www.elsevier.com/locate/ybbrc

Biochemical and Biophysical Research Communications 361 (2007) 1048–1053

Inhibition of AtMYB2 DNA-binding by nitric oxide involvescysteine S-nitrosylation

Viviane Serpa a, Javier Vernal a, Lorenzo Lamattina b, Erich Grotewold c, Raul Cassia b,*,Hernan Terenzi a

a Laboratorio de Expressao Genica, Departamento de Bioquımica, Universidade Federal de Santa Catarina, 88040-900 Florianopolis, SC, Brazilb Instituto de Investigaciones Biologicas, Facultad de Ciencias Exactas y Naturales, Universidad Nacional de Mar del Plata,

CC1245 (7600) Mar del Plata, Argentinac Department of Plant Cellular and Molecular Biology and Plant Biotechnology Center, The Ohio State University, Columbus, OH 43210, USA

Received 24 July 2007Available online 31 July 2007

Abstract

Nitric oxide (NO) can influence the transcriptional activity of a wide set of Arabidopsis genes. The aim of the present work was toinvestigate if NO modifies DNA-binding activity of AtMYB2 (a typical R2R3-MYB from Arabidopsis thaliana), by a posttranslationalmodification of its conserved Cys53 residue. We cloned a fully active minimal DNA-binding domain of AtMYB2 spanning residues 19–125, hereafter called M2D. In EMSA assays, M2D binds the core binding site 5 0-[A]AACC[A]-3 0. The NO donors SNP and GSNO inhi-bit M2D DNA-binding. As expected for a Cys S-nitrosylation, the NO-mediated inhibitory effect was reversed by DTT, and S-nitrosy-lation of Cys53 in M2D was detected by biotin switch assays. These results demonstrate that the DNA-binding of M2D is inhibited by S-nitrosylation of Cys53 as a consequence of NO action, thus establishing for the first time a relationship between the redox state andDNA-binding in a plant MYB transcription factor.� 2007 Elsevier Inc. All rights reserved.

Keywords: Nitric oxide; Nitrosylation; R2R3-MYB; AtMYB2; Arabidopsis; Biotin switch; EMSA

Nitric oxide (NO) is a diffusible multifunctional mole-cule involved in numerous physiological processes in phy-logenetically distant species [1]. NO was conclusivelydemonstrated to be present in plants, and it is involved inthe signalling of growth, development, and adaptiveresponses to multiple stresses [2–8]. NO action is achievedeither directly, by the reaction with effector molecules, orindirectly, by modifying the redox state of the cell. NOcan influence the expression of a wide set of Arabidopsis

genes [9], and several indirect regulatory mechanisms,including peroxynitrite formation, the reaction with transi-tion metals and S-nitrosylation, have been proposed tomediate NO action on transcriptional activity. Lindermayr

0006-291X/$ - see front matter � 2007 Elsevier Inc. All rights reserved.

doi:10.1016/j.bbrc.2007.07.133

* Corresponding author. Fax: +54 223 4922344.E-mail address: rocassia@mdp.edu.ar (R. Cassia).

and co-workers [10] have identified several S-nitrosylatedArabidopsis proteins resulting as a consequence of NOtreatments. Although several transcription factors havebeen shown to be modified by NO in animals [11], less isknown about the nitrosylation of plant transcriptional fac-tors. Members of the R2R3-MYB family of transcriptionfactors provide potential target for NO covalent modifica-tion. R2R3-MYBs constitute the largest MYB subfamilypresent only in plants, with more than 125 members in Ara-

bidopsis [12].Arabidopsis thaliana R2R3-MYB transcription factors

regulate a variety of processes including responses to envi-ronmental factors and hormones, developmental processesand cell fate, and metabolic pathways (for a review see [12].R2R3-MYB DNA-binding domains (DBD) are formed bytwo adjacent MYB repeats (R2 and R3) [12]. A character-istic of R2R3-MYB DBD, which is also shared by MYB

V. Serpa et al. / Biochemical and Biophysical Research Communications 361 (2007) 1048–1053 1049

proteins from animals and fungi, is the presence of a veryconserved Cys at position 53 (Cys53), in the DNA-recogni-tion helix of R2. The reduction of this Cys is essential for c-Myb DNA-binding. Mutation, oxidation or alkylation ofthis Cys inhibits c-Myb DNA-binding [13], and Brendefordet al [14] demonstrated that NO-generating agents severelyinhibited the DNA-binding activity of c-Myb, and thatCys130 (equivalent to Cys53 in plants) was responsiblefor this sensitivity to NO.

In plants, studies on the maize P1 regulator of flavonoidbiosynthesis highlighted the importance of redox control inR2R3-MYB DNA-binding by uncovering the formationunder non-reducing conditions of an intra-molecular disul-fide bond between Cys53 and Cys49, a cysteine residue thatis present in a large subset of plant R2R3-MYB proteins[15]. However, the physiological conditions that wouldinduce formation of the intra-molecular S–S bond in P1and related R2R3-MYB factors remain unknown.ATMYB2 is a typical Arabidopsis thaliana R2R3-MYBtranscription factor, which contains the conserved Cys53but lacks Cys49. AtMYB2 is expressed in response to waterstress, hypoxia, high salt conditions, and treatment withABA. ATMYB2 is also known to regulate the expressionof the salt and dehydration responsive genes ADH1 andrd22 [16,17,18]. AtMYB2 is expressed early in response tolow oxygen conditions, dehydration, or 24 h after250 mM NaCl or 1 mM ABA treatments [16,17], and itsexpression is reduced after 2 days of rehydration [16]. Tis-sue specific expression of AtMYB2 was restricted to roottips and leaf bases [16]. Interestingly, NO has been impli-cated in plant responses in all these stresses [7,19–21].AtMYB2 seems to function cooperatively with AtMYC2(a bHLH-ZIP protein former named rd22BP1) in a waydifferent to the ABRE-bZIP regulatory system in vegetativetissues and seeds [18,22].

Transgenic Arabidopsis plants overexpressing AtMYB2or AtMYC2 cDNAs exhibited ABA hypersensitivity.ABA-induced gene expression of many stress-induciblegenes including rd22 and AtADH1, was enhanced in thesetransgenic plants. [18].

The aim of the present work was to investigate if NO isable to inhibit AtMYB2 DNA-binding activity by post-translational modification of its Cys53.

Materials and methods

Material. The clone U63651A corresponding to a full-length cDNA ofAtMYB2 was provided by the Arabidopsis Biological Resource Center(The Ohio State University, Columbus, OH, USA). This cDNA is 822 bplong and was used as a template to amplify the entire DNA-bindingdomain of AtMYB2 by PCR using specific oligonucleotides. The forwardprimer contained a NdeI restriction site, AtMYB2 for (5 0-GGA AAT CATATG GAT GTA CGG AAA GG-3 0), and the reverse primer containedthe stop codon and a BamHI restriction site, AtMYB2rev (5 0-GTT AACGGA TCC TTA TTT GGC TTG CTT TTG G-3 0); the restriction sites areunderlined. PCR amplification using Taq DNA polymerase consisted ofan initial denaturation step at 95 �C for 5 min, followed by 30 cycles ofdenaturation at 95 �C for 45 s, annealing at 60 �C for 30 s, and extensionat 72 �C for 1 min, with a final extension step at 72 �C for 10 min in the

presence of 1.5 mM MgCl2. The DNA fragment obtained (348 bp) wasdigested with NdeI and BamHI restriction enzymes and ligated into thepET-14b vector (Novagene) previously digested with the same enzymes.The fragment was inserted downstream and in-frame with a codingsequence corresponding to the following amino acid residues: carrying ahexahistidine tag: MGSSHHHHHHSSGLVPRGSH. The recombinantplasmid (pET14b-M2D) was used to transform Escherichia coli DH5acompetent cells. Clones carrying the pET14b-DBD_AtMyb2 recombinantplasmid were identified by colony PCR and checked by DNA sequencing.In order to express the recombinant AtMYB2 DBD, plasmid pET14b-M2D was used to transform E. coli BL21(DE3) pLysS. E. coli cells con-taining the pET14b-M2D recombinant plasmid were inoculated in 10 mlof LB containing 100 lg/ml ampicillin and 50 lg/ml chloramphenicol.Overnight cultures were transferred into 250 ml of the same medium andwere grown at 37 �C until an OD value of 0.6 at 600 nm was reached.Isopropyl-b-D-thiogalactopyranoside (IPTG) was added to a final con-centration of 1 mM and cultures were further grown at 15 �C for 15 h.Cells were harvested by centrifugation (6000g for 30 min at 4 �C) and apellet of 1 g (wet weight) of cells was resuspended in 1 ml of 50 mMsodium phosphate lysis buffer (pH 8.0) containing 300 mM NaCl, 10 mMimidazole and protease inhibitor cocktail (Complete, Mini, Boehringer-Mannheim). The cells were disrupted by gentle sonication (6 cycles, 20 s)on ice and centrifuged (10,000g for 30 min at 4 �C). M2D was purifiedunder native conditions by metal chelate affinity chromatography (Che-lating Sepharose Fast Flow), following the supplier’s instructions (GEHealthcare, Uppsala, Sweden), 2 ml of column bed volume were used. Thehexahistidine tag M2D was eluted with 250 mM imidazole. The purity ofthe protein preparations was assessed by SDS–PAGE in 16% acrylamideslab gels, under reducing conditions [23]. The gels were stained withCoomassie brilliant blue R-250. The protein content was determined usingthe method of Bradford, with bovine serum albumin as standard.

The maize P1 MYB domain corresponds to a fragment spanning res-idues 10–118, previously cloned as a N terminal poly-histidine fusion(N6His-PMYBD9) [15].

Mass spectrometry. In-gel tryptic digestion was performed [24] using5 lg of purified M2D run in SDS–PAGE. Tryptic peptides were cleanedup with C-18 Zip tips (Millipore) and mixed with 60% acetonitrile and0.1% trifluoroacetic acid. Purified sample (1 ll) was mixed with 1 ll of a-cyano-4-hydroxycinnamic acid (10 mg/ml), spotted on a target plate, andsubmitted to mass spectrometric analysis in a MALDI-TOF equipment.

Polyacrylamide gel electrophoresis mobility shift assay. DNA bindingwas monitored by electrophoretic mobility shift assay (EMSA) using thedouble-stranded oligonucleotide probe MYBE (5 0CTTTCTTTACCTACCACCAACCTAACGGTCAAACCAACCAAACCTCTC3 0) corre-sponding to the rd22 gene promoter in which the AtMYB2 binding site isunderlined. All binding reactions were performed in a total volume of20 ll. The reaction solution contained 10 mM Tris–HCl (pH 8.0), 50 mMNaCl, 1 mM DTT, 1 mM EDTA, 5% glycerol and 15 lM M2D proteinswhen indicated. Samples treated with the NO donors sodium nitroprusside(SNP, 5 mM) or S-nitrosoglutathione (GSNO, 5 mM) were incubated at4 �C for 15 min. After treatment, the oligo probe (5 lM) was added andthe binding mixture incubated for an additional 15 min at 4 �C. Thesamples were analyzed by electrophoresis on a 10% native polyacrylamidegel, using a Tris–borate–EDTA (TBE) buffer system and stained withethidium bromide.

Biotin switch detection of S-nitrosylated proteins. Bacterial pellet wereresuspended and sonicated in HENS buffer (Hepes 25 mM, pH 7.7; EDTA1 mM; SDS 1%) as was described above. Protein concentration wasadjusted to 0.5 mg/ml. After treating 100 ll of each supernatant with1 mM GSNO for 30 min at room temperature (RT) in the dark, theproteins were incubated for 20 min (RT) with 300 ll of 25 mM Hepes, pH7.7 containing 1 mM EDTA; 3.3% (w/v) SDS, 27 mM MMTS. Sampleswere frequently vortexed for blocking non-nitrosylated free Cys residues.To differentiate between specific and non-specific nitrosylations, a set ofsamples was treated with 1 mM GSH, instead of GSNO. Residual MMTSwas removed by precipitation with 2 vol of chilled (�20 �C) acetone andthe proteins were resuspended in 60 ll of HENS buffer. Biotinylation wasachieved by adding 1 mM ascorbate and 2 mM biotin-HPDP and incu-

1050 V. Serpa et al. / Biochemical and Biophysical Research Communications 361 (2007) 1048–1053

bating at room temperature for 1 h. Proteins were acetone-precipitatedand resuspended in the same volume of HENS buffer. To detect biotin-ylated proteins by Western blot, samples from the biotin switch assay wereseparated on 15% SDS–PAGE gels, transferred to PVDF membranes,blocked with non-fat dried milk, and incubated with 1/10,000 goat anti-biotin antibody (Sigma) overnight at 4 �C. After that, membranes werewashed and incubated 1 h with secondary rabbit anti-goat IgG peroxidaseconjugate. Amersham ECL chemiluminescent kit was used to detect thesignals, and Kodak XR films to visualize the results.

Western blot. In order to check the M2D identity, membranes werestripped and rebloted with a rabbit polyclonal antibody raised against theP1-MYB domain (amino acids 1–118). This antibody was used at 1:5000dilution, and visualized with an AP-conjugated secondary antibody.

Results and discussion

The AtMYB2 minimal DBD is functionally active

We have used E. coli to express M2D, a minimalAtMYB2 DNA-binding domain, spanning residues 19–125. M2D is a his-tagged fusion protein, which was purifiedby metal chelate affinity chromatography. The M2D iden-tity was confirmed by mass spectrometry (not shown) andused in electrophoretic mobility shift assays (EMSA). M2Dretarded the migration of MYBE, a double-stranded oligo-nucleotide containing the sequence 5 0-CAAACCAAC-3 0,to which AtMYB2 was shown to bind [17] (Fig. 1, lanes2 and 3). In contrast, and highlighting the distinctDNA-binding specificity of AtMYB2 compared to otherR2R3-MYB proteins, M2D did not shift the APB1 probe,containing two overlapping canonical R2R3-MYB bindingmotifs- 5 0-CCTACCAACC-3 0, (Fig. 1, lane 4), and whichis bound by N6His-PMYBD9 (Fig. 1, lane 6). Expanding

5µM MYBE + +

5µM APB1 - -

15µM N6His-PMYBΔ9 - -

15µM M2D - +

1mM DTT + +

1 2

Fig. 1. DNA-binding properties of R2R3 MYB M2D. DNA binding was mostranded oligonucleotide probe MYBE, corresponding to a region present in tregion of the P1-regulated A1 gene promoter (lanes 4, 5, and 6). Shifts were mDTT (indicated by + and �, respectively) before the incubation with the DNprobe, respectively. Differences between MYBE and APB1 free probe migrati

the previously known range of P1-binding sequences [25],our results show that N6His-PMYBD9 also binds the MYBEsite (Fig. 1, lane 7).

Interestingly, and likely reflecting the absence of a sec-ond Cys at position 49, M2D bound to the MYBE site evenin the absence of DTT (Fig. 1, lane 3), conditions underwhich P1 is not able to bind [15,25]. DTT is necessary alsofor the DNA-binding activity of c-MYB [14] harboringonly Cys130, which is equivalent to Cys53 in AtMYB2.The difference sensitivity of c-MYB and AtMYB2 to redoxconditions are likely to be a consequence of some of themajor structural differences that distinguish the MYBdomains of these two proteins [15].

The nitric oxide donors SNP and GSNO inhibit M2D DNA-

binding

Sodium nitroprusside (SNP) provides a commonly effec-tive NO donor [26]. When M2D was incubated with SNP(5 mM) in the DNA-binding buffer for 15 min at 4 �Cbefore the addition of the MYBE oligo, the binding ofM2D to MYBE was completely abolished, as indicatedby the disappearance of the retarded band (Fig. 2, comparelanes 2 and 3). When 50 mM DTT was added to theSNP-treated M2D, the binding to DNA was restored, asindicated by the shift observed in the DNA migration(Fig. 2, lane 4).

To further determine whether the effect of SNP onthe DNA-binding activity of M2D was due to S-nytrosyla-tion, we tested the more physiological NO donor S-nitroso-glutathione (GSNO). Similar to SNP, GSNO (5 mM)

+ - - - +

- + + + -

- - - + +

+ + - - -

- + + + +

3 4 5 6 7

nitored by electrophoretic mobility shift assay (EMSA) using the double-he rd22 gene promoter (lanes 1, 2, 3, and 7), or APB1, corresponding to aade in the presence or absence of the, M2D or N6His-PMYBD9 proteins orA. Filled and open arrows indicate protein–DNA complex and free DNAon are due to probes sizes.

5µM MYBE: + + + + + +15µM M2D: - + + + + +5mM SNP: - - + + - -5mM GSNO - - - - + +50mM DTT: - - - + - +

1 2 3 4 5 6

Fig. 2. Influence of NO donors and DTT in the DNA-binding propertiesof R2R3 MYB M2D. EMSA was performed with purified M2D and theMYBE probe in the presence or absence of particular reagents (indicatedby + and �) before the incubation with the DNA. M2D was treated withthe NO donors sodium nitroprusside (SNP, 5 mM) or S-nitrosoglutathi-one (GSNO, 5 mM) at 4 �C for 15 min. When indicated, an additional50 mM DTT was added after the incubation with the NO donors. Filled

and open arrows indicate protein–DNA complex and free DNA probe,respectively.

V. Serpa et al. / Biochemical and Biophysical Research Communications 361 (2007) 1048–1053 1051

completely inhibited binding of M2D to MYBE (Fig. 2,lane 5), an activity that could be restored by the additionof 50 mM DTT (Fig. 2, lane 6). DTT appears not to be nec-essary for the M2D binding activity (Fig. 1), but binding isstrongly inhibited by nitrosylating agents, such as SNP andGSNO (Fig. 2). The inhibition of the DNA-binding activ-ity was reversed by DTT, suggesting that Cys53 reductionis necessary for M2D DNA-binding activity. Given thatM2D has no other Cys that would permit the formationof an S–S intra-molecular bond, as found in P1, it is possi-ble to conclude that Cys53 is initially reduced in our exper-imental conditions. Similar as we observed for M2D, NOdonors also inhibited the DNA-binding activity of the c-MYB minimal DNA-binding domain, leading to the sug-gestion that c-MYB might be regulated by S-nitrosylation.Thus, we decided to investigate whether Cys53 in M2Dcould be nitrosylated [14].

M2D is nitrosylated as a consequence of NO treatments

To investigate the putative S-nitrosylation of M2D sug-gested by our previous results, we used the biotin-switchmethod. This method is based on the labelling of S-nitrosy-lated proteins with a biotin moiety, specifically on S-nitro-sylated Cys residues [27,28]. Biotinylated proteins can bevisualized by immunobloting using anti-biotin antibodies.This technique poses some technical difficulties whichinclude (i) high amounts of protein are necessary for biotinswitch nitrosylation assays, (ii) sometimes, pure nitrosylat-

ed proteins must be precipitated with other ‘‘carrier’’ pro-teins, (iii) M2D is purified by elution with imidazole, andimidazole is precipitated in acetone, and (iv) M2D precip-itates when purified fractions are dialyzed. To overcomethese difficulties, we performed an ‘‘in bulk’’ biotin switchassay over bacterial extracts over-expressing M2D. Whenwe applied this method, several bands representing nitrosy-lated proteins were detected in total bacterial extracts trea-ted with 1 mM GSNO (Fig. 3A, lanes 1 and 3). Amongthem, a band corresponding to the molecular weight ofM2D was detected (Fig. 3A, lane 3). M2D identity wasconfirmed by stripping and re-probing the same membranewith an anti-MYB domain polyclonal antibody (Fig. 3C,lanes 3 and 4) [25]. When GSH (1 mM) was used insteadof GSNO, no bands were detected (Fig. 3A, lanes 2 and4), confirming that the detected band in the GSNO-treatedsample is due to an effect of NO. Coomassie staining andWestern blot showed the presence of M2D in GSNO-and GSH-treated samples (Fig. 3B and C, lanes 3 and 4).As a control, biotin switch was performed in bacterialtransformed with the control pET-14b vector plasmid, con-ditions in which the band corresponding to M2D was notdetected neither by Coomassie nor by Western blot(Fig. 3A, lane 1, Fig. 3B and C, lanes 1 and 2). The lowintensity of the band corresponding to M2D in the biotinswitch (Fig. 3A, lane 3) is likely due to the presence of onlyone Cys residue in this protein.

This is the first report that provides experimental evi-dence that a plant R2R3-MYB transcription factor canbe nitrosylated.

S-nitrosylation is gaining increasing interest as a keyregulatory mechanism during plant stress responses, as wellas during changes in the redox potential of the cell signaltransduction [2,10,29]. Cysteine residues are present inpretty much every protein. In some cases, these cysteineresidues participate in the coordination of transition metals(e.g., zinc fingers) yet only in a very small number of pro-teins, cysteines appear to be modulated by nitrosylation[30]. The continuing identification of the proteins thatcan be susceptible to and modulated by this modificationin plants is surely going to contribute to understandingthe mechanistic and functional relevance of this process.

This highly reactive Cys53 was nitrosylated by 1 mMGSNO, a concentration that may inhibit M2D DNA bind-ing. This nitrosylation was detected by the biotin-switchspecific method (Fig. 3), suggesting that nitrosylation isthe mechanism driving the NO-mediated inhibition ofAtMYB2 binding to DNA.

ABA is closely related to NO production under droughtstress conditions [6–8], and AtMYB2 expression is inducedby ABA within 24 h of treatment [16]. ABA also inducesNO overproduction [21] suggesting that the NO-dependentAtMYB2 nitrosylation may provide a mechanism to turn-off the biological activity of this regulatory protein after theinitial response to drought. Thus, changes in the redoxstate of the cell may have consequences in the AtMYB2regulated gene expression. This work is a good starting

pET14b pET14b M2D M2D pET14b pET14b M2D M2DGSNO GSH GSNO GSH kDa GSNO GSH GSNO GSH kDa

21.5

14.4

21.5

14.4

1 2 3 4 1 2 3 4

1 2 3 4

Anti-MYB

A

C

B

Fig. 3. S-Nitrosylation of NO-treated R2R3 MYB M2D. Fifty micrograms of protein from bacteria overexpressing M2D (indicated as M2D), ortransformed with pET-14b plasmid not-containing M2D (pET14b), were treated with 1 mM GSNO (GSNO) or 1 mM GSH (GSH), respectively . Then,proteins were labelled with biotin using the biotin switch method. (A) Detection of S-nitrosylated proteins: Twenty micrograms of the above protein wereseparated by SDS–PAGE and blotted onto polyvinylidene difluoride-membrane. Biotinylated proteins were detected using anti-biotin antibody. Therelative masses of protein standards are shown on the right. Arrow indicates M2D. (B) Twenty micrograms of protein treated as in (A) were separated bySDS–PAGE and stained with Coomassie blue. Numbers in the right indicates molecular weight. Arrow indicates M2D. (C) MYB detection: The samemembrane used in (A) was stripped and re-probed with a polyclonal anti-MYB domain antibody.

1052 V. Serpa et al. / Biochemical and Biophysical Research Communications 361 (2007) 1048–1053

point to go further in investigating if nitrosylation is a gen-eral mechanism regulating R2R3-MYB activity.

Acknowledgments

We thank Dr. Massimo Delledonne (Verone, Italy) forhelpful collaboration with the biotin switch methodology.L. Lamattina and R. Cassia are permanent researchers ofCONICET, Argentina. Research in the authors’ laboratorywas supported by Consejo Nacional de InvestigacionesCientificas y Tecnologicas (CONICET), Universidad Na-cional de Mar del Plata (UNMdP), Agencia Nacional dePromocion Cientifica y Tecnologica (ANPCyT), ConselhoNacional de Desenvolvimento Cientıfico e Tecnologico(CNPq), Coordenacao de Aperfeicomento de Pessoal deNıvel Superior (CAPES), Fundacao de Apoio a PesquisaCientıfica e Tecnologica do Estado de Santa Catarina(FAPESC), Ministerio da Ciencia e Tecnologia (MCT) eFinanciadora de Estudos e Projetos (FINEP). In theGrotewold lab support for this project was provided bystate funds appropriated to the Ohio Plant BiotechnologyConsortium through The Ohio State University, OhioAgricultural Research and Development Center.

References

[1] A.J. Gow, H. Ischiropoulos, Nitric oxide chemistry and cellularsignaling, J. Cell Physiol. 187 (2001) 277–282.

[2] S. Grun, C. Lindermayr, S. Sell, J. Durner, Nitric oxide and generegulation in plants, J. Exp. Bot. 57 (2006) 507–516.

[3] M.V. Beligni, L. Lamattina, Nitric oxide protects against cellulardamage produced by methylviologen herbicides in potato plants,Nitric Oxide 3 (1999) 199–208.

[4] M.V. Beligni, L. Lamattina, Nitric oxide: a non-traditional regulatorof plant growth trends, Plant Sci. 6 (2001) 508–509.

[5] M.V. Beligni, L. Lamattina, Nitric oxide stimulates seed germinationand de-etiolation, and inhibits hypocotyl elongation, three light-inducible responses in plants, Planta 210 (2000) 215–221.

[6] L. Lamattina, C. Garcia-Mata, M. Graziano, G. Pagnussat, Nitricoxide: the versatility of an extensive signal molecule, Annu. Rev.Plant Biol. 54 (2003) 109–136.

[7] C.G. Mata, L. Lamattina, Nitric oxide induces stomatal closure andenhances the adaptive plant responses against drought stress, PlantPhysiol. 126 (2001) 1196–1204.

[8] N. Correa-Aragunde, L. Lanteri, C. Garcia-Mata, A. ten Have, A.M.Laxalt, M. Graziano, L. Lamattina, Nitric oxide functions asintermediate in auxin, abscicic acid, and lipid signaling pathways,in: L. Lamattina, J. Polacco (Eds.), Nitric Oxide in Plant Growth,Development and Stress Physiology, SpringerLink, Heidelberg, 2007,pp. 113–130.

[9] A. Polverari, B. Molesini, M. Pezzotti, R. Buonaurio, M. Marte, M.Delledonne, Nitric oxide-mediated transcriptional changes in Ara-

bidopsis thaliana, Mol. Plant Microbe. Interact. 16 (2003) 1094–1105.

[10] C. Lindermayr, G. Saalbach, J. Durner, Proteomic identification of S-nitrosylated proteins in Arabidopsis, Plant Physiol. 137 (2005) 921–930.

[11] C. Bogdan, Nitric oxide and the regulation of gene expression, TrendsCell Biol. 11 (2001) 66–75.

[12] R. Stracke, M. Werber, B. Weisshaar, The R2R3-MYB gene family inArabidopsis thaliana, Curr. Opin. Plant Biol. 4 (2001) 447–456.

V. Serpa et al. / Biochemical and Biophysical Research Communications 361 (2007) 1048–1053 1053

[13] S. Guehmann, G. Vorbrueggen, F. Kalkbrenner, K. Moelling,Reduction of a conserved Cys is essential for Myb DNA-binding,Nucleic Acids Res. 20 (1992) 2279–2286.

[14] E.M. Brendeford, K.B. Andersson, O.S. Gabrielsen, Nitric oxide(NO) disrupts specific DNA binding of the transcription factor c-Mybin vitro, FEBS Lett. 425 (1998) 52–56.

[15] G.F. Heine, J.M. Hernandez, E. Grotewold, Two cysteines in plantR2R3 MYB domains participate in REDOX-dependent DNAbinding, J. Biol. Chem. 279 (2004) 37878–37885.

[16] T. Urao, K. Yamaguchi-Shinozaki, S. Urao, K. Shinozaki, AnArabidopsis myb homolog is induced by dehydration stress and itsgene product binds to the conserved MYB recognition sequence,Plant Cell 5 (1993) 1529–1539.

[17] F.U. Hoeren, R. Dolferus, Y. Wu, W.J. Peacock, E.S. Dennis,Evidence for a role for AtMYB2 in the induction of the Arabidopsisalcohol dehydrogenase gene (ADH1) by low oxygen, Genetics 149(1998) 479–490.

[18] H. Abe, T. Urao, T. Ito, M. Seki, K. Shinozaki, K. Yamaguchi-Shinozaki, Arabidopsis AtMYC2 (bHLH) and AtMYB2 (MYB)function as transcriptional activators in abscisic acid signaling, PlantCell 15 (2003) 63–78.

[19] C. Dordas, B.B. Hasinoff, A.U. Igamberdiev, N. Manac’h, J. Rivoal,R.D. Hill, Expression of a stress-induced hemoglobin affects NOlevels produced by alfalfa root cultures under hypoxic stress, Plant J.35 (2003) 763–770.

[20] M.G. Zhao, Q.Y. Tian, W.H. Zhang, Nitric oxide synthase-depen-dent nitric oxide production is associated with salt tolerance inArabidopsis, Plant Physiol 144 (2007) 206–217.

[21] J. Bright, R. Desikan, J.T. Hancock, I.S. Weir, S.J. Neill,ABA-induced NO generation and stomatal closure in Arabid-

opsis are dependent on H2O2 synthesis, Plant J. 45 (2006) 113–122.

[22] H. Abe, K. Yamaguchi-Shinozaki, T. Urao, T. Iwasaki, D. Hosok-awa, K. Shinozaki, Role of arabidopsis MYC and MYB homologs indrought- and abscisic acid-regulated gene expression, Plant Cell 9(1997) 1859–1868.

[23] H. Schagger, J.G. von, Tricine–sodium dodecyl sulfate–poly-acrylamide gel electrophoresis for the separation of proteins inthe range from 1 to 100 kDa, Anal. Biochem. 166 (1987) 368–379.

[24] R. Westermeier, T. Naven, Proteomics in Practice. A LaboratoryManual of Proteome Analysis, Wiley-VCH, Weinheim, 2002.

[25] C.E. Williams, E. Grotewold, Differences between plant and animalMyb domains are fundamental for DNA binding activity, andchimeric Myb domains have novel DNA binding specificities, J. Biol.Chem. 272 (1997) 563–571.

[26] J. Floryszak-Wieczorek, G. Milczarek, M. Arasimowicz, A. Ciszew-ski, Do nitric oxide donors mimic endogenous NO-related response inplants? Planta 224 (2006) 1363–1372.

[27] S.R. Jaffrey, S.H. Snyder, The biotin switch method for the detectionof S-nitrosylated proteins, Sci. STKE. (2001) L1.

[28] A. Martinez-Ruiz, S. Lamas, Detection and identification of S-nitrosylated proteins in endothelial cells methods, Enzymology 396(2005) 131–139.

[29] Y. Wang, B.W. Yun, E. Kwon, J.K. Hong, J. Yoon, G.J. Loake, S-nitrosylation: an emerging redox-based post-translational modifica-tion in plants, J. Exp. Bot. 57 (2006) 1777–1784.

[30] D.T. Hess, A. Matsumoto, S.O. Kim, H.E. Marshall, J.S. Stamler,Protein S-nitrosylation: purview and parameters, Nat. Rev. Mol. CellBiol. 6 (2005) 150–166.