from Integrated DNA Technologies (Coralville,A). Real-time PCR was performed with a IQ5 thermal cyclerBioRad Laboratories, Hercules, CA) using a QuantiTectTM

robe PCR kit (QIAGEN Inc., Valencia, CA). Briefly, cDNAas amplified in a 25 �l total volume per reaction using.4 �M PRAME specific primers, 0.2 �M TaqMan probe,nd QuantiTect Probe PCR Master Mix. Reaction conditionsere as follows: 95 ◦C for 15 min followed by 40 cycles of4 ◦C for 15 s and 60 ◦C (universal conditions) for 60 s.

Data relative to PRKG1 expression were analyzedsing IQ5 Optical System Software (BioRad Laborato-ies, Hercules, CA). IgH expression level was determinedelative to PRKG1 gene expression level amplified usinguman PRKG1 gene specific primers and probe—PRKG1-F:GGAAAAGATGCTTCTGGGAA, PRKG1-R: TTGGAAGTGAAGCTCGGAAA, PRKG1-P: AAGGTTAAAGCC-AGCCA [35]. Data was presented as 2−�Ct, where Ct

s the threshold cycle and �Ct is the Ct value of tar-et amplification minus that of reference amplification36].

. Results

.1. PRAME expression in HCL cell lines byonventional PCR

PRAME expression was studied by conventional PCRsing PRAME specific primers in three HCL cell lines, HC1,skol and Bonna12, as well as in the CML cell line K562sed as a positive control [14]. The Burkitt’s lymphoma celline Raji and murine K1 cell line were used as negativeontrols [17]. As shown in Fig. 1 and Table 1, the 835 bpRAME-specific PCR product was expressed only by K562ells. In contrast, all HCL cell lines, Raji and K1 cells wereegative.

.2. PRAME expression by real-time quantitative


aqMan PCR in HCL lines

PRAME expression was quantified using the TaqMan sys-em, and intensity was calculated relative to that of PRKG1


ARTICLE IN PRESSLR-2964; No. of Pages 7

E. Arons et al. / Leukemia Research xxx (2008) xxx–xxx 3

Fig. 1. Conventional RT-PCR of PRAME in cell lines. PRAME and theha

gdsH1K

3

cdwmTwtflac

Table 1PRAME expression* by TaqMan assay in B-cell malignancies derived celllines

Cell line PRAME expression

Bonna12 2.3 × 10−4 ± 9.9 × 10−5

Eskol 1.2 × 10−4 ± 5.3 × 10−5

HC1 4.8 × 10−4 ± 1.9 × 10−5

K1 0K562 2.1 ± 0.88

tG

(ob(

3p

psgu(nn

TF

S

%

N

P

P

E

P

ousekeeping gene GAPDH were amplified using unlabeled primers. Shownre agarose gels stained with ethidium bromide.

ene expression [37]. The positive control K562 cell lineemonstrated the highest level of relative PRAME expres-ion, 2.1. Mouse K1 cells were completely negative. All 3CL cell lines showed measurable PRAME expression, at.2–4.8 × 10−4, about 4 logs lower than the positive control562 (Table 1).

.3. Clinical characteristics of patients

PRAME expression was assessed in 37 patients withlassic HCL, 6 with HCLv, 4 with HCL without evi-ence of HCL cells in the peripheral blood (HCL-CR), 22ith CLL, 2 with follicular lymphoma (FL) and 12 nor-al donors. Flow cytometry and PCR results are listed inable 2. The percentage of circulating mononuclear cellshich were malignant in HCL patients ranged from 0.03

o 93% (median 6%), compared to 5.4–97% (median 48%)


or HCLv and 1–99% (median 93%) for CLL. The abso-ute numbers of leukemic cells per microliter (mm3) arelso listed. By rank order, the percentages and absoluteoncentrations were lower for HCL than for either HCLv

Ttwc

able 2low cytometry and PCR results of patients and controls

HCL H

amples 37 4

Circulating leukemic cells in peripheral bloodRange 0.03–93% 0Median 6% 0

umber of circulating leukemic cells in peripheral blood (cells/mm3)Range 0.4–20,000 0Median 30 0

ositive for PRAME by conventional RT-PCR (%) 3 (8%) 0

RAME expression by real-time quantitative PCRPositive (%) 37 (100%) 3

xpression relative to PRKG1Range (low) 6.3 × 10−5 0Range (high) 0.22 0Median 0.033 0Mean 0.049 0Standard deviation (S.D.) 0.051 0

RAME overexpression by real-time quantitative PCR (%)* 4 (11%) 0

* PRAME overexpression is defined as ≥3 S.D. above the mean of normal contro

* PRAME expression in human cells is defined as the ratio of PRAMEo PRKG1 expression and in murine K1 cells by the ratio of PRAME andAPDH expression.

p = 0.017 for percentages, p = 0.004 for concentrations)r CLL (p < 0.0001). Also, circulating cell concentrationsut not percentages were higher for CLL than for HCLvp = 0.019).

.4. PRAME expression in peripheral blood samples ofatients with HCL and CLL by conventional RT-PCR

To detect PRAME expression by conventional PCR,atients samples were subjected to RT-PCR using PRAME-pecific primers and the products were analyzed by agaroseels. As shown in Table 2, A PRAME-specific PCR prod-ct was detected in 3 (8%) out of 37 HCL samples, in 627%) out of 22 CLL samples, and in 1 (8%) out of 12ormal controls. All HCL-CR, HCLv and FL samples wereegative for PRAME expression by conventional RT-PCR.


here was a trend for higher incidence of PRAME posi-ivity in CLL than HCL (p = 0.066, Fisher’s exact). Thereas no correlation between PRAME expression and clini-

al or laboratory features, such as number of leukemic cells

CL-CR HCLv FL CLL Normal

6 2 22 12

5.4–97% 0 1–99% 048% 0 93% 0

110–57,000 0 25–510,000 01,400 0 67,000 0

(0%) 0 (0%) 0 (0%) 6 (27%) 1 (8%)

(75%) 6 (100%) 2 (100%) 22 (100%) 12 (92%)

5.2 × 10−4 9.2 × 10−3 6.2 × 10−3 0.067 0.034 0.029 41 0.087.039 8.5 × 10−3 0.019 0.056 0.016.036 0.013 0.019 2.000 0.027.036 0.014 0.014 8.8 0.029

(0%) 0 (0%) 0 (0%) 6 (27%) 1 (8%)

ls.



4 a Resea

ie

3pr

wPppmSetFiwpciPPtdne0PoqnfnChlfa

Ffa

3

bbmwpBc0BP(achHpbcan decrease significantly with decreasing tumor burden inHCL, even if PRAME expression was not elevated prior totreatment. However, correlation between PRAME and HCLtumor burden was not a consistent finding.


n the peripheral blood, disease length, and degree of organnlargement.

.5. PRAME expression in peripheral blood samples ofatients with B-cell malignancies by quantitativeeal-time PCR

PRAME expression using the quantitative TaqMan assayas studied in the same group as conventional PCR, usingRKG1 gene expression as reference [37]. The assay waserformed in triplicate and relative PRAME expression isresented in Fig. 2. For each group of patients, the ranges,edians, means and standard deviations are listed in Table 2.amples were considered to overexpress PRAME if theirxpression level was at least three standard deviations abovehe mean level of expression reported for the normal group.our (11%) of the HCL patients showed overexpression,

ncluding all 3 of the patients for which PRAME expressionas demonstrated by conventional RT-PCR, and 1 additionalatient for which conventional RT-PCR results were equivo-al. Six (27%) of the CLL patients overexpressed PRAME,ncluding 5 of the 6 patients positive by conventional RT-CR. One patient positive by conventional RT-PCR had aRAME level of 0.108, which was 2.85-fold higher than

he mean of normal controls, and thus did not meet theefinition for overexpression of 3-fold above the mean oformal controls. Median PRAME relative expression lev-ls were 0.033 in HCL, 0.039 in HCL-CR, 0.009 in HCLv,.019 in FL, 0.056 in CLL, and 0.016 in the control group.RAME was not overexpressed among any HCLv, HCL-CRr FL patients. By rank order (Wilcoxon) analysis, real-timeuantitative PRAME expression was significantly higher thanormal controls in CLL (p = 0.0077), and there was a trendor higher expression than normal in HCL (p = 0.06), butot in HCLv (p = 0.35). PRAME expression was higher inLL than in either HCL (p = 0.02) or HCLv (p = 0.004), and


igher in HCL than in HCLv (p = 0.02). There was no corre-ation between the level of PRAME expression and clinicaleatures, including disease prognosis or response to ther-py.

ig. 2. PRAME expression relative to PRKG1. Relative expression is shownor the samples listed in Table 2. The housekeeping gene PRKG1 was useds a reference.

F(etcc


.6. PRAME expression during HCL treatment

The correlation between PRAME expression and tumorurden (assessed by number of HCL cells in peripherallood) was studied in 4 patients before and during treat-ent with BL22, a recombinant anti-CD22 immunotoxinith clinical activity in HCL [38,39]. Only 1 (25%) of theatients had PRAME activity considered elevated prior toL22, defined as 3 standard deviations above the mean ofontrols (Table 2). Pretreatment PRAME levels were 0.040,.032, 0.109 and 0.15 for patients BH02, BH05, BH07 andH11, respectively. As shown in Fig. 3B for patient BH05,RAME expression was strongly and directly correlatedr2 = 0.961, p < 0.0001) with circulating HCL cells, althought one point (i.e. day 250) an increase in HCL count was asso-iated with a decrease in PRAME expression. Patient BH02ad an increase in PRAME expression with a decrease inCL count, but without significant correlation (r2 = 0.080,= 0.46). Patients BH07 and BH11 also had no correlationetween PRAME expression and HCL counts. Thus PRAME


ig. 3. PRAME expression and circulating HCL cells. HCL patients BH02A), BH05 (B), BH07 (C), and BH11 (D) were treated with BL22. PRAMExpression, determined by real-time quantitative PCR (�), and concen-rations of circulating HCL cells (©) in cells/mm3, determined by flowytometry, are shown at the indicated time points after beginning the firstycle of treatment.



a Resea

4

ebefsWbnqHaca

4

oPsi3tpnccriOeibbimtPtpHc

4

tbcwcMd

CwpbptttwBttbitHimtBspiPd

4

uFteiCce9cTca1ltbov

4H


. Discussion

PRAME expression has been characterized for a wide vari-ty of solid tumors and hematological malignancies [1,3–26],ut has yet to be reported for HCL. To determine if PRAME isxpressed in HCL, and like in other tumors, may be a markeror following MRD, we studied HCL cell lines and patientamples using conventional and real-time quantitative PCR.e found by conventional PCR that PRAME was expressed

y 8% of HCL samples compared to 27% of CLL and 8% oformal controls, and that the level of PRAME expression byuantitative real-time PCR was higher in CLL than in eitherCL or normal controls. Moreover, 1 out of 4 HCL patients

chieving CR had a decrease in PRAME levels significantlyorrelating with disease burden, while the other HCL patientschieving CR did not.

.1. PRAME expression on malignant and normal cells

PRAME was reported to be expressed in 35–41% of casesf pediatric AML and both pediatric and adult ALL [17].RAME expression was much lower in normal controls,uggesting its utility in following MRD [30]. RT-PCR stud-es with CLL showed PRAME expression in 6 (16%) of8 patients [12] and 1 (3%) of 30 patients [26]. By quan-itative real-time PCR, 6 (18%) of 33 CLL patients wereositive (defined as cycle threshold <40) versus 0 of 15ormal donors [24]. In another study, 5 (28%) of 18 CLLases were positive (defined as copy number >2.5/10,000ells), versus none of 42 normal donors [25]. Our study alsoequired a cycle threshold (Ct) of <40 to be considered pos-tive and we did not determine PRAME copy number/cells.ur finding that samples from nearly all normal donors

xpress PRAME was previously observed by flow cytometryn 15 normal controls [24] and by RQ-PCR in 25 normallood and bone marrow samples [17]. PRAME positivityy flow cytometry was associated with PRAME negativ-ty by RQ-PCR in one study, possibly due to the RQ-PCR

ethod and to the primer sequences used [24]. It is cer-ainly possible that normal cells alone were responsible forRAME expression in our samples. PRAME expression from

he malignant cells likely occurred in at least some sam-les, since PRAME was overexpressed in patients with >90%CL cells and in several CLL patients with 95–99% CLL

ells.

.2. PRAME as a target for following MRD in HCL

A good target for following MRD must be detectable inhe presence of a low number of malignant cells and alsoe specific for tumor versus normal cells. We presented bothonventional and RQ-PCR data to determine if either method


ould provide a difference between normal and malignantells significant enough to justify PRAME as a target forRD in this disease. In the present study, the incidence and

egree of PRAME expression in HCL appears lower than in

Cpt

PRESSrch xxx (2008) xxx–xxx 5

LL, and normal PBMCs expressed PRAME at a level whichas similar to that of the HCL patients. In fact, the one HCLatient with significant correlation (r2 = 0.96, p < 0.0001)etween PRAME level and tumor burden (Fig. 3B) had aeak (pretreatment) PRAME level (0.03) which was essen-ially identical to the mean for normal controls. This suggestshe possibility that in this patient, PRAME was expressed byhe normal rather than the HCL cells, and that the decreaseith treatment was due to a decrease in normal cells. BecauseL22 is specific for B-cells and because normal cells in

his patient did not decrease during achievement of CR,hat explanation for this patient is unlikely. Nevertheless,ecause pretreatment PRAME expression in HCL patientss not very high compared to normal expression, it is unlikelyo be of value in following MRD. In fact, in leukemias likeCL, the normal PBMCs would be expected to significantly

ncrease several months after achievement of CR, and thisight lead to increases in PRAME expression despite loss of

he HCL cells. This might have been the case in patientsH02 (Fig. 3A) and BH11 (Fig. 3D). Using the patient-

pecific immunoglobulin rearrangement as a target, recentlyublished real-time PCR methods can detect one HCL celln as many as 106 normal cells [40]. Our results indicate thatRAME cannot add to these previously reported methods foretecting MRD in HCL.

.3. PRAME as an MRD target for other leukemias

We speculate that PRAME expression would be of limitedse in following MRD in other leukemias, particularly CLL.or example, in our study, even as little as a 1-log reduc-

ion of CLL would in nearly all patients reduce the PRAMExpression (if due to CLL) to levels at or below that foundn normal controls. However, there may be patients withLL expressing high levels of PRAME for which diseaseould be followed by monitoring PRAME expression. Forxample, it was reported that CLL cells express a median of364 sties/cell and range up to 24,665 sites/cell of PRAME,ompared to a median of 1659 sites/cell on normal cells [24].hus, for some CLL patients, 1–2 logs of disease reductionould be monitored. In contrast, some patients with pedi-tric AML by RQ-PCR expressed PRAME in excess of3-logs more than the mean of normal samples, and evenow expressers of pediatric AML and ALL had 6 logs morehan the mean of normal controls [17]. Thus PRAME maye a poor MRD target for chronic leukemias but an excellentne for the acute leukemias, particularly for patients withery high pre-treatment expression.

.4. Differences in PRAME expression between CLL andCL


It is notable that significant differences are found betweenLL and HCL in terms of level of PRAME expression. It isossible that these differences were simply due to the higherumor burden in CLL compared to HCL patients, but in nei-



6 a Resea

t(epoPim[letCcl

A

aSBcsI

acm

R

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[


her disease was there a correlation between tumor burdenconcentration of circulating leukemic cells) and PRAMExpression. Moreover, the tumor burden in most of the HCLatients overexpressing PRAME was lower than that of >95%f the CLL patients, most of whom did not overexpressRAME. We have recently reported a number of differences

n these 2 diseases with respect to immunoglobulin rearrange-ents, in terms of VH gene usage and mutation frequency

31] and also in light chain kappa/lambda usage ratios andight chain gene usage [41]. We would speculate that PRAMExpression is different in these 2 leukemias either because athe time of malignant transformation the precursor HCL andLL cells express different levels of PRAME, or becauseertain characteristics of differentiated HCL and CLL cellsead to different tendencies for PRAME overexpression.

cknowledgements

We thank the nurses Karen Bergeron, Rita Mincemoyer,nd Linda Ellison-Dejewski, and patient care coordinatoronya Duke, for helping to obtain clinical samples, andarbara Debrah for performing calculations to determineoncentrations of circulating leukemic cells. This work wasupported by the intramural program of the National Cancernstitute, NIH.

Contributions. EA and TS performed PCR assays, CYnd MS interpreted flow cytometry assays, IM worked withell lines, and EA and RJK analyzed all data and wrote theanuscript.

eferences

[1] Ikeda H, Lethe B, Lehmann F, van Baren N, Baurain JF, de Smet C,et al. Characterization of an antigen that is recognized on a melanomashowing partial HLA loss by CTL expressing an NK inhibitory receptor.Immunity 1997;6:199–208.

[2] Kessler JH, Beekman NJ, Bres-Vloemans SA, Verdijk P, van Veelen PA,Kloosterman-Joosten AM, et al. Efficient identification of novel HLA-A(*)0201-presented cytotoxic T lymphocyte epitopes in the widelyexpressed tumor antigen PRAME by proteasome-mediated digestionanalysis. J Exp Med 2001;193:73–88.

[3] Partheen K, Levan K, Osterberg L, Horvath G. Expression analysis ofstage III serous ovarian adenocarcinoma distinguishes a sub-group ofsurvivors. Eur J Cancer 2006;42:2846–54.

[4] Doolan P, Clynes M, Kennedy S, Mehta JP, Crown J, O’Driscoll L.Prevalence and prognostic and predictive relevance of PRAME in breastcancer. Breast Cancer Res Treat 2007.

[5] Boon K, Edwards JB, Siu IM, Olschner D, Eberhart CG, MarraMA, et al. Comparison of medulloblastoma and normal neural tran-scriptomes identifies a restricted set of activated genes. Oncogene2003;22:7687–94.

[6] Segal NH, Blachere NE, Guevara-Patino JA, Gallardo HF, Shiu HY,Viale A, et al. Identification of cancer-testis genes expressed by


melanoma and soft tissue sarcoma using bioinformatics. Cancer Immun2005;5:2.

[7] Figueiredo DL, Mamede RC, Proto-Siqueira R, Neder L, Silva Jr WA,Zago MA. Expression of cancer testis antigens in head and neck squa-mous cell carcinomas. Head Neck 2006;28:614–9.

[

[


[8] Oberthuer A, Hero B, Spitz R, Berthold F, Fischer M. The tumor-associated antigen PRAME is universally expressed in high-stageneuroblastoma and associated with poor outcome. Clin Cancer Res2004;10:4307–13.

[9] Neumann E, Engelsberg A, Decker J, Storkel S, Jaeger E, HuberC, et al. Heterogeneous expression of the tumor-associated antigensRAGE-1, PRAME, and glycoprotein 75 in human renal cell carcinoma:candidates for T-cell-based immunotherapies? Cancer Res 1998;58:4090–5.

10] Li CM, Guo M, Borczuk A, Powell CA, Wei M, Thaker HM, et al.Gene expression in Wilms’ tumor mimics the earliest committed stagein the metanephric mesenchymal-epithelial transition. Am J Pathol2002;160:2181–90.

11] van Baren N, Chambost H, Ferrant A, Michaux L, Ikeda H, MillardI, et al. PRAME, a gene encoding an antigen recognized on a humanmelanoma by cytolytic T cells, is expressed in acute leukaemia cells.Br J Haematol 1998;102:1376–9.

12] Proto-Siqueira R, Falcao RP, de Souza CA, Ismael SJ, Zago MA. Theexpression of PRAME in chronic lymphoproliferative disorders. LeukRes 2003;27:393–6.

13] Paydas S, Tanriverdi K, Yavuz S, Disel U, Baslamisli F, Burgut R.PRAME mRNA levels in cases with acute leukemia: clinical impor-tance and future prospects. Am J Hematol 2005;79:257–61.

14] Greiner J, Ringhoffer M, Taniguchi M, Li L, Schmitt A, Shiku H, etal. mRNA expression of leukemia-associated antigens in patients withacute myeloid leukemia for the development of specific immunothera-pies. Int J Cancer 2004;108:704–11.

15] Steinbach D, Hermann J, Viehmann S, Zintl F, Gruhn B. Clinicalimplications of PRAME gene expression in childhood acute myeloidleukemia. Cancer Genet Cytogenet 2002;133:118–23.

16] Steinbach D, Viehmann S, Zintl F, Gruhn B. PRAME gene expressionin childhood acute lymphoblastic leukemia. Cancer Genet Cytogenet2002;138:89–91.

17] Tajeddine N, Millard I, Gailly P, Gala JL. Real-time RT-PCRquantification of PRAME gene expression for monitoring minimalresidual disease in acute myeloblastic leukaemia. Clin Chem Lab Med2006;44:548–55.

18] Matsushita M, Ikeda H, Kizaki M, Okamoto S, Ogasawara M,Ikeda Y, et al. Quantitative monitoring of the PRAME gene for thedetection of minimal residual disease in leukaemia. Br J Haematol2001;112:916–26.

19] Radich JP, Dai H, Mao M, Oehler V, Schelter J, Druker B, et al. Geneexpression changes associated with progression and response in chronicmyeloid leukemia. Proc Natl Acad Sci USA 2006;103:2794–9.

20] Roman-Gomez J, Jimenez-Velasco A, Agirre X, Castillejo JA, NavarroG, Jose-Eneriz ES, et al. Epigenetic regulation of PRAME gene inchronic myeloid leukemia. Leuk Res 2007.

21] Willenbrock K, Kuppers R, Renne C, Brune V, Eckerle S, WeidmannE, et al. Common features and differences in the transcriptome oflarge cell anaplastic lymphoma and classical Hodgkin’s lymphoma.Haematologica 2006;91:596–604.

22] Abramenko IV, Belous NI, Kriachok IA, Chumak AA, Aksenova EV,Lisovskaia EV, et al. Expression of PRAME gene in multiple myeloma.Ter Arkh 2004;76:77–81.

23] Pellat-Deceunynck C, Mellerin MP, Labarriere N, Jego G, Moreau-Aubry A, Harousseau JL, et al. The cancer germ-line genes MAGE-1,MAGE-3 and PRAME are commonly expressed by human myelomacells. Eur J Immunol 2000;30:803–9.

24] Proto-Siqueira R, Figueiredo-Pontes LL, Panepucci RA, Garcia AB,Rizzatti EG, Nascimento FM, et al. PRAME is a membrane and cyto-plasmic protein aberrantly expressed in chronic lymphocytic leukemiaand mantle cell lymphoma. Leuk Res 2006;30:1333–9.


25] Paydas S, Tanriverdi K, Yavuz S, Seydaoglu G. PRAME mRNA levelsin cases with chronic leukemia: clinical importance and review of theliterature. Leuk Res 2007;31:365–9.

26] Giannopoulos K, Li L, Bojarska-Junak A, Rolinski J, Dmoszynska A,Hus I, et al. Expression of RHAMM/CD168 and other tumor-associated



a Resea

[

[

[

[

[

[

[

[

[

[

[

[

[

[


antigens in patients with B-cell chronic lymphocytic leukemia. Int JOncol 2006;29:95–103.

27] Epping MT, Wang L, Edel MJ, Carlee L, Hernandez M, Bernards R.The human tumor antigen PRAME is a dominant repressor of retinoicacid receptor signaling. Cell 2005;122:835–47.

28] Tajeddine N, Gala JL, Louis M, Van Schoor M, Tombal B, GaillyP. Tumor-associated antigen preferentially expressed antigen ofmelanoma (PRAME) induces caspase-independent cell death in vitroand reduces tumorigenicity in vivo. Cancer Res 2005;65:7348–55.

29] Schenk T, Stengel S, Goellner S, Steinbach D, Saluz HP. Hypomethyla-tion of PRAME is responsible for its aberrant overexpression in humanmalignancies. Genes Chromosomes Cancer 2007;46:796–804.

30] Spanaki A, Perdikogianni C, Linardakis E, Kalmanti M. Quantitativeassessment of PRAME expression in diagnosis of childhood acuteleukemia. Leuk Res 2007;31:639–42.

31] Arons E, Sunshine J, Suntum T, Kreitman RJ. Somatic hypermu-tation and VH gene usage in hairy cell leukemia. Br J Haematol2006;133:504–12.

32] Vanhentenrijk V, Tierens A, Wlodarska I, Verhoef G, Wolf-PeetersCD. V(H) gene analysis of hairy cell leukemia reveals a homogeneousmutation status and suggests its marginal zone B-cell origin. Leukemia2004;18:1729–32.


33] Sausville JE, Salloum R, Sorbara L, Kingma DW, Raffeld M, KreitmanRJ, et al. Minimal residual disease detection in hairy cell leukemia.Comparison of flow cytometric immunophenotyping with clonal anal-ysis using consensus primer polymerase chain reaction for the heavychain gene. Am J Clin Pathol 2003;119:213–7.

[

PRESSrch xxx (2008) xxx–xxx 7

34] Kamiguti AS, Serrander L, Lin K, Harris RJ, Cawley JC, AllsupDJ, et al. Expression and activity of NOX5 in the circulating malig-nant B cells of hairy cell leukemia. J Immunol 2005;175:8424–30.

35] Goodman GR, Bethel KJ, Saven A. Hairy cell leukemia: an update.Curr Opin Hematol 2003;10:258–66.

36] Livak KJ, Schmittgen TD. Analysis of relative gene expression datausing real-time quantitative PCR and the 2(-Delta Delta C(T)) method.Methods Cell Biol 2001;25:402–8.

37] Lossos IS, Czerwinski DK, Wechser MA, Levy R. Optimization ofquantitative real-time RT-PCR parameters for the study of lymphoidmalignancies. Leukemia 2003;17:789–95.

38] Kreitman RJ, Wilson WH, Bergeron K, Raggio M, Stetler-Stevenson M,FitzGerald DJ, et al. Efficacy of the anti-CD22 recombinant immuno-toxin BL22 in chemotherapy-resistant hairy-cell leukemia. N Engl JMed 2001;345:241–7.

39] Kreitman RJ, Squires DR, Stetler-Stevenson M, Noel P, FitzgeraldDJ, Wilson WH, et al. Phase I trial of recombinant immunotoxinRFB4(dsFv)-PE38 (BL22) in patients with B-cell malignancies. J ClinOncol 2005;23:6719–29.

40] Arons E, Margulies I, Sorbara L, Raffeld M, Stetler-Stevenson M, Pas-tan I, et al. Minimal residual disease in hairy cell leukemia patients


assessed by clone-specific polymerase chain reaction. Clin Cancer Res2006;12:2804–11.

41] Arons E, Suntum T, Sunshine J, Stetler-Stevenson M, Kreitman RJ.Immunoglobulin light chain repertoire in hairy cell leukemia. LeukRes 2007;31:1239–44.


prame expression in hairy cell leukemia

Documents