Chapter 5

Methylated DNA Immunoprecipitation (MeDIP)

Fabio Mohn, Michael Weber, Dirk Schubeler, and Tim-Christoph Roloff

Abstract

Methylated DNA immunoprecipitation (MeDIP) is a versatile immunocapturing approach for unbiaseddetection of methylated DNA. In brief, genomic DNA is randomly sheared by sonication and immuno-precipitated with a monoclonal antibody that specifically recognizes 5-methylcytidine. The resultingenrichment of methylated DNA in the immunoprecipitated fraction can be determined by PCR to assessthe methylation state of individual regions. Alternatively, MeDIP can be combined with large-scale analy-sis using microarrays as a genome-wide experimental readout. This protocol has been applied to generatecomprehensive DNA methylation profiles on a genome-wide scale in mammals and plants, and furtherto identify abnormally methylated genes in cancer cells.

Key words: MeDIP, methylated DNA, DNA methylation, genome-wide analysis, epigenomics,5mC antibody, CpG, immunoprecipitation.

1. Introduction

Techniques to map DNA methylation on a genome-wide scalewere only developed recently. Several of these are based on classi-cal methylation-sensitive (e.g., HpaII and NotI) or methylation-specific (e.g., McrBC) restriction enzymes. However, these assayslimit the analysis to certain sequence motifs, for example, only3.9% of all nonrepeat CpGs in the human genome reside withinrecognition sites of the HpaII enzyme (1). To circumvent thismotif bias, techniques have been developed that use affinity purifi-cation of methylated DNA either by monoclonal antibodies spe-cific to 5-methylcytidine (5mC) or by methyl-binding protein(MBD) domains specific to methylated CpGs (for a more compre-hensive list of methods see (2,3)). Importantly, such affinity-basedapproaches bear constraints that need to be taken into account

Jörg Tost (ed.), DNA Methylation: Methods and Protocols, Second Edition, vol. 507C© 2009 Humana Press, a part of Springer Science+Business MediaDOI 10.1007/978-1-59745-522-0 5 Springerprotocols.com

55

56 Mohn et al.

when setting up experiments and choosing the most suitable tech-nique. Namely, the fact that methylated CpG-rich sequences aremore enriched by affinity approaches than methylated CpG-poorsequences which is simply because they contain more epitopes tobe bound by the antibody or MBD domain.

Another caveat which applies to all techniques combined withgenome-wide detection on microarrays is that allelic methyla-tion and methylation of individual repetitive elements cannotbe addressed comprehensively. Bisulfite genomic sequencing isless limited in that regard but requires extensive resources whenapplied genome-wide.

The methylated DNA immunoprecipitation (MeDIP) pro-tocol (Fig. 5.1) is a fast and simple approach to determineDNA methylation on a genome-wide scale or for individual loci:genomic DNA is randomly sheared by sonication and methy-lated DNA is subsequently immunocaptured with a monoclonal

Fig. 5.1. Principle of MeDIP (methylated DNA immunoprecipitation). Total genomic DNAis sonicated and methylated DNA (Me) is immunoprecipitated with an antibody directedagainst 5-methylcytidine. Input DNA (IN) and methylated DNA (M) can be used for single-gene analysis by standard or real-time PCR or they can be differentially labeled with Cy5and Cy3 and cohybridized as a two-color experiment on oligonucleotide microarrays.

Methylated DNA Immunoprecipitation 57

antibody specific for 5mC (4). For individual regions the enrich-ment of the methylated fraction as compared to the input can beassessed by PCR. In combination with DNA microarrays, MeDIPcan be applied to generate large-scale maps of DNA methyla-tion. The protocol has been successfully used with genomic DNAfrom various organisms that contain methylated cytosines in theirgenome (human, mouse, chimp, Arabidopsis thaliana, and Neu-rospora crassa). Comprehensive DNA methylation profiles on agenome scale have been published for mammals and plants (5–7),and genes abnormally methylated in cancer cells could be identi-fied (5,8).

2. Materials

Materials can be stored at room temperature (RT) for severalweeks unless indicated otherwise.

2.1. Isolation ofGenomic DNA

1. Lysis buffer: 20 mM Tris–HCl, pH 8.0, 4 mM EDTA, 20 mMNaCl, 1% SDS.

2. Proteinase K (Roche), store at −20◦C.3. RNase A (Sigma, Cat. No. 83833), store at −20◦C.

2.2. Sonication ofGenomic DNA

1. The protocol was established using a BRANSON digital Soni-fier model 450 with a tapered Microtip. Other sonicators(including waterbath sonicators) work too, but conditionsneed to be adjusted.

2. Glycogen (Roche), store at −20◦C.

2.3.Immunoprecipitationof Methylated DNA(MeDIP)

1. 1M Na-Phosphate buffer, pH 7.0: 39 mL 2 M monobasicsodium phosphate (NaH2PO4) (276 g/L), 61 mL 2 M diba-sic sodium phosphate (Na2HPO4) (284 g/L), 100 mL H2O.

2. 10 × IP buffer: 100 mM Na-Phosphate, pH 7.0, 1.4 MNaCl, 0.5% Triton X-100.

3. TE (Tris EDTA) buffer: 10 mM Tris–HCl, pH 8.0, 1 mMEDTA, pH 8.0.

4. 1 × IP buffer: one volume 10 × IP buffer and nine volumesTE buffer.

5. 5-Methylcytidine antibody: this protocol was establishedusing the mouse monoclonal antibody against 5mC gen-erated by Reynaud and colleagues (4) and supplied byEUROGENTEC (#BI-MECY-1000). A similar antibodyis also available from other companies (CALBIOCHEM,DIAGENODE), which work with comparable efficiency. Theantibody can be aliquoted and stored at −20◦C to avoidfreeze–thaw cycles.

58 Mohn et al.

6. PBS buffer: 2.67 mM KCl, 1.47 mM KH2PO4, 137.93 mMNaCl, 8.06 mM Na2HPO4, pH 7.3;

7. 0.1% BSA/PBS: 9 mL PBS, 1 mL BSA 10 mg/mL stock.8. Magnetic beads: Dynabeads M-280 Sheep anti-mouse IgG

(DYNAL BIOTECH #112.01).9. A magnetic rack for microtubes is required for the washing

steps following immunoprecipitation.10. Proteinase K digestion buffer: 50 mM Tris–HCl, pH 8.0,

10 mM EDTA, 0.5% SDS.

2.4. PCR Verificationof MeDIP

1. Taq polymerase (New England Biolabs, 5 U/μL).2. 10 × ThermoPol buffer (New England Biolabs).3. 2.5 mM dNTP mix

3. Methods

3.1. Isolation ofGenomic DNA

1. Resuspend the cell pellet or the homogenized tissue in TE ina 2 mL microtube. We typically use 106–107 cells which areresuspended in 300 μL (the volume should be increased forbig cell pellets or tissue samples).

2. Add 300 μL (one volume) lysis buffer containing 20 μL pro-teinase K (10 mg/mL stock) (see Note 1).

3. Incubate at 55◦C for at least 5 h.4. Extract with one volume phenol (600 μL). Transfer the upper,

aqueous phase to a new tube.5. Extract with one volume chloroform (600 μL). Transfer the

upper, aqueous phase to a new tube.6. Precipitate the DNA by slowly adding two volumes ethanol

containing 75 mM Na Acetate pH 5.2 (1.2 mL) and let it sitat RT for a few minutes until the genomic DNA is fully pre-cipitated.

7. Transfer the DNA with a pipette tip into a fresh tube contain-ing 1 mL ethanol 70%, invert 5 ×, and centrifuge 5 min at topspeed at RT.

8. Resuspend the DNA pellet in TE containing 20 μg/mLRNAse A.

9. Incubate at 37◦C for 30 min (see Note 2).

3.2. Sonication ofGenomic DNA

Genomic DNA is randomly sheared by sonication to generatefragments between 300 bp and 1000 bp (Fig. 5.2). GenomicDNA can also be fragmented with restriction enzymes like AluI,but this is not recommended for unbiased microarray studies.The sonication efficiency varies with DNA concentration, soni-cator model and settings, and size and quality of the sonicationtip. Therefore, we recommend systematic checking of the size ofthe sheared DNA on an agarose gel to ensure equal sonication

Methylated DNA Immunoprecipitation 59

Fig. 5.2. The gel illustrates sonicated genomic DNA run on a 2% agarose gel stainedwith ethidium bromide. Most of the sheared fragments have a size between 300 bp and1000 bp with an average fragment size around 500 bp.

between experiments. The following shearing settings are opti-mized for a Branson Sonifier model 450 with a tapered Microtip(see Note 3) and a Diagenode Bioruptor 200 waterbath sonicator,respectively.

3.2.1. Branson Sonifier 1. Dilute the genomic DNA in TE in a 1.5 mL microtube(10–20 μg DNA in 300 μL TE, 40–60 μg DNA in 700 μLTE).

2. Sonicate 5 × 10 s with amplitude 20% while the tube is cooledin ice water. Allow the sample to cool down after each pulsefor 1 min (see Note 3).

3. Load 5–10 μL on an agarose gel to check the size of the DNA(mean size should be 300–1000 bp; Fig. 5.2). Alternatively,fragment size can be monitored by a labchip assay on a Bio-analyzer (Agilent). If necessary, sonicate for one or two addi-tional pulses until the size of the DNA is 300–1000 bp (seeNote 4).

4. Continue at 3.2.3

60 Mohn et al.

3.2.2. BioruptorWaterbath Sonicator

1. Dilute 20 μg genomic DNA in 300 μL TE in a 1.5 mLmicrotube.

2. Sonicate for 12 cycles 30 s on/30 s off, the highest output levelwhile cooling the tube to 1◦C in the waterbath (see Note 3).

3. Load 5–10 μL on an agarose gel to check the size of the DNA(mean size should be 300–1000 bp; Fig. 5.2). Alternatively,fragment size can be monitored by labchip assay on a Bioana-lyzer (Agilent). If necessary, sonicate for one or two additionalpulses until the size of the DNA is 300–1000 bp (see Note 4).

3.2.3. Purification ofSonicated DNA

1. Precipitate the sonicated DNA with 400 mM NaCl (24 μL5 M NaCl for 300 μL, 56 μL 5 M NaCl for 700 μL), two vol-umes 100% EtOH and 1 μL glycogen. Centrifuge for 60 minat 4◦C at 16,100g in a table centrifuge. Add 300 μl of 70%EtOH to remove salts and centrifuge for 10 min at 16,100g(Note that the precipitation for 700 μL has to be done in2-mL tubes or in two 1.5 mL microtubes).

2. Resuspend the DNA pellet in 50μL TE and measure DNAconcentration.

3.3.Immunoprecipitationof Methylated DNA(MeDIP)

The sonicated DNA is immunoprecipitated with a monoclonalantibody against 5mC (4). A portion of the sonicated DNAshould be left untreated to serve as input control (for microar-ray experiments, typically 3–5 μg input material are required).1. Dilute 4 μg of sonicated DNA in 450 μL TE (see Note 5).2. Denature for 10 min in boiling water and immediately cool

on ice for 10 min.3. Add 51 μL of 10× IP buffer.4. Add 10 μL of 5mC antibody.5. Incubate 2–6 h at 4◦C with overhead shaking.6. Prewash 40 μL of Dynabeads with 800 μL of 0.1% BSA/PBS

for 5 min at RT with overhead shaking to avoid sedimenta-tion of the beads.

7. Trap the beads on the wall of the tube using a magnetic rack,discard supernatant, and repeat wash once with 800 μL 0.1%BSA/PBS.

8. Trap the beads on a magnetic rack, discard supernatant, andresuspend in 40 μL of 1× IP buffer.

9. Add Dynabeads to the sample.10. Incubate 2 h at 4◦C with overhead shaking (see Note 6).11. Trap the beads on a magnetic rack, discard supernatant,

and wash with 700 μL 1× IP buffer for 10 min at RT withshaking.

12. Repeat the washing with 700 μL 1× IP buffer twice.13. Trap the beads on a magnetic rack, discard supernatant, and

resuspend in 250 μL proteinase K digestion buffer.14. Add 7 μL proteinase K (10 mg/mL stock).

Methylated DNA Immunoprecipitation 61

15. Incubate 3 h at 50◦C (use a shaking heat block at 800 rpm(Eppendorf Thermomixer) to prevent sedimentation of thebeads).

16. Extract with one volume phenol (250 μL), transfer the upper,aqueous phase to a fresh microtube.

17. Extract supernatant with one volume chloroform (250 μL),transfer the upper, aqueous phase to a fresh microtube.

18. Precipitate the DNA with 400 mM NaCl (20 μL 5 M NaCl),glycogen (1 μL) and two volumes 100% ethanol (500 μL).Wash with 70% EtOH as described above.

19. Resuspend the DNA pellet in 60 μL TE and store at −20◦C(see Note 7).

3.4. Analysis by PCRand Microarrays

Enrichments in the MeDIP fraction can be measured by PCRor by microarray analysis (Fig. 5.1). Table 5.1 contains a setof control primers for human and mouse, which are suitable fortesting the efficiency of MeDIP, and the PCR conditions as wellas the PCR setup and cycling conditions.

Keep in mind that CpGs are unequally distributed in mam-malian genomes and that the enrichment of any target sequencein the MeDIP fraction depends both on the methylation statusof the target sequence and the number of CpGs it contains (6).A low enrichment can thus reflect an unmethylated state or theabsence of CpGs.1. For PCR or real-time PCR, use 20 ng of total input DNA and

2 μL of MeDIP DNA.2. Enrichments in the MeDIP fraction are calculated relative to

an unmethylated control, which typically is a CpG island pro-moter of a housekeeping gene.

3. For genome-wide analyses, input and MeDIP fractions are dif-ferentially labeled with two dyes (e.g., Cy3 and Cy5) and cohy-bridized to oligonucleotide-tiling microarrays.For the MeDIP fraction, DNA from parallel MeDIPs can be

pooled to obtain the required quantity of DNA for labeling. Alter-natively, if pooling of up to 8 MeDIPs is not feasible, amplifica-tion of a single MeDIP can be performed. The whole genomeamplification (WGA) protocol (see NoE protocol PROT30 (9))can be applied to single-stranded DNA samples and thus shouldbe usable. However, we have not tested systematically if WGAintroduces amplification biases when applied to MeDIP samples.

The array analysis depends largely on the type of array usedand the questions to be answered. Thus, a general description ofan analysis strategy could be misleading. An example for DNAmethylation analysis on Nimblegen Promoter arrays can be foundin (6). For probe labeling, hybridization to NimbleGen 385K chips and washing steps, the Nimblegen Hybridization Kit(KIT002-2) and the corresponding protocols were used. In brief,data analysis consists of the following steps: normalization of the

62 Mohn et al.

Table 5.1Control PCR reaction scheme and primer to test MeDIP efficiency

PCR reaction setup

2 μL Template (resuspended MeDIP/total input 10 ng/μL)

0.5 μL Taq polymerase (5 U/μL)

5 μL ThermoPol reaction buffer

1.5 μL Forward primer 5 μM

1.5 μL Reverse primer 5 μM

2.5 μL 2.5 mM dNTP mix

37 μL H2O

PCR cycling conditions

3 min. 95◦C 1×30 sec. 95◦C |30 sec. Annealing temperature (see below) |× number of cycles

(see below)

30 sec. 72◦C |30 min. 72◦C 1×Name Positive/negative Sequence Number

of cyclesAnnealingtemp.

Control primers for mouse

Beta actinpromoter

Neg. AGCCAACTTTACGCCTAGCGT 32 60◦C

TCTCAAGATGGACCTAATACGGC

Gapdhpromoter

Neg. CTCTGCTCCTCCCTGTTCC 32 60◦C

TCCCTAGACCCGTACAGTGC

H19-ICR Pos. GCATGGTCCTCAAATTCTGCA 32 60◦C

GCATCTGAACGCCCCAATTA

IAP (repeat) Pos. CTCCATGTGCTCTGCCTTCC 24 60◦C

CCCCGTCCCTTTTTTAGGAGA

Control primers for human

UBE2B Neg. CTCAGGGGTGGATTGTTGAC 36 60◦C

TGTGGATTCAAAGACCACGA

(continued)

Methylated DNA Immunoprecipitation 63

Table 5.1 (continued)

PCR reaction setup

HIST1H3B Neg. CCCACACTTCTTATGCGACA 34 60◦C

CTGTGCCTGGTTGCAGATTA

H19 ICR Pos. GAGCCGCACCAGATCTTCAG 36 60◦C

TTGGTGGAACACACTGTGATCA

data (e.g., loss normalization), averaging of signals in regions ofinterest (e.g., average over a region in a promoter), definition of asignificant threshold for enrichment or depletion of DNA methy-lation signals and annotation of the identified regions to relatechanges in DNA methylation to genomic information.

4. Notes

1. Due to the viscosity of the solution after cells lysis, it is rec-ommended to add the proteinase K to the lysis buffer beforemixing it with the sample.

2. It is important to completely remove any RNA, as the anti-body also recognizes 5mC in the context of RNA molecules.

3. Keep the sample on ice during the sonication process toavoid denaturing and potential degradation of the DNA dueto contaminations. Alternatively, waterbath sonicators canbe used; however, conditions need to be adjusted for eachapparatus.

4. Avoid shearing the DNA too small, that is, below an averagesize of 400 bp as this can affect the immunoprecipitation effi-ciency and also the detectability of methylated DNA by PCRand microarrays.

5. We recommend the use of 4 μg; however, smaller amountsdown to 1 μg have been used successfully. For little startingmaterial, the amount of antibody has to be adapted in orderto avoid unspecific binding and increasing background in theIP.

6. Avoid incubation over 3 h as this might increase unspecificbinding of DNA to the beads.

7. With the described conditions, the MeDIP procedure gener-ally yields 5% of the original total DNA in mammalian cells(i.e., 200 ng of methylated DNA starting from 4 μg totalDNA). The amount of recovered DNA can be increasedby using amounts of Dynabeads to up to 100 μl. How-ever, with increasing amounts of Dynabeads, the linear range

64 Mohn et al.

of enrichment might be changed. Thus, additional controls(e.g., bisulfite sequencing) need to be done to make sure thatthe enrichments are correctly reflecting the methylation statusof the region of interest.

Acknowledgements

The authors would like to thank the members of the Schubelerlab for helpful comments on the protocol.

References

1. Fazzari, M. J., Greally, J. M. (2004) Epige-nomics: beyond CpG islands. Nat Rev Genet5, 446–455.

2. Weber, M. Schubeler, D. (2007) Genomic pat-terns of DNA methylation: targets and func-tion of an epigenetic mark. Curr Opin Cell Biol19, 273–280.

3. Zilberman, D., Henikoff, S. (2007) Genome-wide analysis of DNA methylation patterns.Development 134, 3959–3965.

4. Reynaud, C., Bruno, C., Boullanger, P., et al.(1992) Monitoring of urinary excretion ofmodified nucleosides in cancer patients using aset of six monoclonal antibodies. Cancer Lett61, 255–262.

5. Weber, M., Davies, J. J., Wittig, D., et al.(2005) Chromosome-wide and promoter-specific analyses identify sites of differentialDNA methylation in normal and transformedhuman cells. Nat Genet 37, 853–862.

6. Weber, M., Hellmann, I., Stadler, M. B., et al.(2007) Distribution, silencing potential andevolutionary impact of promoter DNA methy-lation in the human genome.Nat Genet 39,457–466.

7. Zilberman, D., Gehring, M., Tran, R. K., et al.(2007) Genome-wide analysis of Arabidopsisthaliana DNA methylation uncovers an inter-dependence between methylation and tran-scription. Nat Genet 39, 61–69.

8. Keshet, I., Schlesinger, Y., Farkash, S., et al.(2006) Evidence for an instructive mechanismof de novo methylation in cancer cells. NatGenet 38, 149–153.

9. The EPIGENOME Network of Excellence(2007) Whole genome amplification pro-tocol for ChIP–chip (PROT30). (Accessedat http://www.epigenome-noe.net/ research-tools/pdfs/p30.pdf.)