7. molecular identification of alternaria alternata based...

7. MOLECULAR IDENTIFICATION OF ALTERNARIA ALTERNATA

BASED ON RIBOSOMAL DNA (ITS) SEQUENCES AND

PHYLOGENETIC ANALYSIS

7.1. Introduction

Taxonomy is an essential discipline of the biological sciences simply

because it provides a frame work for the scientific community to facilitate

understanding and knowledge exchange (Rossello-Mora, 2005). The identification

of fungi involving biochemical and temperature testing, as well as observance of

their microscopic morphology using standard mycological manuals, which always

had an limitations. A major criticism of this approach is that it depends heavily

upon highly skilled laboratory personnel with training that is not readily available

in many laboratories. In addition, a significant number of fungi are not able to be

properly identified using these methodologies, mainly because they do not

sporulate in most of the commonly used fungal media (Davis, 2010). Most studies

on fungal strains and populations focused on phenotypic differences in

morphology, physiology and mating. However, these phenotypic features are often

difficult to observe, quantify, standardize, and or analyze.

In the last two decades, tremendous growth in the development and

application of molecular methods in the analyses of fungal species and

populations. Molecular methods are faster, more sensitive, more stable and less

dependent on external factors than morphological methods (Graser et al., 1998;

Faggi et al., 2001; Kim et al., 2001). The characterization of fungal DNA has been

employed to detect and differentiate fungi (Gil-Lamaignere et al., 2003).

Molecular approaches have been developed for the assessment of microbial

Molecular Identification Of Alternaria alternata

170

diversity in complex communities as well (Gonzalez and Saiz-Jimenez, 2005).

Methods based on DNA analysis can reveal fungal diversity in ecosystems, and

offer the potential benefits of highly sensitive and rapid detection (Saad et al.,

2004). The Internal Transcribed Spacer (ITS) region of the nuclear ribosomal

repeat unit has become the primary genetic marker for molecular identification and

other species-level pursuits in many groups of fungi (Seifert, 2009). The

identification of fungi to species level has been based mostly on the use of variable

ribosomal-DNA (rDNA) internally transcribed spacer (ITS) regions. The non-

coding ITS region consisting of ITS1, the 5.8S rDNA and ITS2, should produce a

highly sensitive assay as the target sequence for amplification, because of its high

copy number in the fungal genome as part of tandemly repeated nuclear rDNA.

However, this is one of the most frequently sequenced regions, ITS sequences

from well-identified fruiting bodies are estimated to be available for <1% of the

hypothesized number of fungal species (Nilsson et al., 2005). These ITS regions

benefit from a fast rate of evolution, which results in higher variation in sequence

between closely related species, in comparison with the more conserved coding

regions of the rRNA genes. As a consequence, the DNA sequences in the ITS

region generally provide greater taxonomic resolution than those from coding

regions (Lord et al., 2002; Anderson et al., 2003). Additionally, the DNA

sequences in the ITS region are highly variable and might serve as markers for

taxonomically more distant groups. The International Nucleotide Sequence

Database (INSD: GenBank, European Molecular Biology Laboratory (EMBL), and

DNA Database of Japan (DDBJ)) are the major open repository for sequenced data

(Benson et al., 2008).


171

For phylogenetic analysis, among species or higher taxonomic levels, the

most common genes to be sequenced and compared reside in the ribosomal RNA

(rRNA) gene cluster, including the internal transcribed spacer (ITS) regions ITS1

and 2, the intergenic spacer IGS, 5.8S rRNA, 18S rRNA, and 26S rRNA genes.

This is because these multi-copy genes are high conserved within a species but can

be quite variable among the species.

The genus Alternaria was established in 1817 with A. alternata (originally

A. tenuis) as the type isolate. In classic approaches, Alternaria alternata were

identified based on morphological characters according to descriptions of Simmons

(1995) and Ellis (1971). The absence of an identified sexual stage for the vast

majority of Alternaria species, this genus was classified into the division of

mitosporic fungi or the phylum Fungi Imperfecti. The classical key taxonomic

feature of the genus Alternaria is the production of large, multicellular, dark-

colored (melanized) conidia with longitudinal as well as transverse septa

(phaeodictyospores). These conidia are broadest near the base and gradually taper

to an elongated beak, providing a club-like appearance. They are produced in

single or branched chains on short with erect conidiophores. Alternaria forms

conidia that arise as protrusions of the protoplast through pores in the conidiophore

cell wall. At the onset of conidial development, apex of the conidiophore thickens

and a ring-shaped electron-transparent structure is deposited at the apical dome.

Identification of some Alternaria species still offers considerable difficulties owing

to their high variability and the polymorphism occurring even in pure culture.

Conidia from Alternaria fungi whose show the same size range could be sorted

into different taxa on the basis of the three-dimensional sporulation patterns. The


172

conidial features distinguish Alternaria from the closely related genera

Ulocladium, Stemphylium, Embellisia and Nimbya. The difficulty to distinguish

between species or even isolates is demonstrated by the presence of nearly one

thousand published species designations of Alternaria (Simmons, 1992).

Over 100 species occurring worldwide have been described. However,

errors in the taxonomy of Alternaria species have arisen due to the variability of its

morphological characters, which are not only affected by intrinsic factors but also

by environmental conditions. The molecular taxonomy of the genus Alternaria has

been recently reviewed and hypothetically, the difficulties in taxonomic

classification of species within the genus Alternaria are partly due to the lack of

sexual stages (Yu, 1992).

Hence, this chapter focuses the ITS regions of ribosomal DNA construction

that can be used to identify Alternaria sp. Further, comparisons of these isolates

with those representing known phylogenetic groups that are previously

characterized in this species complex were also attempted.


173

7.2. Materials and Methods

7.2.1. Requirements

DNA isolation reagent (SoluteReady® Genomic DNA purification kit)

PCR Master Mix

Agarose gel electrophoresis

Primers (HELINI Biomolecules, Chennai).

7.2.1.1. DNA extraction and purification buffers

Liquid Nitrogen

Tris, EDTA

100 μL lysozyme

Proteinase K

5 M NaCl

5 ml chloroform

10% SDS

PT Buffer: isopropanol mix

Wash buffer: 70% ethanol

TE Buffer: Tris and EDTA

7.2.1.2. PCR Master Mix

Taq DNA polymerase

10X Taq reaction buffer

0.2 mM dNTPs mix and PCR additives.

7.2.1.3. Agarose gel electrophoresis

0.7 % Agarose

50X TAE buffer


174

6X gel loading buffer

Ethidium bromide.

7.2.2. DNA extraction

Genomic DNA of the fungal culture was extracted by using the salting out

method (Neumann et al., 1992). 5 g of fungal mycelia was ground into a powder

using liquid nitrogen and suspended in 5 ml buffer containing 75 mM NaCl,

25 mM EDTA (pH 8.0) and 20 mM Tris (pH 7.5). 100 μl lysozyme (final

concentration-1 mg/ ml) was added to the above solution and incubated at 37ºC for

60 min. 140 μl of proteinase K (final conc. 0.5 mg/ ml) and 600 μl of 10% SDS

were added and incubated for 2 hrs at 55ºC with occasional mixing. 2 ml of 5 M

NaCl (final concentration 1.25 M) was added and the mixture was cooled to 37ºC.

5 ml chloroform was added and mixed for about 30 min at room temperature and

then the mixture was centrifuged for 20 min at 4,500 rpm. The supernatant was

transferred into a fresh tube and to it 0.6 μl of Isopropanol was added to precipitate

the DNA. The DNA was pelleted and washed twice with 70% ethanol, air dried

and dissolved in 100-200 μl of TE buffer (10 mM Tris, 1 mM EDTA, pH 8.0) at

55ºC. The quality of the isolated DNA was checked on a 0.7% agarose gel stained

with ethidium bromide.

7.2.3. PCR amplification of ITS regions and 18S rDNA

18S rDNA and ITS regions from the fungal strain were amplified using

PCR with a final reaction mixture volume of 15 μl containing 0.4 μl fungal DNA

solution (40 ng), 1.5 μl 10X buffer, 4 μl (0.2 mM) dNTPs, 1 μl (1 μM) each of the

universal eukaryotic primers (forward primer) ITS1-

TCCGTAGGTGAACCTGCGG, (reverse) ITS2- TCCTCCGCTTATTGATATGC.


175

Thermocycling parameters were: Initial denaturation at 94ºC for 3 min, 30

cycles: Denaturation (94ºC/ 1 min); annealing (58ºC/1 min); final extension was at

72ºC for 10 min. The resulting PCR products were analyzed on 1% agarose gel

containing ethidium bromide. PCR fragments were eluted from gel with the help

of gel elution kit. DNA sequence was carried out using genetic analyzer (Applied

biosynthesis, USA).

7.2.4. DNA sequencing and phylogenetic tree construction

DNA sequencing of PCR products was done by the dideoxynucleotide

chain termination method (Sanger et al., 1977). The rDNA homology searches

were performed using the BLAST program through the internet server at the

National Center for Biotechnology Information (National Institutes of Health,

Bethesda, USA). Sequences and accession numbers for compared isolates were

retrieved from the GenBank database. Sequence pair distances among related and

different fungi of the isolate were scored with the Clustal X program and

phylogenetic tree analysis was performed with the MEGA-5 (Tamura et al., 1994)

software package (DNASTAR, Inc., Madison, USA). The evolutionary history

inferred using the neighbor joining method (Saitou and Nei, 1987) was carried out.


176

7.3. Results

The sequenced rDNA region of Alternaria alternata (Accession no:

KC906251) covered the internal transcribed spacer1, partial sequence; 5.8S

ribosomal RNA gene and ITS2, complete sequences; and 28S ribosomal RNA

gene, partial sequence (Table 18). The evolutionary history inferred using the

neighbor joining method (Saitou and Nei, 1987) and the combined data from all

isolates of the Alternata species-group were analyzed to produce a dendrogram

was shown in Figure 59. Stages of Alternaria alternata were shown in the

photoplate 9.

Table 18. ITS rDNA sequence of Alternaria alternata

Species name ITS rDNA sequence

Alternaria alternata

strain

HEPRA.KALAI

Genbank accession

number

(KC906251)

5´CTCGGGGTTACAGCCTTGCTGAATTATTCACCCTTGTCTTTTGC

GTACTTCTTGTTTCCTTGGTGGGTTCGCCCACCACTAGGACAAAC

ATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAAATTAATA

ATTACAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAA

GAACGCAGCGAAATGCGATAAGTAGTGTGAATTGCAGAATTCA

GTGAATCATCGAATCTTTGAACGCACATTGCGCCCTTTGGTATTC

CAAAGGGCATGCCTGTTCGAGCGTCATTTGTACCCTCAAGCTTTG

CTTGGTGTTGGGCGTCTTGTCTCTAGCTTTGCTGGAGACTCGCCT

TAAAGTAATTGGCAGCCGGCCTACTGGTTTCGGAGCGCAGCACA

AGTCGCACTCTCTATCAGCCAAGGTCTAGCATCCATTAAGCCTTT

TTTCAACTTTTGACCTCGGATCAGGTAGGGATACCCGCTGAACTT

AAGCATATCATA 3´


177

BLAST search for similarities using Alternaria sp identification showed

that the percentage of similarity of the isolates ranged from 97%-99%. Therefore,

the species name assigned was according to the closest BLAST search. In the

constructed phylogenetic tree, the strains A. alternata (HQ014678), A. alternata

(JF746168), A. alternata (EF471931) and A. arborescencs (JF802119) were 98%

of similarities with A. alternata (KC906251). Exact match or 99% similarity with

isolates in A. alternata identification database found to be A. alternata (JF802094)

and A. tenuissima (JF802120). The isolates of Rhizoctonia bataticola (HQ392798)

formed a distinct clade that was clearly separated from the other isolates of

Alternaria in the neighbor-joining tree.

Fig. 59. Dendrogram showing relationships among 18 isolates of

Alternaria sp.


178

7.4. Discussion

Most extremophiles are difficult to culture under laboratory condition.

They contain genetic materials which could code for secondary metabolites that are

medicinally useful. Many fungal strains produce enzyme that have found

applications in the biodegradation of chemical warfare agents (Mulbry and

Rainina, 1999). Identification of such proficient fungi was consider as always a

risk task, thus rDNA-ITS have an unique potential for providing information about

an organisms.

DNA sequencing has greatly enhanced the ability to accurate and

reproducibly identifies the fungi. Fungal taxonomists have been using DNA

sequences for many years as a basis for the re-classification of all fungal taxa and

have more recently moved to ITS sequencing as the “Gold Standard” (Hall et al.,

2003). In this present investigation, the ITS region of halotolerant fungus was

sequenced and resulted the strain was identified as Alternaria alternata.

Kusaba and Tsuge (1995) reported that the species of Alternaria, which had

been distinguished morphologically, were clearly separated from one another on

the basis of variation in ITS of rDNA. In this study, Alternaria alternata showed

97-99% similarity with existing Alternaria species from different environments.

Further, this was highly harmony with Sharma et al. (2013) assessed the genomic

regions of 17 Alternaria sp. showing 99% - 100% sequence identity with

Alternaria alternata. Peever et al. (2002) reported that 26 genotypes were found in

sixty six A. alternata isolates sampled from citrus brown spot lesions using RAPD

markers. Adachi et al. (1993) stated low genetic variation of an A. alternata


179

population was observed, i.e. eight rDNA variants in 271 isolates based on RFLP

analysis.

In this study, the Alternaria alternata strain of HEPRA.KALAI (KC906251)

showed the maximum similarity with the references ITS, and the accession number

notified as HQ014678, JF746168, EF471931 and JF802119. Guo et al. (2004)

reported the three unknown isolates of Alternaria species were sequenced, results

indicated the best match had high similarity with A. alternata with some reference

ITS sequences, AF455537, AF455441, AF397233, AF397242, and AY160211.

The sequenced strain of halotolerant fungi was named as Alternaria

alternata strain of HEPRA.KALAI and made publically available in Genbank with an

assigned accession number KC906251.

Molecular Identification of Alternaria alternata

7. molecular identification of alternaria alternata based...

Documents