Seediscussions,stats,andauthorprofilesforthispublicationat:https://www.researchgate.net/publication/51541493

ComparativeproteomicanalysisoffourBacillusclausiistrains:Proteomicexpressionsignaturedistinguishesproteinprofileofthestrains

ARTICLEinJOURNALOFPROTEOMICS·JULY2011

ImpactFactor:3.89·DOI:10.1016/j.jprot.2011.06.032·Source:PubMed

CITATIONS

6

READS

99

9AUTHORS,INCLUDING:

AnnaAbbrescia

UniversitàdegliStudidiBariAldoMoro

7PUBLICATIONS45CITATIONS

SEEPROFILE

DamianoPanelli

UniversitàdegliStudidiBariAldoMoro

19PUBLICATIONS370CITATIONS

SEEPROFILE

AnnaMariaSardanelli

UniversitàdegliStudidiBariAldoMoro

46PUBLICATIONS1,228CITATIONS

SEEPROFILE

AntonioGaballo

ItalianNationalResearchCouncil

33PUBLICATIONS350CITATIONS

SEEPROFILE

Allin-textreferencesunderlinedinbluearelinkedtopublicationsonResearchGate,

lettingyouaccessandreadthemimmediately.

Availablefrom:AntonioGaballo

Retrievedon:05February2016

J O U R N A L O F P R O T E O M I C S X X ( 2 0 1 1 ) X X X – X X X

ava i l ab l e a t www.sc i enced i r ec t . com

www.e l sev i e r . com/ loca te / j p ro t

JPROT-00610; No of Pages 10

Comparative proteomic analysis of four Bacillus clausii strains:Proteomic expression signature distinguishes protein profileof the strains

Rosa Lippolis b,⁎, Antonio Gnoni a, Anna Abbresciab, Damiano Panelli b,Stefania Maioranoa, Maria Stefania Paternoster a, Anna Maria Sardanelli a, Sergio Papaa, b,Antonio Gaballo b

a Department of Medical Biochemistry, Biology and Physics, University of Bari, Policlinico, Piazza G. Cesare, 70124 Bari, Italyb Institute of Biomembranes and Bioenergetics, Consiglio Nazionale delle Ricerche, (CNR) Bari Italy

A R T I C L E I N F O

Abbreviations: IPG, immobilized pH gradienase; MICs, minimum inhibitory concentratiDTT, 1,4-dithio-DLthreitol; PMSF, phenylmet⁎ Corresponding author. Tel.: +39 080 5448541

E-mail address: r.lippolis@ibbe.cnr.it (R. L

1874-3919/$ – see front matter © 2011 Elsevidoi:10.1016/j.jprot.2011.06.032

Please cite this article as: Lippolis R, et alsignature distinguishes protein profile o

A B S T R A C T

Article history:Received 3 March 2011Accepted 27 June 2011

A comparative proteomic approach, using two dimensional gel electrophoresis and massspectrometry, has been developed to compare and elucidate the differences among thecellular proteomes of four closely related isogenic O/C, SIN, N/R and T, B. clausii strainsduring both exponential and stationary phases of growth.Image analysis of the electropherograms reveals a high degree of concordance among thefour proteomes, some proteins result, however, differently expressed. The proteins spotsexhibiting high different expression level were identified, bymass-spectrometry analysis, asalcohol dehydrogenase (ADHA, EC1.2.1.3; ABC0046 isoform) aldehyde dehydrogenase(DHAS, EC 1.2.1.3; ABC0047 isoform) and flagellin-protein of B. clausii KSM-k16. Thedifferent expression levels of the two dehydrogenases were confirmed by quantitative RT-PCR and dehydrogenases enzymatic activity. The different patterns of protein expressioncan be considered as cell proteome signatures of the different strains.

© 2011 Elsevier B.V. All rights reserved.

Keywords:Bacillus clausii probiotic strainsProteomic analysisTwo-dimensional gel electrophoresisMass-spectrometry

1. Introduction

The spore-bearing alkaliphilic Bacillus species (B. cereus, B.clausii, B. pumilus) constitute a large, heterogeneous group ofgram-positive microorganisms, which present relevant appli-cation in human and animal infection and commercialinterest as producers of antibiotics and industrial enzymes[1]. Mixtures of four viable Bacillus spores have been marketedfor more than 30 years for use in oral bacteriotherapy [2].Bacillus probiotic species have been proved useful in prevent-

nt; ID, identification numon; LB, Luria Bertani, CHAhylsulfoniyl fluoride; SDS, +39 080 5448509; fax: +3ippolis).

er B.V. All rights reserved

, Comparative proteomif the strains, J Prot (201

ing and treating various gastrointestinal disorders by improv-ing the host's intestinal microbial balance [3], in prevention ofside effects in antibiotic therapy [4], as well in systemicimmunoglobulin regulation [5,6].

Recently molecular characterization led to the finding thatfour Bacillus strains O/C, SIN, N/R and T, now used to produce acommercial probiotic preparation, belong to a unique genos-pecies identified as alkali-tolerant species and aligned withmembers of the Bacillus clausii subgroup rather than withBacillus subtilis, as previously reported [3]. The four Bacillus

ber; ADHA, alcohol dehydrogenase; DHAS, aldehyde dehydroge-PS, -[(3-cholamidopropyl) dimethylammonio]-1-propanesulfonate;, sodium dodecyl sulphate9 080 5448538.

.

c analysis of four Bacillus clausii strains: Proteomic expression1), doi:10.1016/j.jprot.2011.06.032

2 J O U R N A L O F P R O T E O M I C S X X ( 2 0 1 1 ) X X X – X X X

strains display a low level of intraspecific diversity and exhibita high degree of genomic conservation [3] with inherentintrinsic difficulty in identifying the alkaliphilic strains. Thefour strains have a specific pattern of resistance to clinicallyimportant antibiotics [4,7], including macrolides [8] andaminoglycosides [2].

Proteomic analysis is a tool of choice in providingvaluable information on overall cellular protein expression.While the complete sequencing of a genome is today adefinite undertaking, it is however more difficult to deter-mine an organism proteome as a whole due to thesignificantly higher complexity, mainly caused by proteintargeting, post-translational modifications and protein pro-cessing. Analysis of the proteome profile of the Bacillusstrains can provide definite information for their functionalcharacterization and identification of the metabolic pro-cesses and bioactive molecules responsible for the probioticbeneficial effects of the strains.

Two-dimensional polyacrylamide gel electrophoresis (2-DE) represents the basis for proteome dissection [9,10]resulting in extensive separation of hundreds or eventhousands of protein species. Combined with mass spectrom-etry and the introduction of database search algorithms,proteins separation patterns by 2-DE-gels can result in asignificantly higher throughput.

In the present work comparative proteomics analysis,using 2-DE followed by computer-assisted gel image analysisand mass spectrometry protein identification, was performedto characterize gene expression at the protein level of the B.clausii strains O/C, SIN, N/R, and T. This study resulted in: i) abetter understanding of how these microorganisms, charac-terized by a notable low level of intraspecific genomediversity, transfer their genetic information into proteinexpression profiles and metabolic responses. ii) Detection ofdifferently expressed proteins. iii) Identification of proteinsignature that can identify the strains.

2. Materials and methods

2.1. Bacterial strains

The four O/C, SIN, N/R and T B. clausii strains, nowpropagated for production of commercial probiotic prepara-tion, were provided from Sanofi–Aventis as separate sporesuspensions. The designations of these strains are derivedfrom their resistance to different antibiotic resistancemarkers: O/C is resistant to chloramphenicol, SIN is resis-tant to neomycin and streptomycin, N/R is resistant tonovobiocin and rifampicin and T is resistant to tetracycline[2]. Rifampicin and streptomycin resistance was stablymaintained for at least 200 generations in the absence ofselective pressure, chloramphenicol resistance proved to beinducible, showing a progressive loss when the resistantstrain was grown in the absence of the antibiotic and returnto its original resistance level after growth in the presence ofthe antibiotic [11]. All strains were stored from a glycerolstock solution at −80 °C.

Please cite this article as: Lippolis R, et al, Comparative proteomisignature distinguishes protein profile of the strains, J Prot (201

2.2. Strains and culture conditions

B. clausii strains O/C, N/R, SIN and T have been maintained onLB-agar plates. B. clausii strains were inoculated in LB broth(Tryptone 10.0 g, Yeast extract 5.0 g, NaCl 10 g, H2O B.D. to 1.0 l)supplemented with 100 mM tricine pH 8, from a stationarypre-culture. Growth was performed in 250 ml flasks contain-ing 50 ml of broth at 37 °C in an orbital shaker with radius of5 cm at 150 rpm.

Bacteria growth was quantified in bacterial suspension bymeasuring the optical density at 595 nm. Cultivation startedwith an initial optical density of about 0.04 at 37 °C. The cellswere collected at the exponential growth phase (8 h) and atstationary phase (24 h) of the cultivation process (Fig. 7 insupplementary material).

2.3. Extraction of intracellular protein fraction

Cell proteins were extracted from exponential and stationaryphases of B. clausii growing cultures, as described previously[12] with some modifications. Briefly cells were centrifuged at6500 rpm for 30 min at 4 °C. Cell pellets were washed twicewith phosphate-buffer, after harvesting the cells were sus-pended in lysis buffer (7 M urea, 2 M thiourea, 4% (w/v) CHAPS,50 mM DTT, 0.5% (w/v) IPG-buffer (GE Healthcare) pH 3–10),supplemented with 1 mM PMSF (Sigma) and disrupted by ultrasonication in a ice bath for 10×30 s with a 30 s intervalbetween each ultrasonic cycle for better cooling effect.Insoluble materials were separated by centrifugation at13,000 ×g for 30 min at 4 °C. Raw protein extracts wereprecipitated with 3 volumes of cold acetone (−20 °C), washedadditionally two times with cold acetone, air-dried and storedat −80 °C until use. Protein pellets were diluted with anadequate volume of rehydration buffer (8 M urea, 2% (w/v)CHAPS, 1% (w/v) DTT, 0.5% (w/v) IPG buffer pH 4–7 or pH 3–10).The protein concentration was determined using the Bio-RadProtein Assay kit (Bio-Rad) according to the manufacturer'sinstruction [13].

2.4. Two dimensional gel electrophoresis (2-DE)

Proteins were separated by 2-DE [8,9] essentially as previouslydescribed inGorg et al. [14] andHochstrasser et al. [15]. 250 μg ofeach protein sample diluted in the IPG strip rehydration buffer,containing 8 M urea, 2% (w/v) CHAPS, 0.5% IPG buffer (GEHealthcare), 2% (w/v) DTT and trace of bromo-phenol-blue,were loaded on 24-cm IPG strips (GE Healthcare) that provided alinear pH gradient from 3–10 and 4–7; the first pH gradient issuited for an overview pattern of total cell extracts, the secondis used to zoom the specific region of the gel. Isoelectricfocusing was carried out at 20 °C using the Ettan IPG-phorIsoelectric Focusing System (GE Healthcare) to 70 kVh. Afterfocusing, the IPG strips were equilibrated 15min in the SDSequilibration buffer (50 mM Tris/HCl, pH 8.8, 6 M urea, 30% (v/v)glycerol, 2% (w/v) SDS, containing 1% DTT and 10min in thesame equilibration buffer containing 2.5% (w/v) iodoacetamideand trace of bromophenol blue. The second-dimensional gelelectrophoresis (SDS-PAGE) was carried out using the verticalslab separation unit Ettan Dalt II System (Amersham

c analysis of four Bacillus clausii strains: Proteomic expression1), doi:10.1016/j.jprot.2011.06.032

3J O U R N A L O F P R O T E O M I C S X X ( 2 0 1 1 ) X X X – X X X

Biosciences). Homogeneous SDS 13.5% polyacrylamide gel wasused in a Laemmli buffer system [16] at a constant current of15mA gel−1 and at 10 °C until the bromophenol blue dye frontreached the bottom of the gel. Molecular mass marker and pIstandards were from Bio-Rad. All strains were analyzed usinggels run in triplicate. All gels used were from three differentbatches of each B. clausii strains grown independently. The gelswere stained using Brilliant Blue G-Colloidal Concentrate(Sigma, St. Louis, MO, USA) [17].

2.5. Analysis of protein patterns

Stained gels were scanned with an Image Scanner (GEHealthcare) at 300 dpi resolution to acquire the gel images.Image analysis was performed using Image Master 2-DEsoftware v. 6.0 (GE Healthcare) following the software instruc-tion [23].

Spot detection was carried automatically using the defaultsettings in the first instance. The optimal values for the spotintensity, spot area and saliency were then determined byapplying real-time filters and visually determining theseoptimal values, in order to minimize the detection of artifactsand to maximize the real spot detection. These optimizedsettings were applied to all gel images within the same 2-DEexperiment. After spot detection, manual spot editing wascarried out for each image. Editing consisted of deleting spotsat the periphery of the gel and removal of obvious artifact thatescaped the filtering process. Three gels from each O/C, SIN,N/R and T samples were used to create the four match setswith one gel included from each of three protein extractionrepeats. Reproducible landmarks were used to match spots.Spots that were matched in two of the three replicate imageswere visually checked for mismatches and these were edited.For each match set, an artificial gel image was constructedcontaining all proteins present in at least two of the threeproteins extraction experiments used to obtain the scatter plotof each gel and this was used for the normalization of the gelimages using the normalization built-in tools of the ImageMaster software.

Relative spot volume (% volume) i.e. digitized stainingintensity integrated over the area of the individual spotdivided by the sum of volume of all spots in the gel andmultiplied by 100, was used for spot quantification [18], Thematch ID number was used to identify all spots in a match.Spots present in all the gels of the four classes and exhibitingan intensity difference between the four strains with a P value<0.05, using the two-tailored Student's t-test for equal orunequal variance (depending on the calculated variance ofspots), were considered to be differentially expressed.

2.6. Protein identification by mass spectrometry

The proteins spots which were more highly and differentlyexpressed from the four strains were excised from 2-DE gelsand in-gel digested using trypsin (Trypsin proteomics grade,Sigma), following manufacturer instructions, which includealkylation and reduction of proteins. The protolithic peptideswere separated and analysed with Nano-scale reverse-phaseHPLC-ESI-MS/MS. Nano-LC-MS/MS analyses were performedon a hybrid quadrupole time-of-flight (Q-Tof Micro) instru-

Please cite this article as: Lippolis R, et al, Comparative proteomisignature distinguishes protein profile of the strains, J Prot (201

ment, (Waters, Milford, MA USA) equipped with a Nano-flowelectrospray ion source. Protolithic peptides were loaded,purified and concentrated on a pre-column (NanoEase trapcolumn, dC18 Atlantis, Waters, Milford, MA USA) using aCapLCmicro HPLC (Waters, Milford, MAUSA) at 30 μl/min flowrate. Nano column (NanoEase Atlantis, C18, 75 μm×100 mm,100 Å, Waters, Milford, MA USA), was used for peptideseparation with a flow rate split to approximately280 nL/min using solvents A) 2% acetonitrile in 0.1% formicacid (HCOOH) and B) 98% acetonitrile in 0.1% HCOOH.Separation was performed using linear gradients: 5–95% B in30 min.

The mass spectrometer operates in positive ion mode witha source temperature of 100 °C. A voltage of 3.5 kVwas appliedto the probe tip. The instrument was externally calibratedwith a multi-point calibration based on the MS/MS fragmentions of doubly charged Fibrinopeptide-B (Sigma). Argon wasused as collision gas. Mass spectra were acquired with the Q-Tof analyser in the V-mode of operation and spectra wereintegrated over one second interval. MS and MS/MS data wereacquired in continuum mode. Data-directed analysis (DDA;parent survey) was employed to perform MS/MS analysis onup to fourthly charged precursor ions using the Mass Lynx 4.0(Waters, Milford, MAUSA) software. Peak list was generated byProteinLynx Global Server 2.2 (Waters, Milford, MA USA).Database search was performed by Mascot program (www.matrixscience.com) [19] using the following criteria: type ofsearch: MS/MS Ion Search, databases were NCBInr and MSDB,with taxonomy Firmicutes, the narrowest taxonomy to Bacillusclausii available on the Mascot server. (The release version/date of NCBInr is 26/03/2010). It was assumed thatmass valueswere monoisotopic, set as fixed modifications: carbamido-methyl, and no variable modifications. The MS/MS Ion Searchmethod allowed for zero-missed cleavage for Trypsin, and thepeptide mass tolerance was set as 0.2 Da and the fragmentmass tolerance as 0.6 Da; peptide charge was set +2 and +3.

2.7. RNA procedures

For real-time PCR experiments, total RNA was isolated fromexponential (8 h) and stationary (24 h) phases of B. clausiigrowing cultures, using the RNeasymidi-kit (Qiagen). Residualgenomic DNA was removed by DNase I digestion (Roche,Mannheim, Germany). The quantity and the purity of RNAwere determined by measuring the absorbance at 260 and280 nm. Total RNA (1 μg) was then reverse transcribed by usingrandom hexamers (250 ng) with AMV reverse transcriptase-RNase H minus (New England Biolabs) according to themanufacturer's instructions. Semi-quantitative analysis ofthe adhA (alcohol dehydrogenase, ABC0046 isoform) anddhaS (aldehyde dehydrogenase, ABC0047 isoform) gene tran-scripts, normalized to rpoB encoding RNA polymerase ßsubunit was performed by RT real-time PCR with the iQSYBRgreen Supermix (BioRad) on a Biorad iCycler iQ instru-ment. About 10% of each RT reactionwas used to run real-timePCR reactions. Real-time PCR reactions were run in duplicate.Primer pairs (Table 1) used in real time PCR experiments weredesigned considering the non-conserved sequences of thedehydrogenases isoforms in the reference B. clausii KSM-k16strain (accession number: APOO6627). The real-time PCR

c analysis of four Bacillus clausii strains: Proteomic expression1), doi:10.1016/j.jprot.2011.06.032

Table 1 – Oligonucleotide primers used in RT real-time PCR experiments.

Gene Primers forward 5′–3′ Primers reverse 5′–3′

adhA (ABC0046) CTATTAGCGTGGCAGTCAC GTATCGAAAATCGGAATGGGCdhaS (ABC0047) ATGTCACAAGTGCCAACAGGC GTCCTGCTTCTGCCACAATGrpoB ATGGTGGAGACGGAATCGTTC AACGGCATATCTTCTTCTGGC

4 J O U R N A L O F P R O T E O M I C S X X ( 2 0 1 1 ) X X X – X X X

conditions were: 20″ at 94 °C, 30″ at 58 °C, 45″ at 72 °C for45 cycles, followed by a melt curve cycle. Relative geneexpression levels were determined by the comparative Ct

method and expressed as the average of at least three separatedeterminations±S.D.

2.8. Enzymatic assay

Enzymatic assay of alcohol dehydrogenase (ADHA) andaldehyde dehydrogenase (DHAS)was determined on extractedsoluble proteins fraction, according to Nosova [20]. Briefly,cytosolic dehydrogenases activities were determined spectro-photometrically by measuring the reduction of NAD+ at340 nm at 25 °C after the addition of substrate. The assaymixture for ADHA activity contained 60 mM sodium phos-phate buffer pH 8, 2.5 mM NAD+ and 25 mM ethanol assubstrate. The assay mixture for DHAS activity contained60 mM sodium phosphate buffer pH 8, 2.5 mM NAD+, 25 mMacetaldehyde as substrate and 5 nM 4-methylpyrazole (ADHAinhibitor). Blank cuvettes without substrate were run simul-taneously and the results were corrected for blank reactions.Dehydrogenases activities were calculated as nmol of reducedNADH/mg protein. Results are expressed as means±SD atleast three determinations.

2.9. Alcohol dehydrogenase (ADHA) activity PAGE staining

The soluble native protein fractions (25 mg of each N/R, SIN,O/C and T) were separated by nondenaturating 14%polyacrylamide gel electrophoresis according to Laemmli'smethod [16]. The gel was stained in 25 mM sodiumphosphate pH 8, 30 mM ethanol, 2 mM NAD+, 0.33 mg/mlNitro Blue Tetrazolium and 0.06 mg/ml Phenazine Metasol-phate [21].

3. Results

3.1. 2-DE analysis of protein pattern

Comparative analysis of the overall intracellular proteinpattern, of the four O/C, SIN, N/R and T B. clausii strains, wasperformed. In Fig. 1a and b the protein patterns of fourrepresentative gels, at pH 4–7 and 3–10 are shown. Analysisof the protein pattern of the four strains was repeated threetimes, and each biological repeat was performed in tripli-cate. Cells from each biological repeat, i.e. resulting fromthree independent cultures, were pooled for the subsequentprotein extraction (Fig. 2). Overall positions and numbers ofproteins spots were similar in the gels of the four strains.The number of spots observed in the gel was similar in the

Please cite this article as: Lippolis R, et al, Comparative proteomisignature distinguishes protein profile of the strains, J Prot (201

four classes without significant difference (670±38 in O/C,630±SIN±45, 650±68 in N/R and 680±46 in T). Also thepercent of matches between gels from the same class wassimilar (around 60%) and without statistically significantdifferences among the classes.

In expression proteomics the possibility of false positive,i.e. of false call of significance, is particularly high [22]. Toreduce the possibility of false positive, only the protein spotssystematically present in all gels of each OC, SIN, NR and Tclass i.e. spots present in two or three gels from three differentbatches of each were considered in the analysis. The majorityof proteins were present in all the four strains. Some spotswere not considered for analysis because they were presentonly in a subset of gels and exhibited variability.

In order to analyze the protein differently expressed in thefour strains, only the matched spots present in all gels of allclasses have been investigated. Among this group of spots,only those showing a different expression in the four strainswith a p<0.05, applying the restrictive two tailored Student's t-test, were considered to be differentially expressed. Using thisconstrained statistical analysis, twenty-seven proteins spotswith masses ranging from 67.9 to 12.05 kDa and pIs rangingfrom 2.68 to 5.96 were differentially expressed from the fourstrains. (Figs. 1a,b, 3a, b and c and Table 3 in supplementarymaterials). The four B. clausii strains, which belong to a uniquegenospecies, exhibited the same variations in proteins ex-pression pattern during both the exponential (at 8 h cultiva-tion time) and the stationary (at 24 h cultivation time) growthphases.

Most of the protein spots, differently expressed in thefour strains, were synthesized at low level (Figs. 1a, b, and3a). Three protein spots were expressed at very highdifferent level in the four strains. The spot ID 257 withmasses 53,7 kDa and pI 5,57, exhibited overexpression in SINand NR strains (% spot volume: 4.2969 and 4.2969 relatively)respect to OC and T strains (% spot volume: 0.2361 and0.4108 respectively). The spot ID 475 with masses 37.9 kDaand pI 5.26 was overexpressed in SIN and NR strain (% spotvolume: 6.79 and 8.595 respectively) with respect to OC and Tstrains (% spot volume: 0.119 and 0.175 respectively). Thespot ID 694 with masses 32.04 kDa and pIs 4.52 wasexpressed at the highest level in the N/R and T strains (%spot volume: 6.9006 and 9.6444 respectively) whit respect toOC and SIN strains (% spot volume: 1.027 and 1.533respectively). (Figs. 1a, b, 3b, c and Table 3, in supplementarymaterials).

The four B. clausii strains, which are characterized by a lowlevel of intraspecific genome diversity, expressed at differentlevels proteins encoded by the same genes. Further study wasdirected to spot which were more highly and differentlyexpressed in the four B. clausii strains.

c analysis of four Bacillus clausii strains: Proteomic expression1), doi:10.1016/j.jprot.2011.06.032

257 350

368 418 409 487

597

442 539

496

694 747

722 649

973

1134

889

825 731

674

310

1205

475

299 287

OC

491

749

1112

1198

150

50

37

25

20

15

10

75

200

100

SIN

257 350

368

475 409

487

597

442 539

694 747

722

649

973

1134

299 310 418

674

582

1198 1205

825 731

642

496

889

287

491

749

NR

257 350

368 418

475 487 597

442 539 496

649

747 722 649

973

1134

1205

409

674 825

889

299

731

310

491

749

287

1112

T

257 350

442 418

409

487 539 496

649 649

973

1134

1205

825

597

475

368 310

749

287 299

731

889

491

722 747

1112

257 350 299

694

973

825 889

749

368 287

475

597

1125

487 442 491 496

1198

OC KDa

KDa

150

50

37

25

20

15 10

75

200

100 257

350

299

368

694 722

487 496

973

825

642

475

889

368

749 597

1198

SIN

1125

287

491

257

350

299

418

694

722

487

496

973

825

642

475

889

368

747

597

NR

1125

287

442 491

257 350 299

418

694

973

825 889 749

418 287

475

596

597

1125

487 491

649 722

T

A

B

Fig. 1 – A. Overview of the 2-DEmaps of the O/C, SIN, N/R, and T B. clausii strains at pH 4–7. Equivalent amounts (250mg) of proteins, from stationary growth phase were separated,using linear pH ranges 4–7 IPG strips. SDS-PAGE was performed with 12.5% acrylamide. Gels were stained with Colloidal Coomassie brilliant blue G-250. Proteins spots showingdifferent expression level from the four strains, are indicated by match ID and listed in Fig. 3a, b. Arrows indicate the protein spots identified by mass-spectrometry analysis andMascot search (Table 2). B. Overview of the 2-DEmaps of the O/C, SIN, N/R, and T B. clausii strains at pH 3–10. Equivalent amounts (250mg) of proteins, from stationary growth phasewere separated, using linear pH ranges 3–10 IPG strips. SDS-PAGE was performed with 12.5% acrylamide. Gels were stained with Colloidal Coomassie brilliant blue G-250. Proteinsspots showing different expression level from the four strains, are indicates by numbers referred to Fig. 1a. Arrows indicate the protein spots identified by mass-spectrometryanalysis and Mascot search.

5JO

UR

NA

LO

FPR

OT

EO

MIC

SX

X(2011)

XX

X–X

XX

Pleasecite

this

articleas:Lippolis

R,et

al,Com

parativeproteom

ican

alysisoffou

rBacillus

clausiistrains:Proteom

icexpression

signatu

redistin

guishes

proteinprofile

ofth

estrain

s,JProt

(2011),doi:10.1016/j.jprot.2011.06.032

Table 2 – Proteins identified by Mascot search.

Spotnumber

Proteinname

Species Acessionno a

Mascot score b

NCBIpI c MWd

(Da)pI e MW f

(Da)SC g % Unique

peptide hPeptide

sequence im/z state j

257 Aldehyde dehydrogenase B. clausii strains KSM K16 gi|56961829 224 5.46 54,000 5.57 53,768 8 4 SQVPTGENSLK +2VAFTGSTNVGK +2VTLELGGK +2SPNIILPDADLSK +2

475 Alcohol dehydrogenase B. clausii strains KSM K16 gi|56961828 191 5.10 38,000 5.26 37,979 9 3 AAVVNQFNQQLEIK +2APANYIVK +2TNIETQPLDK +2

649 Flagellin protein B. clausii strains KSM K16 gi|56965461 98 4.45 31,000 4.52 32,042 4 1 AGDDAAGLSISEK +2

a Accession number in NCBI.b Mascot score obtained fromMS/MS ion search against NCBI [the Mascot score for an MS/MSmatch is based on the absolute probability (P) that the observedmatch between the experimental data and thedatabase sequence is a random event, the reported score is −10Log(P) and the significance threshold is p<0.05; all the ion scores are higher than the threshold values, (see also www.matrixscience.com)].c Theoretical pI.d Theoretical molecular weight.e Experimental pI.f Experimental molecular weight.g Sequence coverage.h Number of identified peptides.i Sequences of identified peptides.j Number of charge.

6JO

UR

NA

LO

FPR

OT

EO

MIC

SX

X(2011)

XX

X–X

XX

Pleasecite

this

articleas:Lippolis

R,etal,C

omparative

proteomic

analysis

offourBacillus

clausiistrains:Proteom

icexpression

signatu

redistin

guishes

proteinprofile

ofth

estrain

s,JProt

(2011),doi:10.1016/j.jprot.2011.06.032

O/C SIN N/R T

Fig. 2 – 2-DE gels images sections. Reproducible differences, in the expression level, of some protein spots among the four strains.

7J O U R N A L O F P R O T E O M I C S X X ( 2 0 1 1 ) X X X – X X X

3.2. MS analysis

Besides few intense spots showing high variability from thestrains, protein spots exhibiting a different expression in the

0

0.2

0.4

0.6

0.8

1

1.2

1.4

1.6

1.8

287 299 310 350 368 409 418 442 457 487 491 496 53

0

2

4

6

8

10

12

14

257 475

A

B

Fig. 3 – A. Different expression profile of low abundant proteins svolume (% volume) i.e. digitized staining intensity integrated oveof all spots in the gel and multiplied by 100, was used for spot qbars (SEM) are indicated. B. Different expression profile of proteiclausii strains. Relative spot volume (% volume) i.e. digitized staidivided by the sum of volume of all spots in the gel and multipliindicated with match ID. The error bars (SEM) are indicated.

Please cite this article as: Lippolis R, et al, Comparative proteomisignature distinguishes protein profile of the strains, J Prot (201

four strains show very low intensities (Figs. 1a, b, 3a b). Thespots exhibiting significant high different expression in thefour B. clausii strains were excised from the 2-DE gels,subjected to in-gel digestion and peptides extracted for mass

9 597 649 722 747 749 825 889 973 1112 1134 1205

O/CSINNRT

694

O/CSINNRT

pots in the OC, SIN, NR, and T B. clausii strains. Relative spotr the area of the individual spot divided by the sum of volumeuantification. Each spot is indicated with match ID. The errorns spots expressed at high level in the OC, SIN, NR, and T B.ning intensity integrated over the area of the individual spoted by 100, was used for spot quantification. Each spot is

c analysis of four Bacillus clausii strains: Proteomic expression1), doi:10.1016/j.jprot.2011.06.032

Fig. 4 – Quantitative RT-PCR analysis of ADHA and DHASisoform. adhA and dhaS relative genes expression analysis ofthe four B. clausii strains after 8 h, (exponential phase) (PanelA) and 24 h (stationary phase) (Panel B) of growth. Theexpression level of the transcripts was analysed by real-timePCR. Normalization was performed with the rpoB transcript,which was set as 100 in the first experiment. In all theexperiments the average values and standard deviations inthree real-time PCR analyses are shown.

8 J O U R N A L O F P R O T E O M I C S X X ( 2 0 1 1 ) X X X – X X X

spectrometric characterization by LC-nano-ESI MS and data-base searching identification. To overcome problems of falsepositives, restrictive parameters in Mascot analyses wereused. The analytical procedure identified the spots ID 257and 475, as respective homologues of aldehyde dehydroge-nase (DHAS ABC0047 isoform) and alcohol dehydrogenase(ADHA ABC0046 isoform) and spot ID 694 as Flagellin protein(see Table 2and Table 3 in supplementary data). All proteinswere identified in B. clausii (data base KSM-k16) thus confirm-

Fig. 5 – Alcohol dehydrogenase activity by histochemical stainin30 h of growth. 25 mg of O/C, SIN, N/R and T soluble protein fractigel electrophoresis according to Laemmli. The ADHA activity waunder Materials and methods.

Please cite this article as: Lippolis R, et al, Comparative proteomisignature distinguishes protein profile of the strains, J Prot (201

ing the accuracy of the present identifications and thesimilarity among the B. clausii KSM-k16 and the four strainsanalysed in this work. The different expression levels in thefour strains of aldehyde dehydrogenase and alcohol dehydro-genase is of particular interest because no significant changesin the expression levels of enzymes involved in intermediarymetabolism have so far been reported for different B. clausiistrains.

3.3. Quantitative analysis of the adhA and dhaStranscripts

Sequence analysis of PCR products confirmed the presence ofthe adhA and dhaS genes, annotated in B. clausii KSM-k16genome, in the four B. clausii strains analysed in the presentwork (data not shown). To estimate the transcript levels ofadhA and dhaS genes during the growth of the four B. clausiistrains, real-time PCR experiments were carried out. In theexperiment shown in Fig. 4, transcript levels of adhA and dhaSgenes were evaluated after 8 h (panel A) and 24 h (panel B) ofgrowth. Data were normalized with respect to the transcriptlevels of rpoB. The transcription trend presented macroscopicdifferences in the four strains in agreementwith the proteomeexpression profile. The mRNA level of both adhA and dhaSgenes were much higher in SIN and N/R with respect to O/Cand T strains.

3.4. DHAS and ADHA enzymatic activities

Histochemical staining determination of the activity of ADHArevealed activity of this enzyme in both the SIN and N/Rstrains as compared to the O/C and T strains in which noactivity was detected by the staining procedure (Fig. 5).

A direct spectrophotometric determination of NADH re-duction by DHAS and ADHA showed, however, that activitiesof these enzymes were significantly higher in the SIN than inthe N/R strain. (Fig. 6). No activity of both enzymes could bedetected spectrophotometrically in the O/C and T strains.

4. Discussion

With a view toward verifying the original taxonomic positionof the O/C, SIN, N/R and T B. clausii probiotic strains Senesi andco-workers catalogued the genotypic traits exhibited by thefour Bacillus probiotic strains isolated from the sporemixtures

g. Samples were collected for analysis at 8 h, 16 h, 24 h, andons were separated by non-denaturating 14% polyacrylamides revealed as described by Venugopal. For further details see

c analysis of four Bacillus clausii strains: Proteomic expression1), doi:10.1016/j.jprot.2011.06.032

Fig. 6 – Dehydrogenases enzymatic activities. Samples were collected for analysis at 24 h (stationary phase) of cultivationprocess. 25 mg of O/C, SIN, N/R, and T soluble proteins were assayed according to Nosova. Enzymatic activities were calculatedas nmoles of reduced NADH/mg protein. Results are expressed as means±SD of least three determinations. For further detailssee under Materials and methods.

9J O U R N A L O F P R O T E O M I C S X X ( 2 0 1 1 ) X X X – X X X

of a commercial pharmaceutical preparation [3]. Complete 16SrRNA gene sequences, DNA-DNA reassociation, and otherinvestigations showed that the four strains belong to a uniquegenospecies characterized by a notable low level of intraspe-cific genome diversity and originated even from a commonancestor. To investigate the protein expression profile of thefour O/C, SIN, N/R, and T B. clausii strains we have used aproteome analytical approach, developed in our laboratory forproteomic analysis of different microorganism [23].

The present proteomic analysis provides, for the first time,an overall 2-DE description of the protein patterns of four B.clausii strains at the exponential and stationary phases ofgrowing cultures. The four strains, which have the samegenotypic traits, exhibit surprising variations in the expressionlevel of some proteins. Many of the differences found in thecurrent analysis concerned low abundant proteins (Fig. 3a).

Themost significant differencesamong the four strainswereobserved in the expression level of two proteins spots (ID 257and 475) identified as aldehyde dehydrogenase (DHAS-genelocus ABC0047) and alcohol dehydrogenase (ADHA-gene locusABC0046) in B clausii KSM-K16 reference strain, involved inintermediary metabolism of the cell, and protein spot ID 694identified as flagellin, a structural protein component ofbacterial flagellum, in the same B clausii KSM-K16 referencestrain (Figs. 1a, b, 3b, and Table 3 in supplementary materials)The two isoforms of alcohol dehydrogenase and aldehydedehydrogenasewere constitutivelyoverexpressed in thestrainsSIN and N/R with respect to the strains O/C and T while theflagellin is expressed at high level in the strains N/R and T withrespect to the strains O/C and SIN. The different proteinexpression level of the two dehydrogenases, among the strains,was confirmed by quantitative real-time PCR analysis (Fig. 4)and enzymatic activity measurement (Figs. 5, 6).

Alcohol dehydrogenases comprise a group of several iso-zymes that catalyze the interconversion of alcohols, aldehydesand ketones and play an important role in a broad range ofmetabolic processes [24–29]. Aldehyde dehydrogenase, bycoupling with alcohol dehydrogenase, acts on a wide range ofaliphatic aldehydes as a producer of acetic acid [30]. Thepositive correlation between aldehyde dehydrogenase andalcohol dehydrogenase bacterial activity [31] is supported by

Please cite this article as: Lippolis R, et al, Comparative proteomisignature distinguishes protein profile of the strains, J Prot (201

the present finding that in the B. clausii strains both thedehydrogenases are expressed at high levels (SIN, and N/R), orboth are under-expressed (O/C and T). This indicates that theproduction of acetic acid or alcohol is a feature mainlyassociated with two of four of B. clausii strains. The OC, SIN,NR, and T B. clausii strains are, currently used in thecommercial probiotic suspensions and are, generally identi-fied by their resistance to chloramphenicol, tetracycline,rifampicin and streptomycin respectively [2,32], Sometimes itis, however, difficult to identify the strains based on antibioticmarkers resistance which can be lost by reversion throughrepeated passages [33]. The demonstrated functional overexpression of the two dehydrogenases in B. clausii strains SINand N/R coupledwith overexpression of flagellin in the strainsN/R and T is of particular interest because as shown, for thefirst time, that it is possible to distinguish each of the four Bclausii strains on the basis of their 2-DE protein signature.

The OC strain does not present significant level of each spot,SIN strain over-expresses two spots (spot ID 257 and 475), NRstrainover express three spots (spot ID257and475and694)whilethe T strain overexpresses only one spot (spot ID 694) (Figs. 1a,b, 3b). Our results show that the proteomic analysis of the fourstrains provides definite markers for strain identification and analternative method for monitoring each strain identity.

The molecular basis for different expression of these pro-teins, in the four probiotic strains, is presently not clearlyunderstood. The implementation of advanced technologies,including DNA array and proteome–secretome analysis, will berequired to further evaluate the biological relevance of the latterobservations and, ultimately, to exploit the specific metabolicfunction for the different production of proteins associated witheach strain. Generation of information about specific proteinsthat are consistently up-regulated or down-regulated in the fourstrains may also be useful in understanding the biology of eachstrainandelucidate thebiologicalmechanismofprobioticeffect.

Acknowledgments

The authors are grateful to Sanofi-Aventis for its contributionto research and for providing the B. clausii strains.

c analysis of four Bacillus clausii strains: Proteomic expression1), doi:10.1016/j.jprot.2011.06.032

10 J O U R N A L O F P R O T E O M I C S X X ( 2 0 1 1 ) X X X – X X X

This work was supported by: National Project, “ProgettoFIRB Rete Nazionale per lo Studio della Proteomica Umana(Italian Human ProteomeNet)”, 2009, Ministero dell'Istruzione,dell'Università e della Ricerca (MIUR).

Appendix A.Supplementary data

Supplementary data to this article can be found online atdoi:10.1016/j.jprot.2011.06.032.

R E F E R E N C E S

[1] Ikawa K, Araki H, Tsujino Y, Hayashi Y, Igarashi K, Hatada Y,et al. Hyperexpression of the gene for a bacillusalpha-amylase in Bacillus subtilis cells: enzymaticproperties and crystallization of the recombinant enzyme.Biosci Biotechnol Biochem 1998;62:1720–5.

[2] Ciffo F. Determination of the spectrum of antibiotic resistanceof “Bacillus subtilis” strains of enterogermina. Chemioterapia1984;3:45–52.

[3] Senesi S, Celandroni F, Tavanti A, Ghelardi E. Molecularcharacterization and identification of Bacillus clausii strainsmarked for use in oral bacterioterapy. Appl Environ microbiol2001;67:834–9.

[4] Mazza P. The use of Bacillus subtilis as an antidiarrhoealmicroorganism. Boll Chim Farm 1994;133:3–18.

[5] Fiorini G, Cimminiello C, Chianese R, Visconti GP, Cova D,Uberti T, et al. Bacillus subtilis selectively stimulate thesintesis of membrane bound and secreted IgA. Chenioterapia1985;4:310–2.

[6] Duc LH, Hong HA, Cutting SM. Germination of the spore in thegastrointestinal tract provides a novel route for heterologousantigen presentation. Vaccine 2003;21:4215–24.

[7] Galopin S, Cattoir, Leclercq RA. Chromosomal chloramphenicolacetyltransferase determinant froma probiotic strain of Bacillusclausii. FEMS Microbiol Lett 2009;296:185–9.

[8] Bozdogan B, Galopin S, Leclercq R. Characterization of anew erm-related macrolide resistance gene present inprobiotic strain of Bacillus clausii. Appl Environ Microbiol2004;70:280–4.

[9] Klose J. Proteinmapping by combined isoelectric focusing andelectrophoresis of mouse tissues. A novel approach to testingfor induced point mutations in mammals. Humangenetik1975;26:231–43.

[10] O'Farrell PH. High resolutions two-dimensional electrophoresisof proteins. J Biol Chem 1975;250:4007–21.

[11] Mazza P, Zani F, Martelli P. Studies on the antibiotic resistanceof Bacillus subtilis strains used in oral bacteriotherapy. BollChim Farm 1992;131:401–8.

[12] WangW, Hollmann R, Deckwer WD. Comparative proteomicanalysis of high cell density cultivationswith two recombinantBacillus megaterium strains for the production of a heterologousdextransucrase. Proteome Sci 2006;5:4–19.

[13] BradfordMM.A rapidandsensitivemethod for thequantitationof microgram quantities of protein utilizing the principle ofprotein-dye binding. Anal Biochem 1976;72:248–54.

[14] Gorg A, Postel W, Gunther S. The current state oftwo-dimensional electrophoresis with immobilized pHgradients. Electrophoresis 1988;9:531–46.

[15] Hochstrasser DF, Harrington MG, Hochstrasser AC, Miller MJ,Merril CR. Methods for increasing the resolution oftwo-dimensional protein electrophoresis. Anal Biochem1988;173:424–35.

Please cite this article as: Lippolis R, et al, Comparative proteomisignature distinguishes protein profile of the strains, J Prot (201

[16] LaemmliUK.Cleavageof structural proteinsduring theassemblyof the head of bacteriophage T4. Nature 1970;227:680–5.

[17] Neuhoff V, Taube AN, Ehrhardt WD. Improved staining ofproteins in polyacrylamide gels including isoelectric focusinggels with clear background at nano grams sensitivity usingCoomassie Brillant Blue G-250 and R-250. Electrophoresis1988;9:255–62.

[18] Appel RD, Hoogland C, Bairoch A, Hochstrasser DF.Constructing a 2-D database for the World Wide Web.Methods Mol Biol 1999;112:411–6.

[19] Perkins DN, Pappin DJ, Creasy DM, Cottrell JS. Probability-basedprotein identification by searching sequence databases usingmass spectrometry data. Electrophoresis 1999;20:3551–67.

[20] Nosova T, Jousimies-Somer H, Kaibovaara P, Jokelainen K,Heine R, Salaspuro M. Characteristic of alcoholdehydrogenases of certain aerobic bacteria representinghuman colonic flora. Alcohol Clin Exp Res 1997;21:489–94.

[21] Venugopal KS, Adiga PR. Artifactural staining of proteins onpoliacrilamide gels by nitrobluetetrazolium chloride andphenazine-methosulfate. Anal Biochem 1980;101:215–20.

[22] Karp NA, Spencer M, Lindsay H, O'Dell K, Lilley KS. Impact ofreplicate types on proteomic expression analysis. J ProteomeRes 2005;4:1867–71.

[23] Gnoni A, Lippolis R, Zanotti F, Papa S, Palese LL. Atwo-dimensional electrophoresis and mass-spectrometryprotein analysis of the antibiotic producer Nonomuraea sp.ATCC39727 in different growth conditions. FEMS MicrobiolLett 2007;2:1–7.

[24] Park DH, Plapp BV. Isoenzymes of horse liver alcoholdehydrogenase active on ethanol and steroids. cDNA cloning,expression, and comparison of active sites. J Biol Chem1991;266:13296–302.

[25] Ma K, Loessner H, Heider J, Johnson MK, Adams MW.Effects of elemental sulfur on the metabolism of thedeep-sea hyperthermophilic archaeon Thermococcusstrain ES-1: characterization of a sulfur-regulated,non-heme iron alcohol dehydrogenase. J Bacteriol1995;177:4748–56.

[26] Tani A, Sakai Y, Ishige T, Kato N. ThermostableNADP+-dependent medium-chain alcohol dehydrogenasefrom Acinetobacter sp. strain M-1: purification andcharacterization and gene expression in Escherichia coli. ApplEnviron Microbiol 2000;66:5231–5.

[27] Burdette DS, Jung SH, Shen GJ, Hollingsworth RI, Zeikus JG.Physiological functionofalcoholdehydrogenasesand long-chain(C30) fatty acids in alcohol tolerance of Thermoanaerobacterethanolicus. Appl Environ Microbiol 2002;68:1914–8.

[28] Vangnai AS, Arp DJ, Sayavedra-Soto LA. Two distinct alcoholdehydrogenases participate in butanemetabolism by Pseudomonas butanovora. J Bacteriol 2002;184:1916–24.

[29] Yoon SY, Noh HS, Kim EH, Kong KH. The highly stable alcoholdehydrogenase of Thermomicrobium roseum: purification andmolecular characterization. Comp Biochem Physiol B BiochemMol Biol 2002;132:415–22.

[30] Ameyama M, Adachi O. Aldehyde dehydrogenase from aceticacid bacteria, membrane-bound. Methods Enzymol 1982;89:491–7.

[31] Nosova T, Jokelaien K, Kaihovaara P, Heine1 RH, Somer J,Salaspur M. Characteristics of aldehyde dehydrogenases ofcertain aerobic bacteria representing human colonic flora.Alcohol Alcohol 1998;33:273–80.

[32] Mazza G. Genetic studies on the transfer of antibioticresistance genes in Bacillus subtilis strains. Chemioterapia1983;2:64–72.

[33] Green DH, Wakeley PR, Page A, Barnes A, Baccigalupi L, RiccaE, et al. Characterization of two Bacillus probiotics. ApplEnviron Microbiol 1999;65:4288–91.

c analysis of four Bacillus clausii strains: Proteomic expression1), doi:10.1016/j.jprot.2011.06.032