danshen (radix salviae miltiorrhizae) reverses renal ... · treat kidney damage through protecting...

TOPIC

JTCM |www. journaltcm. com June 15, 2015 |Volume 35 | Issue 3 |

Online Submissions: http://www.journaltcm.com J Tradit Chin Med 2015 June 15; 35(3): [email protected] ISSN 0255-2922

© 2015 JTCM. All rights reserved.

EXPERIMENTAL STUDY

Danshen (Radix Salviae Miltiorrhizae) reverses renal injury inducedby myocardial infarction

Lu Xiaomei, Jin Yunan, Ma Ling, Du Liliaa

Lu Xiaomei, Jin Yunan, Ma Ling, Du Lili, Department ofPathophysiology, College of Basic Medicine, China MedicalUniversity, Shenyang 110001, ChinaSupported by the Grants from the National Natural ScienceFoundation of China (Effects of Membrane-type Matrix Me-talloproteinase 1 on Vascular Endothelial Cell Proliferationand Differentiation, No. 81100109)Correspondence to: Prof. Lu Xiaomei, Department ofPathophysiology, College of Basic Medicine, China MedicalUniversity, Shenyang 110001, China. [email protected]: +86-24-23256666-5362Accepted: July 17, 2014

AbstractOBJECTIVE: To evaluate the protection of Danshen(Radix Salviae Miltiorrhizae) (SM) injection in myo-cardial infarction (MI) induced renal damage.

METHODS: Forty male C57 mice were divided intocontrol group, MI group and SM group. In MIgroup, the left coronary artery was occluded for 8weeks; the same procedure was used for the SMgroup, with the additional step of SM (0.2 mL) ad-ministered intraperitoneally for 56 days. Before sur-gery and 8 weeks later, transthoracic echocardiog-raphy was performed and urine protein and albu-min was measured. At the end of the time, all micewere killed and kidneys removed for reactive oxy-gen species (ROS) and fibrosis analysis, plasma wascollected for blood urea nitrogen and serum creati-nine determination.

RESULTS: MI slightly decreased renal function andincreased production of ROS, accompanied with re-nal fibrosis. Administration of SM reduced produc-tion of ROS and increased renal function, it also re-

duced renal fibrosis.

CONCLUSION: MI plays a causal role in renal injuryand SM exerts renal-protective effects, probably byits antioxidant activities.

© 2015 JTCM. All rights reserved.

Key words: Salvia Miltiorrhiza; Myocardial infarc-tion; Reactive oxygen species

INTRODUCTIONHeart failure (HF) is a complex syndrome character-ized by signs related to inadequate perfusion of organsand tissues during exercise and represents the commonpathway for most primary cardiovascular diseases.1 Pro-gressive aging of the population, together with the sig-nificant reduction in mortality for cardiovascular diseas-es, have been accompanied by a marked increase in itsprevalence, so that HF is now considered a major pub-lic health problem2

Myocardial infarction (MI) patient's progressed to verylate stage will cause chronic heart failure. Chronicheart failure with renal insufficiency, which means car-diorenal syndrome, has gradually attracted attention ofthe medications.3 As we all know, congestive heart fail-ure is a progressive disorder that in its later stages leadsto intense intrarenal vasoconstriction, elevated renalvascular resistance, reduced renal blood flow,4 progres-sive kidney damage and renal insufficiency.5 Recently,excessive production of reactive oxygen species (ROS)has been found to be involved in causing renal injury.In recent years, the incidence of chronic cardiovasculardisease was significantly higher, and due to the surgicaltreatment of many patients in the acute phase of thedisease, the progression of the disease to end-stage pa-tients also increased significantly, which often present

306


Lu XM et al. / Experimental Study

with renal insufficiency and cardiorenal syndrome man-ifestations.Traditional Chinese Medicine has evolved into awell-developed, coherent system of medicine to treat ill-ness.6 Herbal medicine has been used for more than2000 years.7 Danshen (Radix Salviae Miltiorrhizae)(SM) is a kind of traditional chinese drug commonlyused for activating circulation,8 the research on the effect of it in the treatment of cardiorenal syndrome hasnot been reported. SM injection is the extraction ofwild Salvia roots, the main activating redients includeDanshensu, salvianolic acid, as well as tanshinone, di-hydrotanshinone, and cryptotanshinone,9 which areable to protect endothelial cells, fight against inflamma-tion, and prevent lipid peroxidation and calcium over-load.10-12 Some studies have shown that SM is used totreat kidney damage through protecting renal cortexand renal function.13,14 Moreover, SM also shows sometherapeutic effects on renal failure patients.15 AlthoughSM has been used to treat some kind of renal disease,the exact mechanism is not very clear. For this reason,the purpose of this study is to evaluate the protectionof SM injection against chronic heart failure inducedrenal failure in mice through observing the pathologi-cal alterations and the contents of ROS in the kidney.

MATERIALS AND METHODS

Animal preparationForty male C57 mice of specific pathogen free (SPF)grade, ten weeks old, weighing (20 ± 3) g, were sup-plied by China Medical University Animal Center.Mice were housed under climate-controlled conditionswith a 12-h light/dark cycle and were provided withstandard food and water ad libitum. All experimentalprocedures were performed under the guidelines forthe care and use of animals as established by the animalethics committee in China Medical University. Micewere randomly divided into 3 groups by random num-ber table method, sham group (n = 13), MI group (n =14), and SM treatment group (n = 13). The surgicalprotocol were performed similar to methods describedpreviously,16 Briefly, the mice were anesthesiaed by50 mg/kg phenobarbital sodium (Sigma, St. Louis,MO, USA) to relieve the suffering of the animal, thenthe mice were orally intubated with polyethylene tub-ing and connected to a rodent ventilator (type 845,Harvard Apparatus, Kent, UK). Positive-pressure artifi-cial respiration was started immediately with room air,using a volume of 1.5 mL/100 g body weight at a rateof 90 strokes/min to maintain normal PCO2, PO2, andpH parameters. The chest was opened by a left thora-cotomy, followed by sectioning the fourth and fifthribs. The left anterior descending coronary artery wasvisualized and ligated with 7-0 silk suture. The chestwall was closed and allowed to recover in a temperaturecontrolled area. Mice were included in the MI group if

there was a transmural left ventricular scar at autopsyobliterating at least 25% of the left ventricular muscle.Sham-operated mice underwent the same surgery mi-nus the coronary artery ligation. As for the SM treat-ment group, mice were treated with 0.2 mL SM injec-tion (each 10 mL vial contains active componentsequivalent to 15 g of the original medicine (ShenghePharmaceutical Co., Ltd., Sichuan, China) intraperito-neally for 8 weeks. The sham group and MI groupwere treated with 0.2 mL saline injection intraperitone-ally for 8 weeks.

Heart rate, blood pressure and cardiac functiondeterminationOne day before the animals were killed, intelligentnon-invasive blood pressure monitor (Kent ScientificCorporation, Torrington, CT, USA) were used to mea-sure systolic blood pressure (SBP) and heart rate (HR)in the awake state. Transthoracic echocardiography wasperformed before surgery and 8 weeks later. UsingHP5500 imaging system (Hewlett-Packard Co., PaloAlto, CA, USA), equipped with a 15 MHz probe. TheM-mode cursor was positioned perpendicular to the an-terior wall in order to measure interventricular septalthickness (IVS), left ventricular end-diastolic andend-systolic diameters (LVDD and LVDS, respective-ly) at the level of the papillary muscles below the mitralvalve tip, and LV ejection fraction (EF) and fractionalshortening (FS) were calculated.

BUN, SCr, urinary protein and albuminconcentrations determinationAfter decapitation, trunk blood was collected intochilled tubes and processed for measurements of plas-ma BUN and SCr (Nanjing jiancheng company, Nan-jing, China). The urinary excretion rate of protein andalbumin concentration was measured using ELISA kit(Exocell Inc., Philadelphia, PA, USA) from a one daytimed urine collection on 8 weeks after surgery.

SOD, MDA and ROS determinationCoomassie brilliant blue method17 was used for the de-termination of protein content, using the xanthine oxi-dation method18 and thiobarbituric acid (TAB, Sig-ma-Aldrich, St. Louis, MO, USA) to determine the ac-tivity of Superoxide dismutase (SOD) and the contentsof malondiadehyde (MDA) and ROS according to kitsinstructions (Nanjing jiancheng company, Nanjing,China).

Renal pathological changesThe animals were killed by decapitation, followed byimmediate organ collection for histologic analysis.Fresh kidney sections were fixed in 10% buffered for-malin (Sigma-Aldrich, St. Louis, MO, USA) and em-bedded in paraffin (Sigma-Aldrich, St. Louis, MO,USA), 4 μm sections were stained with hematoxy-lin-eosin (HE) and azo-carmine G and aniline blue

307



(AZAN) staining by light microscopy. A pathologistblind to group assignments analyzed the samples anddetermined the levels of injury.

TGF-β, CTGF, COLⅠand COLⅢ expression inkidney tissuesThe mRNA expression of glyceraldehydes-3-phosphate-dehydrogenase (GAPDH), transforming growth fac-tor-β (TGF-β), connective tissue growth factor (CT-GF), collagen Ⅰ (COLⅠ) and collagen Ⅲ (COLⅢ)were analyzed by real-time reverse transcription–poly-merase chain reaction using a Light Cycler Fast StartDNA Master SYBR Green I kit (Applied Biosystems,Foster City, CA, USA). The primer sequences are as fol-lows: 5′ GCTGCTGACCCCCACTGATA and 3′ACAAGAGCAGTGAGCGCTGAA for TGFβ; 5′AT-GCCACCAAAGTGAGAACGTT and 3'CTCACCT-CAGTGTGCGTTCTG for CTGF; 5′GGCGGCCAGGGCTCCGACCC and 3′ AATTCCTGGTCT-GGGGCACC for COLⅠ; 5′TGGTGTTGGAGCC-GCTGCCA and 3′ CTCA GCACTA GAA TCT-GTCC for COL Ⅲ; 5′ ATCATCAGCAAT-GCCTCCTG and 3′ CCCTCCGACGCCTGCTTfor GAPDH. All data were expressed as the relative dif-ferences after normalization to GAPDH expression.

TGF-β1, phospho-Smad2/3, COL1A1 and COL3A1expression in kidney tissuesAfter decapitation, renal tissue samples were lysed andprotein concentrations were determined. Equalamount of protein from tissue homogenates was sepa-rated on SDS-PAGE gels and transferred to nitrocellu-lose membranes, membrane was incubated with prima-ry antibodies against TGF-β1, phospho-Smad2/3,COL1A1,COL3A1 (Cell Signaling Technology, Bever-ly, MA,USA) overnight. And then incubated withHRP-conjugated secondary antibody (Cell SignalingTechnology), for 1 h and visualized with enhanced che-miluminescence system (ECL kit, Amersham Pharma-cia, Little Chalfont, Buckinghamshire, UK). Mem-branes then were re-probed with an antibody againstSmad2/3 and actin (Cell Signaling Technology) as anindicator for equal loading of samples. Western blot-ting data and density of blots were quantified by densi-tometric analysis using National Institutes of Health

(NIH) image software (NIH, Bethesda, MD, USA).

Statistical analysisAll data were analyzed using SPSS 13.0 software (SPSSStatistics, Chicago, IL, USA). Data are expressed asmean ± standard deviation ( x̄ ± s). When P < 0.05,the difference was considered to be statistically signifi-cant. Multiple comparisons between the experimentalgroups were performed by one-way analysis of variancewith a Tukey post hoc test.

RESULTS

General state and cardiac function changes in eachgroupEight weeks after surgery, all animals in the shamgroup were alive and generally in good condition. Inthe MI group, three died because of severe heart fail-ure, the remaining mice were varying degrees of short-ness of breath, wheezing, eating and activity reduction.Mice in the SM group also have a slight eating, re-duced activity situation. The mice in the MI and SMgroups showed anatomical visible left ventricular cham-ber and liver enlargement, lung congestion, pleural ef-fusion and ascites. Transthoracic echocardiography re-sults shown that cardiac infarction lead to LV enlarge-ment and systolic dysfunction versus sham operatedmice (P < 0.05). When compared with the MI mice,mice in the SM group had less LV enlargement (mea-sured as LVDD and LVDS) and less LV systolic dys-function (measured as EF and FS), MI also increasedSBP, while in the SM group decreased (Table 1). Ourdata showed that the MI model documented the typi-cal hemodynamic changes of chronic heart failure.

Renal injury and renal insufficiency in each groupParameters of serum SCr and BUN could be used todisplay the renal function in the renal disease. Eightweeks after MI experimental model establishing, thelevels of SCr [(54.0 ± 8.7) μmol/L] and BUN [(20.9 ±4.4) mmol/L] in MI group were higher than those ofthe sham group for SCr [(49.6 ± 6.8) μmol/L] andBUN [(18.4 ± 4.9) mmol/L] respectively (both P >0.05). Treatment with Danshen slightly decreased thelevels of SCr [(52.6 ± 9.1) μmol/L] and BUN [(19.9 ±

Group

Sham

MI

SM

n

11

11

11

HR (times/min)

602.50±11.30

598.70±12.70

608.20±14.50

SBP (mm Hg)

100.30±1.70

119.10±2.30a

99.90±2.90b

IVS (mm)

0.95±0.02

0.92±0.01

0.90±0.01

LVDD (mm)

3.29±0.42

4.23±0.55a

3.91±0.53a

LVDS (mm)

1.68±0.31

3.59±0.52a

2.99±0.68a

FS (%)

42.31±5.09

19.65±3.42a

29.87±3.52a

EF (%)

88.91±6.42

59.16±4.73a

69.55±5.23a

Table 1 HR, SBP and echocardiography parameters of mice ( x̄ ± s)

Notes: sham: sham surgery group; MI: myocardial infarction group; SM: Danshen (Radix Salviae Miltiorrhizae) treatment group. TheDanshen (Radix Salviae Miltiorrhizae) treatment group were treated with 0.2 mL Danshen (Radix Salviae Miltiorrhizae) injection (each 10mL vial contains active components equivalent to 15 g of the original medicine) intraperitoneally for 8 weeks. The sham group and myo-cardial infarction group were treated with 0.2 mL saline injection intraperitoneally for 8 weeks. HR: heart rate; SBP: systolic blood pres-sure; IVS: interventricular septum; LVDD: left ventricular end-diastolic diameter; LVDS: left ventricular end-systolic diameter; FS: frac-tional shortening; EF: ejection fraction. aP < 0.05, vs sham group;bP < 0.05, vs MI group.

308



8.5) mmol/L] compared with those of MI group, butnot significantly (both P > 0.05). The 24 h urinary pro-tein excretion was increased 8 weeks after MI model es-tablishing from [(25.5 ± 0.7) mg/24 h] and Urinary al-bumin [(17.7 ± 0.9) μg/24 h] to [(31.4 ± 0.9) mg/24 h]and [(20.3 ± 5.4) μg/24 h]. Treatment with Danshencould decrease the 24 h urinary protein excretion levelto [(29.3 ± 0.8) mg/24 h] and Urinary albumin [(18.9± 3.5) μg/24 h], however, the data had no statisticalsignificance (both P > 0.05). These data displayed thetendency of worsened renal function after MI, al-though they had no statistical significance.

Renal pathological changes in each groupIn the sham group, HE staining showed normal glo-merular and tubular structures, renal tubular epithelialcells arranged in neat rows and the stroma had no in-flammatory cell infiltration. While in the MI group,glomerular mesangial and tubular lumen expansionand irregular thickening of the basement membranewere observed, renal interstitial AZAN positive stain-ing was significantly increased. These changes were sig-nificantly reduced in the SM group (Figure 1).

Oxidative stress in the kidneyMDA and ROS are markers of oxidative stress, wefound that MDA and ROS values were significantly in-crease after MI from (0.49 ± 0.09) to (1.89 ± 0.20)nmol/mg protein and (88.32 ± 8.66) to (158.57 ±18.65) μmol/mg protein respectively (both P < 0.05).SM administration significantly decreased MDA andROS content to (1.53 ± 0.16) nmol/mg protein and(101.58 ± 9.84) μmol/mg protein respectively (bothP < 0.05). SOD were investigated as the evaluation in-dices of anti-oxidant enzyme activity. The SOD levelin the MI group [(199 ± 19) unit/mg protein] were sig-nificantly lower than that of control group [(249 ± 28)unit/mg protein] (P < 0.05). With the treatment of

SM for 8 weeks, the levels of SOD [(225 ± 17) unit /mg protein] were increased (P < 0.05). These data dis-played the oxidative stress after MI, and SM treatmentrepresented favorable protection.

Fibrosis in kidneyThe overproduction of interstitial matrix componentssuch as type Ⅰ and type Ⅲ collagen is thought to bethe most important event in renal fibrosis. To investi-gate the fibrosis in kidney, we examined TGF-β, CT-GF, COLⅠ and COLⅢ mRNA expression in the kid-ney (Table 5). There were significantly increase inTGF-β (1.49 ± 0.19) fold, CTGF (2.11 ± 0.10) fold,COLⅠ (1.65 ± 0.11) fold and COLⅢ (1.47 ± 0.07)fold expression in MI group compared with SHAMgroup (P < 0.05). SM administration significantly de-creased them (P < 0.05). To further investigate the sig-nal pathway involved in the process of kidney fibrosisafter MI, we examined TGF-β1, phospho-Smad 2/3,COL1A1 and COL3A1 expression in kidney tissues bywestern blotting. The results showed that MI increasedTGF-β1, phospho-Smad 2/3, COL1A1 and COL3A1expression, while SM administration significantly de-creased them (P < 0.05). Our data indicated thatTGF-β/Smad pathway may be related with the devel-opment of renal fibrosis in MI mice, and the anti-fibro-sis effect of SM maybe due to the inhibition of TGF-β/Smad pathway activation (Figure 2).

DISCUSSIONReduced cardiac mass after MI commonly leads to con-gestive heart failure in humans and in experimental ani-mal models.19 In patients with congestive heart failure,renal perfusion and function are often compromised,which called cardiorenal syndrome.20,21 Cardiac and re-nal dysfunctions often occur simultaneously because

FD E

A B C

Figure 1 Renal pathological changes of kidney sections in each group with HE and AZAN staining (× 200)A, D: sham surgery group; B, E: myocardial infarction group; C, F: Danshen (Radix Salviae Miltiorrhizae) treatment group. A-C: HEstaining; D-F: AZAN staining. The Danshen (Radix Salviae Miltiorrhizae) treatment group were treated with 0.2 mL Danshen (RadixSalviae Miltiorrhizae) injection (each 10 mL vial contains active components equivalent to 15 g of the original medicine) intraperi-toneally for 8 weeks. The sham and myocardial infarction groups were treated with 0.2 mL saline injection intraperitoneally for 8weeks. HE: hematoxylin-eosin; AZAN: azo-carmine G and aniline blue.

309



they share causes and pathogenetic mechanisms. Thereis a close association between renal and cardiac func-tion in both acute and chronic diseaseCardiovasculardisease causes over 50% of deaths in patients with re-nal failure while poor renal function increases mortali-ty in patients with heart failure.22 Traditionally, renalimpairment has been attributed to the renal hypoperfu-sion due to reduced cardiac output and decreased sys-temic pressure. The hypovolemia leads to sympatheticactivity, increased renin-angiotensin-aldosterone path-ways and arginine-vasopressin release. In addition, oxi-dative stress are considered the main determinants ofboth cardiac and renal dysfunction.23

Oxidative injury may contribute to the final pathwayof organ dysfunction. It is accepted that the produc-tion of oxygen-derived radical species constitutes oneof the major events involved in the initiation, mainte-nance and reversibility of functional alterations associ-ated with ischemia injury.24, 25 It is known that myocar-dial ischemia changes blood pressure.26 This situationmay causes damage in the highly perfusing organs suchas kidneys. Healthy kidneys consume relatively largeamounts of oxygen, accounting for approximately 10%of total oxygen consumption by the body; thus, aber-rant generation of ROS occurs prominently in the kid-ney. In health, ROS generated by the kidneys are me-tabolized by adaptive scavenger mechanisms. However,in endogenous or exogenous renal injury, excessivelyproduced ROS may cause acute or progressive renaldamage.27 In this study we measured the activity of

SOD and the contents of MDA and ROS in the kid-ney, which represented the oxidative injury of the or-gan, and found that there were significantly increase inMDA and ROS values and decrease in SOD activity af-ter MI.The model of coronary ligation in mouse was selectedsince previous studies have documented the typical he-modynamic changes of chronic heart failure,28 In thepresent study, the left coronary artery of mice was oc-cluded for 8 weeks, and the mice heart showed signifi-cantly left ventricular enlargement and systolic dysfunc-tion, accompanied with renal function presented asslightly increased plasma BUN, SCr and urinary excre-tion rate of protein and albumin concentration withno statistical significance. AZAN staining resultsshowed glomerular fibrosis accompanied with in-creased renal TGFβ,CTGF, phospho Smad2/3, COLⅠ and COLⅢ expression, which were consistent withprevious studies.SM in the experiment, as an old Chinese herb, wasshown to be valuable for many kinds of disease previ-ously. All these research reveal that SM play a role inthe treatment of some kind of disease by its prope rtiessuch as protect endothelial cells and prevent lipid per-oxidation and calcium overload. SM were used in themanagement of humans and experimental animalswith renal failure.29 In our study, we used the animalmodel to mimic the cardiorenal syndrome in humansboth biochemically and morphologically. The charac-teristic histological features of our models were find-ings of swelling and necrosis of proximal or distal tu-bules and edema of connective tissue in renal intersti-tium. And the model also shown an increase in the se-rum concentration of creatinine and BUN. In thestudy, we are able to show a significant recovery ofmental state and progressive decrease of serum creati-nine and BUN after SM administration. We have alsoobserved that SM attenuated the histologic severity ofkidney. So we can speculate on the mechanism underly-ing the protective effect of SM on experimental MI in-duced renal failure. It can improve the renal functionand prevent the oxidative stress in kidney tissue. How-ever, there is still a great need for more and better re-search on the efficacy and safety of SM. Although it isdifficult to extrapolate animal data to humans, we rec-ommend SM as a beneficial treatment for MI inducedrenal failure.

REFERENCES1 Wang L, Shi J, Zhang Y. Influences of simvastatin on vas-

cular endothelial function of patients with coronary heartdisease complicated with congestive heart failure. Eur RevMed Pharmacol Sci 2013; 17(12): 1590-1593.

2 Hayashi H, Fukuma N, Kato K, Kato Y, Takahashi H,Mizuno K. Clinical backgrounds and the time course ofsleep-disordered breathing in patients after myocardial in-farction. J Nippon Med Sch 2013; 80(3): 192-199.

Figure 2 TGF-β1, phospho-Smad2/3, COL1A1 and COL3A1expression in kidney tissues by western blottingThe Danshen (Radix Salviae Miltiorrhizae) treatment groupwere treated with 0.2 mL Danshen (Radix Salviae Miltiorrhi-zae) injection (each 10 mL vial contains active componentsequivalent to 15 g of the original medicine) intraperitoneal-ly for 8 weeks. The sham group and myocardial infarctiongroup were treated with 0.2 mL saline injection intraperito-neally for 8 weeks. MI: myocardial infarction; SM: Danshen(Salvia Miltiorrhiza); TGF-β1: transforming growth factor-β.

TGF-β1

phospho-Smad2/3

Smad2/3

COL1A1

COL3A1

actin

kDa

25

52/60

52/60

210

140

43

310



3 Longhini C, Molino C, Fabbian F. Cardiorenal syn-drome: still not a defined entity. Clin Exp Nephrol 2010;14(1): 12-21.

4 Ronco C, Kaushik M, Valle R, Aspromonte N, PeacockWF. Diagnosis and management of fluid overload in heartfailure and cardio-renal syndrome: the "5B" approach.Semin Nephrol 2012; 32(1): 129-141.

5 Ronco C, Grammaticopoulos S, Rosner M, et al. Oligu-ria, creatinine and other biomarkers of acute kidney inju-ry. Contrib Nephrol 2010; 164: 118-127.

6 Ni JX, Gao SH. Understanding the viscera-related theorythat the lung and large intestine are exterior-interiorly re-lated. J Tradit Chin Med 2012; 32(2): 293-298.

7 Zheng LW, Hua H, Cheung LK. Traditional ChineseMedicine and oral diseases: today and tomorrow. Oral Dis2011; 17(1): 7-12.

8 Han JY, Fan JY, Horie Y, et al. Ameliorating effects ofcompounds derived from Danshen (Salvia Miltiorrhiza)root extract on microcirculatory disturbance and target or-gan injury by ischemia and reperfusion. Pharmacol Ther2008; 117(2): 280-295.

9 Yu J, Fei J, Azad J, Gong M, Lan Y, Chen G. Myocardialprotection by Danshen (Salvia Miltiorrhiza) injection instreptozotoc-ininduced diabetic rats through attenuationof expression of thrombospondin-1 and transforminggrowth factor-β1. J Int Med Res 2012; 40(3):1016-1024.

10 Zhao Y, Yin Y, Lü XJ, et al. Effects of Radix Salviae Milt-iorrhizae on the PMN-EC adhesion in vitro at the earlystage of endotoxemia. Sichuan Da Xue Xue Bao Yi XueBan 2004; 35(3): 320-322, 346.

11 Xia Z, Gu J, Ansley DM, Xia F, Yu J. Antioxidant therapywith Danshen (Salvia Miltiorrhiza) decreases plasma endo-thelin-1 and thromboxane B2 after cardiopulmonary by-pass in patients with congenital heart disease. J ThoracCardiovasc Surg 2003; 126(5): 1404-1410.

12 Chen S, Liu XM. Effect of Danshen (Salvia Miltiorrhiza)injection on hyperpolarization-activated current channelsin dorsal root ganglion neurons of rats. Yao Xue Xue Bao2006; 41(11): 1038-1043.

13 You Z, Xin Y, Liu Y, et al. Protective effect of Danshen(Salvia Miltiorrhiza) injection on N(G)-nitro-D-arginineinduced nitric oxide deficient and oxidative damage in ratkidney. Exp Toxicol Pathol 2012; 64(5): 453-458.

14 Ling Z, Xiping Z, Fengmei Q, Ping Y, Qihui C. Protec-tive effects of Danshen (Salvia Miltiorrhiza) on multipleorgans of rats with obstructive jaundice. Mediators In-flamm 2009; 2009: 602935.

15 Ngai HH, Sit WH, Wan JM. The nephroprotective ef-fects of the herbal medicine preparation, WH30+, on thechemical-induced acute and chronic renal failure in rats.Am J Chin Med 2005; 33(3): 491-500.

16 Watari K, Nakaya M, Nishida M, Kim KM, Kurose H.β-arrestin2 in infiltrated macrophages inhibits excessive in-flammation after myocardial infarction. PLoS One 2013; 8(7): e68351.

17 Brunelle JL, Green R. Coomassie blue staining. MethodsEnzymol 2014; 541: 161-167.

18 Wang W, Jiang HM, Li WR, Zuo L, Tao L, Yu X. Effectsof low-dose insulin on oxidation-reduction in rat organs af-ter major burns. Zhong Hua Yi Xue Za Zhi 2013; 93(42):3394-3397.

19 Venugopal J, Rajeswari R, Shayanti M, et al. Xylan poly-saccharides fabricated into nanofibrous substrate for myo-cardial infarction. Mater Sci Eng C Mater Biol Appl 2013;33(3): 1325-1331.

20 Bagshaw SM, Cruz DN, Aspromonte N, et al. Epidemiol-ogy of cardio-renal syndromes: workgroup statementsfrom the 7th ADQI Consensus Conference. Nephrol DialTransplant 2010; 25(5): 1406-1416.

21 Shah BN, Greaves K. The cardiorenal syndrome: a review.Int J Nephrol 2010; 2011: 920195.

22 Coresh J, Astor BC, Greene T, Eknoyan G, Levey AS.Prevalence of chronic kidney disease and decreased kidneyfunction in the adult US population: Third NationalHealth and Nutrition Examination Survey. Am J KidneyDis 2003; 41(1): 1-12.

23 Ritz E. Heart and kidney: fatal twins? Am J Med 2006;119(5 Suppl 1): S31-S39.

24 Raedschelders K, Ansley DM, Chen DD. The cellularand molecular origin of reactive oxygen species generationduring myocardial ischemia and reperfusion. PharmacolTher 2012; 133(2): 230-255.

25 Peglow S, Toledo AH, Anaya-Prado R, Lopez-Neblina F,Toledo-Pereyra LH. Allopurinol and xanthine oxidase inhi-bition in liver ischemia reperfusion. J Hepatobiliary Pan-creat Sci 2011; 18(2): 137-146.

26 Selimoglu O, Basaran M, Ozcan H, et al. A practical andeffective approach for the prevention of ischemia-reperfu-sion injury after acute myocardial infarction: pressure-regu-lated tepid blood reperfusion. Heart Surg Forum 2007; 10(4): E309-E314.

27 Rodrigo R, Gonzalez J, Paoletto F. The role of oxidativestress in the pathophysiology of hypertension. HypertensRes 2011; 34(4): 431-440.

28 Maki T, Nasa Y, Tanonaka K, Takahashi M, Takeo S. Ben-eficial effects of sampatrilat, a novel vasopeptidase inhibi-tor, on cardiac remodeling and function of rats with chron-ic heart failure following left coronary artery ligation. JPharmacol Exp Ther 2003; 305(1): 97-105.

29 Ngai HH, Sit WH, Wan JM. The nephroprotective ef-fects of the herbal medicine preparation, WH30+, on thechemical-induced acute and chronic renal failure in rats.Am J Chin Med 2005; 33(3): 491-500.

311

danshen (radix salviae miltiorrhizae) reverses renal ... · treat kidney damage through protecting...

Documents