INTRODUCTION

MATERIALSAND METHODSCollection of plant material:

Pathogen isolation:

Turmeric ( L.) is a perennial herbaceous plantbelonging to family which is well known asthe Golden spice or spice of life in the Vedic literature. Indiais a world's major producer of turmeric which is mostlycultivated inAndhra Pradesh followed by Maharashtra, TamilNadu, Orissa, Karnataka and Kerala (Velayudhan .,2012). It is one plant which has been in use since timesimmemorial because of its therapeutic relevance in thetreatment of some of the dreaded ailments including cancer,cardiovascular diseases, as hepatoprotectant, and ingastrointestinal disorders, etc

Turmeric is prone to several diseases like rhizome rot, leafblight and anthracnose (Kavitha ., 2012). Among these,leaf blight disease, which is caused by(Fr.) Keissler is an important foliar disease usually found inKarnataka in South India damaging this crop to a larger extentby size and weight reduction of the rhizome, therebyafftecting quality, quantity as well as marketability.Normally pathogen infections are the most significant stressstimuli that these plants encounter during their growth. Inresponse to such stress stimuli , certain specific pathogeninduced enzymes are produced in the host, which play a majorrole in the defense mechanism against the pathogens.

The typical symptoms of the disease under study include theformation of bright to pale yellow leaf spots on the uppersurface of leaf surrounded by green or yellow halo. Thedisease cycle is very simple and no teleomorph is reported sofar (Aveling ., 1994). Following infection the symptomsare reported to become apparent after 24 h which is followedby continued expansion of lesions resulting in the killing ofthe afftected portion by host selectiveACT-toxin (Allen .,1983). It has also been documented that for minor infectionto occur there is a requirement of leaf wetness by 4-8 hduration, however, for substantial infection to occur there is arequirement of 10-12h of wetness in the leaf (Caihos .,1997).

Various events of pathogenesis involving like

appressoria formation, penetration and conidia germinationin diverse hosts have been studied in detail (Aveling .,1994; McRoberts and Lennard, 1996). Most of the researchin this regard has been undertaken in susceptible hosts. Thehistopathological studies comparing the events ofpathogenesis in resistant and susceptible genotype and intissues with different ages are very scarce. The study of host-pathogen interaction involving and sicklepod( ) using light microscopy and scanningelectron microscopy has been undertaken by Van Dyke andTrigiano (1987). The pathogen and host plant interactioninduces certain changes in cell metabolism, primarily inenzyme activities.

So far not much information is available on the sporulation,germination of conidia, infection process byand the histopathological changes taking place on turmericleaves as a consequence of infection. So as to study theprocess of pre-penetration, penetration and infectionprocesses of on resistant and susceptiblegenotypes of turmeric using light and scanning electronmicroscopy analysis and to understand the role of defensiveenzymes in the induction of host resistance, the presentinvestigation was undertaken.

Turmeric samples werecollected from Puttunpura, Hangla Malliyaapura, andBasavanpura, Gundulpet Taluk; Hampapura from K.R.Nagar; Bogarahally from Hassan District; Paalya fromKollegal Taluk; Goravanahally from Maddur taluk ofKarnataka, India.

The pathogen isolation was done usingstandard blotter method and by growing on PDA. For thispurpose the sterilized Petri plates were furnished with 3 layersof sterile blotter discs so as to absorb moisture content fromthe infected leaf material. Typical spots werecut into 1-2 cm pieces and surface sterilized with 2% sodiumhypochlorite solution for 2 min. Later washed with doubledistilled water twice to remove sodium hypochlorite and the

Curcuma longaZingiberaceae

et al

.

et alAlternaria alternata

et al

et al

et al

Alternaria

et al

A. cassiaeCassia obtusifolia

A. alternata

A. alternata

Curcuma longa

KAVAKA54: 57-63 (2020)

K. S. Shilpashree and M. S. Sharada*

Role of defense enzymes in the induction of host resistance to leaf blight of turmeric (L.)

Curcumalonga

Department of Studies in Botany, University of Mysore, Manasagangotri, Mysore-570006, Karnataka, India*Corresponding author Email: shilpashreeks6@gmail.com(Submitted on February 15, 2020;Accepted on May 23, 2020)

ABSTRACTThe present study highlights the role of defense-related enzymes such as phenylalanine ammonia-lyase (PAL), peroxidase (POX) andpolyphenol oxidase (PPO) in inducing resistance in turmeric against fungal leaf blight pathogen (Fr.) Keissler designated asCL1 which was isolated from the infected leaf of L. and subsequently identified on the basis of morphological and molecularsequencing studies. The results of our study indicated that defense enzymes activity was maximum at 24 h for PAL, 12 h for POX and 48 h forPPO, respectively upon pathogen inoculation in resistant cultivar. The enzyme activity increased significantly (P<0.05) in resistant genotypeupon pathogen inoculation. Indeed, the increase in enzyme activities was not significant in case of susceptible genotypes. It is quite apparentfrom the study that in host-pathogen interaction, the initial infection process involved conidium germination followed by penetration throughstomata in both the genotypes. However, it was considerably slow in Hassan-8 genotype due to its resistant nature. The DNA sequence of thispathogenic CL1 has been submitted to NCBI GenBank under the accession number MN307311.

Keywords:

Alternaria alternataCurcuma longa

Alternaria alternata

Turmeric, leaf blight, phenylalanine ammonia-lyase, peroxidase, polyphenol oxidase,

57

.doi:10.36460/Kavaka/54/2020/57-63

samples were transferred aseptically to the Petri plates. Theinoculated plates were incubated for 1 week at 37 ºC with12/12 hour alternative light and dark periods. After 1 week ofincubation, the plates were observed for sporulation anddevelopment of the pathogen. The microscopic examinationwas carried out and culture characters noted.

For isolation of the PDA Petri plateswere inoculated with leaf samples and subsequentlyincubated at 28±2 ºC at an alternative period of 12/12 hourlight and dark periods for 1 week. After 1 week, the plateswere observed for the growth of the fungal pathogen. Thefungal colonies were observed on Petri plates and then sub-cultured on fresh PDAplates to obtain pure cultures.

The isolated pathogenwas tested for its capability to cause infection on 30 days oldturmeric seedlings under the greenhouse environment. Thesporangial suspension was used for this purpose. The conidiawere harvested from 7 days old fungal pathogen culture andthe suspension prepared (1x10 conidia/mL) and sprayed onturmeric leaf samples. The whole setup was then covered withplastic covers for 24 h. After 5 days, the inoculated plantsamples were observed for disease symptoms. Plants sprayedonly with sterile distilled water served as control.

The harvested turmeric leaf-samples (1 g each) at 0, 6, 12, 24, 48 and 72 h werehomogenized in 1 mLof ice-cold 25 mM Tris-buffer (pH 8.8),containing 250

Ls

L

L

Alternaria alternata

Treatment of pathogen with plant:

Estimation of PAL activity:

5

5

5

μL of β- mercaptoethanol. The obtainedextract was centrifuged at 10000 rpm for 30 min at 4 °C andsupernatant was used as an enzyme source.Areaction mixturecontaining 0.3 mL of enzyme extract was incubated with 1.2mL of 25 mM Tris–HCl buffer (pH 8.8) and 1.5 mL of 10 mML-phenylalanine in the same buffer for 2 h at 40 °C. Theactivity was stopped using 5 N HCl. PAL activity wasdetermined as the rate of conversion of L-phenylalanine totrans-cinnamic acid at 290 nm. Enzyme activity wasexpressed as μmol of trans-cinnamic acid/mg protein/h. Eachexperiment was repeated in triplicates (Dickerson .1984).

The harvested turmeric leaf-samples (1 g each) at the above mentioned time intervals werehomogenized in 1 mL of 10 mM potassium phosphate buffer(pH 6.9) in a pre-chilled Mortar and Pestle. The homogenatewas centrifuged at 12000 rpm for 20 min at 4° C to get thesupernatant and used as an enzyme source. POX activity wasdetermined according to the method described byHammerschmidt . (1982) with minor modifications. Thereaction mixture of 3 mL consisted of 0.25 % (v/v) guaiacol in10 mM potassium phosphate buffer (pH 6.9) containing 10mM hydrogen peroxide. 10 μL of crude enzyme extract wasadded to the reaction mixture to initiate the reaction whichwas recorded spectrophotometrically at 470 nm. The POXactivity was expressed as an increase in absorbance at 470nm/mg protein/min. Each experiment was repeated intriplicates.

The harvested turmeric leaf-samples (1 g each) were macerated in 100 mM potassiumphosphate buffer (pH 6.5). PPO activity was assayed

spectrophotometrically according to the method described byMayer (1965) with slight modifications. The standardreaction mixture consisted of 3 mL of 10 mM sublimatedcatechol in 100 mM potassium phosphate buffer (pH 6.5) and10 μLof enzyme extract. Change in absorbancewas recordedat 420 nm for 1 min. The results are expressed as the change in420 nm/min/mg protein. Each experiment was repeated intriplicates.

Estimation of protein content wasdetermined according to the method described by Lowry(1951), using BSA (Sigma) as the standard. The reactionmixture consists of 10 μLof sample and the volumewasmadeup to 1 m using distilled water. To the same solution, 1.5 mLolution C (50 mL of 0.2g NaOH, 1g Na2CO3, 0.01g sodium

tartarate+CuSO4, 0.02g in 5 mL water) was added and mixedwell and incubated at room temperature for 10 min. Later 250μL of Folin’s reagent was added to each tube and mixed. Thereaction mixture in the test tubes was again incubated at roomtemperature for 30 min and optical density (OD) was recordedat 660 nm. The blank solution contains 1.5 mL solutionC+250 μL Folin’s reagent. In another set of tubes containingBSA solution, 1.5 mL solution C+250 μL Folin’s reagentswere added and incubated. The standard curve was drawnagainst μg of BSA. From the standard curve, the amount ofprotein in the sample was determined and the protein/gram ofsample was calculated.

The conidia were harvested from 7days old culture of fungal pathogen and the conidialsuspension was adjusted (1×10 conidia/m ) using ahemocytometer. The surface-sterilized leaf-bits ofsusceptible and resistant turmeric leaves were dip-inoculatedwith the conidial suspension (1×10 conidia/m ) andincubated for different time intervals , 2, 4, 6, 8, 12 and 24h. The inoculated seedlings were removed from the conidialsuspension fixed in acetic alcohol (1:3) (v/v) and processedfurther for histological observations.

The fixed seedlings were partially macerated in3 % sodium hydroxide for 30 min at 60 ºC and washed withrunning water for 30 minutes to remove sodium hydroxide.The washed seedlings were transferred to 0.2 % (w/v), warmcotton blue and stained for 2 h.

The isolated fungalpathogen designated as CL1 was cultured in PDB medium for7 days at 28 °C and mycelium was harvested by vacuumfiltration. The chilled mycelia were grinded with pestle andmortar under liquid nitrogen and transferred into amicrocentrifuge tube with 1 mL of 2×CTAB extraction bufferand incubated at 65 °C for 30 min with gentle swirling. Aftercentrifugation at 10000 rpm for 8 min, the aqueous phase ofthe mixture containing total DNAwas extracted with an equalvolume phenol:chloroform:isoamyl alcohol (25:24:1).Residual phenol was removed by the addition ofchloroform:isoamyl alcohol (24:1) twice. 2 vol ethanol and0.1 volume 3 M sodium acetate was added to the aqueousphase of DNA to precipitate and incubated at -20 °C over-

et al

et al

et al

et al

viz

Estimation of POX activity:

Estimation of PPO activity:

Protein estimation:

Preparation of sample and inoculation for lightmicroscopic studies:

Preparation of plant materials for histologicalobservation:

Isolation of fungal genomic DNA:

58

night. DNA pellet was washed with 70 % ethanol andsuspended in 15 μL of TE buffer. The extracted DNAqualityin terms of integrity was detected in agarose gel (1 %)electrophoresis using ethidium bromide for the visualizationat UV light (Kim ., 2010).

ITS region of the fungus were amplifiedby ITS primers, ITS1 5’TCCGTAGGTGAACCTGCGG 3’)and ITS4 (5’ TCCTCCGCTTATTGATATGC 3’) (White

., 1990). The PCR amplification was carried out in 0.2 mLPCR tubes, using Master cycler personal (Eppendorf). ThePCR reactionmixture (50 μ ) contained 5 μL10×PCRbuffercontaining 15 mMMgCl , 5 μL 2 mM each deoxynucleosidetriphosphates (dNTPs), 2 μLof eachprimer (5 pmol/μL), 4 μLtemplate DNA, 2 μL (1 U/ mL) Taq polymerase anddeionosed water (30 μL). Thermal cycling conditions were asfollows: initial denaturation (4 min at 95 °C), followed by 30cycles of denaturation (94 °C for 50 s), annealing (51 °C for 1min), and primer extension (72 °C for 1 min), followed byfinal extension for 10 min at 72 °C. Amplification productswere electrophoretically resolved on 1.4% (w/v) agarose gelcontaining ethidium bromide (0.5 μg/ mL), using 1×TAEbuffer at 70 V(Bhagat ., 2012).

ITS sequencedata was annotated using Geneious 6.1. software andsubmitted to National Centre for Biotechnology Information(NCBI) GenBank. ITS rDNA sequences with maximumidentity to strain CL1 were retrieved from the NCBI databaseusing BLAST search tool. DNA sequences were filter-searched and the closest sequences were selected for thephylogenetic study. The multiple sequence alignments wereperformed using the Clustal Omega alignment programutilizing the default settings and a dendrogram was generatedusing MEGA 4.0 with a bootstrap consensus of 1000replicates.

Theinfected tissue segments of 10 mm from infectedand healthy turmeric leaves were collected and fixed informalin – propionic – proponaol (1:1:8) (FPP) for 1 h. Thetissue sections were dehydrated in gradient concentration (50% to 90 %) using isopropyl series later embedded in paraplastfollowed by softening by 1 % sodium lauryl sulfate for 48 h.The dried tissue sections were mounted on aluminum stubsusing double – stick tape which were previously sputter-coated (20 nm gold palladium) and visualized under scanningelectron microscope.

The isolated pathogen from the infectedleaf tissue of ( ) has been identified as

CL1 ( ) based on the symptoms,morphology, growth pattern, color and characteristics of thecolony, surface texture, hyphae and characteristics of thespores ( ). Molecular analysis confirmed the identityof the isolated pathogen.

Bothresistant and susceptible genotypes of turmeric leaf samplesshowed increase in PAL activity after fungal pathogeninoculation ( ). In resistant turmeric leaves, high

PAL activity of 159.5 U was recorded in Hassan-8 varietyand least activity was recorded in susceptible variety,Hangla-1 (57.3 U).

: Two diverse genotypes, one resistant and othersusceptible genotypes of turmeric leaf samples were analyzedfor POX with or without pathogen inoculation. Bothgenotypes showed an increase in the level of enzymeactivities after pathogen inoculation ( ). High POXactivity of 10.23 U was observed in Hassan-8 which wasinoculated with fungal pathogen whereas the least activity ofPOX was found in variety Hangla-1 (2.73 U) after pathogeninoculation showing significant (p differencebetween their respective control samples.

Light microscopic details of 24profusely grown germ tubes of conidia in the infected leavessurface lesions are depicted in . In B-Hallia susceptiblegenotype penetration of pathogen fungal hyphae intointercellular space was recorded at 24 hpi . No suchpenetration was observed in Hassan-8 genotype at 24 hpi.Some hyphal structures of were found to spreadaround the intercellular spaces of the parenchyma tissues viathe wounds of the turmeric-leaves. Few germ-tubes were seen

et al

etal

et al

A. alternata

Curcuma longaAlternaria alternata

A alternata

PCR amplification:

Taxon sampling and phylogenetic analysis:

Tissue preparation for scanning electron microscopy:

RESULTSPathogen isolation:

Fig.1AFig. 1B

Fig. 1C

Estimation of PAL activities in turmeric genotypes:

Fig. 2A

Estimation of POX enzymes in different turmericgenotypes

Fig. 2B

Light microscopic analysis:

Fig. 3

(Fig. 3)

L

Both turmeric genotypesshowed varied levels of enzymes exhibiting an increase inPPO activitiy after pathogen inoculation ( ). Thehighest PPO activity was observed in variety Hassan-8 (14.41OD at 420nm ⁄mg protein ⁄min), showing a 3.6-fold increasewhen compared to control (8.43 OD at 420 nm⁄mgprotein⁄min). Less activity level was recorded in susceptiblevariety Hangla-1 (5.24 OD at 420 nm⁄mg protein ⁄min)turmeric leaf samples upon pathogen inoculation compared tocontrol (1.61ODat 420nm ⁄mgprotein ⁄min).

2

≤ 0.05)

Spectrophotometric estimation of PPO enzymes indifferent turmeric genotypes:

Fig. 2C

.

Fig. 1: (A) L (B) Colony morphology ofCL1 on PDA (C) Microscopic features of

Cl1

Curcuma longa Alternariaalternata A.alternata

59

growing and entering the stoma without forming anappressorium over the stoma. The other germ-tubes thoughbranched and formed no appressoria, exhibited no directionalgrowth towards the stomata. Occasionally branched germtubes formed a hyphal network on the host tissues andpenetrated through the stomata. This study also showed thatthe hyphae did not penetrate the xylem tissue.

Strain CL1was identified using morphological characters andphylogenetic analysis. The amplified ITS region of DNA( ) was sequenced and aligned with similar ITS DNA

of the different isolates retrieved from NCBI GenBankus ing CLUSTALW (Thompson . , 1994) .Corresponding neighbor-joining (NJ) analysis showedclearly that strain CL1 fell into the group of

with strong support ( ). The DNA sequenceof this pathogenic CL1 is submitted to

Taxon sampling and phylogenetic affiliation:

Fig. 4A

Fig. 4B

et a l

Alternariaalternata

A alternata. strainFig. 2: (A) PALactivity in different turmeric varieties at 24 h with

and without CL1 inoculation. (B) POXactivity in different turmeric varieties at 12 h with andwithout inoculation. (C) PPO activity indifferent turmeric varieties at 48 h with and without

inoculation. The data expressed as the average ofthree independent experiments with three replicates each

A. alternata

A. alternataA.

alternata.

Fig. 3: Cl1 infecting the leaf surface nearstomata/penetration thorough stomata (0 to 72 hours)Alternaria alternata

Fig. 4: (A) PCR amplification of CL1 DNA byinternal transcribed spacer (ITS1 and ITS4) universalprimers (B) Phylogenetic tree derived from neighbor-joining analysis showing the evolutionary relationship of

CL1 with its closest BLASThits

Alternaria alternata

A. alternata

60

NCBI GenBank under the accession number MN307311.

During the study of host-pathogen interaction betweenturmeric and CL1 all the eightturmeric varieties used exhibitted clear variation in the degreeof their resistance to the pathogen. PAL is an enzyme of thephenylpropanoid pathway that is induced during plant-pathogen interaction. Chen . (2000) showed theproduction of high level of PAL in cucumber root inoculatedwith . Geetha . (2005)suggested the involvement of PAL in the resistancemechanisms of pearl millet to . Anearly increase in PAL activity in rice plant have been reportedupon infection with blast pathogen (Wang

., 2004). Indeed plants are reported to have abundantenzymatic resources like PAL, POX, PPO, peroxidases,etc.that contain iron as heme and are involved in the scavengingof H O by the oxidation of phenols and its generation,through the oxidation of NADH. The induction of POXappears to be an early event in the defense of host againstpathogen during plant-microbe interaction Shivalingaiahand Umesha, 2016).

Rotem 994 documented that spores of all sp.germinate in a remarkably less time and formed many germ-tubes which entered via the stoma with no appressoriumformation. Similar observations were made by Allen .(1983) while investigating interaction with

sunflower. Results of the present study also exhibited bothdirect and indirect penetrations with or without formation ofappressoria, suggesting that appressoria formation is notnecessary for the infection. Similar observations were madeby Van Dyke and Trigiano (1987) while investigatingpathogenesis of . This pathogen has been reportedto enter their specific host via the stomata and by directpenetration with or without appressoria formation. VonRamm (1962) also documented that penetratedtobacco leaf without appressoria formation. Mims .(1997) reported that conidia of germinated in 2-3hpi producing multiple germ-tubes which grew across leavessurface. In this study, germ tube is reported to enter via stomawith no appressorium formation. The results of the presentstudy exhibited both direct and indirect penetration withoutthe formation of appressoria suggesting that appressoriaformation is not necessary for initiating the infection process.

Lesions formed in leaf tissues of resistant genotypes and inyoung leaves exhibit slow expansion rate in comparison toexpansion in susceptible genotypes or old leaves (Dita ,2006). This slow colonization in resistant genotypes andyoung leaves might be primarily due to some of the defenserelated reactions initiated from within such hosts during host-pathogen interaction. Dehpour . (2007) reported theformation of secondary hyphae from primary hyphaeanastomoses in the intercellular space and also growintercellularly within the epidermis. There is a report of

and entering the leaves tissue ofand , by direct and stomatal

penetration. Similar observations have been made in case ofinfection of castor leaves by and onion leaves by

(Suheri and Price, 2000; Babu ., 2009).

During present study, an attempt has also been made to studythe resistance and susceptibility of diverse turmericgenotypes against by considering PAL, POX andPPO as biochemical markers. From amongst the differentturmeric genotypes evaluated a potent source of resistancewas documented in only Hangla-1 genotype, whichexhibited minimum disease incidence. As for other genotypesare concerned none of them were free from leaf blight diseasesymptoms after the pathogen inoculation and in all of themsusceptibility was high. During the interaction, wedocumented the direct involvement of PAL, POX and PPO inturmeric inoculated with . Spectrophotometricinvestigation for POX and PPO enzymes in resistant andsusceptible turmeric leaves samples without pathogeninoculation revealed fewer activities in comparison to theinoculated turmeric leaves sample, suggesting a possible roleof these enzymes during pathogen infections and host-resistance. Substantially high activity of PAL, POX and PPOwas documented in resistant turmeric leaves sample incomparison to susceptible turmeric leaves sample, therebyclearly suggesting that PAL, POX and PPO have played asignificant role in the development of host resistance. Thepresent findings are in conformity with the earlier researchwork by Chittoor . (1997) where the role of POX inresistant interaction between rice andpv. causing bacterial blight disease has beenemphasized.

DISCUSSION

Alternaria alternata

et al

Pythium aphanidermatum et al

Sclerospora graminicola

Pyricularia oryzaeet al

Alternaria

et alA helianthi

A. alternata

A. longipeset al

A. cassiae

et al.

et al

A.brassicicola A. brassicaeBrassica oleracea B. juncea

A. ricini A.porri et al

A. alternata

A. alternata

et alXanthomonas oryzae

oryzae

strain

(

(1 )

which

.

2 2

Fig. 5: (A) Control plants showing no infection ofCL1 in stomatal aperture. (B) Susceptible

genotype B-Halli showing the infection in leaves. (C)Conidial infection in susceptible genotype B-Hallishowing the infection in stomatal aperture. (D) Stomatalaperture invaded by infection hyphae emanating fromconidial spores of . (E) Hassan-8: genotypewhich is not showing infections by after 24 h.(F) Hassan-8: genotype which is not showing infections of

after 24 h

Alternariaalternata

A. alternataA. alternata

A. alternata

61

In a related study Mohammadi and Kazemi (2002) reportedsignificant increase in POX specific activity in both resistantand susceptible wheat genotypes upon inoculation with

conidia. Increase in peroxidaseactivity was considered as an indicator for resistance of beansto chocolate spot disease by Nawar and Kuti (2003). The PPOactivity has been reported to significantly increase inresistant and susceptible genotypes of wheat upon inoculationwith conidia (Mohammadi and Kazemi,2002). Similar results have been recorded in plant-pathogenicfungal interaction between cabbage and , beanand , sunflower andonion and , soybean and .Pretreatments of Chick pea with rhizobium has been reportedto increase peroxidase, total phenolics and polyphenyloxidase levels in the host (Arfaoui ., 2007).

In conformity with the earlier reports the present study alsorevealed the role of increased PPO levels in the developmentof resistance in turmeric to leaf blight pathogen. Presentlymaximun PPO activity at 24hpi was documented in pathogeninoculated turmeric leaves sample, in comparison to controlsuggesting that PPO might play an important role to triggerhost resistance. Upon inoculation of resistant turmeric leafsamples, elevated levels of POX and PPO was documentedwhich seems to have a role in the inhibition of the growth ofpathogen by suppressing attempted invasion thus impartingresistance against leaf blight of turmeric.

The present investigation involving the study of the infectionprocess of on termeric has beenundertaken for the first time. It has thrown light on the detailsof pre-penetration, penetration and colonization events in thedevelopment of disease syndrome during infection of

on termeric plant, which is a member of family. Based upon the investigations undertaken it

can be concluded that PAL, POX and PPO can be used as abiochemical marker to indicate the resistance or susceptibilitynature of turmeric against leaf blight disease.

We are grateful to the University Grants Commission (UGC)for providing financial assistance in the form of Rajiv GandhiNational Fellowship for SC/ST candidates to the first author.We also express our gratitude to the Department of Studies inBotany, University of Mysore, India for providinginstrumentation facilities.

Allen, S.J., Brown J.F. and Kochman, J.K. 1983. Theinfection process, sporulation and survival of

on sunflower.413-419.

Arfaoui, A., El Hadrami, A., Mabrouk, Y., Sifi, B.,Boudabous,A., El Hadrami, I., and Chérif, M. 2007.Treatment of chickpea with isolatesenhances the expression of phenylpropanoiddefense-related genes in response to infection by

f. sp.

: 470-479.

Aveling, T.A.S., Snyman H.G. and Rijkenberg, F.H.J. 1994.Morphology of infection of onion leaves by

:1164-70.

Babu A M , Philip T , Kumar V Kariappa B K 2009.Germination, penetration and sporulation of

(Yoshii) Hansf. On castor leaf.. (10): 915–921.

Bhagat, J., Kaur, A., Sharma, M., Saxena, A.K. and Chadha,B . S . 2012 . Mol e c u l a r a nd f unc t i on alcharacterization of endophytic fungi fromtraditional medicinal plants.

. : 963–971.

Caihos, Y., Erkilic, A. and Timmer, L.W. 1997. First report ofbrown spot of Minneola tangelo in

Turkey. :230-235.

Chen, C., Belanger, R.R., Benhamou, N., and Paulitz, T.C.2000. Defense enzymes induced in cucumber rootsby treatment with plant growth-promotingrhizobacteria (PGPR) and

. : 13-23.

Chittoor, J.M., Leach, J. E., and White, F.F. 1997. Differentialinduction of a peroxidase gene family duringinfection of rice by pv.

: 861-871.

Dehpour, A.A., Alavi S.V. and Majad, A. 2007. Light andscanning electron microscopy studies on thepenetration and infection processes of

causing brown spot onin the West Mazandaran-Iran.

: 68-72.

Dickerson, D.P., Pascholati, S.F., Hagerman, A.E., Butler,L.G., and Nicholson, R.L. 1984. Phenylalanineammonia-lyase and hydroxycinnamate: CoA ligasei n m a i z e m e soc o t y ls i no c u l a te d wi t h

or: 111-123.

Dita, M.A., Brommonschenkel, S. H., Matzuoka, K.Mizubuti, E. 2006. Components of resistance toearly blight in four potato cultivars: effect of leafposition. : 1-6

Geetha, N.P., Amruthesh, K.N., Sharathchandra, R.G., andShetty, H.S. 2005. Resistance to downy mildew inpearl millet is associated with increasedphenylalanine ammonia lyase activity.

. : 267-275.

Hammerschmidt, R., Nuckles, E.M., and Ku

, . . , . , . and , . .

, and

Fusarium graminearum

F. graminearum

F. oxysporumRhizoctonia Sclerotinia sclerotiorum,

Botrytis Phytophthora megasperma

et al

Alternaria alternata

AalternataZingiberaceae

A. alternata

Alternaria helianthi Ann. Appl. Biol.

Rhizobium

Fusarium oxysporum ciceris. Plant Physiol.

Biochem.

Alternaria porri. Canadian J. Bot.

Alternaria riciniArch. Phytopathol. Plant Prot

World J. Microbiol.Biotechnol

AlternariaCanadian Journal of Plant Pathology

Pythium aphanidermatum.Physiol. Mol. Plant. Pathol

Xanthomonas oryzae oryzae.Mol. Plant-Microbe Inter.

Alternariaalternata Minneola tangelo

World Applied. Sci. J.

Helminthosporium maydis Helminthosporiumcarbonum. Physiol. Plant Pathol.

J Phytopathol

FunctionalPlant. Biol

CONCLUSION

ACKNOWLEDG MENTS

REFERENCES

45

72

42

28

9

56

10

2

25

153

32

.

. .

E

ć, J. 1982.Association of enhanced peroxidase activity withinduced systemic resistance of cucumber to

. .: 73-82.

Kavitha, K., Nakkeran, S. and Chandrashekar, G. 2012.Rhizobacterial mediated induction of defense

Colletotrichum lagenarium Physiol Plant. Pathol20

62

enzymes to enhance the resistance of turmeric( L.) tocausing rhizome rot.

: 199-219.

Kim, J.S., Seo, S.G., Jun, B.K., Kim, J.W. and Kim, S.H.2010. Simple and reliable DNA extraction methodfor the dark pigmented fungus,

. : 289-292.

Lowry, O.H., Rosebrough, N.J., Farr, A.L., and Randall, R.J.1951. Protein measurement with the Folin phenolreagent. : 265-275

Mayer, A.M., Harel, E., and Ben-Shaul, R. 1965. Assay ofcatechol oxidase - a critical comparison of methods.

: 783-789

McRoberts, N. and Lennard, J.H. 1996. Pathogen behaviourand plant cell reactions in interactions between

species and leaves of host and nonhostplants. : 742-752.

Mims, C.W., Rogers, M.A. and Van-Dyke, C.G. 1997.Ultrastructure of conidia and conidium germinationin the plant pathogenic fungus

: 252-260

Mohammadi, M., and Kazemi, H. 2002. Changes inperoxidase and polyphenol oxidase activities insusceptible and resistant wheat heads inoculatedwith and inducedresistance. : 491-498.

Nawar, H.F., and Kuti, J.O. 2003. Wyerone acid phytoalexinsynthesis and peroxidase activity as markers forresistance of broad beans to chocolate spot disease.

. : 564-570.

Rotem, J. 1994. ‘ ’ The AmericanPhytopathological Society: St Paul, Minnesota,USA

Shivalingaiah and Umesha, S. 2016. Study of involvement ofperoxidase and polyphenol oxidase in imparting

resistance to bacterial blight disease invarieties.

(7): 05-10

Suheri H Price T V 2000. Infection of onion leaves byand and

disease development in controlled environments.. : 375 – 382.

Thompson, J.D., Higgins, D.G. and Gibson, T.J. 1994.CLUSTALW: improving the sensitivity ofprogressive multiple sequence alignment throughsequence weighting, position-specific gap penaltiesand weight matrix choice. :4673-4680.

Van Dyke, C.G. and Trigiano, R.N. 1987. Light and scanningelectron microscopy of the interaction of thebiocontrol fungus with sicklepod( ). :230-235.

Velayudhan, K. C., Dikshit, N., and Nizar, M. A. 2012.Ethnobotany of turmeric ( L.).

(4):607-614.

Von Ramm C 1962 Histological studies of infection byon tobacco.

391–398.

Wang, L., An, C., Qian, W., Liu, T., Li, J., and Chen, Z. 2004.Detection of the putative cis-region involved in theinduction by a elicitor of thepromoter of a gene encoding phenylalanineammonia-lyase in rice. : 513-518.

Curcuma longa Pythium aphanidermatumArch. Documented Plant Prot.

Cercospora sojina.J. Plant Pathol

J. Biol. Chem.

Phytochemistry

AlternariaPlant Pathol.

Alternaria cassiae.Canadian J. Bot.

Fusarium graminearumPlant Sci.

JPhytopathol

The genus Alternaria

Oryza sativaEuropean Journal of Biotechnology and

Bioscience

Alternaria porri Stemphylium vesicarium

Plant Pathol

Nucleic. Acids Res.

Alternaria cassiaeCassia obtusifolia Canadian J. Plant Pathol.

Curcuma longaIndian Journal of Traditional Knowledge

Alternaria longipes PhytopathologischeZeitschrift

Pyricularia oryzae

Plant Cell Rep.

45

6

193

5

45

75

162

151

4

49

11

9

11

45

22

.

. PCRProtocols: A Guide to Methods and Applications

, . and , . .

, . .

:

White, T.J., Bruns, T.D., Lee, S.B. and Taylor, J.W. 1990.Amplification and Direct Sequencing of FungalRibosomal RNA Genes for Phylogenetics. In:

.(Eds.: Innis, M.A., Gelfand, D.H., Sninsky, J.J. andWhite, T.J.) Academic Press, NewYork, 315-322.

63