induction of cell death by basic fibroblast growth factor in ewing's sarcoma

[CANCER RESEARCH 60, 6160–6170, November 1, 2000]

Induction of Cell Death by Basic Fibroblast Growth Factor in Ewing’s Sarcoma1

Lisa-Marie Sturla, Georgina Westwood, Peter J. Selby, Ian J. Lewis, and Susan A. Burchill2

Candlelighter’s Children’s Cancer Research Laboratory [L-M. S., G. W., S. A. B.], Imperial Cancer Research Fund Cancer Medicine Research Unit [P. J. S.], and Department ofPediatric Oncology [I. J. L.], St. James’s University Hospital, Leeds LS9 7TF, United Kingdom

ABSTRACT

Ewing’s sarcoma is thought to arise after developmental arrest ofprimitive neural cells during embryogenesis. Because basic fibroblastgrowth factor (bFGF) has a critical role in the regulation of cell survival,proliferation, and differentiation during embryogenesis, we have testedthe hypothesis that bFGF and FGF receptors may contribute to thedevelopment of Ewing’s sarcoma and may provide a mechanism for themodulation of their behavior. All four of the Ewing’s sarcoma cell linesexamined expressed bFGF and FGF receptors, which were detected byimmunofluorescence and Western blotting. bFGF-induced a significantdose-dependent decrease in Ewing’s sarcoma cell proliferation on plasticand reduced anchorage-independent growth in soft agar. Unexpectedly,this decrease in cell number reflected bFGF-induced apoptosis and ne-crosis, as demonstrated by electron microscopy, binding of annexin V, andstaining with acridine orange. Induction of cell death was dependent ondosage of, and period of exposure to, bFGF. bFGF did not induce differ-entiation of Ewing’s sarcoma cells in either the presence or the absence ofserum or nerve growth factor. Treatment of NuNu mice with bFGFdecreased growth of the highly tumorigenic Ewing’s sarcoma cell lines.Histologically tumors grown in the NuNu mice treated with bFGF wereless cellular than those in control mice, and showed an increased level ofapoptotic nuclei. This is in contrast to the mitogenic effect bFGF has inmost other cancer cells. In summary, bFGF decreases Ewing’s sarcomagrowth in vitro and in vivo by the induction of cell death. This novelobservation may provide a new therapeutic strategy for Ewing’s sarco-mas.

INTRODUCTION

bFGF3 belongs to a family of heparin-binding polypeptide growthfactors and was originally identified in extracts of pituitary and braintissue (1). It is ubiquitously expressed but is most abundant in thenervous system (2), affecting a broad spectrum of developmentallyregulated cellular responses involved in the control of growth anddifferentiation (3, 4). Levels of bFGF are high during neuronal mor-phogenesis (5), in which it has been shown to promote survival andrepair of neurons (2, 6). This suggests that bFGF has an important rolein maintaining specific neuronal populations (3). bFGF commonlyincreases cell proliferation (7–9), and inappropriate expression of thisgrowth factor and its receptors has been implicated in transformationand malignant progression (10–12). The use of bFGF to treat malig-nancy would, therefore, appear counterintuitive.

bFGF signal transduction occurs through a family of high- andlow-affinity FGF receptors, which are thought to account for itsdiverse effects. Four high-affinity receptors sharing the same basicstructure have been described, each containing an intracellular split-kinase domain and an extracellular domain containing up to three

immunoglobulin-like domains. Structural variants of the high-affinityreceptors can be generated by alternative splicing (13), resulting inmodified ligand binding (14, 15) and subcellular localization (16).These are expressed in a cell- and tissue-specific manner, which maychange during lineage development (10, 17).

Tumors of the Ewing’s sarcoma family, including the peripheralprimitive neuroectodermal tumors (pPNETs), are small round-celltumors arising in the bone or soft tissues in persons predominantlybetween the ages of 10 and 20 years. The histogenic origin of Ewing’ssarcoma has been a matter of some dispute, although recent evidenceconfirms a primitive pluripotent neural cell of origin (18). The varietyof bony and soft tissue locations for these tumors may be explained inpart by the wide distribution of pluripotent stem cells throughout theparasympathetic autonomic nervous system. Despite some improve-ments in treatment and outcome, less than 20% of patients whopresent with metastatic disease are long-term survivors, demonstratingthe need for new treatment strategies.

For many cancers, including the neurally derived childhood tumorneuroblastoma (19), histological and biochemical features of differ-entiation are associated with a good prognosis. This has lead to theevaluation of differentiation therapies, the aim being to selectivelyengage the process of terminal differentiation leading to restoration ofnormal cellular homeostasis. In neuroblastoma,in vitro studies haveshown that treatment with agents such as NGF (20, 21) or retinoic acid(22–24) induces differentiation, and more recently, the clinical effi-cacy of retinoic acid analogues has been demonstrated (25). However,Ewing’s sarcomas appear to have lost the ability to engage terminaldifferentiation (18, 26). We, therefore, formed the hypothesis thatbecause these tumors are derived from a primitive neural crest pro-genitor, they might be too immature to undergo differentiation aftertreatment with commonly used differentiation-inducing agents. If thiswere true, treatment of Ewing’s sarcoma cells with growth factors orhormones that commit pluripotent cells toward a differentiated lineagemight modulate their behavior and response to differentiation-induc-ing agents. Such use of growth-promoting agents in the treatment ofthis aggressive malignancy has not previously been considered.

bFGF has a critical role in the commitment of primitive neural cellstoward a neuronal phenotype (27, 28). Although exposure to NGF isan important mediator of neuronal differentiation, it will induce dif-ferentiation of sympathoadrenal progenitors only when the cells havefirst been exposed to bFGF (28). To determine whether bFGF drivesEwing’s sarcoma cells toward a neural phenotype, which might par-adoxically be exploited therapeutically, the effects of bFGF on theirgrowth, survival, and differentiation in the presence and absence ofNGF have been examined for the first time.

MATERIALS AND METHODS

Cell Lines

The well-characterized Ewing’s sarcoma family cell lines RD-ES, TC-32,SK-N-MC, A673, and TTC-466 were studied (29). All of the cell lines werederived from soft tissue peripheral primitive neuroectodermal tumors, with theexception of RD-ES, which was derived from a bony Ewing’s sarcoma. TheTC-32 and RD-ES cell lines were maintained in RPMI 1640 (Sigma, Poole,United Kingdom) supplemented with 10% FCS (Seralab, Sussex, UnitedKingdom). SK-N-MC and A673 cells were maintained in DMEM nutrient

Received 3/20/00; accepted 9/1/00.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby markedadvertisementin accordance with18 U.S.C. Section 1734 solely to indicate this fact.

1 Supported by the Candlelighter’s Trust, St. James’s University Hospital, Leeds,United Kingdom.

2 To whom requests for reprints should be addressed, at ICRF Cancer Medicine ResearchUnit, St. James’s University Hospital, Beckett Street, Leeds LS9 7TF, United Kingdom.Phone: 00-44-113-2065873; Fax: 00-44-113-2429886; E-mail: [email protected].

3 The abbreviations used are: bFGF, basic FGF; FGF, fibroblast growth factor;BrdUrd, bromodeoxyuridine; TUNEL, terminal deoxynucleotidyl transferase-mediatednick end labeling; FACS, fluorescence-activated cell sorting; RT-PCR, reverse transcrip-tion-PCR; PI, propidium iodide; NGF, nerve growth factor.

6160

Research. on February 6, 2016. © 2000 American Association for Cancercancerres.aacrjournals.org Downloaded from

http://cancerres.aacrjournals.org/

mixture HAM F12 (Sigma) and DMEM, respectively, supplemented with 10%FCS. The neuroblastoma cell line IMR-32, used as a positive control inproliferation and soft agar studies, was cultured in DMEM/RPMI 1640 (Sig-ma) plus 10% FCS. The breast carcinoma cell line MCF-7 was used as apositive control for bFGF and FGF receptor studies, and was maintained inDMEM supplemented with 10% FCS. With the exception of the TC-32 andRD-ES cells, which were a kind gift from Dr. J. A. Toretsky (National CancerInstitute, Bethesda, MD), all of the cell lines were purchased from the Amer-ican Tissue Culture Collection (Rockville, MD).

bFGF

Lyophilized bFGF (25mg; Sigma) was dissolved in 1 ml of sterile PBS (pH7.4) containing 1% (w/v) fatty-acid-free BSA (Sigma). bFGF was aliquotedand stored at220°C until required. Biological activity of bFGF was assayedusing a PC12 neurite extension assay (results not shown). Forin vivo studies,bFGF was dissolved in normal growth media and delivered daily by a singles.c. injection.

Viable Cell Number

Cells (2 3 105) were seeded in Primaria 6-well plates and incubated innormal media with serum for 24 h. Media were removed by aspiration andreplaced with fresh media plus 10% FCS alone or supplemented with bFGF(10–80 ng/ml). Cells were incubated at 37°C in a 95% air-5% CO2 humidifiedatmosphere for 24–96 h. In some experiments, cells were exposed to bFGF (20ng/ml) for 6, 12, 24, or 48 h; media were removed and replaced with freshmedia plus 10% FCS, followed by incubation for an additional 24, 48, or 72 h.After incubation, cells were harvested using EDTA (0.05%) and trypsin(0.1%), and viable cell numbers were counted using the trypan blue exclusionassay and a Neubauer hemocytometer. Results are shown as mean6 SE (n512; Fig. 3a).

BrdUrd Proliferation Assay

Cells (1.53 103) were seeded in Primaria 96-well plates and incubated innormal medium with serum for 24 h. Medium was removed, and wells wererinsed with a serum-free medium before treating with bFGF (2 pg–2mg/ml) innormal medium supplemented with 10% FCS or in a serum-free definedmedium containing sodium selenite (30 nM), progesterone (20 nM), putrescine(100 mM), transferrin (100mg/ml), and insulin (10mg/ml). Cells were incu-bated at 37°C in a 95% air-5% CO2 humidified atmosphere.

The Biotrak cell proliferation ELISA system, version 2 (Amersham) wasused to measure proliferation, following manufacturer’s instructions. BrdUrd(13.3mM) was added to culture medium 2 h prior to assay of cells at 24, 48,and 72 h. Absorbance (Abs) was determined at 450 nm (Titertek Multiskanplate reader). Relative BrdUrd incorporation is shown as (absorbancevalue 3 1000) 6 SE (n 5 3). Each assay was repeated three times, with 7replicates of each condition per assay.

Soft Agar Tumorgenicity Assay

Primaria Petri dishes (35-mm) were coated with 0.5 ml of endotoxin freeagar (0.3% v/v; Life Technologies, Inc., Paisley, United Kingdom) to preventcells adhering to the bottom of the dish. A single-cell suspension (53 104

cells/ml) of each cell line was prepared in serum-supplemented medium withbFGF (10 or 20 ng/ml), and agar was added to a final concentration of 0.3%(w/v) before plating 1 ml of cell suspension into the precoated Petri dishes.Agar was allowed to set for 10 min, and dishes were placed in a 10-cm2 Petridish containing one 35-mm dish of sterile ddH2O to maintain humidity. Disheswere incubated at 37°C in a humidified atmosphere of 95% air-5% CO2, andcolony formation was observed over 14 days. Colony number and size werescored in four randomly selected fields for each dish. Each condition wastested in triplicate, and each assay was repeated at least three times.

Ewing’s Sarcoma Xenografts in Nude Mice

Equal numbers of RD-ES or TC-32 cells (2.53 106 suspended in 200ml ofgrowth media) were delivered by a single s.c. injection in the right flank offemale NuNu mice. After 8 days, mice were treated with either bFGF (100 or200 ng in 0.1 ml of growth media/mouse/day) or with 0.1 ml of medium alone.

Mice were examined twice weekly for tumor growth, and palpable tumor sizewas recorded. When tumors reached approximately 1.4 cm3, mice were killed,tumors were excised, and sizes were accurately measured before they weremounted in OCT and frozen in liquid nitrogen-cooled isopentane. Cryosections(10-mm) of tumors were prepared and stained with H&E. Endogenous perox-idase was quenched in sections by treating with hydrogen peroxide (3% v/v inPBS; BDH) for 5 min at room temperature. Expression of the proliferationmarker Ki 67 was examined using a sheep anti-Ki 67 antibody (workingconcentrate, 1:200 dilution of antibody. The Binding Site, Birmingham, UnitedKingdom). Staining for Ki 67 was visualized using peroxidase-antiperoxidase,sections counterstained with H&E and mounted in DePeX mounting medium(BDH). The sections were examined by light microscopy using a ZeissAxioplan microscope (340), and the number of positive cells were scored in5 fields per xenograft. The proliferation index5 number of Ki 67-positivenuclei 4 number of nuclei scored ( proliferation index: 1, all cells proliferat-ing; 0, no cells proliferating). The number of apoptotic nuclei was scored usingthe TUNEL assay (see “TUNEL Assay” below).

Characterization of Cell Death

Light and Electron Microscopy. Cells (23 106) were seeded in 75-cm2

flasks and were cultured under normal growth conditions for 24 h. The mediawere removed and replaced with media alone or media containing bFGF (20ng/ml) for up to 4 days. Cells were harvested by gentle scraping with a rubberscraper and were centrifuged at 9003 g for 4 min to form a soft pellet. Cellswere then fixed in 2.5% gluteraldehyde in Sorenson’s buffer [0.16M disodiumhydrogen Pi, 0.04M sodium dihydrogen phosphate (pH7.4)] for 1 h before four20-min washes in Sorenson’s wash buffer [80 mM disodium hydrogen Pi, 20mM sodium dihydrogen phosphate (pH7.4)]. Sections (5-mm) were examinedby light and electron microscopy. The number of apoptotic, mitotic, andnecrotic cells per 1000 were scored (31500). Only cells in which a nucleuscould be seen were scored. Apoptotic bodies were not counted. Cells demon-strating increased overall and nuclear size, with breakdown of the nuclear andplasma membranes and loss of organelles, were scored as necrotic.

Annexin V Binding. Cells were grown in 25-cm2 Primaria flasks andtreated with bFGF (5–80 ng/ml) for up to 72 h. Cells were harvested bytrypsinization and were resuspended in ice-cold RPMI-HEPES (10 mM;Sigma) at a density of 53 105 cells/ml. Time of exposure to EDTA (0.1% inPBS) and trypsin (13in PBS) and pipetting were kept to a minimum to avoidcell damage. Cells were labeled with annexin V (1:200; Alexis) and PI (1mg/ml; Sigma) for 30 min before preparation of cytospins (500 g for 5 min;Shandon Cytospin 3) or FACS (Becton Dickinson FACScan). Cytospins wereviewed and photographed immediately by fluorescence microscopy using anAxioplan Zeiss microscope.

Acridine Orange Staining. Cells were seeded on 12-well slides (53 1023

cells/well) and, after 24 h, were treated with bFGF (20 ng/ml) for 0–4 days.Slides were fixed at 12-h intervals in methanol/acetone (1:1) and were stainedwith acridine orange (30mg/ml; Sigma) in phosphate buffer [5 mM Na2HPO4

(pH 7.4)] for 10 s. Cells were washed three times for 10 min each in phosphatebuffer and were visualized by fluorescence microscopy using an AxioplanZeiss microscope.

TUNEL Assay. Apoptosis in xenografts from control and bFGF-treatedmice was determined using the TUNEL assay (30) to detect DNA fragmen-tation (ApoTag; Intergen, Oxford, United Kingdom). Briefly, cryostat sections(10 mm) were fixed in paraformaldehyde [1% w/v in PBS (pH 7.4)] for 10 minat room temperature, followed by a post-fix in precooled ethanol:acetic acid(2:1) for 5 min at220°C. Endogenous peroxidase was quenched by treatingsections with hydrogen peroxide (3% v/v in PBS) for 5 min at room temper-ature. DNA strand-breaks were detected by enzymatically labeling the free39-OH termini with modified nucleotides and staining with peroxidase-anti-peroxidase according to the manufacturer’s instructions (ApoTag; Intergen).Sections were counterstained with crystal violet-free methyl green [0.5% w/vin 0.1M sodium acetate (pH 4)], dehydrated in xylene (100%), and mounted inDePeX mounting medium. The sections were examined by light microscopyusing a Zeiss Axioplan microscope (340) and the number of apoptotic nucleiwere scored in 5 fields per xenograft. The apoptotic index5 number ofapoptotic nuclei4 number of nuclei scored (apoptotic index: 1, all nucleiapoptotic; 0, no nuclei apoptotic.

6161

bFGF-INDUCED CELL DEATH



Western Blotting

Cells were grown in media alone and in media supplemented with bFGF (20ng/ml) for neurofilament studies. Cells were harvested at intervals between 8 hand 4 days by trypsinization, and pellets were washed twice with PBS. Proteinextracts were prepared in lysis buffer [1M NaCl; 10 mM Tris-HCl (pH7.6); 1mM EDTA; 1 mg/ml aprotinin, and 100mg/ml phenylmethylsulfonylfluoride],and the protein content of cell extracts was estimated using the Bio-RadDCprotein assay (Bio-Rad Laboratories). Each protein sample (20mg) was size-fractionated by SDS-polyacrylamide (10%) gel electrophoresis. The accuracyof protein estimation and loading was confirmed by staining the separatedproteins using the Lowry silver stain (Pharmacia Biotech).

Proteins were transferred onto nitrocellulose membrane (Hybond-C; Am-ersham) in transfer buffer (25 mM Tris, 192 mM glycine, and 20% methanol)using a mini-transblot system (Bio-Rad Laboratories) overnight at 4°C. Mem-branes were blocked with a 5% nonfat milk solution in 13TTBS [0.05%Tween 20, 20 mM Tris-HCl (pH7.5), and 500 mM NaCl] for 2 h. Membraneswere incubated in rabbit polyclonal anti-pan-neurofilament and FGF recep-tor-1 antibodies [1:500 (Affiniti) and 1:20 (Santa Cruz), respectively) for 1 hin a 2% nonfat milk solution in 13TTBS. The filter was then washed twicefor 5 min in 13 TTBS and was incubated for 1 h in streptavidin-conjugatedgoat antirabbit antibody (1:2000; Sigma). Membranes were washed (three timefor 5 min each) in 13TTBS, and secondary antibody was detected byenhanced chemiluminescence (Hyperfilm ECL; Amersham).

Immunofluorescence

Cells were cultured on 12-well glass slides at a density of 53 1023

cells/well under normal culture conditions. After a 48-h incubation period,medium was removed, and cells were fixed in methanol/acetone (1:1) twice for2 min each before they were air-dried. Cells were incubated with rabbitpolyclonal anti-pan-neurofilament (1:500; Affiniti), anti-bFGF (20mg/ml;Santa Cruz), or anti-FGF receptor-1 (200mg/ml, Santa Cruz) antibodies for1 h, followed by two washes with PBS and refixing in methanol/acetone twicefor 2 min each. Cells were again air-dried before a 30-min incubation withFITC-conjugated goat antirabbit antisera (1:300; Sigma). Two washes in PBSand two washes in PBS-0.25% Tween 20 were followed by a final rinse inddH2O and air-drying. Cells were mounted in DABCO-glycerol and viewed byfluorescence microscopy. Specificity of immunofluorescence was confirmedby the absence of staining in a primary antibody negative control.

RT-PCR

Primers designed to amplify the first immunoglobulin-like loop (I) of theextracellular domain or the transmembrane/kinase domains (K) of each of thefour high-affinity FGF receptors were used (Table 1). PCR conditions wereoptimized using total RNA isolated from the MCF-7 breast carcinoma cell line.RNA (2 mg) was reverse transcribed at 37°C for 1 h using 15 units of murineMoloney leukemia virus reverse transcriptase (Pharmacia Biotech) in 13PCRbuffer, [10 mM Tris-HCl (pH 8.3) and 50 mM KCl (Perkin-Elmer, Warrington,United Kingdom)], 1 mM dNTP (Pharmacia Biotech), 10 mM MgCl2, 1.2mg ofrandom primers (Life Technologies, Inc.), and 28 units of RNA guard (Phar-macia Biotech). cDNA was divided to amplify all of the target FGF receptors.cDNA (10 ml) was amplified using 2.5 units of Amplitaq gold (Perkin-Elmer)and primers at a concentration of 40 pmol per reaction in 13PCR buffer (asabove), 0.2 mM dNTP, and 2 mM MgCl2. Activation of Amplitaq gold with onecycle of 95°C for 10 min was followed by amplification for 35 cycles of 95°Cfor 30 s, annealing at 55–68°C (primer dependent; Table 1) for 30 s, extensionat 72°C for 45 s, and a final cycle of 72°C for 7 min. A MCF-7 positive control,and reverse transcriptase and water negative controls were included for eachset of PCR primers. PCR products were separated in a 1.5% agarose gel andfX174 RF DNA/HaeIII DNA fragments (Life Technologies, Inc.) were usedas markers for product sizing. The identity of PCR products for all of the fourreceptors was confirmed by sequence analysis using an ABI 377 automatedsequencer (ABI PRISM Big dye terminator kit; Perkin-Elmer).

Statistical Analysis

Statistical analysis was performed by one-way ANOVA with a Bonferroni,Dunnett, or paired Studentt test. AP of ,0.05 was considered significant.

RESULTS

bFGF and FGF Receptors Are Ubiquitously Expressed byEwing’s Sarcoma Cell Lines.All of the Ewing’s sarcoma cell linesexamined expressed bFGF as demonstrated by immunofluorescence (Fig.1a). Immunofluorescence for bFGF showed diffuse staining throughoutthe cell, although expression was stronger in the cytoplasm than in thenucleus. Expression of FGF receptors was also evident in all of theEwing’s sarcoma cell lines studied. Immunofluorescence using an FGFreceptor-1 antibody showed diffuse staining throughout the cell (Fig. 1a).The same antibody used for Western blotting confirmed the presence ofFGF receptor-1, detecting a protein of the expectedMr 145,000 size in allof the Ewing’s sarcoma cell lines and the breast carcinoma positivecontrol (Fig. 1b). However, additional proteins were also detected withthis antibody, possibly pertaining to the receptor at various stages ofglycosylation (31) or cross-reactivity with related proteins.

In the absence of specific antibodies suitable for Western blotting orimmunohistochemistry, RT-PCR using primers to the extracellular (I) ortransmembrane kinase (K) domains of the FGF receptors was used todemonstrate the presence of all four of the high-affinity receptors in theEwing’s sarcoma cell lines (Fig. 1c). In addition the Ewing’s sarcoma cellline, SK-N-MC and A673 expressed an apparently truncated form ofFGF receptor-2, missing the first immunoglobulin-like loop of the extra-cellular domain. Two variant forms of FGF receptor-3 were also detectedin the Ewing’s sarcoma cells and the MCF-7 breast carcinoma positivecontrol; sequence analysis showed these variant forms to be lacking thesecond half of the third immunoglobulin-like loop of the extracellulardomain and the transmembrane domain.

bFGF Decreases Ewing’s Sarcoma Cell Numbersin Vitro. Un-der normal serum-supplemented growth conditions, all three of theEwing’s sarcoma cell lines studied—TC-32, RD-ES, and SK-N-MC—showed a significant reduction in proliferation when treatedwith bFGF (2–20 ng/ml) for 48 h (ANOVA,F7160 5 22.12, 29.54,and 8.59 respectively;P , 0.0001 in all of the cases), as demonstratedby BrdUrd incorporation (Fig. 2). The RD-ES cell line demonstratedthe greatest reduction in proliferation, with bFGF (2 ng/ml)-treatedcultures exhibiting an 80% reduction in proliferation as comparedwith an untreated control (P , 0.0001, Dunnett’st test). In the TC-32

Table 1 Primers for RT-PCR of FGF receptors 1 to 4, first immunoglobulin-like loop(I) and transmembrane/tyrosine kinase domain (K)

Primer paira Expected PCR productAnnealing

Temperature

AACTGGGATGTGGAGCTGGAAGTGC FGFRb-1 (I) 60°CAGGTGGTGTCACTGCCCGAGGGGCT bases 81–424

size5 344bpGACAAAGAGATGGAGGTGCT FGFR-1 (K) 60°CGTTGTAGCAGTATTCCAGCC bases 1045–1845

size5 801bppATCTCTCAACCAGAAGTGTACG FGFR-2 (I) 55°CpCTGTGTTGGTCCAGTATGGTGC bases 142–490

size5 349bppGATAGCCATTTACTGCATAGGG FGFR-2 (K) 55°CpTGTCTGCCGTTGAAGAGAGG bases 1143–1381

size5 239bpGGGGCCCACTGTCTGGGTCAAG FGFR-3 (I) 55°CGTCTTCGTCATCTCCCGAGGAT bases 246–447

size5 202GCAGCATCCGGCAGACGTACAC FGFR-3 (K) 57°CGGCGGCCCGGTCCTTGTCAATG bases 743–1539

size5 797CCTGTTGGGGGTCCTGCTGAGTGTG FGFR-4 (I) 55°CCTTGCTGGGGGTAACTGTGCCTATT bases 73–491

size5 419GGCAGCATCCGCTATAACTACC FGFR-4 (K) 47°CGCCACAGTGCTGGCTTGGTCAG bases 746–1157

size5 812a With the exception of the primers marked with an asterisk (p), primers were as

designed by Abbasset al. (51).b FGFR, fibroblast growth factor receptor.

6162




and SK-N-MC cell lines, the reduction was 55 and 44%, respectively(P , 0.0001, Dunnett’st test). A decrease in proliferation was seenafter exposure of TC-32 and RD-ES cells to bFGF (5–80 ng/ml) inboth serum-free defined medium and serum-supplemented medium(ANOVA, F5120 5 39.94 and 65.59, respectively;P , 0.0001). Forexample, RD-ES cells exhibited a 94% reduction in proliferationwhen cultured in serum-free defined medium supplemented withbFGF (5 ng/ml) for 48 h, not significantly different from the 89%reduction observed in serum-supplemented medium (P 5 1.00, Bon-

ferroni’s t test). At concentrations of$200 ng/ml, bFGF had no effecton BrdUrd incorporation.

This decrease in BrdUrd incorporation correlated with a decrease inviable Ewing’s sarcoma cell number (Fig. 3a; P , 0.0001, Bonfer-roni’s t test). Exposure of TC-32 cells to bFGF (20 ng/ml) for 6 and12 h led to a 54% decrease in viable cell number after a 24-h recoveryperiod (Fig. 3band Table 2;P , 0.05, Bonferroni’st test). Thepercentage of viable cells in the bFGF-treated culture decreased to 44and 27%, respectively, after 24-h (P , 0.001, Bonferroni’st test) and

Fig. 1. Expression of bFGF and FGF receptors in Ewing’s sarcoma cell lines. All of the cell lines examined expressed bFGF and FGF receptors, demonstrated by immunofluorescence(a), Western blotting (b), and RT-PCR(c).a, immunofluorescence using an anti-pan bFGF or anti-FGF receptor-1 antibody. Both of the antibodies showed diffuse-staining throughoutthe cell, although bFGF showed some specific localization to the cell nucleus. Expression of bFGF and FGF receptors is shown in the TC-32 cell line.b, Western blotting with thesame FGF receptor-1 antibody, demonstrating the presence of aMr 145,000 band (145KDa)—consistent with expression of FGF receptor-1—in the breast carcinoma positive controlMCF-7 (Lane 1) and the Ewing’s sarcoma cell lines, TC-32 (Lane 2), RD-ES (Lane 3), A673 (Lane 4), SK-N-MC (Lane 5), and TTC-466 (Lane 6). The correct-size band was notdetected in the COS-7 negative control (Lane C). Additional proteins were also detected with this antibody, which may reflect expression of the receptor at different stages ofglycosylation or cross-reactivity with related proteins.c, RT-PCR for the extracellular (I) or transmembrane kinase (K) domain of each of the four high-affinity FGF receptors. TheEwing’s sarcoma cell lines expressed all four of the high-affinity FGF receptors; the MCF-7 breast carcinoma cell line expressed full-length FGF receptors 1, 2, and 4, but FGF receptor3 was modified in the transmembrane kinase domain. Two novel forms of FGF receptor-3, modified in the transmembrane kinase domain, were identified in the Ewing’s sarcoma celllines by RT-PCR. Results for the MCF-7 breast carcinoma cell line (positive control,Lane a) and the Ewing’s sarcoma cell line TC-32 (Lane b) are shown.m, molecular weight markers.

6163




48-h (P, 0.0001, Bonferroni’st test) exposure (Fig. 3band Table 2).However the total viable cell number after treatment with bFGF for 6,12, 24, or 48 h was not significantly different (Fig. 3b). This popu-lation of apparently bFGF-resistant cells had a reduced rate of growth,as demonstrated by the slope of the growth curves (Fig. 3a). Similarresults were found in the RD-ES cell line (Table 2).

bFGF Inhibits Anchorage-independent Growth of Ewing’sSarcoma Cells.Both of the TC-32 and RD-ES cells formed coloniesin 0.3% soft agar. The mean colony-forming efficiency of RD-ES

cells was 4.8% and of TC-32 cells was 2.4%. Supplementing thegrowth medium with 10 ng/ml bFGF reduced the colony number by68% in the TC-32 cells and by 87% in the RD-ES cells (Table 3;P , 0.0001, Dunnett’st test). When the concentration of bFGF wasdoubled to 20 ng/ml, the reduction in colony formation was notsignificantly different from that observed with 10 ng/ml bFGF(P 5 1.00, Dunnett’st test). bFGF (10 and 20 ng/ml) also significantlyreduced colony size (P, 0.0001, Dunnett’st test). In marked con-trast, treatment of the neuroblastoma cell line IMR-32 with bFGFincreased the number and size of colonies formed in soft agar(P , 0.0001, Dunnett’st test; Table 3), consistent with previousreports (11, 12).

bFGF Decreases Ewing’s Sarcoma Xenograft Growth in NuNuMice. s.c. injection of NuNu mice with RD-ES or TC-32 cells re-sulted in rapid tumor growth in all of the injected mice;#30 daysafter s.c. injection with 2.53 106 tumor cells, 100% of the mice hadgrown tumors of 1.4 cm3 (Fig. 4) and were killed according toapproved protocols. However, the rate of tumor growth (assessed bythe maximum area of palpable tumor) was significantly reduced in

Fig. 2. bFGF decreased the incorporation of BrdUrd. bFGF (2 pg–2mg/ml) decreasedthe proliferation of Ewing’s sarcoma cell lines (l, TC-32;f, RD-ES; 3, SK-N-MC)under normal growth conditions. Proliferation was measured using an ELISA assay todetect the incorporation of BrdUrd, which is given as absorbance (Abs) units3 1023. a,the effect of bFGF (2pg–2mg) on BrdUrd incorporation.b, the effect of bFGF (2pg–2mg)on BrdUrd incorporation as a percentage of control cultures.c, bFGF (5–80 ng/ml)decreased BrdUrd incorporation in serum-free defined media (f) and under normalgrowth conditions in the presence of serum (l) to the same extent. Results are shown asmean6 SE (n5 3). Statistical analysis was made using ANOVA analysis and a Dunnettt test.

Fig. 3. bFGF decreases viable Ewing’s sarcoma cell number in a dose- and time-dependent manner. Exposure of Ewing’s sarcoma cells to bFGF (20 ng/ml) decreased theviable cell number. Ina, after treatment with bFGF (20 ng/ml) for 48 h, there weresignificantly fewer viable cells in the control population compared with the bFGF-treatedcells at 24 (P, 0.01), 48 (P, 0.0001), and 72 h (P, 0.0001). Results are shown forviable TC-32 cell number at 0, 24, 48, and 72 h in control cells (l) and in cells treatedwith bFGF (20 ng/ml) for 48 h (f). Inb, exposure to bFGF for 6, 12, 24, or 48 h decreasedthe viable cell population to;50% of that in the untreated cell population at 24 h. Afterreturning cells to normal growth conditions for 24 h, there was no significant differencein viable cell number in cells treated with bFGF (f) at 6, 12, 24, or 48 h, which suggeststhat these cells are not proliferating. However the control () untreated cultures continuedto increase in number. Results are shown as mean6 SE (n5 6). Statistical analysis wasmade by ANOVA, with a Bonferronit test.Ps are shown for viable cell number in controland bFGF-treated cultures.

6164




mice treated daily with bFGF (100 or 200 ng/mouse/day) 8 days afterinoculation with tumor cells, compared with those injected withvehicle alone (P, 0.001, Bonferroni’st test; Fig. 4).

Decreased Ewing’s Sarcoma Cell Number and XenograftGrowth Is Mediated by bFGF-induced Apoptosis and Necrosis.bFGF (2–80 ng/ml) induced cell death in the three Ewing’s sarcomacell lines that we studied in a time- and dose-dependent manner, asdemonstrated by light- and electron microscopy, labeling with an-nexin V and PI, and staining of nucleic acids with acridine orange.

By electron microscopy and labeling with annexin V and PI, anincrease in both necrotic and apoptotic cell number was seen in all ofthe Ewing’s sarcoma cells after exposure to bFGF (Fig. 5 and 6). Lossof membrane asymmetry, an early apoptotic marker, was detected bystaining with annexin V after treatment with bFGF (2–80 ng/ml) for24 h (Fig. 5a). FACS analysis for annexin V- and PI-labeled cellsidentified three cell populations: one labeling with annexin V alone;one with only PI; and one with both annexin V and PI (Fig. 5b). Inexponentially growing control TC-32 and RD-ES cells,.90% of thecell population did not stain with PI or annexin V (Fig. 5b). However,48 h after treatment of TC-32 and RD-ES cells with bFGF, 42 and57% of the respective cell populations were either alive but apoptotic(stained with annexin V alone) or dead (stained with annexin V plusPI or with PI alone). After 72 h, 83% of the RD-ES and 66% of theTC-32 cell populations were dead (stained with annexin V and PI orwith PI alone; Fig. 5b). At 72 h, there were no viable apoptotic cells.

Less than 1% of the total cell population exhibited signs of cell

death identified by electron microscopy in the Ewing’s sarcoma cellsunder normal growth conditions (Fig. 6). After exposure to bFGF (20ng/ml) the necrotic and apoptotic cell population increased with time(Fig. 6). After a 4-day exposure to bFGF, there were very few livecells. The majority of cells were vacuolated and showed signs ofapoptosis or necrosis. Cells that were scored as apoptotic showedtypical margination of the chromatin and chromatin condensation.Cells had decreased in size and had become more electron-dense. Thenuclear and plasma membranes remained intact, with the subsequentformation of apoptotic bodies. However, a population of cells with anintact nuclear membrane and chromatin margination, but with plasmamembrane permeability, increased cytoplasmic volume and a loss ofcellular organelles was also observed. These cells were scored asnecrotic; consequently, the scoring of necrotic cells after electronmicroscopy is artificially high compared with the number of apoptoticcells.

Table 3 Effect of bFGF, NGF, and bFGF plus NGF on anchorage-independent growth

Effect of bFGF on growth of TC-32 and RD-ES cells in soft agar. Cells were incubatedin soft agar for 14 days. Four randomly selected fields per plate were visualized andphotographed using a Zeiss light microscope, under dark field conditions and a magnifi-cation of35. Prints (133 9 cm) were made, and colonies were counted and sized fromthese. IMR-32 cells were included as a positive control. Results are shown as mean colonynumber or size6 SE (n5 9). Where results are significantly different from the controlby Dunnett’st test,Ps are given.

Mean colony number Mean colony size (mm)

RD-ESControl 1176 7 5.26 0.1bFGF (10 ng/ml) 156 1a 3.66 0.1b

bFGF (20 ng/ml) 156 2a 3.66 0.1b

NGF (20 ng/ml) 1146 5 5.06 0.1bFGF (10 ng/ml)1 NGF

(10 ng/ml)156 2a 3.36 0.1b

TC-32Control 1046 7 5.76 0.1bFGF (10 ng/ml) 336 4b 4.76 0.1b

bFGF (20 ng/ml) 266 3b 4.76 0.1b

NGF (20 ng/ml) 1056 6 5.56 0.1bFGF (10 ng/ml)1 NGF

(10 ng/ml)316 9b 5.26 0.3

IMR-32Control 666 3 3.96 0.02bFGF (10 ng/ml) 1046 6b 7.56 0.02b

bFGF (20 ng/ml) 1096 6b 8.56 0.06b

a P , 0.0001.b P , 0.0001.

Table 2 Effect of exposure to bFGF on cell number at 0, 24, 48 and 72 h after treatment

Effect of bFGF on TC-32 and RD-ES cell number. Results are shown as the percentage of viable cells in a cell population at 0, 24, 48, and 72 h after exposure to bFGF (20 ng/ml)for 6, 12, 24, or 48 h. Column of shadowed data shows the % of viable cells in TC-32 cultures 24 h after treatment with bFGF for 6 h, 12 h, 24 h, or 48 h; these data are also presentedin the form of a histogram in Fig 3b.

Time exposedto bFGF

% of viable RD-ES cells 0, 24, 48, and 72 h after treatmentwith bFGF

% of viable TC-32 cells 0, 24, 48, and 72 h after treatmentwith bFGF

0 h 24 h 48 h 72 h 0 h 24 h 48 h 72 h

6 h 82% 46% 59% 50% 67% 54% 61% 55%12 h 69% 68% 58% 57% 70% 54% 59% 51%24 h 45% 49% 41% 41% 54% 44% 41% 55%48 h 39% 23% 26% 29% 37% 27% 23% 31%

Fig. 4. bFGF reduces the rate of Ewing’s sarcoma xenograft growth in NuNu mice bythe induction of apoptosis. Both RD-ES and TC-32 cell lines are highly tumorigenic,producing tumors of 1.4 cm3 in 100% of inoculated NuNu mice within 30 days. Treatmentof mice (n 5 10) with bFGF (100 ng) significantly decreased the rate of both RD-ES[P , 0.01 (a)] and TC-32 [P, 0.001 (b)] tumor growth compared with control-vehicle-only injected mice (n5 10). The decrease in RD-ES tumor growth was dose-dependent;treatment of mice (n5 10) with 200 ng of bFGF/mouse/day had a greater inhibitory effectthan treatment with 100 ng/mouse/day. Statistical analysis was made by ANOVA, with aBonferroni t test.a, E, control;F, treated with bFGF (100 ng/kg/day);Œ, treated withbFGF (200 ng/kg/day);b, M, control;f, treated with bFGF (100 ng/kg/day).

6165




Cryostat sections of RD-ES and TC-32 xenografts were highlycellular (Fig. 7a,Control) and showed no evidence of DNA fragmen-tation (Fig. 7b,Control). However, apoptotic nuclei were detected inthe xenografts from mice treated with bFGF (Fig. 7b,1bFGF), which

suggests that the decreased rate of xenograft growth in bFGF-treatedmice is associated with increased apoptosis. The apoptotic index inRD-ES and TC-32 xenografts was 0.0056 0.005 and 0.0076 0.001,respectively. After treatment of mice with 100 ng of bFGF/mouse/

Fig. 5. Induction of apoptosis and necrosis in RD-ES cells treated with bFGF. Ina, RD-ES cells treated with bFGF (20 ng/ml) for 36 and 48 h showed a decrease in viable cellnumber as seen under light microscopy. Loss of membrane asymmetry (an early apoptotic marker), detected by staining with annexin V, is shown after 36- and 48-h exposure to bFGF.At 36 and 48 h, bFGF-treated and control, untreated cultures showed a redistribution of staining with acridine orange. Inb, under normal growth conditions, more than 90% of TC-32and RD-ES cultures were viable (red, lower left quadrant) and did not stain with annexin V or PI. After treatment with bFGF (20 ng/ml), the number of viable apoptotic (blue, lowerright quadrant) and dead cells (pink, upper right quadrantandgreen, upper left quadrant) was significantly increased. After 72 h exposure to bFGF, the majority of TC-32 and RD-EScells were dead (pinkor green upper quadrants;P , 0.0001).

6166




day, the apoptotic index of RD-ES xenografts significantly increasedto 0.19 6 0.03 (P , 0.0001, Student’st test; 38-fold increase); inmice treated with 200 ng of bFGF, the apoptotic index increased to0.286 0.02 (P, 0.0001, Student’st test; 56-fold increase). In TC-32xenografts, bFGF (100 ng/mouse/day) increased the apoptotic index

20-fold (0.146 0.04;P , 0.004, Student’st test). Labeling with Ki67 was reduced in the tumors of mice treated with bFGF (Fig. 7c,1bFGF), compared with control-vehicle-only-treated mice. The pro-liferation index in bFGF-treated mice inoculated with RD-ES cellswas 0.0156 0.005 compared with 0.296 0.04 (P, 0.0001, Stu-

Fig. 6. Effect of bFGF on ultrastructure of RD-ES cells.Treatment of Ewing’s sarcoma cells with bFGF (20 ng/ml)-induced cell death. The ultrastructure of cells treated withbFGF showed evidence of both necrosis and apoptosis (a).The apoptotic cell number increased with increased expo-sure time to bFGF (b). In cultures exposed to bFGF for 4days, it was not possible to score the apoptotic and necroticcell number, the culture consisting largely of cell debris(results not shown). Counts are shown for approximately1000 cells.

Fig. 7. The number of apoptotic nuclei increasesin xenografts from NuNu mice treated with bFGF.RD-ES and TC-32 xenografts from control andbFGF-treated NuNu mice were mounted in OCTand frozen through liquid nitrogen-cooled isopen-tane. Cryostat sections (10mm) were fixed andstained with H&E, and viewed by light microscopy(a), stained for apoptotic nuclei using the TUNELassay as described in the “Material and Methods”(b) or the Ki 67 proliferation antigen (c). Sectionsstained for Ki 67 were counterstained with H&E;the TUNEL-stained sections were counterstainedwith methyl green. Xenografts in control mice werevery cellular (a); showed no, or very little evidenceof, apoptosis (b); and had a high rate of prolifera-tion (c). In contrast, bFGF-treated mice grew tu-mors that were reduced in size, less cellular (a), hadfewer Ki 67-positive cells (c), and significantlymore apoptotic nuclei than in the control group (b).

6167




dent’st test) in control-vehicle-only-treated mice. Similar results werefound in TC-32 xenografts (control, 0.236 0.004; bFGF-treated,0.0126 0.004;P , 0.0001, Student’st test).

NGF Does Not Affect Ewing’s Sarcoma Cell Proliferation orDifferentiation. NGF (20 and 40 ng/ml) did not induce morpholog-ical differentiation in any of the Ewing’s sarcoma cell lines examined(Fig. 8a), unlike the neuroblastoma cell line IMR-32, in which treat-ment with NGF (20 ng/ml) increased neurofilament expression andinduced neurite extension (results not shown) characteristic of neuraldifferentiation. Substrate-dependent (Fig. 8b) and -independent (Table3) proliferation of the Ewing’s sarcoma cell lines was unaffected byNGF (20 and 40 ng/ml) in the presence or absence of bFGF (20 ng/ml;P 5 1.0 in all of the cases, Bonferroni’st test).

DISCUSSION

bFGF decreases cell number by inducing cell death in Ewing’ssarcoma. As far as we are aware, this is the first report of bFGF-induced cell death in neurally derived tumor cells. Previous studies inrat mesencephalic (32) and chick primitive neural (33) structures haveshown bFGF to induce apoptosis, which supports the hypothesis thatbFGF has an initial sorting role in early development. The inductionof apoptosis by bFGF in Ewing’s sarcomas is, therefore, consistentwith the hypothesis that these tumors arise in a primitive neural stem

cell. The magnitude of bFGF-induced cell death was different in thecell lines studied, probably reflecting the heterogeneity of Ewing’ssarcomas. This suggests that Ewing’s sarcomas can arise from prim-itive cells at various stages, and that expression of different growthfactors and hormones by Ewing’s sarcomas may modulate the effectof bFGF either directly (34) or by modifying the expression of FGFreceptors (35). Ewing’s sarcoma-derived cell lines demonstrated abiphasic response to bFGF, with concentrations of bFGF.200 ng/mlfailing to significantly affect cell proliferationin vitro. This mayreflect the activation of additional signaling pathways within the cell,counteracting the bFGF-induced cell death pathway, either directlythrough the FGF receptors or indirectly by interaction with otherreceptors. FGF receptor signaling is initiated after FGF-induceddimerization of the high-affinity FGF receptors, which is regulated atleast in part by the low-affinity FGF receptors (36, 37). In those instancesin which the concentration of FGF molecules greatly exceeds thecapacity of the low-and high-affinity receptors, steric hindrance mayprevent receptor dimerization and consequent signaling.

We have shown that bFGF decreases Ewing’s sarcoma growthby inducing cell death.In vivo cell death was mediated, at least inpart, by apoptosis.In vitro, electron microscopic features typical ofboth apoptosis and necrosis were identified. Although apoptosisand necrosis have been defined as two distinct modes of cell death,

Fig. 8. NGF has no effect on Ewing’s sarcoma cell morphology (a) or on anchorage-dependent proliferation (b), in the presence or absence of bFGF. The morphology andproliferation of RD-ES cells after exposure to NGF (20 ng/ml) was unchanged compared with control, untreated cultures. Treatment with bFGF (20 ng/ml) for 24–72 h caused cellsto round (a) and was associated with a decrease in proliferation, as measured by incorporation of BrdUrd (b). NGF (20–40 ng/ml) had no effect on the morphology or decrease inproliferation that was induced after exposure to bFGF (20 ng/ml). Results are shown as mean6 SE (n5 3). Statistical analysis was made by ANOVA with a Bonferronit test correction.f, TC-32; , RD-ES; , SK-N-MC.

6168




it is now clear that the two can occur simultaneously within a cellpopulation and may involve common signaling and executionmechanisms. Populations of typically apoptotic and necrotic cellswere identified in the bFGF-treated cell cultures, although cellswith an intact nuclear membrane and chromatin margination, butwith plasma membrane permeability, increased cytoplasmic vol-ume and the loss of cellular organelles were also observed. Thesecells were scored as necrotic in the electron microscopic studies,although cell death in this cell population may better be describedas oncosis,i.e., the development of necrosis accompanied byswelling and karyolysis (38). FACS analysis of cells labeled withannexin V and PI seems to be a more useful quantitative methodfor the assessment of cell death, because it is not subjective, andcomparisons between treated and nontreated cell populations canreadily and rapidly be made. Our observations support the hypoth-esis that a single cytokine—in this case, bFGF—may simulta-neously induce apoptosis and necrosis.

bFGF has previously been shown to decrease MCF-7 breast cancercell proliferation (39–41). Furthermore, bFGF and acidic FGF levelsare lower in breast tumor biopsies than in normal breast tissue, whichsuggests that these factors may have an inhibitory role that is lost astumors progress (42, 43). There has been some suggestion that asimilar phenomenon may occur in SK-ES1 Ewing’s sarcoma cells(44), although whether expression of bFGF correlates with outcome intumors of the Ewing’s sarcoma family remains to be seen. Theseeffects of bFGF are in direct contrast to its mitogenic and survivaleffects described in a number of different cell types of mesodermaland neuroectodermal origin (12).

It is not known how bFGF stimulates growth in some tumors butinhibits growth in others. The effect of bFGF seems to be dependenton the growth phase of the cells investigated. Although bFGF inhibitsapoptosis of oligodendrocytes under normal growth conditions, it canincrease cell death when cells are prevented from entering the cellcycle (45). Distinct patterns of FGF receptor expression and/or local-ization may confer such growth stimulatory or inhibitory effects.Although the Ewing’s sarcoma cell lines that were examined ex-pressed all four of the high-affinity FGF receptors, a novel truncatedform of FGF receptor-3 was identified that differed from the full-length receptor in its major ligand-binding region. It is possible thatthis may cause changes in structural conformation leading to consti-tutive activation of FGF receptor-3 signaling pathways such asSTAT1 (46), which results in growth inhibition and induction of celldeath.

Because bFGF drives primitive pluripotent cells toward a differen-tiated neuronal phenotype (28), we originally formed the hypothesisthat treatment of Ewing’s sarcoma with bFGF and NGF might inducedifferentiation. However, we found no evidence of neural differenti-ation after treatment with bFGF alone, nor in combination with NGF.Furthermore, although studies in the neurally derived childhood tumorneuroblastoma have shown that induction of differentiation precedesapoptosis (47), this does not seem to be the case in Ewing’s sarcoma.NGF was not mitogenic and did not offer a survival advantage forEwing’s sarcoma cells in the presence or absence of bFGF, as reportedin other neural cell types, including neuroblastoma (48, 49). Thissuggests bFGF signaling pathways are more important in Ewing’ssarcoma than those of NGF, as previously reported in pluripotentneural crest-derived stem cells (50). The induction of cell death afterexposure to bFGF may arise in Ewing’s sarcoma cells because thecells are unable to execute an appropriate differentiation response.

In summary, bFGF decreases the growth of Ewing’s sarcomas byinducing cell death. This may provide an opportunity for therapeuticinitiatives. We are currently investigating the mechanism of bFGF-

induced cell death, which may identify targets for the clinical modu-lation of Ewing’s sarcoma behavior.

ACKNOWLEDGMENTS

We thank Carol Upton, Department of Electron Microscopy, ImperialCancer Research Fund, Lincoln’s Inn Fields, London for assistance and adviceon electron microscopy, and Del Watling and Sandra Peak, Biological Re-sources, Imperial Cancer Research Fund Clare Hall Laboratories, Potters Bar,Hertfordshire for assistance within vivo mouse studies.

REFERENCES

1. Gospodarowicz, D. Localisation of a fibroblast growth factor and its effect alone andwith hydrocortisone on 3T3 cell growth. Nature (Lond.),249: 123–127, 1974.

2. Ledoux, D., Gannoun-Zaki, L., and Barritault, D. Interactions of FGFs with targetcells. Prog. Growth Factor Res.,4: 107–120, 1992.

3. Gomez-Pinilla, F., and Cotman, C. W. Transient lesion-induced increase of basicfibroblast growth factor and its receptor in layer VIb (subplate cells) of the adult ratcerebral cortex. Neuroscience,49: 771–780, 1992.

4. Grothe, C., and Meisinger, C. The multifunctionality of FGF-2 in the adrenal medulla.Anat. Embryol.,195: 103–111, 1997.

5. Caday, C. G., Klagsbrun, M., Fanning, P. J., Mirzabegian, A., and Finklestein, S. P.Fibroblast growth factor (FGF) levels in the developing rat brain. Brain Res. Dev.Brain Res.,52: 241–246, 1990.

6. Schwaber, J. S., Due, B. R., Rogers, W. T., Junard, E. O., Sharma, A., and Hefti, F.Use of a digital brain atlas to compare the distribution of NGF- and bFGF-protectedcholinergic neurons. J. Comp. Neurol.,309: 27–39, 1991.

7. Joy, A., Moffet, J., Neary, K., Mordechai, E., Stachowiak, E. K., Coons, S., Rankin-Shapiro, J., Florkiewicz, R. Z., and Stachowiak, M. K. Basic fibroblast growth factorin the chick embryo: immunolocalization to striated muscle cells and their precursors.Oncogene,14: 171–183, 1997.

8. Piotrowicz, R. S., Martin, J. L., Dillman, W. H., and Levin, E. G. The 27-kDa heatshock protein facilitates basic fibroblast growth factor release from endothelial cells.J. Biol. Chem.,272: 7042–7047, 1997.

9. Kusaka, K., Kothary, P. C., and Del Monte, M. A. Modulation of basic fibroblastgrowth factor effect by retinoic acid in cultured retinal pigment epithelium. Curr. EyeRes.,17: 524–530, 1998.

10. Yamaguchi, F., Saya, H., Bruner, J. M., and Morrison, R. S. Differential expressionof two fibroblast growth factor-receptor genes is associated with malignant progres-sion in human astrocytomas. Proc. Natl. Acad. Sci. USA,91: 484–488, 1994.

11. Fernig, D. J., and Gallagher, J. T. Fibroblast growth factors and their receptors: aninformation network controlling tissue growth, morphogenesis and repair. Prog.Growth Factor Res.,5: 353–377, 1994.

12. Mason, I. J. The ins and outs of fibroblast growth factors. Cell,78: 547–552, 1994.13. Hou, J., Kan, M., McKeehan, K., McBride, G., Adams, P., and McKeehan, W. L.

Fibroblast growth factor receptors from liver vary in three structural domains. Science(Washington DC),251: 665–668, 1991.

14. Werner, S., Duan, D., Peters, K. G., Johnson, D. E., and Williams, L. T. Differentialsplicing in the extracellular region of fibroblast growth factor receptor 1 generatesreceptor variants with different ligand-binding specificities. Mol. Cell. Biol.,12:82–88, 1992.

15. Chellaiah, A. T., McEwen, D. G., Werner, S., Xu, J., and Ornitz, D. M. Fibroblastgrowth factor receptor (FGFR) 3. Alternative splicing in immunoglobulin-like do-main III creates a receptor highly specific for acidic FGF/FGF-1. J. Biol. Chem.,269:11620–11627, 1994.

16. Johnston, C. L., Cox, H. C., Gomm, J. J., and Coombes, R. C. Fibroblast growthfactor receptors (FGFRs) localize in different cellular compartments. A splice variantof FGFR-3 localizes to the nucleus. J. Biol. Chem.,270: 30643–30650, 1995.

17. Sensenbrenner, M. The neurotrophic activity of fibroblast growth factors. Prog.Neurobiol. (Oxf.),41: 683–704, 1996.

18. Horowitz, M., Malawer, M., Woo, S., and Hicks, M. Ewing’s sarcoma family oftumors: Ewing’s sarcoma of bone and soft tissue and the peripheral primitiveneuroectodermal tumors.In: P. Pizzo and D. Poplack (eds.), Principles and Practiceof Pediatric Oncology, pp. 831–863. Philadelphia: Lippincott-Raven, 1997.

19. Brodeur, G., and Castleberry, R. Neuroblastoma.In: P. Pizzo and D. Poplack (eds.),Principles and Practice of Pediatric Oncology, pp. 761–797. Philadelphia: Lippincott-Raven, 1997.

20. Nakagawara, A., Arima-Nakagawara, M., Azar, C. G., Scavarda, N. J., and Brodeur,G. M. Clinical significance of expression of neurotrophic factors and their receptorsin neuroblastoma.In: A. Evan, J. L. Biedler, G. M. Brodeur, G. J. D’Angio, and A.Nakagawara (eds.), Advances in Neuroblastoma Research, pp. 155–161. New York:Wiley-Liss, Inc., 1994.

21. Matsushima, H., and Bogenmann, E. NGF induces terminal differentiation in trkAexpressing neuroblastoma cellsin vitro andin vivo. In: A. Evan, J. L. Biedler, G. M.Brodeur, G. J. D’Angio, and A. Nakagawara (eds.), Advances in NeuroblastomaResearch, pp. 177–183. New York: Wiley-Liss, Inc., 1994.

22. Sidell, N. Retinoic acid-induced growth inhibition and morphologic differentiation ofhuman neuroblastoma cellsin vitro. J. Natl. Cancer Inst.,68: 589–596, 1982.

23. Reynolds, C. P., Kane, D. J., Einhorn, P. A., Matthay, K. K., Crouse, V. L., Wilbur,J. R., Shurin, S. B., and Seeger, R. C. Response of neuroblastoma to retinoic acidinvitro and in vivo. Prog. Clin. Biol. Res.,366: 203–211, 1991.

6169




24. Abemayor, E. The effects of retinoic acid on thein vitro and in vivo growth ofneuroblastoma cells. Laryngoscope,102: 1133–1149, 1992.

25. Matthay, K. K., Villablanca, J. G., Seeger, R. C., Stram, D. O., Harris, R. E., Ramsay,N. K., Swift, P., Shimada, H., Black, C. T., Brodeur, G. M., Gerbing, R. B., andReynolds, C. P. Treatment of high-risk neuroblastoma with intensive chemotherapy,radiotherapy, autologous bone marrow transplantation, and 13-cis-retinoic acid. Chil-dren’s Cancer Group. N. Engl. J. Med.341: 1165–1173, 1999.

26. Burchill, S. A., Berry, P. A., Bradbury, F. M., and Lewis, I. J. Contrasting levels ofp21ras activation and expression of neurofibromin in peripheral primitive neuroec-todermal tumour and neuroblastoma cells, and their response to retinoic acid. J. Neu-rol. Sci.,157: 129–137, 1998.

27. Brill, G., Vaisman, N., Neufeld, G., and Kalcheim, C. BHK-21-derived cell lines thatproduce basic fibroblast growth factor, but not parental BHK-21 cells, initiateneuronal differentiation of neural crest progenitors. Development (Camb.),115:1059–1069, 1992.

28. Anderson, D. J. Molecular control of cell fate in the neural crest: the sympathoadrenallineage. Annu. Rev. Neurosci.,16: 129–158, 1993.

29. van Valen, F. Ewing’s sarcoma family of tumours.In: J. R. W. Masters and B.Palsson (eds.), Human Cell Culture, pp. 55–85. Cheltenhain, Great Britain: KluwerAcademic Publishers, 1999.

30. Gavrieli, Y., Sherman, Y., and Ben-Sasson, S. A. Identification of programmed celldeathin situ via specific labeling of nuclear DNA fragmentation. J. Cell Biol.,119:493–501, 1992.

31. Prudovsky, I. A., Savion, N., LaVallee, T. M., and Maciag, T. The nuclear traffickingof extracellular fibroblast growth factor (FGF)-1 correlates with the perinuclearassociation of the FGF receptor-1a isoforms but not the FGF receptor-1b isoforms.J. Biol. Chem.,271: 14198–14205, 1996.

32. Espejo, M., Roig, T., Cutillas, B., Bermudez, J., Bartrons, R., and Ambrosio, S. Earlyeffects of basic fibroblast growth factor on foetal rat mesencephalic cell suspensions.Neurosci. Lett.,221: 5–8, 1996.

33. Yokoyama, Y., Ozawa, S., Seyama, Y., Namiki, H., Hayashi, Y., Kaji, K., Shirama,K., Shioda, M., and Kano, K. Enhancement of apoptosis in developing chick neuralretina cells by basic fibroblast growth factor. J. Neurochem.,68: 2212–2215, 1997.

34. Stachowiak, M., Moffett, J., Joy, A., Puchacz, E., Florkiewicz, R., and Stachowiak,E. Regulation of bFGF gene expression and subcellular distribution of bFGF proteinin adrenal medullary cells. J. Cell Biol.,127: 203–223, 1994.

35. Chotani, M., and Chiu, I. Differential regulation of human fibroblast growth factor 1transcripts provides a distinct mechanism of cell-specific growth factor expression.Cell Growth Differ.,8: 999–1013, 1997.

36. Ornitz, D. M., Yayon, A., Flanagan, J. G., Svahn, C. M., Levi, E., and Leder, P.Heparin is required for cell-free binding of basic fibroblast growth factor to a solublereceptor and for mitogenesis in whole cells. Mol. Cell. Biol.,12: 240–247, 1992.

37. Spivak-Kroizman, T., Lemmon, M. A., Dikic, I., Ladbury, J. E., Pinchasi, D., Huang,J., Jaye, M., Crumley, G., Schlessinger, J., and Lax, I. Heparin-induced oligomeriza-

tion of FGF molecules is responsible for FGF receptor dimerization, activation andcell proliferation. Cell,79: 257–283, 1994.

38. Majno, G., and Joris, I. Apoptosis, oncosis, and necrosis. An overview of cell death.Am. J. Pathol.,146: 3–15, 1995.

39. Taiji, M., Taiji, K., Deyerle, K. L., and Bothwell, M. Basic fibroblast growth factorenhances nerve growth factor receptor gene promoter activity in human neuroblas-toma cell line CHP100. Mol. Cell. Biol.,12: 2193–2202, 1992.

40. Wang, H., Rubin, M., Fenig, E., DeBlasio, A., Mendelsohn, J., Yahalom, J., andWeider, R. Basic fibroblast growth factor causes growth arrest in MCF-7 humanbreast cancer cells while inducing both mitogenic and inhibitory G1 events. CancerRes.,57: 1750–1757, 1997.

41. Johnson, M. R., Valentine, C., Basilico, C., and Mansukhani, A. FGF signalingactivates STAT1 and p21 and inhibits the estrogen response and proliferation ofMCF-7 cells. Oncogene,16: 2647–2656, 1998.

42. Bansal, G. S., Yianou, C., Coope, R. C., Gomm, J. J., Luqmani, Y. A., Coombes,R. C., and Johnston, C. L. Expression of fibroblast growth factor 1 is lower in breastcancer than in the normal human breast. Br. J. Cancer,72: 1420–1426, 1995.

43. Yiangou, C., Gomm, J. J., Coope, R. C., Law, M., Luqmani, Y. A., Shousha, S.,Coombes, R. C., and Johnston, C. L. Fibroblast growth factor 2 in breast cancer:occurrence and prognostic significance. Br. J. Cancer,75: 28–33, 1997.

44. Schweigerer, L., Neufeld, G., and Gospodarowicz, D. Basic fibroblast growth factoras a growth inhibitor for cultured human tumor cells. J. Clin. Invest.,80: 1516–1520,1987.

45. Grinspan, J., Reeves, M., Coulaloglou, M., Nathanson, D., and Pleasure, D. Re-entryinto the cell cycle is required for bFGF-induced oligodendroglial dedifferentiation andsurvival. J. Neurosci. Res.,46: 456–464, 1996.

46. Su, W., Kilegawa, M., Xue, N., Xie, B., Garofalo, S., Cho, J., Deng, C., Horton,W. A., and Fu, X. Activation of STAT1 by mutant fibroblast growth factor receptorin thanatophoric dysplasia type II dwarfism. Nature (Lond.),386: 288–292, 1997.

47. Lovat, P. E., Irving, H., Annicchiarico-Petruzzelli, M., Bernassola, F., Malcolm, A. J.,Pearson, A. D., Melino, G., and Redfern, C. P. Apoptosis of N-type neuroblastomacells after differentiation with 9-cis-retinoic acid and subsequent washout. J. Natl.Cancer Inst.,89: 446–452, 1997.

48. Johnson, D., Lanahan, A., Buck, C. R., Sehgal, A., Morgan, C., Mercer, E., Bothwell,M., and Chao, M. Expression and structure of the human NGF receptor. Cell,47:545–554, 1986.

49. Maness, L., Kastin, A. J., Weber, J. T., Banks, W. A., Beckman, B. S., and Zadina,J. E. The neurotrophins and their receptors: structure, function, and neuropathology.Neurosci. Biobehav. Rev.,18: 143–159, 1994.

50. Sieber-Blum, M., and Zhang, J-M. Growth factor action in neural crest cell diversi-fication. J. Anat.,191: 493–499, 1997.

51. Abbass, S. A., Asa, S. L., and Ezzat, S. Altered expression of fibroblast growth factorin human pituitary adenomas. J. Clin. Endocrinol. Metab.,82: 1160–1166, 1997.

6170




2000;60:6160-6170. Cancer Res Lisa-Marie Sturla, Georgina Westwood, Peter J. Selby, et al. Ewing's SarcomaInduction of Cell Death by Basic Fibroblast Growth Factor in

Updated version

http://cancerres.aacrjournals.org/content/60/21/6160

Access the most recent version of this article at:

Cited articles

http://cancerres.aacrjournals.org/content/60/21/6160.full.html#ref-list-1

This article cites 42 articles, 15 of which you can access for free at:

Citing articles

http://cancerres.aacrjournals.org/content/60/21/6160.full.html#related-urls

This article has been cited by 5 HighWire-hosted articles. Access the articles at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected] at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

Permissions

[email protected] at

To request permission to re-use all or part of this article, contact the AACR Publications


http://cancerres.aacrjournals.org/content/60/21/6160

http://cancerres.aacrjournals.org/content/60/21/6160.full.html#ref-list-1

http://cancerres.aacrjournals.org/content/60/21/6160.full.html#related-urls

http://cancerres.aacrjournals.org/cgi/alerts

mailto:[email protected]

mailto:[email protected]


induction of cell death by basic fibroblast growth factor in ewing's sarcoma

Documents