welcome to hst.508/biophysics 170 - mit opencourseware...welcome to hst.508/biophysics 170...
TRANSCRIPT
![Page 1: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/1.jpg)
Welcome toHST.508/Biophysics 170
Harvard-MIT Division of Health Sciences and TechnologyHST.508: Quantitative Genomics, Fall 2005Instructors: Leonid Mirny, Robert Berwick, Alvin Kho, Isaac Kohane
![Page 2: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/2.jpg)
Our emphasis
• Evolution
• Quantitative
• Medical applications
![Page 3: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/3.jpg)
Syllabus
1. Evolutionary and population genetics
2. Comparative genomics
3. Structural genomics and proteomics
4. Functional genomics and networks
![Page 4: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/4.jpg)
Module 1
1. Evolutionary and population genetics• The basic forces of evolution: mutation, recombination, mating,
migration. Neutral evolution and drift, effective population size,coalescent theory.
• Selection, fitness, and diffusion models. Selection at genetic andhigher levels
• Phylogenetic analysis. Models of nucleotide evolution: Jukes-Cantor,Kimura, maximum likelihood models; Human/mouse/rate examples.
• Measuring selection: from ‘classical’ methods to maximumlikelihood (with applications to disease evolution, HIV andinfluenza)
• Medical Lecture:Genetic diversity and evolution of hepatitis C virus
![Page 5: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/5.jpg)
Drift, mutations, selection
Consider a deleterious recessive allele A1 of frequency p in a randomly mating humanpopulation with mutations, selection and drift. Steady state distribution of p is given by
(1)
where N is an effective population size, s is selection coefficient, u1 and u2 are mutationrates to A1 and from A1 respectively, and C is a normalization coefficient.
![Page 6: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/6.jpg)
Module 22. Comparative genomics• Sequence comparison, substitution matrices, alignment
methods, alignment statistics. Multiple alignments, profilesand PSSMs.
• Genome comparison and genome evolution: duplication,recombination, insertions, repeats. Orthologs, paralogs, in/out-paralogs. Algorithms of genome alignment.Conserved non-coding, positive selection. Motif discovery.
• Prediction of gene function using: homology, context,structure, networks.
• SNPs: microevolution, history of population, markers medicalapplications (example)
• Medical Lecture Finding the keys to human heart disease inthe genomes of other animals.
![Page 7: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/7.jpg)
SPLIT
Substitutions T->A (site 5)Insertions H (between sites 1 & 2)Deletions
SubstitutionsInsertionsDeletions F (site 4)
CAEFTP
CHAEFAP
CAEFTP
CAETP
Evolution Evolution
Evolutionarily Correct Alignment : CHAEFAPC - AE - TP
Common AncestorCAEFTP
Figure by MIT OCW.
![Page 8: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/8.jpg)
ACATGCGATCCAAGGCTGAC
ACACGCGATCCAAGGCTCAC
ACACGGGATCCAAGGATCAC
GCACGGGATCCAAGGATCAC
GCATGGGATCCAAGGATCAC
GCATGGGACCCAAGGATCAC
GCATGGGACCCAAGGTTCAT
TIME
Site 4 evolves accordingto a Markov Chain.
All Markov chains (=sites) are independent
All Markov chains have thesame transition probabilities
0
1
2
3
4
5
6
Model for Sequence evolution (DNA): Each site of the DNA sequence evolves according to a Markov Chain with state space {A,C,G,T}.
Figure by MIT OCW.
![Page 9: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/9.jpg)
MARKOV CHAIN
TRANSITION MATRIX
![Page 10: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/10.jpg)
MARKOV CHAIN
TRANSITION MATRIX012736503034390348
012736503034390348
012736503034390348
012736503034390348
012736503034390348
012736503034390348
012736503034390348
012736503034390348
012736503034390348
012736503034390348
012736503034390348
012736503034390348
012736503034390348
012736503034390348
012736503034390348
012736503034390348
012736 0
12736
012736
012736
012736
012736
012736
0127360
12736
012736 0
12736
012736
012736
Figure by MIT OCW.
![Page 11: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/11.jpg)
![Page 12: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/12.jpg)
Markov chain 1 (site 1)Markov chain 2 (site 2)Markov chain 3 (site 3)
MRAP
MRAQFAP
IS
FAPVIS
R
0 1 2 Time
Seq.
MRAQFAPVIS
Underlying Model: Each site in the sequence evolves according to a Markov chain, and independently of the other sites.
All the Markov chains have the same transition matrix P (matrix with dimension 20 20 ).
...........
Figure by MIT OCW.
![Page 13: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/13.jpg)
FROM TRANSITION MATRIX TO ALIGNMENT SCORES
Two hypothesis: 1. Sequences S1 and S2 are unrelated (=random matching)2. Sequences S1 and S2 have a common ancestor.
Score = Log (P1/P2)
P1 - probability of observed alignment given model 1P2 - probability of observed alignment given model 2
![Page 14: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/14.jpg)
Homology
Homologs
ParalogsOrthologs Orthologs
Frog α Chick α Mouse α Mouse β Chick β Frog β
α - Chain gene β - Chain gene
Early Globin Gene
Gene Duplication
Figure by MIT OCW.
![Page 15: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/15.jpg)
Guest lecture 1
• Richard Lewontinevolutionary geneticist philosopher of science social critic numerous publications including, "The Spandrels of San Marco", "The Genetic Basis of Evolutionary Change", "Biology as Ideology", "The Triple Helix: Gene, Organism, and Environment" ... http://hrst.mit.edu/hrs/evolution/public/profiles/lewontin.html http://www.nybooks.com/authors/4463
••••
••
(Compilation of information by MIT OCW.)
![Page 16: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/16.jpg)
Module 33. Structural genomics and proteomics• Overview of protein structures, domain architecture.
Sequence-structure mapping, protein folding, forces andinteractions.
• Structure-based substitution matrices. Protein structureprediction. Threading.
• Protein function: binding and kinetics. Michaelis-Menthenkinetics, inhibition. Protein-DNA recognition: models andalgorithms.
• Proteomics: networks of protein-protein interactions,complexes, modules. Power-law distributions, clusteringcoefficient. Evolution of networks.
• Medical Lecture Hemoglobin and the anemias.
![Page 17: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/17.jpg)
Module 33. Structural genomics and proteomics• Overview of protein structures, domain architecture.
Sequence-structure mapping, protein folding, forces andinteractions.
• Structure-based substitution matrices. Protein structureprediction. Threading.
• Protein function: binding and kinetics. Michaelis-Menthenkinetics, inhibition. Protein-DNA recognition: models andalgorithms.
• Proteomics: networks of protein-protein interactions,complexes, modules. Power-law distributions, clusteringcoefficient. Evolution of networks.
• Medical Lecture Hemoglobin and the anemias.
![Page 18: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/18.jpg)
ELECTRO + SOLVENT :Dielectric effect
80 ; 4
== εεπ ij
ji
r
qqV
2-3 Kcal/molΔG ~ T
Linear in T => entropic!
Figure removed due to copyright considerations.
![Page 19: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/19.jpg)
More forces:
Elastic 1-100 pN
Covalent 105 pN
Viscous 1-1000 pN
Collisional 10-12-10-9pN for 1 collision/s
Thermal 100-1000 pN
Gravity 10-9 pN
Electrostatic and VdW 1-1000 pN
Magnetic << 10-6 pN+ -
![Page 20: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/20.jpg)
Hydrophobic effect
Frank & Evans 1945
• Water molecules form hydrogen bonds
• Polar groups do not disturb the network of water-water interactions.
• Non-polar (hydrophobic) groups disrupt the network leading to formation of “local ordering” of water.• Local ordering reduces the entropy
Please see Figure 2 in:Laidig, Keith E., and Valerie Daggett. "Testing the Modified Hydration-Shell Hydrogen-Bond Model of Hydrophobic EffectsUsing Molecular Dynamics Simulation." J Phys Chem 100 (1996): 5616-5619.
Figure removed due to copyright reasons.
![Page 21: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/21.jpg)
Module 33. Structural genomics and proteomics• Overview of protein structures, domain architecture.
Sequence-structure mapping, protein folding, forces andinteractions.
• Structure-based substitution matrices. Protein structureprediction. Threading.
• Protein function: binding and kinetics. Michaelis-Menthenkinetics, inhibition. Protein-DNA recognition: models andalgorithms.
• Proteomics: networks of protein-protein interactions,complexes, modules. Power-law distributions, clusteringcoefficient. Evolution of networks.
• Medical Lecture Hemoglobin and the anemias.
![Page 22: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/22.jpg)
RECOGNITION OF BINDING MOTIFS IN DNA
Figures removed due to copyright reasons.
![Page 23: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/23.jpg)
RECOGNITION OF BINDING MOTIFS IN DNA 2
HOMEODOMAIN
Figures removed due to copyright reasons.
![Page 24: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/24.jpg)
Module 33. Structural genomics and proteomics• Overview of protein structures, domain architecture.
Sequence-structure mapping, protein folding, forces andinteractions.
• Structure-based substitution matrices. Protein structureprediction. Threading.
• Protein function: binding and kinetics. Michaelis-Menthenkinetics, inhibition. Protein-DNA recognition: models andalgorithms.
• Proteomics: networks of protein-protein interactions,complexes, modules. Power-law distributions, clusteringcoefficient. Evolution of networks.
• Medical Lecture Hemoglobin and the anemias.
![Page 25: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/25.jpg)
Examples of biologicalnetworks
• Protein-proteininteractionsproteins ~5000interactions ~7000
A comprehensive analysis of protein-protein interactions in S.cerevisiae. Nature. 2000, 623-7. Uetz P et al
Databases:BindDBMIPSDIP
Figures removed due to copyright reasons.
![Page 26: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/26.jpg)
Examples of biologicalnetworks
• Protein-DNA interactions(TF-upstream binding)
Figures removed due to copyright reasons.
Please see Figure 5 in T. I., Lee, et al. "Transcriptional regulatory networks in Saccharomyces cerevisiae." Science 298, no. 5594 (Oct 25, 2002): 799-804.
![Page 27: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/27.jpg)
Metabolic Pathways
Figure removed due to copyright considerations.
![Page 28: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/28.jpg)
Module 33. Structural genomics and proteomics• Overview of protein structures, domain architecture.
Sequence-structure mapping, protein folding, forces andinteractions.
• Structure-based substitution matrices. Protein structureprediction. Threading.
• Protein function: binding and kinetics. Michaelis-Menthenkinetics, inhibition. Protein-DNA recognition: models andalgorithms.
• Proteomics: networks of protein-protein interactions,complexes, modules. Power-law distributions, clusteringcoefficient. Evolution of networks.
• Medical Lecture Hemoglobin and the anemias.
![Page 29: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/29.jpg)
it’s not a random graph!
IT’S ALMOST SCALE-FREE (=POWER-LAW) GRAPH
Figures removed due to copyright reasons. Please see figures 1e and 2 in Jeong, H., B. Tombor, R. Albert, Z. N. Oltvai, and A. L. Barabasi.
Nature 407, no. 6804 (Oct 5, 2000): 651-4."The large-scale organization of metabolic networks."
![Page 30: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/30.jpg)
Figures removed due to copyright reasons. Please see:Liljeros, F., et al. "Distributions of number of sexual partnerships have power law decaying tails and finite variance." eprint ARXIV,(http://arxiv.org/). (May 2003). and Liljeros F., et al. "The web of human sexual contacts." Nature 411, no. 6840 (Jun 21, 2001): 907-8.
![Page 31: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/31.jpg)
Module 33. Structural genomics and proteomics• Overview of protein structures, domain architecture.
Sequence-structure mapping, protein folding, forces andinteractions.
• Structure-based substitution matrices. Protein structureprediction. Threading.
• Protein function: binding and kinetics. Michaelis-Menthenkinetics, inhibition. Protein-DNA recognition: models andalgorithms.
• Proteomics: networks of protein-protein interactions,complexes, modules. Power-law distributions, clusteringcoefficient. Evolution of networks.
• Medical Lecture Hemoglobin and the anemias.
![Page 32: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/32.jpg)
Module 4
4. Functional Genomics and Networks• Gene regulation and function, conservation, detecting
regulatory elements.• RNA expression: clustering and classification.• RNA expression: classification, 2-way clustering, regulatory
modules. Integration of expression and proteomic data.• Dynamics of biological networks metabolic, regulatory.
FBA, signaling, regulation of gene expression.• Medical Lecture: Two examples: phenylketonuria (monogenic)
and diabetes type 2 (multigenic+). “Disease” genes vs.“susceptibility” genes. “Environmental” vs. “Developmental”regulation of gene expression.
![Page 33: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/33.jpg)
cDNA microarray expt
Figure by MIT OCW.
![Page 34: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/34.jpg)
Figure by MIT OCW.
![Page 35: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/35.jpg)
Blank slide/colon data
Figure removed due to copyright reasons.
![Page 36: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/36.jpg)
Giraffe
DEFINITION OF THE CLUSTERING PROBLEM
Figure by MIT OCW.
Figure by MIT OCW.
![Page 37: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/37.jpg)
CLUSTER ANALYSIS YIELDS DENDROGRAM
Dendrogram1
T (RESOLUTION)
![Page 38: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/38.jpg)
Giraffe + Okapi
BUT WHAT ABOUT THE OKAPI?
Figure by MIT OCW.
Figure by MIT OCW.
Figure by MIT OCW.
![Page 39: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/39.jpg)
how many clusters?
3 LARGEMANY small (SPC)
toy problem SPC
Figures derived from Blatt, M., S. Wiseman, and E. Domany. "Superparamagnetic Clustering of Data." Phys Rev Lett 76, no. 18 (1996): 3251.
![Page 40: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/40.jpg)
other methods
Figures derived from Blatt, M., S. Wiseman, and E. Domany. "Superparamagnetic Clustering of Data." Phys Rev Lett 76, no. 18 (1996): 3251.
![Page 41: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/41.jpg)
Functionally related genes
Image removed due to copyright reasons.
![Page 42: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/42.jpg)
AG
G
G
G
mRNA
CC
C
CT
TT
T
T
AA
A
A
A
Gene (DNA)
Transcription Translation
CENTRAL DOGMA
Sugar-phosphate back bone
Hydrogen bonds
Base
Protein
Figure by MIT OCW.
![Page 43: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/43.jpg)
HST.508 Cases
![Page 44: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/44.jpg)
Case 1: Dr. Gail Genomous• Took HST.508 in 2005
• Since 2008 works at R&D of Shrek Pharmaceuticals
• She works on target identification for mysteriousgreen-rash syndrome.
• Pathways involved are know. But candidate drugs although binding to their targets have been inefficient on model organisms. • Her goals are
– Suggest better target proteins
– Assist drug design/organic syntheses group in drug development
![Page 45: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/45.jpg)
Case 1: Dr. Gail Genomous
• She found that involved drug targets are enzymes of well-known metabolic pathway. She sets up flux-balancesimulations to study this pathways (Lec F4).
• Simulations suggest that inhibition of targeted enzymesdoes not shutoff the pathway. Dr.Genomous identifies otherenzymes that need to be inhibited to shutoff the pathway.She suggests that down-regulating these enzymes is themost efficient intervention strategy.
![Page 46: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/46.jpg)
Case 1: Dr. Gail Genomous
• She finds out that these enzymes are co-expressed (LecF1), but transcription factor is unknown.
• However, available protein-protein interactions suggest thatthese enzymes are also activated by a kinase pi314 (LecS4).
• Dr.Genomous model the structure of pi314 by homology toanother kinase (Lec S1).
• Comparison of pi314 with its orthologs from related species(P.Winnie, D.Scooby etc) suggests functional region of thestructure (Lec C2,S2).
• Dr. Genomous proposes drug design group the new drugtarget and a specific functional region to be targeted.
![Page 47: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/47.jpg)
Case 2: Dr. Pete Proteomson• Took HST.508 in 2005
• Works on his dissertation at the Whitetail institute
• He is interested in tail discoloration syndrome (TDS).
• In collaboration with the hospital, his lab has performed expression profiling of patients and normal individuals.• His goals are
– Identify genes involved
– Suggest and test mechanisms of the disease
![Page 48: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/48.jpg)
Case 2: Dr. Pete Proteomson• Dr Proteomson has detected differentially expressed genes
(Lecture F2)
• Mapped differentially expressed genes on the network ofprotein-protein interactions (Lec. S3) and network ofsynthetically lethal genes. Results suggested that most ofthese genes belong to the same pathway (Lec S4).
• Using homology, genomic and network location, hepredicted function for some of these genes as proteinkinases involved in cell signaling (Lec S4).
![Page 49: Welcome to HST.508/Biophysics 170 - MIT OpenCourseWare...Welcome to HST.508/Biophysics 170 Harvard-MIT Division of Health Sciences and Technology HST.508: Quantitative Genomics, Fall](https://reader030.vdocuments.mx/reader030/viewer/2022040513/5e669c9b6020f348b949ce6a/html5/thumbnails/49.jpg)
Case 2: Dr. Pete Proteomson• Mapping selected gene onto a database of SNPs revealed rear polymorphisms
in some of these genes (Lec C4).
• Population analysis suggests that these mutations are likely to be deleterious(Lec E3). Mapping mutations on known structures of protein kinases and cross-species comparison strongly supported deleterious nature of some SNPs (LecS2,C4).
• Finally, Dr.Proteomson demonstrated that patients carry more deleterious SNPsin the identified pathway than normal individuals. This result supports the role ofidentified pathways in development of the green rash.