developmental changes in expression of myeloid cell leukemia-1 in human germ cells during oogenesis...

Developmental Changes in Expression of Myeloid CellLeukemia-1 in Human Germ Cells during Oogenesis andEarly Folliculogenesis

P. S. HARTLEY, R. A. L. BAYNE, L. L. L. ROBINSON, N. FULTON, AND R. A. ANDERSON

Medical Research Council Human Reproductive Sciences Unit, Centre for Reproductive Biology, Edinburgh, Scotland,United Kingdom EH3 9ET

The regulation of germ cell number in the developing ovary iscentral to female reproduction. Members of the Bcl-2 family ofproapoptotic and antiapoptotic proteins have been impli-cated in this process in rodents. We investigated the expres-sion of Mcl-1, Bcl-2, Bax, and BAD at 13–21 gestational wk inthe human fetal ovary and of Mcl-1 in the adult ovary. mRNAexpression of Mcl-1 and its short form Mcl-1s, Bcl-2, Bax, andBAD was demonstrated in fetal ovary by RT-PCR. Hybridiza-tion array analysis suggested a selective increase in Mcl-1expression between 14 and 18 wk gestation, which was con-firmed by quantitative PCR. There was a correspondingchange in the expression of Mcl-1 protein, detected by immu-nohistochemistry, from germ cells at the periphery of theovary at 14–16 wk to the largest germ cells, including oocyteswithin newly formed primordial follicles, at 21 wk. Mcl-1 was

also expressed by oocytes of primordial and preantral folliclesin the adult. Bax and BAD immunostaining was detected inboth somatic and germ cells in the fetal ovary, whereas Bcl-2was restricted to somatic cells: no changes in expression wereobserved. Apoptotic cells, detected by terminal deoxynucleo-tidyl transferase-mediated dUTP nick end labeling, were ob-served in all fetal ovaries but were infrequent. These resultsconfirm that Bcl-2 family members are differentially ex-pressed in several cell types within the developing humanovary. Increased mRNA expression and the changing distri-bution of Mcl-1 in germ cells as they develop into primordialfollicles as well as persistence in the growing oocyte in theadult may indicate an important role for this survival/anti-apoptotic factor throughout germ cell development andmaturation. (J Clin Endocrinol Metab 87: 3417–3427, 2002)

A CENTRAL ASPECT of ovarian function is that thenumber of oocytes in the postnatal ovary is limited.

This is determined by the balance between germ cell prolif-eration and loss during fetal development, and the rate ofsubsequent loss throughout adult life. Factors regulating thisbalance are therefore crucial to the determination of repro-ductive potential. Following a period of mitotic proliferation,the human fetal ovary at mid-gestation contains its maximalnumber of germ cells (1). Entry into meiosis and interactionwith somatic cells to form primordial follicles is believed tobe essential for germ cell survival during this period of de-velopment (2, 3). Several factors including c-kit and its ligand(kit ligand or stem cell factor), DAZLA, GDF-9, and neuro-tropins have been identified as potentially important regu-lators of germ cell survival in the ovary (4–10). Nevertheless,the number of oocytes present in the ovary is reduced bysome 85% by the time of birth (1).

Follicular atresia during adult life has been established tobe a regulated apoptotic process (11, 12). Prenatal loss ofgerm cells in the mouse has also been demonstrated to resultfrom apoptosis (13, 14), and apoptosis has been reported inthe developing human ovary (15, 16). The Bcl-2 family ofevolutionarily conserved, proapoptotic, and antiapoptoticproteins are implicated in the survival or demise of numer-

ous cell types and have been identified as regulators of ap-optosis within the mammalian ovary (17). Oncogenes andtumor suppressor genes implicated in the regulation of apo-ptosis have been identified in the first trimester human ovary(18), and Bax but not Bcl-2 was detected after 14 wk ofgestation (16). Mcl-1 is a recently identified antiapoptoticmember of the Bcl-2 family (19). Expression of Mcl-1 is up-regulated by a variety of growth factors (20), including fac-tors demonstrated to be of importance to germ cell survival(21). Very limited data are available, however, regarding itspossible expression in the human ovary (22). We have ex-amined the expression and localization of the apoptotic reg-ulatory factors Mcl-1, Bcl-2, Bax, and BAD in mid-trimesterhuman fetal ovary during this period of formation of theessential structures of the ovary. In the light of the high levelof expression of Mcl-1 in the oocyte in the developing ovary,we extended our investigations to the developing follicle inthe adult ovary.

Materials and MethodsTissues

Human fetal ovaries were obtained following medical termination ofpregnancy. Women gave consent according to national guidelines (23),and the study was approved by the Lothian Paediatrics/ReproductiveMedicine Research Ethics SubCommittee. Termination of pregnancywas induced by treatment with mifepristone (200 mg orally) followedby prostaglandin E1 analog (Gemeprost, Beacon Pharmaceuticals, Tun-bridge Wells, UK) 1 mg every 3 h per vaginam. None of the terminationswere for reasons of fetal abnormality, and all fetuses appeared morph-ologically normal. Gestational age was determined by ultrasound ex-amination before termination and confirmed by subsequent direct mea-surement of foot length. A total of 30 specimens were used for this study.

Abbreviations: Cp, Cross-over point; DNase, deoxyribonuclease;GAPDH, glyceraldehyde phosphate dehydrogenase; Mcl-1s, short formof Mcl-1; Mcl-1L, long form of Mcl-1; PCNA, proliferating cell nuclearantigen; RT, Expand Reverse Transcriptase; TBS, Tris-buffered saline;TUNEL, terminal deoxynucleotidyl transferase-mediated dUTP nickend labeling.

0013-7227/02/$15.00/0 The Journal of Clinical Endocrinology & Metabolism 87(7):3417–3427Printed in U.S.A. Copyright © 2002 by The Endocrine Society

3417

Biopsies of 4 adult ovaries were also obtained from women undergoinggynecological surgery for benign disease. The women were aged 31–39yr, of proven fertility, and all gave informed written consent and thestudy received ethical approval from the above-mentioned committee.

Ovaries were dissected free and either fixed for immunohistochem-ical analysis or snap frozen and stored at �70 C. Fixation was carriedout in Bouins for 5 h, followed by transfer to 70% ethanol before pro-cessing into paraffin using standard methods.

Isolation of RNA and synthesis of cDNA

Total RNA was extracted using either the RNeasy Mini Kit (QIAGENLtd., Crawley, West Sussex, UK) for RT-PCR or TRIReagent (Sigma,Poole, Dorset, UK) for array and quantitative PCR analysis according tothe manufacturers’ instructions. To remove contaminating genomicDNA, 3 �g of total RNA were treated with deoxyribonuclease (DNase)using Amplification grade DNase-1 (Roche Molecular Biochemicals,West Sussex, UK) according to the manufacturer’s instructions. TheRNA was primed for reverse transcription with oligo(deoxythymidine)(Genosys Biotechnologies, Pampisford, UK) at 65 C for 10 min. The entirereaction was added to a total volume of 57 �l containing deoxynucle-otide triphosphates to 1 mm, dithiothreitol to 10 mm, 12 �l 5� ExpandReverse Transcriptase (RT) buffer, and 120 U ribonuclease inhibitor(Promega Corp., Southampton, UK). One third (19 �l) of this reactionwas added to 1 �l water (RT�), which acted as a negative control toestablish the efficacy of the DNase treatment. One hundred units ofExpand RT (Roche Molecular Biochemicals) were added to the remain-ing 38 �l (RT�), and both reactions were incubated for 2 h at 40 C.Reactions were stored at �70 C until required.

Amplification of specific cDNAs by PCR

Target-specific PCR was performed using 1 �l of the RT�, RT�, orH2O as template in a reaction volume of 25 �l containing 1 U of AGSGoldDNA polymerase (Hybaid, Middlesex, UK) 2.5 �l 10� reaction buffer(with MgCl2 at 15 mm), deoxynucleotide triphosphates to 200 �m, for-ward and reverse primers to 500 nm. PCR primer sequences were BADforward 5�GTTTGAGCCGAGTGAGCAGG 3�; reverse 5�ATAGCGCT-GTGCTGCCCAGA 3�; Bcl-2 forward 5�CCTTCTTTGAGTTCGGTGGG3�; reverse 5�CCAGGAGAAATCAAACAGAGGC 3�; Mcl-1 forward5�ATCTCTCGGTACCTTCGGGAGC 3�; reverse 5�CCTGATGCCAC-CTTCTAGGTCC 3�; Bax forward 5�TTCTGACGGCAACTTCAACTGG3�; reverse 5�GAGGAAGTCCAATGTCCAGC 3�; GAPDH forward5�GAACGGGAAGCTCACTGGCAT 3�; reverse 5�GTCCACCACCCT-GTTGCTGTAG 3�. The identity of all PCR products was confirmed bydirect sequencing using an PE Applied Biosystems (Foster City, CA)373A automated sequencer.

cDNA array analysis

First strand cDNA probes were generated by reverse transcribing 5�g of total RNA from 14 and 18 wk gestation ovary in the presence of50 �Ci [�-32P]-deoxycytidine triphosphate (3000 Ci/mmol�1, Amer-sham Pharmacia Biotech) using the cDNA Synthesis reagents providedwith the array which include apoptosis gene-specific primers. Identicalarray membranes (Human Apoptosis-4 GEArray, Super Array Inc., Be-thesda, MD) were hybridized and washed according to the manufac-turer’s recommendations and exposed for 3 d each to phosphorimagescreens (for densitometry analysis) and autoradiography at �70 C withintensifying screens. After scanning, phosphorimages were analyzedusing ImageQuant Software (Molecular Dynamics Ltd., Buckingham-shire, UK). Arrays were normalized to account for differences in quan-tity of starting RNA by calculating densities as a proportion of GAPDHsignal.

Lightcycler quantitative PCR

Quantitative PCR was performed using the Lightcycler system(Roche Molecular Biochemicals). Reverse transcribed RNA sampleswere diluted in water as indicated, and 1 �l of the dilution was addedto a final volume of 10 �l containing 2 mm MgCl2 and 1 �m each offorward and reverse primer in 1� LightCycler-Fast Start DNA MasterSYBR Green 1 Master Mix (Roche Molecular Biochemicals). Signal ac-

quisition was performed for each of 45 amplification cycles followed bycontinuous melt curve analysis to ensure product accuracy. Primers(Sigma), were: GAPDH: forward GACATCAAGAAGGTGGTGAAGC,reverse GTCCACACCCTGTTGCTGTAG, Mcl-1L: forward ATCTCT-CGGTACCTTCGGGAGC, reverse GCTGAAAACATGGATCATCA-CTCG. The homologous sequence for the reverse Mcl-1L primer is inexon 2, allowing specific detection of the full length form of Mcl-1(denoted Mcl-1L), whereas the primers described above detect both fulllength and the alternatively spliced short form, Mcl-1s (24, 25).

Standard curves for GAPDH and Mcl-1 were derived by making10-fold (GAPDH) or 2-fold (Mcl-1L) dilutions of first-strand cDNA from14 and 18 wk gestation ovary. When the number of cycles needed to firstyield a fluorescent signal above background (the cross-over point, Cp)is plotted against the log of relative concentration using LightCyclerSoftware (Molecular Dynamics Ltd., Buckinghamshire, UK), the dilu-tions yielded a straight line for each product, confirming that Cp is agood indicator of target concentration across several orders of magni-tude. The slopes of these curves are a measure of the efficiency of thePCR. Subsequent quantification of ovary cDNA was performed on 1:50dilutions of cDNA in duplicate reactions for each experiment. BothGAPDH and Mcl-1 amplification from individual samples were per-formed in the same experiment. To normalize differences in templatecDNA concentration between ovaries to allow comparison, calculationsfor Mcl-1 amplification were made relative to GAPDH from the samesample. Allowance for differences in amplification rate for the twotargets was achieved by determining the actual amount of amplificationrequired to yield a signal for each target. Results were subjected tostatistical analysis by ANOVA and Student’s t test.

Tissues, fixation, and immunohistochemistry

Sections (5 �m) were mounted onto 3-aminopropyl triethoxy-silane(Sigma) coated slides that were subsequently baked overnight at 60 C.Slides were dewaxed with xylene, and rehydrated through graded eth-anol solutions. Heat-induced epitope retrieval was performed for Bcl-2,BAD, and Bax, by pressure cooking for 2.5 min in 0.01 m citrate at pH6. Slides were incubated in 3% H2O2 for 30 min to quench endogenousperoxidase activity and washed twice in Tris-buffered saline (TBS; 0.05m Tris, 0.85% NaCl, pH 7.4). Sections were then blocked with 0.01 mavidin then 0.001 m biotin (both from Vector Laboratories, Inc., Peter-borough, UK and both diluted in 20% normal serum/TBS) for 15 mineach, with washes in TBS in between. Primary antibodies were appliedto slides and incubated overnight at 4 C as follows; anti-Mcl-1 (S19; SantaCruz Biotechnology, Inc., Santa Cruz, CA) at 1:100; anti-Bcl-2 (DAKOCorp., Glostrup, Denmark) at 1:30; anti-Bax (PharMingen, San Diego,CA) at 1:2500 and anti-BAD (Santa Cruz Biotechnology, Inc.) at 1:10.Unbound primary antibody was removed from slides by two TBSwashes before the application of appropriate biotinylated secondaryantibody (DAKO Corp.) at a concentration of 1:500.

Following two washes in TBS, sections were incubated with avidinbiotin horseradish peroxidase linked complex (DAKO Corp.) accordingto the manufacturers instructions. Bound antibody was visualized using3,3�-diaminobenzidine tetra-hydrochloride (DAKO Corp.). Primary an-tibodies were omitted as negative controls for Bcl-2 and Bax, whereas foranti-Mcl-1 and anti-BAD primary antibodies were preadsorbed over-night at 4 C with 100-fold excess of the respective blocking peptide (SantaCruz Biotechnology, Inc.).

All sections were counterstained with hematoxylin, dehydrated,mounted, and visualized by light microscopy. Images were capturedusing an Olympus Corp. Provis microscope (Olympus Corp. OpticalCo., London, UK) equipped with a Kodak DCS330 camera (EastmanKodak Co., Rochester, NY).

Nuclear measurement and statistics

The nuclear diameter of Mcl-1 immunopositive and immunonegativegerm cells was measured in two dimensions for 14, 16, 18, and 21 wkgestation ovaries using Image Proplus Image Analysis software (MediaCybernetics, Silver Spring, MD). Mean diameter for each germ cell wascalculated, and numbers of cells grouped in 1-�m increments. Bias wasavoided by systematically measuring all germ cell nuclei in sequential,nonoverlapping fields of view until either over one hundred cells or all

3418 J Clin Endocrinol Metab, July 2002, 87(7):3417–3427 Hartley et al. • Developmental Changes in Mcl-1 Expression

immunopositive cells in the case of later gestational ages were measured.Data were analyzed by ANOVA and Student’s t test.

Detection of apoptosis using in situ DNA terminaldeoxynucleotidyl transferase-mediated dUTP nick endlabeling (TUNEL)

Tissue sections were prepared as for immunohistochemistry withheat-induced epitope retrieval as described for immunohistochemistry.Slides were incubated at 37 C in the presence of 1.5 �g/ml proteinaseK in 0.05 m Tris, pH 7.4, for 15 min. Endogenous peroxidase, avidin andbiotin were blocked as described for immunohistochemistry. Sectionswere incubated with TUNEL solution (30 mm Tris, pH 7.2; 140 mmNa-Cacodylate; 1 mm CoCl2) containing 5 �l/ml digoxigenin-deoxyuri-dine triphosphate (Roche Molecular Biochemicals) and 30 U/ml termi-nal deoxynucleotidyl transferase (Promega Corp., Southampton, UK)for 30 min at 37 C. TUNEL solution was washed off and replaced withsheep antidigoxigenin antibodies (Roche Molecular Biochemicals) at1:100, incubated at room temperature for 90 min, and washed. Positivestaining was visualized with avidin-biotin complex-horseradish perox-idase/diaminobenzidine tetra-hydrochloride as described above for im-munohistochemistry. Positive and negative controls were included ineach experiment. For positive controls, sections were treated with 40U/ml DNase-1 (Promega Corp., Southampton, UK) for 20 min at 37 C.Negative controls were incubated without terminal deoxynucleotidyltransferase enzyme.

Western immunoblotting

Protein was extracted from human fetal ovary by homogenization inan extraction buffer containing 62.5 mm Tris (pH 6.80), 1% sodiumdodecyl sulfate, 10% glycerol, and a cocktail of protease inhibitors (Com-plete Mini Protease Inhibitor cocktail tablets, Roche Molecular Biochemi-cals, Mannheim, Germany). Ten micrograms of protein extract wasboiled for 5 min in 4� reduced sample buffer (250 mm Tris, pH 6.8; 8%

sodium dodecyl sulfate; 20% glycerol; and 0.01% bromophenol blue) andseparated by SDS-PAGE on a 10% Tris/glycine gel (Novex, Invitrogen,Paisley, UK) in parallel with prestained protein molecular weight mark-ers (Rainbow markers, Amersham Pharmacia Biotech, Bucks, UK). Pro-teins were transferred onto polyvinylidenedifluoride transfer mem-brane (Hybond-P, Amersham Pharmacia Biotech). The membrane wasblocked overnight at 4 C in 5% wt/vol powdered milk and 10% normalswine serum in TBS, pH 7.5, then incubated with the primary antibody(rabbit antihuman MCL-1: s-19, Santa Cruz Biotechnology, Inc.) diluted1:200 for 2 h at room temperature. Bound antibody was detected usingan alkaline phosphatase-linked secondary antibody (1:20,000; goat-antirabbit alkaline phosphatase conjugate, Sigma) and visualized usingthe enhanced chemifluorescent system (Amersham Pharmacia Biotech).Primary antibody specificity was verified both by preabsorbing theprimary antibody with the Mcl-1 blocking peptide (Santa Cruz Biotech-nology, Inc.) and by omitting the primary antibody.

ResultsExpression of Mcl-1, Bcl-2, Bax, and BAD mRNA: RT-PCRand cDNA array analysis

The expression of Bcl-2 family members, Mcl-1, Bcl-2, Bax,and BAD in human fetal ovary was determined by RT-PCRanalysis. Single products for Bcl-2, Bax and BAD were am-plified from RNA extracted from fetal ovaries across thegestational range 14–19 wk (Fig. 1). Two products wereamplified for Mcl-1 from RNA extracted from both fetal(14–17 wk gestation) and adult ovary specimens (Fig. 1).Although the major product corresponded to the full-lengthMcl-1 cDNA, a fainter band was also identified that corre-sponded to the recently described short form splice variant

FIG. 1. Expression of mRNA for Mcl-1, Bcl-2, Bax,and BAD in human ovary. RT-PCR analysis ofmRNA expression for Bcl-2, Bax, Mcl-1 (long andshort forms), and BAD in 14–19 wk gestation ovaryand for Mcl-1 in adult ovary as indicated. Molecularweights of the amplicons are marked. The band at198 bp for Mcl-1 represents the short form (24, 25),confirmed by direct sequencing. Lanes markedRT� contained samples in which the reverse tran-scriptase enzyme was not included.

Hartley et al. • Developmental Changes in Mcl-1 Expression J Clin Endocrinol Metab, July 2002, 87(7):3417–3427 3419

Mcl-1s (24, 25). The identity of this PCR product was con-firmed to be the short form spice variant by direct sequencing.

To investigate differences in expression of these genes withgestational age, a mini cDNA array was hybridized with first-strand cDNA probes generated from a 14- and an 18-wk ges-tation human fetal ovary. Spots were analyzed by densitometryand normalized to the GAPDH signal. Bcl-2, Bad, and Baxappeared to be expressed at relatively low levels, yielding lowhybridization signals (Fig. 2). These results suggested that theremay be a small increase in signal for each of these genes in 18wk compared with 14 wk ovary but of less than 1.5-fold. Incontrast, Mcl-1 produced a stronger hybridization signal andshowed a 2.02-fold greater intensity of signal in 18-wk ovarycompared with 14-wk ovary when normalized to GAPDH. A2-fold increase can be considered significant (26); thus, thisresult was indicative of up-regulation in Mcl-1 expression con-temporaneous with primordial follicle formation in the humanovary.

Quantitative PCR

cDNA array analysis, however, is only semiquantitative,and the increase in expression observed was modest. In ad-dition, hybridization may not distinguish between the longand short forms of Mcl-1 mRNA that, given their antiapo-ptotic and proapoptotic functions, may make different con-tributions at different stages in development. It was thereforenecessary to confirm this result by other means. We haveused quantitative PCR in a LightCycler (Roche MolecularBiochemicals) using SYBR GREEN Dye chemistry to com-pare Mcl-1 expression relative to GAPDH in fetal ovaryacross the gestational range 14–18 wk with primers specificfor full-length Mcl-1 (Mcl-1L). Formation of product wasascertained in each reaction by melt curve analysis and con-firmed by running sample reactions on a 2.0% agarose gel(Fig. 3, A–C). Standard curves for GAPDH and Mcl-1 (Fig. 3,D and E) were derived to determine the efficiency of eachPCR and allow relative concentrations to be calculated(Fig. 3F). This confirmed an increase in Mcl-1 expressionthrough mid gestation (P � 0.003), with a 2.6-fold increase inMcl-1 mRNA levels between 14–15 and 18 wk gestation,comparable with that found from the array analysis. Mcl-1mRNA expression was significantly higher at 18 wk gesta-

tion than at all previous gestations examined, whereas Mcl-1mRNA levels in 16 and 17 wk gestation ovaries were com-parable to those at 14–15 wk, suggesting that the increase inMcl-1 mRNA occurs sharply at 17–18 wk gestation, at thetime when primordial follicles are first observed.

This analysis considered only the full-length form of Mcl-1(Mcl-1L). A PCR assay specific for the short form (Mcl-1s)was also devised using a primer spanning the junction ofexons 1 and 3 which will therefore only amplify a messagein which these 2 exons are adjacent (i.e. Mcl-1s). This wasvalidated by conventional PCR (not shown). However, thismolecule appears to be present at much lower levels thanfull-length Mcl-1, as suggested by RT-PCR with nonspecificMcl-1 primers (Fig. 1). The high Cp value in the LightCyclergave values close to background therefore quantitative com-parisons were not possible.

Immunohistochemical localization and immunoblottingof Mcl-1

Mcl-1 protein was specifically immunolocalized to the cy-toplasm of germ cells in mid-trimester ovaries, with a changein the distribution across the gestational age range investi-gated (Fig. 4, A–D). At 14 and 16 wk gestation, a clear dif-ferential distribution within the ovary was observed withimmunostained germ cells localized predominantly to theperiphery of the ovary with few stained cells present cen-trally (Fig. 4, A). At later gestations (17–18 wk), there was astriking change in the pattern of immunostaining. Althoughthe signal in the peripheral germ cells was maintained, largergerm cells within the more medullary region of the ovaryshowed intense immunostaining. This pattern of stainingbecame even more marked at 18 and 21 wk gestation, wherea proportion of the large germ cells showing intense Mcl-1immunostaining were observed to be associated withsomatic cells to form primordial follicles (Fig. 4, B–D). Fur-thermore, the intensity of immunostaining in the cytoplasmof germ cells located in the periphery of the ovary was muchreduced at these later gestations. Weak Mcl-1 immunoreac-tivity was also detected in endothelial vascular cells (notshown), but no immunoreactivity was detected in other so-matic cells of the fetal ovary, including the ovarian surfaceepithelium (Fig. 4A) at any gestation examined. No immuno-

FIG. 2. cDNA array analysis of Mcl-1, Bcl-2, Bax, and BADexpression. Phosphorimages of paired duplicate spots cor-responding to BAD, Bax, Bcl-2, Mcl-1, and GAPDH from ahuman apoptosis-4 cDNA array probed with 32P-labeledfirst-strand cDNA synthesized from RNA from 14 and 18 wkgestation fetal ovaries as indicated. Mean spot signal den-sities for each Bcl-2 family member at the two gestations areexpressed as a percentage of GAPDH signal, from which theratio of level of expression between samples at 18 and 14 wkgestation was calculated for each mRNA.


staining was observed when the primary antibody was pre-absorbed with the blocking peptide (Fig. 4E).

Immunoblotting confirmed the presence of Mcl-1 proteinin the fetal ovary (Fig. 5). A prominent single band of ap-proximately 40 kDa corresponding to full-length Mcl-1 wasidentified in all specimens examined. The antibody used mayalso detect Mcl-1s (25); however, no band of the appropriatesize was detected, indicating very little or no translation ofthis mRNA in these tissues. Quantitative analysis of Mcl-1protein expression was not performed in view of limitedtissue availability.

Quantitative analysis was used, however, to investigatethe size distribution of germ cells showing positive Mcl-1immunoreactivity in the developing ovary to investigate theimpression of increased Mcl-1 immunostaining in largergerm cells. Average germ cell nuclear diameter increasedwith increasing gestation across the range 14–21 wk with, inaddition, a wider range at later gestations (Fig. 6). Meannuclear diameter increased for both Mcl-1 positive and neg-ative cell populations at later gestations (both P � 0.001),although the increase was most marked for Mcl-1 positivecells. Thus, at 14 and 16 wk gestation, mean nuclear diameterof Mcl-1 positive and negative germ cells did not show sta-tistically significant differences (respectively 8.6 � 0.1 �m,n � 130 vs. 8.5 � 0.1 �m, n � 118 at 14 wk; 8.4 � 0.1 �m, n �102 vs. 8.8 � 0.1 �m, n � 101 at 16 wk). However, at 18 and21 wk gestation a differential distribution was seen withMcl-1 positive cells being significantly larger than Mcl-1 neg-ative cells (15.8 � 0.3, n � 66 vs. 11.1 � 0.2 �m, n � 106 at

18 wk; 16.4 � 0.2, n � 54 vs. 11.3 � 0.2 �m, n � 108 at 21 wk;both P � 0.001, Fig. 6).

Mcl-1 expression was also investigated in primordial andgrowing preantral follicles in the adult ovary. Intense im-munostaining for Mcl-1 was detected in the cytoplasm ofoocytes within all primordial and preantral follicles exam-ined (Fig. 4, F–H). Weaker Mcl-1 immunostaining was alsoobserved in the cytoplasm of granulosa and theca cells sur-rounding these oocytes in developing follicles (Fig. 4, G andH). In addition, Mcl-1 immunostaining was observed withinthe cytoplasm of ovarian surface epithelial cells (Fig. 4I), withweaker staining within the cytoplasm of endothelial vascularcells (not shown). The positive staining of adult ovariansurface epithelial cells was in contrast to the negative stainingpattern of the surface epithelium observed in fetal tissues. Noimmunostaining was observed in any tissue sections incu-bated with primary antibody that had been preabsorbed withthe blocking peptide (Fig. 4J).

Immunohistochemical localization of Bcl-2, Bax, and BAD

The expression of Bcl-2 and Bax proteins in the fetal ovaryshowed a very different pattern to that of Mcl-1. Bcl-2 im-munostaining was restricted to the cytoplasm of the somaticcell population in all samples examined (Fig. 7, A–C). Al-though some immunopositive cells were adjacent to germcells and thus may be pregranulosa cells, other immuno-positive cells were distributed throughout the stroma. Baximmunopositive staining was widespread and observed in

FIG. 3. Real-time PCR quantification of Mcl-1 expression in fetal ovary. Expression of Mcl-1L mRNA was quantified in human fetal ovaryspecimens over the gestational range 14 to 18 wk. Data show (A) representative individual PCR melt curves of GAPDH and (B) Mcl-1L PCRproducts indicating single amplicons in each reaction; (C) agarose gel analysis of PCRs, indicating products with the expected sizes for GAPDHand Mcl-1L, the central lane showing molecular weight markers; (D) and (E) standard curves of input cDNA concentration vs. number ofamplification cycles required to yield a signal above threshold for GAPDH and Mcl-1L respectively, demonstrating linearity; (F) calculatedMcl-1L mRNA expression as a percentage of GAPDH for ovaries of 14–15, 16, 17, and 18 wk gestation (n � 4, 2, 3, and 4 respectively, mean �SEM). *, P � 0.003 by ANOVA.


FIG. 4. Immunohistochemical detection of Mcl-1 in human fetal and adult ovary. Immunohistochemical detection of Mcl-1 in human fetal ovaryat (A) 14 wk, (B) 18 wk, and (C and D) 21 wk gestation, and in adult ovary in (F) primordial follicle, (G) secondary follicle, (H) preantral follicle,and (I) ovarian surface epithelium. E and J, Negative controls for fetal and adult ovary respectively, in which the primary antibody waspreabsorbed with the blocking peptide. gc, Germ cell; sc, stromal cell; o, oocyte; pf, primordial follicle; th, theca; ose, ovarian surface epithelium.Scale bars, 50 �m (A, B, C, G, H); 20 �m (D, E, F, I).


all ovarian cell types (Fig. 7, D–F), although more intensestaining was observed within somatic cells compared withgerm cells (Fig. 7F). At earlier gestational ages (14–17 wk),the intensity of staining within germ cells was not consistent;more intense staining was observed in a subset of germ cellsnearer the periphery of the ovary (Fig. 7D). Positive Baxstaining was also present in cells exhibiting apoptotic mor-phology (Fig. 7F), which was not observed for Bcl-2 or Mcl-1.Although the overall pattern of staining changed with theformation of primordial follicles at later gestations, therewere no other major changes observed in the intensity ofimmunostaining for Bcl-2 or Bax across the range of gesta-tional ages examined. Cells of the ovarian surface epitheliumshowed no staining for either Bcl-2 or Bax. Immunostainingfor BAD was localized predominantly to the somatic cells ofthe fetal ovary in all samples examined (Fig. 7, G–I). Thecytoplasm of a small number of germ cells was also immu-nopositive (Fig. 7I), but these did not appear to be restrictedto any particular part of the developing ovary, and no patternwas detected.

TUNEL of germ cells in human fetal ovary

TUNEL-positive nuclei were detected in all fetal ovaryspecimens examined. The cells showed the characteristicappearance of apoptosis (chromatin condensation andshrinkage of the cytoplasm) (27). The prevalence of thesenuclei was very low, only 5–10 positive nuclei (�5% of germcells) being detected per histological section (Fig. 7J), andthere was no clear change in the abundance of these cellsacross the gestational range examined. It was noted, how-ever, that none of the oocytes within primordial follicles wereTUNEL-positive, although the absence of primordial folliclesfrom the majority of specimens examined means that thegreat majority of germ cells studied were at earlier devel-opmental stages. In positive controls, most cell nuclei werestained (Fig. 7K), whereas none were stained in negativecontrols.

Discussion

These data demonstrate mRNA and protein expression ofmembers of the Bcl-2 family Mcl-1, Bcl-2, Bax, and BAD inhuman fetal ovary during the second trimester. These anti-apoptotic (Mcl-1 and Bcl-2) and proapoptotic factors (Baxand BAD) were expressed in different cell types. Mcl-1 wasexpressed exclusively by germ cells, whereas Bcl-2 was ex-pressed by somatic cells and Bax and BAD by both cell types,although BAD expression was seen only in a few germ cells.The data indicate also that there is a pronounced gestationalage-dependent pattern of Mcl-1 expression. We have dem-onstrated by two independent methods that Mcl-1 mRNAlevels are higher at 18 wk gestation than at 14–17 wk ges-tation, i.e. at the time when primordial follicles begin to form.At the protein level, at 14–16 wk of gestation, only small, pe-ripherally located germ cells showed immunostaining with nodifference in size between Mcl-1 positive and negative cells. Atlater developmental stages, there was a wider range in cell size,with the larger germ cells intensely stained for Mcl-1 and themost intense staining seen in oocytes within primordial follicles.Oocyte-specific staining was also observed in primordial anddeveloping preantral follicles in the adult ovary and, as such,is suggestive of Mcl-1 expression persisting in these cellsthrough to adult life. The overall increase in Mcl-1 mRNAbetween 14–17 and 18 wk gestation is consistent with thechanges in Mcl-1 protein distribution observed by immuno-histochemistry. However, the level of this increase (2.6-fold) islikely to be an underestimate for individual oocytes as theRT-PCR analysis was carried out on whole ovary samples,whereas only a proportion of the larger oocytes showed amarked increase in Mcl-1 staining by 18 wk.

The period of ovarian development investigated presentlyspans germ cell proliferation by mitosis through to the entryof germ cells into meiosis and the association with somaticcells to form primordial follicles. In the human, the time scaleof these processes is overlapping, with entry into meiosisbeing detected as early as 11 wk gestation (28, 29). Germ cellnuclear diameters were similar to those previously de-scribed, with increasing diameter associated with progres-sion from mitosis into meiotic prophase (1). During theseprocesses, there is believed to be increasing cell death, suchthat approximately only 15% of oocytes remain present at thetime of birth. Apoptosis, a form of programmed cell death,is a universal system for achieving this goal. Althoughwidely conserved between organisms, the intracellular me-chanics and extracellular controls of apoptosis appear to betissue and cell specific (17). The present results demonstratethat Bcl-2 family members are expressed throughout thesecond trimester and are likely to be involved in the regu-lation of germ cell development and survival at that time indevelopment. In particular, Mcl-1 may be of central impor-tance in suppressing apoptosis at the crucial time of germcell-somatic cell interaction required for the formation of theprimordial follicle. The demonstration of continued Mcl-1expression by oocytes in the adult ovary both in primordialfollicles and during early follicular growth may reflect asignificant role in the regulation of follicular loss. At thestages of follicular development investigated in the presentstudy, it is believed that follicular atresia is initiated by oo-

FIG. 5. Immunoblot of Mcl-1 in human fetal ovary. Total proteinextracts (10 �g) of human fetal ovary at 13–17 wk gestation as in-dicated were separated by SDS-PAGE, transferred to polyvinyliden-edifluoride membrane and incubated with anti-Mcl-1. The positionsof molecular weight markers are shown. A single band of molecularmass approximately 40 kDa corresponding to full-length Mcl-1 wasdetected in each specimen. No signal was detected when the primaryantibody was preabsorbed with blocking peptide or omitted (notshown).


cyte apoptosis followed by granulosa cell death, whereas atlater antral stages it is initiated by granulosa cell apoptosis(11, 30, 31). The significance of the differential expression ofBcl-2 family members by different cell types, i.e. Mcl-1 bygerm cells, Bcl-2 by somatic cells and BAD and Bax by both,is consistent with the cellular specificity of apoptotic path-ways (17) and may underlie the importance of interactionbetween these two cell types for their mutual survival (3).Distinct caspases have been suggested to mediate apoptosisin oocytes and granulosa cells within the ovary (32).

In response to internal and external signals, Bcl-2 familyproteins interact with each other and with other nonBcl-2proteins (33, 34) to form heterodimers. These interactions, aswell as posttranslational modifications (35), govern the sub-cellular localization of the Bcl-2 family members, their func-tional effects, and the ultimate balance between cell survivaland apoptosis. Information regarding potential binding part-ners of Bcl-2 family members has been drawn from the yeast

two hybrid system (36). These studies identified Mcl-1 as anantiapoptotic protein capable of binding Bok, BAD, and Bax(37, 38). Mcl-1 was originally identified in human myelo-blastic leukemia cells (19) and is up-regulated in hemato-poietic cell models by various cell survival signals includingstem cell factor (20, 39–41). Stem cell factor, the ligand for thec-kit proto-oncogene receptor expressed by primordial germcells, is recognized to have an important antiapoptotic andproliferative role in the developing ovary (20, 21, 42). Wehave recently demonstrated the expression of c-kit by humanovarian germ cells before and during primordial follicle for-mation (7). It is therefore possible that Mcl-1 expression ingerm cells leads to an increased antiapoptotic environmentand that this process is stem cell factor/c-kit dependent.Up-regulation of Bax expression was also partially preventedby stem cell factor in cultured murine primordial germ cells(43), consistent with an increased antiapoptotic signal.

It has been demonstrated recently in a hematopoietic cell

FIG. 6. Size distribution of Mcl-1 immunopositive and immunonegative cells in the human fetal ovary. Histograms showing the frequencydistribution of nuclear diameter of Mcl-1 immunopositive cells (filled columns) and immunonegative cells (open columns) in human fetal ovaryat (A) 14, (B) 16, (C) 18, and (D) 21 wk gestation. n � 54–130, as described in Results.


FIG. 7. Immunodetection of Bcl-2, Bax, BAD and of apoptotic cells by TUNEL in human fetal ovary. Bcl-2 immunostaining in fetal ovary at(A) 14 and (B and C) 18 wk gestation. Immunodetection of Bax in fetal ovary at (D) 15 and (E and F) 21 wk gestation. Immunodetection of BADin fetal ovary at (G) 14 wk and (H and I) 18 wk gestation. J, TUNEL staining of an apoptotic germ cell in a 16 wk gestation fetal ovary. K, TUNELpositive control (DNase-treated). gc, Germ cell; sc, stromal cell; pf, primordial follicle; os, ovarian stroma; ap, apoptotic cell; t, TUNEL-positive;ose, ovarian surface epithelium. L–N, Negative controls for Bcl-2, Bax, and BAD, respectively. Scale bars, 50 �m (A); 20 �m (all others).


line that Mcl-1 expression can be differentially controlled atboth the transcriptional and the translational level (44). Cyto-kine-induced increase in Mcl-1 transcription is dependent uponERK, whereas Mcl-1 protein up-regulation is dependent onphosphatidylinositol 3-kinase. Both of these kinases have beenimplicated as downstream effectors of a number of cytokine/growth factor receptors including c-kit (45) and neurotropinreceptors (46–48). As these receptor pathways have themselvesbeen implicated in development of the human fetal ovary (7, 8),either or both of these mechanisms may therefore control Mcl-1expression in the developing ovary.

Recently, a splice variant of Mcl-1 has been identified inhuman placenta (24, 25). This form lacks the BH1, BH2, andtransmembrane domains, while retaining the BH3 domainassociated with a proapoptotic function. Overexpression re-sulted in induction of apoptosis and antagonism of the an-tiapoptotic effect of the full-length form of Mcl-1. The presentresults suggest that germ cells in the developing ovary andin the adult express both forms of Mcl-1 mRNA, althoughmRNA levels of the short form are much lower than those ofthe full-length message, and only the full-length protein wasdetected by immunoblotting. Thus, it is possible that the alter-native splicing mechanism could be regulated in the oocyte atseveral stages of development to determine cell survival.

Mcl-1 was also detected in the adult human ovary. As inthe fetal ovary, Mcl-1 expression was intense in oocytes inprimordial follicles and remained so during early folliculardevelopment. Granulosa and theca cells of growing preantralfollicles were also demonstrated to express Mcl-1, as was thesurface epithelium. Further investigation is required to clar-ify whether there is gene expression by granulosa cells, orwhether the Mcl-1 protein detected is a product of the oocyte.Endothelial vascular cells showed weak Mcl-1 immunostain-ing, as previously described in cultured endothelial cells (49).Mcl-1 mRNA expression is up-regulated by gonadotropinsin the rat ovary (50), indicating that it may have a continuingrole during later stages of follicular development.

Mcl-1 appears to be unique among the Bcl-2 family in thatit appears to have a cell cycle control function in addition tobut independent of its role in apoptosis. Mcl-1 was colocal-ized with proliferating cell nuclear antigen (PCNA) to thenucleus of a human osteosarcoma cell line (34). A mutantform of Mcl-1, incapable of binding to PCNA, was found toretain the antiapoptotic function but attenuated the inhibi-tory effect of wild-type Mcl-1 on DNA synthesis. Thus, Mcl-1appears to inhibit DNA synthesis via a direct interaction withPCNA. Changing expression of Mcl-1 may therefore haveseveral roles in ovarian germ cells as they progress frommitotic proliferation to entry into and arrest in meiosis. It isalso possible the Mcl-1 may have several roles in the differentcell types in the adult ovary in which expression wasdetected.

Bcl-2 has been localized to stromal cells in the first andearly second trimester human ovary (18), consistent with thepresent findings, although others were unable to detect Bcl-2after 14 wk gestation (16). Bcl-2 and Bax have been identifiedin the adult human ovary, with both localized to granulosacells (16, 51). The significance of Bcl-2 and Bax in mammalianovarian development has been examined in murine loss-of-function models. Bcl-2�/� mice display an abnormal ovarianphenotype (52), and BAX�/� mice show an accumulation of

atretic follicles (53), although in BAX�/� mice the number ofprimordial follicles did not appear to be affected. Overex-pression of Bcl-2 leads to the suppression of apoptosis inmurine ovarian cells (54), and similarly deficiency of caspase2 results in an excess of surviving germ cells (55). AlthoughBcl-2 and Bax were undetectable during murine oocyte de-velopment, expression of both was increased in apoptoticgerm cells in culture (43). Mcl-1 knockout results in periim-plantation embryonic loss (56), although no information isavailable regarding the effect of heterozygosity.

The presence of apoptosis in the developing human ovarywas demonstrated morphologically and confirmed using theTUNEL technique. The prevalence of TUNEL-positive cellsidentified in the present study was low (�5% of germ cells),whereas others have reported 9–17% of oocytes to be apo-ptotic using a similar technique (16). An analysis using mor-phological criteria gave much lower proportions of degen-erating germ cells but indicated a marked increase fromapproximately 0.1–3.5% over the gestational range examinedin the present study (28). In contrast, freshly obtained murineovary at a comparable developmental stage (i.e. before pri-mordial follicle formation) was found to contain no apoptoticgerm cells, such cells only being detectable after in vitroculture (45). The wide variation and relatively high percent-ages of apoptotic germ cells reported for human fetal sam-ples may therefore largely reflect differences in prefixationchanges in the tissues as well as differences in the techniquesused. The frequency of TUNEL-positive cells may, however,underestimate the incidence of apoptosis as DNA degrada-tion is a late event in the sequence of cell death (57). It wasnoteworthy that we observed no TUNEL-positive germ cellsamong those that had already formed primordial follicles.Before primordial follicle formation, germ cells are arrangedin clusters of cells in the human (58) and other mammalianand nonmammalian species (59, 60). In the mouse, it hasrecently been demonstrated that most germ cell loss occursby apoptosis as clusters of cells break down to form primor-dial follicles (14). It is therefore likely that similar processesare involved in the human, with the majority of germ cell lossoccurring at a comparable developmental stage.

In conclusion, these data demonstrate the expression andimmunodetection of members of the Bcl-2 family of apoptosis-regulating proteins in the developing human ovary. Differentfamily members were localized to different cell types and astriking developmental change was identified in the expressionof Mcl-1 in oogonia and oocytes. Oocytes within adult preantralfollicles also displayed Mcl-1 immunopositive staining. Thesedata indicate that this antiapoptotic factor may have importantroles both during germ cell maturation and germ cell/somaticcell interaction at the time of primordial follicle formation, andduring subsequent follicle development in adult life.

Acknowledgments

We thank Mike Miller for his assistance with image analysis.

Received December 28, 2001. Accepted March 25, 2002.Address all correspondence to: Dr. R. A. Anderson, Medical Research

Council Human Reproductive Sciences Unit, Center for Reproductive Bi-ology, 37 Chalmers Street, Edinburgh, Scotland, United Kingdom EH3 9ET.E-mail: [email protected].


References

1. Baker TG 1963 A quantitative and cytological study of germ cells in humanovaries. Proc R Soc Lond Ser B 158:417–433

2. Hirshfield AN 1991 Development of follicles in the mammalian ovary. Int RevCytol 124:43–101

3. McLaren A 1991 Development of the mammalian gonad: the fate of the sup-porting cell lineage. Bioessays 13:151–156

4. Dong J, Albertini DF, Nishimori K, Kumar TR, Lu N, Matzuk MM 1996Growth differentiation factor-9 is required during early ovarian folliculogen-esis. Nature 383:531–535

5. Tisdall DJ, Fidler AE, Smith P, Quirke LD, Stent VC, Heath DA, McNattyKP 1999 Stem cell and c-kit gene expression and protein localization in thesheep ovary during fetal development. J Reprod Fertil 116:277–291

6. Dissen GA, Romero C, Hirschfield AN, Ojeda SR 2001 Nerve growth factoris required for early follicular development in the mammalian ovary. Endo-crinology 142:2078–2086

7. Robinson LLL, Gaskell TL, Saunders PTK, Anderson RA 2001 Germ cell specificexpression of c-kit in the human fetal gonad. Mol Hum Reprod 7:845–852

8. Anderson RA, Robinson LLL, Brooks J, Spears N 2002 Expression of neu-rotrophins and their receptors in the human fetal ovary. J Clin EndocrinolMetab 87:890–897

9. Ruggiu M, Speed R, Taggart M, McKay SJ, Kilanowski F, Saunders P, DorinJ, Cooke HJ 1997 The mouse Dazla gene encodes a cytoplasmic protein es-sential for gametogenesis. Nature 389:73–77

10. Elvin JA, Matzuk MM 1998 Mouse models of ovarian failure. Rev Reprod3:183–195

11. Hsueh AJW, Billig H, Tsafriri A 1994 Ovarian follicle atresia: a hormonallycontrolled apoptotic process. Endocr Rev 15:707–724

12. Pru JK, Tilly JL 2001 Programmed cell death in the ovary: insights and futureprospects using genetic technologies. Mol Endocrinol 15:845–853

13. Coucouvanis EC, Sherwood SW, Carswell-Crumpton C, Spack EG, Jones PP1993 Evidence that the mechanism of prenatal germ cell death in the mouseis apoptosis. Exp Cell Res 209:238–247

14. Pepling ME, Spradling AC 2001 Mouse ovarian germ cell cysts undergoprogrammed breakdown to form primordial follicles. Dev Biol 234:339–351

15. de Pol A, Vaccina F, Foraboscu A, Cavazzuti E, Marzoni L 1997 Apoptosis ofgerm cells during human prenatal oogenesis. Hum Reprod 12:2235–2241

16. Vaskivuo TE, Anttonen M, Herva R, Billig H, Dorland M, te Velde ER,Stenback F, Heikinheimo M, Tapanainen JS 2001 Survival of human ovarianfollicles from fetal to adult life: apoptosis, apoptosis-related proteins, andtranscription factor GATA-4. J Clin Endocrinol Metab 86:3421–3429

17. Hsu SY, Hsueh AJ 2000 Tissue-specific Bcl-2 protein partners in apoptosis: anovarian paradigm. Physiol Rev 80:593–614

18. Quenby SM, Gazvani MR, Brazeau C, Neilson J, Lewis-Jones DI, Vince G1999 Oncogenes and tumour suppressor genes in first trimester human fetaldevelopment. Mol Hum Reprod 5:737–741

19. Kozopas KM, Yang T, Buchan HL, Zhou P, Craig RW 1993 MCL1, a geneexpressed in programmed myeloid cell differentiation, has sequence similarityto BCL2. Proc Natl Acad Sci USA 90:3516–3520

20. Huang H-M, Huang C-H, Yen JJ-Y 2000 Mcl-1 is a common target of stem cellfactor and interleukin-5 for apoptosis prevention activity via MEK/MAPK andPI-3K/Akt pathways. Blood 96:1764–1771

21. Manova K, Nocka K, Besmer P, Bachvarova RF 1990 Gonadal expression ofc-kit encoded at the W locus of the mouse. Development 110:1057–1069

22. Sano M, Umezawa A, Suzuki A, Shimoda K, Fukuma M, Hata J 2000 In-volvement of EAT/mcl-1, an anti-apoptotic bcl-2-related gene, in murine em-bryogenesis and human development. Exp Cell Res 259:127–139

23. Polkinghorne J 1989 Review of the guidance on the research use of fetuses andfetal material. London: Her Majesty’s Stationery Office

24. Bae J, Leo CP, Hsu SY, Hsueh AJW 2000 MCL-1S, a splicing variant of theantiapoptotic BCL-2 family member MCL-1, encodes a proapoptotic proteinpossessing only the BH3 domain. J Biol Chem 275:25255–25261

25. Bingle CD, Craig RW, Swales BM, Singleton V, Zhou P, Whyte MK 2000Exon skipping in Mcl-1 results in a bcl-2 homology domain 3 only gene productthat promotes cell death. J Biol Chem 275:22136–22146

26. Rajeevan MS, Vernon SD, Taysavang N, Unger ER 2001 Validation of array-based gene expression profiles by real-time (kinetic) RT-PCR. J Mol Diagn 3:26–31

27. Kerr JFR, Wyllie AH, Currie AR 1972 Apoptosis: a basic biological phenom-enon with wide-ranging implications in tissue kinetics. Br J Cancer 26:239–257

28. Kurilo LF 1981 Oogenesis in antenatal development in man. Hum Genet 57:86–9229. Gondos B, Westergaard L, Byskov AG 1986 Initiation of oogenesis in the

human fetal ovary: ultrastructural and squash preparation study. Am J ObstetGynaecol 155:189–195

30. Gougeon A 1996 Regulation of ovarian follicular development in primates:facts and hypotheses. Endocr Rev 17:121–155

31. Morita Y, Perez GI, Maravei DV, Tilly KI, Tilly JL 1999 Targeted expression ofBcl-2 in mouse oocytes inhibits ovarian follicle atresia and prevents spontaneousand chemotherapy-induced oocyte apoptosis in vitro. Mol Endocrinol 13:841–850

32. Matikainen T, Perez GI, Zheng TS, Kluzak TR, Rueda BR, Flavell RA, TillyJL 2001 Caspase-3 gene knockout defines cell lineage specificity for pro-grammed cell death signaling in the ovary. Endocrinology 142:2468–2480

33. Hsu SY, Hsueh AJ 1998 A splicing variant of the Bcl-2 member Bok with atruncated BH3 domain induces apoptosis but does not dimerize with anti-apoptotic Bcl-2 proteins in vitro. J Biol Chem 273:30139–30146

34. Fujise K, Zhang D, Liu J-L, Yeh ETH 2000 Regulation of apoptosis and cellcycle progression by Mcl-1. J Biol Chem 275:39458–39465

35. Zha J, Harada H, Yang E, Jockel J, Korsmeyer SJ 1996 Serine phosphorylationof death agonist BAD in response to survival factor results in binding to 14–3-3not BCL-X(L). Cell 87:619–628

36. Hsu SY, Hsueh AJ 1998 Intracellular mechanisms of ovarian cell apoptosis.Mol Cell Endocrinol 145:21–25

37. Hsu SY, Kaipia A, McGee E, Lomeli M, Hsueh AJ 1997 Bok is a pro-apoptoticBcl-2 protein with restricted expression in reproductive tissues and het-erodimerizes with selective anti-apoptotic Bcl-2 family members. Proc NatlAcad Sci USA 94:12401–12406

38. Hsu SY, Lin P, Hsueh AJ 1998 BOD (Bcl-2-related ovarian death gene) is anovarian BH3 domain-containing proapoptotic Bcl-2 protein capable of dimeriza-tion with diverse antiapoptotic Bcl-2 members. Mol Endocrinol 12:1432–1440

39. Chao JR, Wang JM, Lee SF, Peng HW, Lin YH, Chou CH, Li JC, Huang HM,Chou CK, Kuo ML, Yen JJ, Yang-Yen HF 1998 Mcl-1 is an immediate-earlygene activated by the granulocyte-macrophage colony-stimulating factor (GM-CSF) signaling pathway and is one component of the GM-CSF viability re-sponse. Mol Cell Biol 18:4883–4898

40. Moulding DA, Quayle JA, Hart CA, Edwards SW 1998 Mcl-1 expression inhuman neutrophils: regulation by cytokines and correlation with cell survival.Blood 92:2495–2502

41. Fukuchi Y, Kizaki M, Yamoto K, Kawamura C, Umezawa A, Hata JJ, Nishi-hara T, Ikeda Y 2001 Mcl-1, an early-induction molecule, modulates activinA-induced apoptosis and differentiation of CML cells. Oncogene 20:704–713

42. Pesce M, Farrace MG, Piacentini M, Dolci S, De Felici M 1993 Stem cell factorand leukemia inhibitory factor promote primordial germ cell survival bysuppressing programmed cell death (apoptosis). Development 118:1089–1094

43. Felici MD, Carlo AD, Pesce M, Iona S, Farrace MG, Piacentini M 1999 Bcl-2and Bax regulation of apoptosis in germ cells during prenatal oogenesis in themouse embryo. Cell Death Differ 6:908–915

44. Schubert KM, Duronio V 2001 Distinct roles for extracellular-signal-regulatedprotein kinase (ERK) mitogen-activated protein kinases and phosphatidylino-sitol 3-kinase in the regulation of Mcl-1 synthesis. Biochem J 356:473–480

45. Morita Y, Manganaro TF, Tao XJ, Martimbeau S, Donahoe PK, Tilly JL 1999Requirement for phosphatidylinositol-3�-kinase in cytokine-mediated germcell survival during fetal oogenesis in the mouse. Endocrinology 140:941–949

46. Greene LA, Kaplan DR 1995 Early events in neurotrophin signalling via Trkand p75 receptors. Curr Opin Neurobiol 5:579–587

47. Yuen EC, Mobley WC 1999 Early BDNF, NT-3, and NT-4 signaling events. ExpNeurol 159:297–308

48. Roux PP, Bhakar AL, Kennedy TE, Barker PA 2001 The p75 neurotrophinreceptor activates Akt (protein kinase B) through a phosphatidylinositol3-kinase-dependent pathway. J Biol Chem 276:23097–23104

49. Karsan A, Yee E, Poirier GG, Zhou P, Craig R, Harlan JM 1997 Fibroblastgrowth factor-2 inhibits endothelial cell apoptosis by Bcl-2-dependent andindependent mechanisms. Am J Pathol 151:1775–1784

50. Leo CP, Hsu SY, Chun SY, Bae HW, Hsueh AJ 1999 Characterization of theantiapoptotic Bcl-2 family member myeloid cell leukemia-1 (Mcl-1) and thestimulation of its message by gonadotropins in the rat ovary. Endocrinology140:5469–5477

51. Kugu K, Ratts VS, Piquette GN, Tilly KI, Tao XJ, Martimbeau S, AberdeenGW, Krajewski S, Reed JC, Pepe GJ, Albrecht ED, Tilly JL 1998 Analysis ofapoptosis and expression of bcl-2 gene family members in the human andbaboon ovary. Cell Death Differ 5:67–76

52. Ratts VS, Flaws JA, Kolp R, Sorenson CM, Tilly JL 1995 Ablation of bcl-2 geneexpression decreases the numbers of oocytes and primordial follicles estab-lished in the post-natal female mouse gonad. Endocrinology 136:3665–3668

53. Knudson CM, Tung KS, Tourtellotte WG, Brown GA, Korsmeyer SJ 1995Bax-deficient mice with lymphoid hyperplasia and male germ cell death.Science 270:96–99

54. Hsu SY, Lai RJ, Finegold M, Hsueh AJ 1996 Targeted overexpression of Bcl-2 inovaries of transgenic mice leads to decreased follicle apoptosis, enhanced follicu-logenesis, and increased germ cell tumorigenesis. Endocrinology 137:4837–4843

55. Bergeron L, Perez GI, Macdonald G, Shi L, Sun Y, Jurisicova A, Varmuza S,Latham KE, Flaws JA, Salter JC, Hara H, Moskowitz MA, Li E, GreenbergA, Tilly JL, Yuan J 1998 Defects in regulation of apoptosis in caspase-2-deficient mice. Genes Dev 12:1304–1314

56. Rinkenberger JL, Horning S, Klocke B, Roth K, Korsmeyer SJ 2000 Mcl-1deficiency results in peri-implantation embryonic lethality. Genes Dev 14:23–27

57. Collins JA, Schandl CA, Young KK, Vesely J, Willingham MC 1997 Major DNAfragmentation is a late event in apoptosis. J Histochem Cytochem 45:923–934

58. Gondos B, Bhiraleus P, Hobel CJ 1971 Ultrastructural observations on germcells in human fetal ovaries. Am J Obstet Gynecol 110:644–652

59. Telfer WH 1975 Development and physiology of the oocyte-nurse cell syn-citium. Adv Insect Physiol 11:223–319

60. Byskov AG 1986 Differentiation of mammalian embryonic gonad. Physiol Rev66:71–117


developmental changes in expression of myeloid cell leukemia-1 in human germ cells during oogenesis...

Documents