volume 15 no. 1 april 2016 · jhun a. mayugba, and daisy ann a. disu 13 impact assessment of the...

1

Volume 15, No. 1 April 2016 JOURNAL OF ABSTRACTS AND RESEARCHES

2

Editorial Staff

Editors

Loreto B. Waguey April J. Rivera Jessica Briones

Christine Lomibao

Dona A. Fortes Renante Malagayo

Rhodora Ibabao

Consultants

Dr. Raquel D. Quiambao Dr. Delia V. Eisma

Dr. Elizabeth I. Olarte Prof. Pearl Natalie B. Estrada

Prof. Jesus Rafael Jarata

3

Published in April 2016 by the College of Arts and Sciences, DMMMSU-SLUC

Agoo, La Union

ISSN: 1658—1716

All Rights Reserved

No part of this publication may be reproduced; stored in a retrieval system or

transmitted in any form or by any means, mechanical, photocopying or otherwise

without prior written permission of the publisher.

4

PREFACE

The 21st century demands countries to be globalized in the field of research. It is at this point whereby Higher Education Institutions (HEIs) play a

crucial role in creating and disseminating new knowledge and technologies not

only in the local and national levels but also internationally. DMMMSU, with its mantra, “Embracing world class standards” has focused on creating ‘world-class’

research university. It has become an avenue whereby new knowledge is created

from various disciplines and fields through education and training. Thus, the university’s international involvement in research has raised its standards and

has maintained its mantra.

The College of Arts and Sciences of DMMMSU South La Union Campus tries its best to improve research performance in order to have a significant contribution

to the country and to the global arena. The production of CAS Science Monitor

is one of the strategies of the college in building research capabilities and producing relevant and quality researches for dissemination. This annual

journal features abstracts of student researches. It serves as a conduit of

information and dissemination of student researches in the field of mathematics and allied disciplines, biology, physics, humanities, and social sciences.

5

CONTENTS

BS PSYCHOLOGY ABSTRACTS

Page

Gender, Decision-Making Style and Level of Cognitive Bias of Oyster Vendors in Dagupan City

Orville B. Barba, Laraine B. Del Prado, Kimberly Jett L. Monsada, and

Delia R. Mendoza

1

Iba’t ibang Paniniwala at Kaugalian ng mga Magsasakang

Magulang sa Pagpapalaki ng kanilang mga Anak

Micah Bernadine A. Mondia, Joden M. Quesada, July Ann F. Leones,

Rachel A. Laroya, and Pearl Natalie B. Estrada

1

Farmers’ Level of Awareness and Acceptance of the Proposed

House Bill 4644

Sheena M. Estacio, Glen R. Estoque, Jayson G. Llego, Christian Jeff. T. Mapile, and Madelyn P. Niño

2

Farming Strategies and Level of Satisfaction of Farmers

Jerry V. Alambra, Gerald T. Briones, Shaira T. Mapile and Delia R. Imperial

2

Parental Favoritism sa Pamilya ng mga Magsasaka

Jaylee Ann F. Apilado, Mark Peter John B. Balderas, Grace Joy M. Hullana, and Kessy Ivy M. De Guzman

3

Socio-Demographic Profile and Level of Perceived Anti-Social

Tendency of DMMMSU-SLUC Institute of Fisheries Students from

Coastal Areas Angelica P. Gundran, Ysha Rae P. Lugto, Rea Kimberly Tess L. Perado,

and Zenaida D.C. Pascua

3

Needs and Satisfaction Level of Farmers in the Selected Barangays of Agoo, La Union

Realiza S. Asperin, Conielyn A. Cunanan, Karren Mae S. Estacio, and

Maria Elena V. Milan

4

Prosocial Tendency and Social Interaction Problems among

Farmers

Charamine M. Hidalgo, Jessa Mae G. Jamile, Raisa Mae L. Paneda, and Kessy Ivy M. de Guzman

4

ESGPPA Scholars’ Psychological Profile and Academic

Performance

Dionica Mae M. Alqueza, Abelyn Joy R. Dapiaoen, Alicia Mae M. Regacho, and Marcelina H. Ayson

5

Parenting Styles of Single Parents and their Relationship with the

Personality and Emotional Stability of their Children Charmaine B. Dumaguin, Clarissa E. Mamuyac, Ma. Aida V. Ocol,

and Maria Elena V. Milan

5

Level of Satisfaction on Agricultural Information Services Christian B. Adriatico, Nimshi A. Boado, Gladys F. Gali, Erika Jane G.

Laranang, and Delia R. Mendoza

6

Extent of Beliefs, Values, Health Conditions and Productivity

Level of Farmers in Macalva, Agoo, La Union

Roxanne F. Carrera, Rodessa Mae G. Corpuz, Jessa E. Estimo, and

Maria Elena V. Milan

6

Konsepto ng Midlife Crisis sa mga Magsasaka

Erica Lyn D. Estacio, Lenneth S. Quinto, Melody D. Tano, and Kessy

Ivy M. de Guzman

7

7

6

Self-Concept of Kaingin Farmers

Krystell Pearl K. Boac, Cindy A. Casuga, Myra P. Druja, and Pearl Natalie B. Estrada

Perceived Parenting Style, Temperament, and Level of Aggression

of the BS Psychology Students Angel May Regacho, Jay Ar A., Rimorin, Allilah Marish Tandang, and

Marcelina H. Ayson

8

Level of Self-concept and Attitude towards Work of Grape Farmers Johaness O. Dela Peña, Rochelle J. Mamuyac, Fredalie U. Sabado,

and Zenaida D. C. Pascua

8

BS MATHEMATICS ABSTRACTS On Cyclic Numbers

Judy-Anne T. Elcano, Jerry O. Dulatre, Ma. Jolina Jane S. Magaro,

and Ralph Vincent E. Alambra

9

Performance Efficiency in Research and Extension of DMMMSU-

SLUC Students Mary Grace V. Molina, Jesabell S. Medina, Rubyrose S. Navarro,

Ginalyn D. Suguitan, and Eduard M. Albay

9

On Voronoi Diagram John Bryan V. Serrana, Diane S. Castro and Jenica M. Rocapor, and

Ronald L. Aquino

10

Miscues in Applying the Different Techniques of Integration.

Myca D. Posadas, Kenneth Vincent C. Carbonell, Joan Fe V. Lagare, Edwin M. Tagudin, and Ralph Vincent E. Alambra

11

Development of Modules on Selected Topics in Number Theory

Rosel R. Boadilla, Marvie B. Suguitan, Suzzane P. Tablazon, and Daisy Ann A. Disu

11

Algorithms on 2-Factorization of Some Special Graphs

Kathlyn Joy A. Gangey, Germelyn B. Hugo, Charmaine Joy P. Peria, and Tjaart Jan B. Estrada

12

Modelling the Performance of BS Mathematics Students in Major

SubjectsRuth Ann C. Ballesteros, Jan Rupert T. Dulay, Reynalyn L. Llobrera, Marlene O. Villanueva, and Karen Abegail F. Bucasas

12

On Lucky Primes and their Application to Rivest, Shamir, and

Adleman (RSA) Cryptosystem

Nialle Loui Mar T. Alcantara., Julie Ann Marie S. Cabilatazan, Jhun-Jhun A. Mayugba, and Daisy Ann A. Disu

13

Impact Assessment of the Mathematics Training Series Joshua A. Caburian, Mary Rose L. Maglaya, Almar Bryan M.

Regacho, John Marvin D.Serran, and Eduard M. Albay

13

Development of Computer Aided Instructional (CAI) Material on Selected Topics in Inferential Statistics

Joanalyn A. Soriano, Jea Thalia A.Doctolero, Ivy Grace V. Rodriguez,

Alvin S. Viduya, and Sunshine P. Briones

14

BS BIOLOGY ABSTRACTS

Decomposition Performance of Black Soldier Fly (Hermetia

illucens) Larvae in Two Levels of Kitchen Waste (Cooked and Uncooked)

15

7

Kassandra F. Aquino, Sheila Mae B. Capoquian, Jessica R. Erfe,

Geraldine M. Mapalo, and Glennadi R. Rualo Inoculum Potential of Arbuscular Mycorrhizal Fungi Associated

with Mimosa pudica L. (Makahiya) and Arachis hypogaea L.

(Peanut) using Zea mays L. (Corn) as Trap Plant Allen Dale L. De Guzman, Reyzielle Ann S. Capingian, Mark Joseph B.

Escobal, Jessica L. Velasquez and Precelita L. Osillos

15

Antihyperuricemic Activity of Euphorbia hirta (Tawa-Tawa) Plant Leaf Extract in Mice

Eva Charmaine G. Dulay, Erwin V. De Guzman, Ella Marie C.

Estoesta, Rose Ann O. Lagliva, and Elizabeth I. Olarte

16

Occurrence of White Spot Syndrome Virus (WSSV) in Wild Litopenaeus vannamei (Pacific Whiteleg Shrimp; L. vannamei) of

Agoo and Aringay, La Union, Philippines Verified Through Gross

Clinical Assessment & Molecular Analysis Marc Levi M. Tumapang, Marjorie M. Bautista, Christian Geen E.

Salazar, and Levylee G. Bautista

17

Antiteratogenic Property of Ginger (Zingiber Officinale) Rhizome Extract in Mice

Ma. Winde Carl P. Leonen, Shula,ite S. Abrogar, Shulamit T. Aspiras,

Mark Anthony C. Capiz, Felomina Rose E. Dacanay, and Elizabeth I. Olarte

17

Biodiversity of Mangroves in Selected Areas of the Second

District of La Union, La Union, Philippines

Emil Ernest A. Llobrera, Chasteen Kyla C. Cabilatazan, Dina T. Cariño, Mary Grace V. Garcia, Alona M. Mabalot, and Prescilita M.

Villanueva

18

8

BS PSYCHOLOGY

9

Gender, Decision-Making Style and Level of Cognitive Bias of Oyster Vendors in Dagupan City

Orville B. Barba, Laraine B. Del Prado, Kimberly Jett L. Monsada, and Delia M. Imperial

Abstract

This study conducted in different oyster vending areas in Dagupan City made use of the descriptive

correlational research design in gathering data to find out the gender, decision-making style, and level of

cognitive bias of the respondents, as well as the relationship that might exist among them. Using the

convenient sampling technique, the researchers administered questionnaires to 30 respondents, wherein 17

of them are females and 13 of them are males. They found that oyster vending is a female work. When it

comes to the level of cognitive bias, both males and females fall on the average. The most dominant female

decision-making style is logical while it is global for males. Gender has no significant relationship with level

of cognitive bias. The level of cognitive bias and decision-making style of the oyster vendors have no

significant relationship as well.

Keywords: cognitive bias, decision-making, level of cognitive bias, decision-making style, decision Introduction

Situation Analysis The Philippines is an archipelago which

has numerous sites suitable for oyster farming. Oysters are sold live in shells or in fresh form in nearly all wet markets and stalls established along national highways adjacent to local source or oyster-producing villages (www.manilatimes.net, 2015). This provides us an idea about the fertility of the province’s bodies of water suitable for production of the said shellfish.

Dagupan City is one among the top producers of milkfish in the province (wikipedia.org). Although Dagupan is known for three Bs – bangus, bagoong and bocayo (Sotelo, 2012), this city also aims to become a top-oyster producer. Oyster is a stable product in Dagupan City.

Despite all of these things, life is not always a “bed of roses” for the oyster vendors in Dagupan City. The culprit to the vendors’ marketing problems is the red tide episode in the different neighboring towns of the city which include Bolinao and Anda.

City Agriculturist Molina (2014) said that the city is not affected by red tide but with the return of the episode in the said towns, oyster producers in Dagupan were also indirectly

affected. Mayor Belen Fernandez acknowledged the report of the BFAR that Dagupan has had no history of red tide episode (www.interaksyon.com, 2015).

The city is importing oyster products from the said towns that is why vendors are prohibited to sell oysters in Dagupan City during red tide season. The consumers are on second thought of buying oysters due to red tide scare. Aside from that, the city created “Oplan Red Tide Sita” when BFAR declared the different coastal waters of Pangasinan to be positive of paralytic shellfish poisoning or red tide toxin (Bacani, 2015).

Despite BFAR’s issuance of warning on the dangers of consumption of oysters positive with red tide toxin and the city government’s “Oplan Red Tide Sita” that may result in the confiscation of products and even imprisonment for worse cases, there are vendors who are insistent in finding ways to sell.

The above-mentioned situations provide a picture of a government that imposes the law, the consequences of violating the law, and the oyster vendors who are torn between selling and not selling during red tide season. Hence, this study is a significant endeavor in making the

10

oyster vendors aware of their decision-making styles and for them to minimize level of cognitive bias. This would also give the city government an idea on what programs to create in order to help the oyster vendors, as well as a way to evaluate the effectiveness of the existing law. A deeper understanding on decision-making and cognitive bias will help instructors, especially in the field of Psychology and Management in discussing the said topics to their students. As a consequence, students will be guided in choosing their careers by making the right decisions.

Moreover, results of this study are believed to be beneficial in a growing area of psychological therapies called Cognitive Bias Modification Therapy (CBMT) wherein the therapists will yield more knowledge on cognitive bias. Results will also serve as a future reference for researchers who would like to help in improving the oyster industry in the country. And more importantly, this will help leaders to improve their leadership by improving their decision-making styles.

Framework of the Study

According to Panday (2012) decision-

making is a choice between two or more alternatives. According to Akrani (2010), decision-making involves the selection of a course of action from among two or more possible alternatives in order to arrive at a solution for a given problem.

In the field of business, Keller (2010) explained that effective decision-making is commonly understood to be an essential skill for business leaders. Whether it’s a learned skill or a natural talent, making good decisions can put a business owner on the path toward long-term success. Every business owner wants long-term success and that requires “making good decisions.”

Olinares (2012) explained that decision-making has a powerful impact on personality and social development. It affects how we effectively respond to a given circumstance using our judgment. Both sexes have equal and different roles in utilizing their intelligence. Males—given that their traits are ambitious, independent and dominant —are the primary decision makers of the family (Helgeson, 1994).

Taylor (2012) defined cognitive bias as the tendency to make decisions and to take action based on limited acquisition and/or processing of information or on self-interest, overconfidence, or attachment to past experience.

Cognitive bias became a common culprit to people’s judgment and decision-making failures. The brain can only process about 40 of

those bits of information and so it creates shortcuts and uses past knowledge to make assumptions (Porter, 2014).

Another theoretical cause of cognitive bias for people, especially in the field of business is Prospect Theory, which is defined as a psychological account that describes how people make decisions under conditions of uncertainty.

Another way to have an initial assessment of a person’s cognitive bias is to look at the gender. There is a wide area of study on person’s “irrationality.” Irrationality is defined as cognition, thinking, talking or acting without inclusion of rationality.

In the field of business, decision-making is a big factor in order to achieve success. This is the reason why companies would hire great decision makers. Kase (2010) said that great leaders understand how to balance emotion with reason and how to make decisions that positively impact themselves, their employees, their customers and stakeholders, and their organizations.

Talking about decision-making styles, it is anchored on the four: Sequential, Global, Logical, and Personable as developed by Silver & Hanson (2003), plus the others that are composed of two or more decision-making styles. These will be correlated with the level of cognitive bias in order to know if a relationship exists between them.

It is in this light that the researchers would like to embark on the present study.

Independent Variables (IV) Dependent Variables (DV)

Fig. 1 Paradigm of the Study

Gender

1. Male

2. Female Decision- Making Styles of Oyster Vendors

1. Sequential 2. Logical 3. Global 4. Personable

Level Of Cognitive Bias

11

Statement of the Problem The researchers sought answers to the following problems:

1. What is the level of cognitive bias of the respondents? 1.1 Male 1.2 Female

2. What decision-making style is dominant among the respondents? 2.1 Male 2.2 Female

3. Is there a significant difference in the decision making styles of the respondents? 4. Is there a significant difference in the respondents’ level of cognitive bias? 5. Is there a relationship between the respondents’ level of cognitive bias and their dominant decision

making style? Methodology

Research Design

The researchers made use of the non-experimental, descriptive-correlational research design in order to gather necessary data on the gender, level of cognitive bias, decision-making style of the respondents, and the possible relationships of these variables. In addition, the researchers also interviewed several respondents to verify the data gathered.

Sources of Data The researchers made use of

Convenience Sampling which is a non-probability sampling technique where participants are selected because of their convenient accessibility and proximity to the researcher in gathering data that would represent the population of oyster vendors in Dagupan City particularly barangays Lucao, Dawel, and Pantal. The researchers also secured a copy of the City Agriculture Office’s Confiscation Report of Shellfish Collected from Areas Positive of PAP from 2012 to 2014 for the list of oyster vendors who violated Oplan Red Tide Sita. They tried to secure a copy of the 2015 confiscation report but to no avail. There were 30 respondents; 17 of them are females and 13 of them are males. Of the 30 respondents, 11 of them - 4 males and 7 females had their names surfaced on the confiscation report. Meanwhile, 19 of the respondents, 9 males and 10 females didn’t have their names listed on the confiscation report. The researchers combined the violators and non-violators of the law because of two reasons: (1) There were only 11 violators and it is not an enough frequency of respondents for quantitative analysis of data, and (2) Representatives from violators and non-violators of the law were needed.

Instrumentation and Data Collection

The data gathering tools were validated first by experts in the field of Psychology, resulting in a content validity coefficient of 4.3125, interpreted as High Validity. Also, the researchers looked for 30 respondents and let them answer the questionnaire on cognitive bias and decision making style. The established reliability for the

level of cognitive bias resulted in 0.719 and is interpreted as High Reliability.

The questionnaire is divided into 3 parts. The first part is the personal profile of the respondents in terms of gender, along with their names. The second part is an adopted structured questionnaire developed by Harvey F. Silver and Robert Hanson (2003).

The questionnaire was translated to Tagalog and had undergone validation and correction by a Filipino critique from the CAS Languages Department, for easier understanding by the respondents who are not accustomed to reading and understanding English. The questionnaire was administered to the respondents so that all sorts of questions and clarifications were given to them by the researchers.

The researchers used the Likert Scale in determining the level of cognitive bias where the respondents indicated a corresponding value denoting the degree of their preference of the items by checking the chosen value on a scale of 1-5. 5 was described as Very High, 4 as High, 3 as Average, 2 as Low, and 1 as Very Low. Analysis of Data

With the use of SPSS in processing data, they were able to correlate different variables.

To determine the gender of the respondents, the researchers made use of Frequency Counting, and to summarize it, they used the Percentage with a pie graph. For the level of cognitive bias of the respondents for each gender, the researchers utilized the (AWM) Average Weighted Mean. The respondents also determined which of the items the respondents got the highest WM and which of the items the respondents got the lowest WM, and also, their AWM. They were both interpreted and were subjected for discussion.

In analyzing the results of the level of cognitive bias of each gender, per item on the questionnaire, the respondents used an interpretation range. If the result falls on or between 4.21 – 5.0, it means that the category

12

(male or female) has Very High level of cognitive bias; if it falls on or between 3.41 – 4.20, it means that it has High level of cognitive bias; if it falls on or between 2.61 – 3.40, it means that it has Average level of cognitive bias; if it falls on or between 1.81 – 2.60, it means that it has Low level of cognitive bias; and if it falls on or between 1.0 – 1.80, it means that it has Very Low level of cognitive bias.

For the decision-making style, there were four types namely: personable, global, logical, and sequential. To determine which among the four decision-making styles a certain respondent belonged, results of the questionnaire were tabulated and added to find the highest value. The researchers made use of Mode, or the value that

occurred or appeared most often on the tabulation sheet of the decision-making styles of the respondents. To determine the most dominant decision-making style, the same sheet from Silver and Hanson was used by the respondents Finally, since the data are categorical, for the significant difference between male and female in terms of decision-making style, the significant difference between male and female in terms of level of cognitive bias, and the significant relationship between cognitive bias and decision-making style of the respondents, the researchers utilized the Chi-Square Test of Independence to analyze their data.

Results and Discussion

Male and Female with their Respective Level of Cognitive Bias Table 1 shows that the most dominant

decision-making style for male respondents is global which means that males use all possible ways and come up with a more creative decision. New research finds that people tend to associate creativity with stereotypically masculine traits like risk-taking, self-reliance and adventurousness. As a result of this bias, people are likely to rate men's contributions as more creative than women's (Gregoire, 2015).

Talking about exploring all other possibilities, being a risk-taker is another quality of a global decision-maker. Nearly 1,000 brain scans have surprisingly confirmed that there are major differences between the male & female brain. Women’s and men’s brains are indeed wired in fundamentally different ways. Men have a brain wired for risk-taking more than women. Male brains get a bigger burst of endorphins, sensation of pleasure when faced with a risky or

challenging situation. The bigger the reward is, the more likely a man will take a risk (Niu, 2014).

Result on female decision-making style is quite surprising since it has been a common belief that they are more emotional rather than logical in nature. This can be explained physiologically, wherein men's brains tend to perform tasks predominantly on the left-side, which is the logical/rational side of the brain. Women, on the other hand, use both sides of their brains because a woman's brain has a larger corpus callosum, which means women can transfer data between the right and left hemispheres faster than men (Niu, 2014). Since women can use both sides of their brains, they can also be logical when needed. In fact, neuroscientists have uncovered evidence suggesting that, when the pressure is on, women bring unique strengths to decision making (Houston, 2014).

Table 1. Frequency of Male and Female with their Respective Level of Cognitive Bias

Very Low Low Average High Very High

Male 0 1 3 8 1 Female 0 1 6 8 2

Total 0 2 9 16 3

Oyster vendors are faced with situations

wherein they have to make choices. One of their biggest decisions is whether to sell or not to sell during red tide season when it is prohibited. Result of this study shows that female oyster vendors would look for the specifics of the choices, along with a clear understanding of the possible results of the different choices. Female oyster vendors are objective this time and they practice

critical judgment. They know what is at stake with their decisions a nd they have to make the best decision, not based on personal feelings.

Lastly, the researchers observed that most of the female respondents are mothers. Since most of them are mothers, they have this mother instinct, which is defined as the natural tendency that a mother has to behave or react in a particular way around her child or children (www.collinsdictionary.com).

13

Table 2 shows the total number of

respondents for each decision-making style. There are 11 respondents under Logical and 10 under Global which are also the most dominant decision-making styles of males and females. On

the other hand, only 2 of the respondents fall on Personable which means that only few of them are decision makers who use the experiences of other people and their own.

Table 3 shows the difference between

male and female oyster vendors in terms of decision making style. Using SPSS, the researchers utilized Chi-Square Test of Independence to evaluate how likely it is that any observed difference between the sets arose by chance.

The researchers obtained a P value (sig) of .037 (p< 0.05) which indicates that there is a significant difference between male and female oyster vendors with regards to their style in making a decision. Male oyster vendors’ most dominant decision-making style is global, whereas females are more of the logical type.

There are noticeable differences between men and women. According to Missri & Seminar (2008), the physical aspect is the most noticeable one, where we can clearly see the differences between both sexes. Male and female differ in their brain structures and that can be explained by how their brains are divided. Male brains have more connections within each hemisphere, while

female brains are more interconnected between hemispheres (Khazan, 2013). With this division, decision-making styles of the two genders differ.

Aside from the physiological factor that affects the way how a person makes decision, the environmental factors or issues play a huge part. The market is their oyster vending business; the economy is Philippine economy; the government legislation is the creation of Oplan Red Tide Sita; and the customer’s reaction is how the oyster buyers would decide whether to buy or not to buy products during red tide season. This explains that it is not only heredity that impacts the decision-making style of a person. It can also be due to the environment. Another, by utilizing the Cramer’s V, the researchers found that the degree of the relationship of gender and decision-making style. It resulted in a value of 0.526 which is interpreted as moderate relationship

. Table 3. Difference between Male and Female Oyster Vendors in Terms of Decision Making Style

Chi-Squared Test Independence

Decision Making Style .082

Gender Pearson Chi-Square Likelihood Ratio .037 N 30

8 cells (80.0%) have expected count less than 5. The minimum expected count is .87.a

Table 4 shows the difference between the level of cognitive bias of male and female oyster vendors. Using the SPSS to process data, the researchers utilized Chi-Square Test of Independence that resulted in a P value (sig) of .382 (p> 0.05). It implies that male and female oyster vendors have no significant difference in terms of their level of cognitive bias. This means that whether the respondents are male or female, this is not a predictor of their level of cognitive bias. The researchers also gathered qualitative data from both male and female respondents who have experienced confiscation of products. They were asked if they knew that oyster vendors are not allowed to sell products during red tide season, and majority of them said that they are

aware about it but they still went through and sold their product.

When asked about what they did when the authorities confiscated their products, they said that they just let them take it. One of the male respondents said: “Wala tayong magagawa, dahil kailangan eh, talagang bawal ang magtinda ng may red tide eh”. Even though they have experienced such confiscation way back in 2012, they still managed to get back to the business because it has been their source of living for a long time and they don’t have any alternatives, but looking at the details, there were only a few oyster vendors who experienced confiscation of products since 2012. The average is four (4) every year.

Table 2. Decision-Making Style of the Respondents Logical Global Personable Sequential Others

Male 3 6 0 3 1

Female 8 4 2 0 3

Total 11 10 2 3 4

14

Table 4. Difference between Male and Female Respondents in Terms of Level of Cognitive Bias

Chi-Square Test Independence

Cognitive Bias .387.

Gender

Pearson Chi-Square

Likelihood Ratio .382

N 30

3 cells (50.0%) have expected count less than 5. The minimum expected count is 1.73.a

By using the SPSS and the Chi-square Test

of Independence, Table 5 shows a computed P value of .511 (p> 0.05). Result implies that whatever decision-making style is dominant among oyster vendors (e.g., Sequential, Global, Logical and Personable), it has nothing to do with their level of cognitive bias. Decision-making style is not a valid predictor of level of cognitive bias as these two variables are independent and are not associated with each other. It does not support the idea that sequential decision-makers are more likely to have higher or lower cognitive bias as compared to global, logical and personable decision makers.

Since the two variables do not have significant relationship with each other, they can be independently manipulated without causing

too much effect on each other. Cognitive bias can be reduced by several ways. There is a process called debiasing which is the reduction of bias, particularly with respect to judgment and decision making. It comes in several general approaches, such as incentives, nudges, and training (Wikipedia). On the other hand, decision-making style can be developed, and if used or maximized properly, this can be rewarding to the person. According Jeff Van Pelt, decisions are the fundamental tools with which we face life’s challenges, uncertainties, and opportunities. Our typical way of approaching decisions—whether we do it well or not—is called our decision-making style. Level of cognitive bias can be reduced. Decision-making style can be developed.

Table 5. Correlation between Oyster Vendor’s Cognitive Bias and Decision Making Style

Chi-Squared Test of Independence

Decision Making Style .614

Cognitive Bias

Pearson Chi-Square

Likelihood Ratio .511

N 30

13 cells (86.7%) have expected count less than 5. The minimum expected count is .27.a

Overall, the most dominant decision-making style is logical with 11 respondents, and

next is global with 10 respondents as shown in the table 6.

.

Table 6. Decision-Making Style and Level of Cognitive Bias of the Respondents

Logical Global Personable Sequential Others

Very Low 0 0 0 0 0 Low 0 1 0 0 1 Average 6 1 1 1 0 High 5 6 1 2 2 Very High 0 2 0 0 1

Total 11 10 2 3 4

Conclusions

Based on the findings of the study, the following conclusions were drawn:

1. Both males and females do not have high or low tendency to think and judge differently from what is reasonable. Therefore, both belong to an average level.

2. Since males’ dominant decision-making style is global, and that of the females is logical, it means to say that males use all possible ways and come up with a more

creative decision while females exercise objective and critical judgment in order not to make choices based on personal feelings.

3. When male and female would have to make decisions, the two genders evaluate the situations differently, and they also decide based on their dominant decision-making styles.

4. Gender has nothing to do with the level of cognitive bias.

15

5. Decision-making style does not dictate the level of cognitive bias. In addition, there is no certain level of cognitive bias

attached or associated with a certain decision-making style

After all the findings and conclusions of the study, the researchers recommend the following:

1. This study can be revised by future researchers by increasing the number of respondents, focusing on the violators only, or conducting studies on other categories of respondents. Also, it is good to conduct studies of respondents during oyster season.

2. Males and females should learn to appreciate their own ways of making decisions.

3. Males and females can attend seminars that would develop their skill in making decisions as well as to improve other areas of their lives directly affected by decision-making. Life coaches can also help people identify what their dominant decision-

making style is. They can make use of the questionnaire developed by Silver & Hanson used in this study.

4. Since gender is proven not related to cognitive bias, another study can be conducted again. This time, the researchers can make use of other variables such as age, educational attainment, socio-economic status, and the like.

5. Since there is no significant relationship between the level of cognitive bias and decision-making style of the respondents, seminars that can determine the factors that may affect decision-making style of an individual can be attended by them

References Akrani, G. (2010, January 06). Decision Making Process in Management. Retrieved

August 5, 2015, from http://kalyan-city.blogspot.in/2010/06/decision-making-process-in-management.html

B & B Online.Factors Affecting Decision Making. Retrieved November 4, 2015 from https://www.dlsweb.rmit.edu.au/toolbox/leadership/toolbox/ip/ip_c15.html

Bacani, J. (2014, April 15). BFAR Lifts Ban on All Shellfish Products from Red Tide- Affected Towns. Retrieved August 5, 2015 from http: //dagupan .gov.ph /2014 /04/bfar-lifts-ban-on-all-shellfish-products-from-red-tide-affected-towns/

Cherry, K. (2015). What Is the Self-Serving Bias? Retrieved November 2, 2015 from http://psychology.about.com/od/cindex/fl/What-Is-a-Cognitive-Bias.htm

Convenience Sampling (2009, September 16).Convenience Sampling. Retrieved November 2, 2015 from https://explorable.com/convenience-sampling

Daily Mail Reporter. (2011, April 19). Men are more decisive (... but a woman is more open-minded), scientists claim. Retrieved November 2m 2015 from http: //www. Dailymail.co.uk/sciencetech/article-1378338/Men-decisive-woman-open-minded-according-new-research.html

Descriptive Correlational Method. Retrieved August 4, 2015 from http://www.ask.com/world-view/descriptive-correlational-method-c9155e5383f0590f

Dietrich, C. (2010) Decision Making: Factors that Influence Decision Making, Heuristics Used, and Decision Outcomes. Retrieved November 2, 2015 from http: //www .studentpulse.com/articles/180/decision-making-factors-that-influence-decision-making-heuristics-used-and-decision-outcomes

Edmonds, M. (2015).Do Men and Women Have Different Brains? Retrieved August 10, 2015 from http://science.howstuffworks.com/life/inside-the-mind/human-brain /men-women-different-brains.htm

Gazzaniga, M. S., Bogen, J. E., & Sperry, R. W. (1962). Some functional effects of sectioning the cerebral commissures in man. Proceedings of the National Academy of Science, 48, 1765– 1769.

Gregoire, C. (2015, September 30). We See Men As More Creative, And That's A Big Problem For Women. Retrieved November 2, 2015 from http: //www. huffingtonpost.com/entry/creativity-gender-bias_560a93fae4b0768126ff1599

Houston, T. (2014, October 17). Are Women Better Decision Makers? Retrieved August 8, 2015 from http://www.nytimes.com/2014/10/19/opinion/sunday/are-women -better-decision-makers.html?_r=0

Kase, L. (2010). Great Leaders are Great Decision-Makers. Retrieved August 5, 2015, from https://gbr.pepperdine.edu/2010/10/great-leaders-are-great-decision-makers/

Keller, M. (2010, July 21). How to Make Effective Business Decisions. Retrieved August 5, 2015, from http://www.businessnewsdaily.com/71-how-to-make-effective-business-decisions.html

16

Khazan, O. (2013, December 2). Male and Female Brains Really Are Built Differently. Retrieved November 4, 2015 from http: //www. theatlantic. com/health /archive/2013/12/male-and-female-brains-really-are-built-differently/281962/

Micua, L. (2015, April 12). 49 Sacks of Shellfish From Anda Seized. Retrieved August 1, 2015 from http://punch.dagupan.com/articles/news/2015/04/49-sacks-of-shellfish-from-anda-seized/

Missri, E. & Seminar, H. (2008, February 11). Gender Differences in Decision Making Processes: A Computerized Experiment. Retrieved November 4, 2015 from http://portal.idc.ac.il/en/schools/government/politicalpsychology/documents/gender_differences_in_decision_making_processes.pdf

Niu, A. (2014). Gender & the Brain: Differences between Women & Men. Retrieved November 2, 2015 from http://www.fitbrains.com/blog/women-men-brains/

No Red Tide in Dagupan, Only in Bolinao and Anda. (2015, March 29). Retrieved July Olinares, Z. (2012). MEN VS. WOMEN: GENDER ROLES IN DECISION MAKING.

Retrieved August 8, 2015 from https: //ainnizisoka. wordpress. com/2012/ 12/06/ men-vs-women-gender-roles-in-decision-making/

Panday, R. (2012, June 21). Decision support system B. sc. I.T. Retrieved August 5, 2015, from http://shovit.com.np/

Porter, J. (2014, October 4). You’re More Biased than You Think. Retrieved November 2, 2015 from http://www.fastcompany.com/3036627/strong-female-lead/ youre-more-biased-than-you-think

Taylor, J. (2013, May 20). Cognitive Biases are Bad for Your Business. Retrieved August 4, 2015 from https://www.psychologytoday.com/blog/the-power-prime /201305 /cognitive-biases-are-bad-business

What is Red Tide? Retrieved August 5, 2015 from https://www.oysterfarm.com/content/red_tide/

http://www.fastcompany.com/3036627/strong-female-lead/

https://www.psychologytoday.com/blog/the-power-prime

17

Iba’t ibang Paniniwala at Kaugalian ng mga Magsasakang Magulang sa Pagpapalaki ng kanilang mga Anak

Micah Bernadine A. Mondia, Joden M. Quesada, July Ann F. Leones, Rachel A. Laroya, and Pearl Natalie B

Panimula

Ang isang bata mula sa kulturang Pilipino ay tumatanggap ng patuloy na atensyon at tulong mula sa kanilang mga magulang at kamag-anak. Kapansin-pansin din ang tulong para sa bata na mula sa mga kapitbahay. Nagkakaroon ng pagkakaiba-iba sa lipunan at sa kung sino ang dapat mag-alaga sa bata at kung anong emosyon ang napapaloob sa pagitan ng nagbibigay kalinga at ng bata ayon sa pag-aaral ni George Guthrie at Pepita J. Jacobs na nalathala sa Philippine Star, A Point of Awarenessni Presciosa S. Soliven (2012). Isang obserbasyon mula sa artikulo ni Annika (June 2014) na kung saan ay kanyang binigyang diin na “Ang pinakamabuting paraan para makita ang kultura ng isang bansa o lugar ay ang pagbibigay pansin sa kung paano pinalaki ang isang bata”. Ang pagpapalaki sa mga bata ay isang representasyon ng kultura ng isang bansa. Ang impluwensya, hindi lamang ng pamilya kundi maging ang tradisyunal na kultura at kapaligiran na kanilang kinabibilangan ay nakakaapekto sa paglaki ng bata dagdag ni Annika.

Isang matatawag na preparasyon at pagkokondisyon sa paglaki ng bata ang

pagbibigay-kalinga, pagaalaga, at atensyon aniya ni Soliven. Pero sa kabila nito, ang bata ay hindi hinihikayat na magsarili hanggang sa tumuntong ito sa panahon kung saan ang bata ay mag-uumpisa nang mag-aral. Ayon kay Dr. Liane Alampay at Roseanne Jocson (2011) ng Ateneo de Manila, batid ng bawat magulang na ang pagkakamali at pagbagsak na kahaharapin ng kanilang mga anak ay kanilaring malaking responsibilidad. Ayon sa ibang pananaliksik at pag-aaral, naniniwala ang mga Pilipinong magulang na mayroon silang gampanin para ihanda at hubugin ang kanilang mga anak mula sa isang batang hindi aktibo patungo sa isang batang may tamang pagrarason at pagpipigil sa sarili. Ang pagkakaroon ng matinding gampanin na ihanda at hubugin ang isang bata ay maaaring magkaroon ng negatibong resulta kaysa sa mabuting kalalabasan. Kinakitaan din na ang gampanin ng mga magulang ay malimit na mapansin sa tuwing ang bata ay masunurin at kapansin-pansin kapag ang bata ay nakakagawa ng pagkakamali.

Sa artikulo ni Cora Llamas (2011), “Parenting, Pinoy style” sinasabing ang istilo ng mga magulang sa pagpapalaki ng kanilang mga anak ay isang produkto ng panahon mula sa partikular na kultura ayon kay Celia Aguila, isang Propesor mula sa Miriam College. Sa Parenting Study ni Aguila (2003) sinasabing isang dahilan ang edad ng magulang at ang taon ng kanilang kapanganakan ang maaaring makaapekto sa kanilang istilo sa pagpapalaki ng kanilang mga anak. Ang mga magulang sa edad na apatnapu ay maaaring hindi istrikto sa kanilang mga anak sa kabila ng istriktong pagpapalaki sa mga ito. “Ang

mga magulang na ipinanganak sa taong 1960 ay maaaring maging strikto o di kaya nama’y maluwag, ito ay nakadepende sa kinakaharap nilang mga sitwasyon. Maaaring higit silang mahigpit pagdating sa pagbibigay ng limitadong oras sa paglabas-labas at higit ang binibigay na pagtitiwala sa kanilang mga anak tungkol sa pagaaral.” Hinihikayat na mai-stereotyped ang makapilipinong istilo ng mga magulang sa pagpapalaki ng kanilang mga anak dagdag ni Felipe Jocano Jr. ng University of the Philippines sa artikulo ni Aguila. Dahil ayon sa kanya ang istilo ng mga magulang sa pag papalaki ng kanilang mga

18

anak ay nagkakaroon ng pagkakaiba mula sa chronological order, socio-economic status, geographical location at ethno-linguistic culture. Napapatatag ang interpersonal na kultura ng Pinoy sa pagkakaroon ng malapit na loob habang ang isang bata ay nasa kanyang murang edad, dagdag ni Jocano (2006). Ito ay taliwas sa pag-aaral

ni Aguila sa kanyang artikulo, na ang pagpoprotekta ng mga magulang sa kanilang mga anak ay magdudulot ng patuloy na pagkadepende sa emosyon at pinansyal na estado ng kanilang buhay hanggang sa kanilang pagtanda. Ang suporta ng mga magulang ay kapansin pansin kahit na sila ay kasal na.

Balangkas ng Pananaliksik

Ang disiplina ay isang proseso sa kung saan itinuturo sa bata kung ano ang pag-uugali at normal na pag-uugali ng kanilang lipunan. Ito ay gabay sa moral, emosyonal at pisikal na paghubog sa bata, na kanilang magagamit bilang isang pag-iingat sa sarili at sa kanilang pagtanda. Ito ay nakatutulong na makapagbigay kamalayan sa limitasyon ng bata sa kung ano ang katanggap-tanggap at hindi katangap-tanggap na pag-uugali ng bata, kung ano ang tama at mali, at kung paano makisalamuha sa mundong kanilang ginagalawan. Binibigyang diin ng disiplina ang pangangaral at ang kahihinatnan ng bawat aksyon.Ang positibong pagdidisiplina ay madalas sinasamahan ng pagtulong sa batang maintindihan kung bakit ang isang pag-uugali ay di katanggap-tanggap at ang ibang pag-uugali ay tanggap” ayon sa pag-aaral ni Smith (2013).

Ang pagpapahalaga sa pamilya ay itinuring ng mga magulang bilang isang pangangaral na kanilang itinuturo sa kanilang mga anak. Kasama rito ang kung ano ang importante at kung ano ang pinahahalagahan sa loob ng pamilya gaya ng mabuting moralidad at disiplina sa sarili. Bagamat ang bawat pamilya ay may pagkakaib-iba ang ilan pang mabuting pag-uugali na itinuturo sa loob ng pamilya ay ang katapatan, lakas ng loob, kabaitan, mabuting asal at matatag na disiplina sa trabaho. Ang ama sa pamilya ay itinuturing na haligi ng tahanan at may responsibilidad na tugunin ang pangangailangan ng pamilya. Ang tradisyunal na trabaho ng isang ina ay ang hubugin at alagaan ang kanilang mga anak. Tinitignan ng isang bata ang kaniyang ina bilang isang malumanay at mabuti samantalang tinitignan ng isang bata ang kaniyang ama bilang isang malakas at nakakatakot sa loob ng pamilya. Hindi hinihikayat ng Pilipinong magulang ang kanilang mga anak na umalis sa kanilang tahanan kahit na ang kanilang anak ay nasa tamang edad na at handa ng bumuo ng sarili niyang pamilya. Dahil sa pagkakaroon ng malapit na loob ng mga magulang sa kanilang anak nahihirapan ang mga ito na pakawalan ang kanilang mga anak kahit nasa tamang gulang na sila.

Ganoon rin ang naisulat sa artikulo ni Soliven (2012) patungkol sa pagpapalaki ng mga magulang sa Pilipinas. Isa sa mga tungkulin ng mga magulang ang pakinggan ang bawat sumbong ng kanilang anak na kung saan ang mga magulang ay inaasang makinig at magbigay ng positibong komento sa pangyayari at sumbong nila. Ang mga magulang ay inaasahang magtatanong hinggil sa pangyayaring kinasangkutan ng anak at

magbibigay ng parusa sa naging kasalanan. Mahigpit ang obserbasyong ibinibigay ng Pilipinong magulang pagdating sa maipapakitang pag-uugali ng bata habang ito ay binibigyan ng kaparusahan sa maling nagawa. Mariing pinagbabawal ang pagsagot sa mga magulang, sakaling ang bata ay makapagbigay ng negatibong saloobin mas nakakatanggap ang mga ito ng mas mabigat na parusa.

Ayon naman sa pag-aaral ni Baumrind (1967), ang interaksyon ng magulang at ng bata ay mahalaga. Pinaniniwalaang ang mga magulang ay hindi dapat mapagparusa o malayo sa anak. Dagdag pa niya na may apat na dimensyon ang interaksyon ng magulang sa anak: a).pagkokontrol ng mga magulang, b).maturity demand, c).kalinawan ng komunikasyon at d).ang nurturance. Ang pagkokontrol mula sa magulang ay nakabatay sa isyu ng enforcing ruleso paraan ng pagbibigay ng motibasyon. Ang maturity demand ay isang pagnanais ng magulang na ang kanilang anak ay magagawa ng isang bagay na kung saan ay ibinibigay nila ang lahat ng kanilang kakayanan. Sinasabing pagpapakita ng malinaw na komunikasyon ang kagustuhan ng magulang na magkaroon ng kaugnayan sa kanilang mga anak, paghingi sa kanilang opinyon at pagrarason upang makuha ang ninanais na pag-uugali. Ang nurturance ay konektado sa pagpapakita ng mga magulang ng init at pagtanggap, at pagbibigay proteksyon sa pisikal at emosyonal na pagkatao ng bata. Gamit nitong apat na dimensyon, natukoy niya ang apat na istilo ng mga magulang sa pagpapalaki ng kanilang mga anak: Authoritative, Authoritarian, Permissive-indulgent, at Uninvolved.

Mula naman sa pag-aaral at artikulo na isinulat ni Dr. Alampay at Roseanne Jocson ukol sa Parenting Cognition (2011), sinasabi nilang walang pinagkaiba ang pagpapalaki ng magulang batay sa sekswalidad na ginagampanan ng mga magulang. Sinasabi ng parehong magulang na may kinalaman ang mga hindi kayang kontrolin na pangyayari sa matagumpay na kinahinatnan ng kanilang anak at parehas na may kinalaman ang mga ginagawang pangongontrol ng mga magulang o ang mga pangyayari sa paglaki ng bata sa pagbagsak o pagkakamali ng mga ito. Ayon pa kay Alampay at Jocson karamihan sa mga napatunayang pag-aaral na batid ng mga magulang na may higit silang responsibilidad upang hubugin ang kanilang anak mula sa isang hindi aktibong bata patungo sa isang batang aktibo. Dagdag pa sa artikulo ni Alampay at Jocson

19

na iminumungkahi ng mga literatura na ang tradisyunal na pamamaraan sa pagpapalaki ng mga bata ay kaakibat ng mas matibay na istratehiya sa pagdidisiplina gaya ng nararapat na pagpaparusa. Ayon pa sa kanilang artikulo na isang mithiin sa loob ng pamilya na ang ama at ina ay makapaghatid at makapagpakita sa kanilang mga anak ng pagkamatatag, kapanatilihan, at kakikitaan ng mabuting kilos at pag-uugali bilang isang magulang.

Ayon naman sa Social Learning theory ni Albert Bandura(1977)na kung saan sinasabi nitong ang pag-uugali ay natututunan mula sa kapaligiran at proseso ng pag-aaral gamit ng obserbasyon. Naniniwala si Bandura na ang tao ay isang active information processor na siyanginihalintulad sa kompyuter na kailangang aralin ang nilalaman sa loob at labas, kung saan ang mga reaksyon nito ay nakabase sa pangyayari sa kanyang paligid. Nakukuha ang atensyon ng bata ng ibang tao na nagsisilbing modelo at itinatanim sa isip ang mga naoobserbahang pag-uugali. Ang mga naobserbahang pag-uugali batay sa kaparehang sekswalidad ay maaari nilang gayahin o minsan nama’y hindi. Ngunit may mga pagkakataon na ang bata ay gumagawa o nagpapakita ng pag-uugali batay sa kaparehas nilang sekswalidad. Nagbibigay-pansin ang mga taong nakapaligid sa kung ano ang pag-uugali ng bata sa pamamagitan ngpagbibigay parusa at

pabuya. Kapag ang isang bata ay nagpapakita ng ugali na kanyang naobserbahan mula sa ibang tao at nakakapagbigay ito ng positibong pabuya sa bata maaari nitong ulit-ulitin ang ginayang pag-uugali. Ang isang paraan ng pampalakas o nagbibigay motibasyon sa isang indibidwalay maaaring nagmula sa eksternal o internal at maaring positibo o negatibo. Halimbawa nito ay ang batang naghahangad ng pagsang-ayon mula sa magulang at mga kaibigan, ang pagsang-ayon ay isang uri ng eksternal na pampalakas, ngunit ang kasiyahang dulot nito ay isang internal na pampalakas.Ayon naman sa artikulo ni Hayne W. Resse (2014) ukol sa Influences of John B. Watson’s Behaviorism on Child Psychology binanggit niya ang paniniwala nito na ang pagkaiba-iba ng isang indibidwal ay batay sa magkakaibang karanasan nito sa pag-aaral. Kanyang pinasikat ang kasabihang,“Bigyan mo ako ng isang dosenang malulusog na bata, nahubog ng mabuti at ang aking mundo para sila ay aking hubugin pa at sisiguraduhin kong ako’y kukuha ng kahit na sino sa kanila at akin siyang tuturuan na maging kahit na anong uri ng espesyalista. Maaari akong makapili ng isang doktor, tagapagtanggol, artista, punong mangangalakal at oo maging ang isang pulubi at magnanakaw, kahit na ano pa man ang kaniyang talento, kakayahan, abilidad, pinag-aralan at lahing pinanggalingan”(Watson, 1924, p. 104)

. Paradima ng Pananaliksik Input Proseso Awtput

Pigura 1. Ito ay nagpapaliwanag sa daloy ng pananaliksik ukol sa Kaugalian at Paniniwala ng mga Magsasakang Magulang

sa Pagpapalaki ng kanilang mga Anak Metodolohiya

Ang disenyong ginamit sa pananaliksik upang ilarawan ang katangian ng populasyon o ng isang penomena ay qualitative research design. Ang Qualitative Research Design ay ginagamit sa pangongolekta, pagsusuri, at pagbibigay-kahulugan sa datos sa pamamagitan ng pag-oobserba sa ginagawa at sinasabi ng mga kalahok. Ito rin ay tumutukoy sa mga bilang at mga panukala ng mga bagay. Ang mapaghambing na pananaliksik ay tumutukoy sa mga kahulugan, mga konsepto, mga katangian, metapora, mga simbolo, at mga paglalarawan ng mga bagay.

Ang pananaliksik na ito ay ginamitan ng purposive sampling upang piliin ang mga nais na

kalahok. Ang Purposive Sampling ay isang uri ng non-probability sampling na kung saan ito ay mas nagiging epektibo kapag ang mananaliksik ay may pangangailangan sa pag-aaral ng isang espisipikong kultura kasama ng isang dalubhasa. Sa pamamagitan ng purposive sampling, limang magsasakang pamilya mula sa barangay San Miguel, Agoo, La Union ang pinanggalingan ng datos na siyang nasa pamamahala ng kanilang punong barangay.

Ang unang magsasakang magulang ay 27 taon nang magsasaka. Ang kalahok ay parehas na nasa 48 taong gulang, may tatlong anak. Mula sa tatlong anak dalawa ang nakatapos. Ang

Iba’t ibang

Paniniwala at

Kaugalian ng mga

Magsasakang

Magulang sa

Pagpapalaki ng

kanilang mga

Anak

Pag-aanalisa sa mga datos na

galing sa ginawang:

a. Pagtatanong-tanong

b. Pakikipagkwentuhan

c. Pakikipag palagayang-loob

d. Ginabayang Talakayan

e. Thematic Analysis

Personal na

Paniniwala at

Kaugalian

pagpapalaki ng

kanilang mga

anak.

20

pangalawang kalahok ay magsasaka sa loob ng 21 na taon. Ang mag-asawa ay nasa 51 at 46 na taong gulang na kung saan may tatlong anak na patuloy na nag-aaral. Ang pangatlong kalahok naman ay mag-asawang nasa 60 at 61 taong gulang at 35 taon nang nagsasaka. Ang pangatlongkalahok ay may limang anak na kung saan lahat sila ay nakatapos. Ang pang-apat na kalahok ay nasa 83 at 68 taong gulang. Nagsasaka sa loob ng 40 na taon. Mayroong anim na anak, ang lima ay nakapagtapos na at isa ay nag-aaral pa. Ang huling magulang na kalahok ay magsasaka na mula pagkabata. Ang mga kalahok na ito ay nasa 67 at 65 taong gulang may labindalawang anak at ilan sa mga ito ay hindi pa nakatapos.

Ang mga mananaliksik ay gumamit ng mga pamamaraan upang kalapin ang datos. Pagtatanung-tanong ang unang uri ng paraan na ginamit. Ito ay itinuturing na isang impormal na interbyu dahil sa pagkakahawig ng dalawa. Ayon kay Pe Pua (2006) magkaiba ang dalawang metodo. Dahil sa pamamaraang ito nagkaroon ng pagkakataon na ilahad ng mga mananaliksik ang kanilang motibo. Ginamit ng mga mananaliksik ang paraan ng pakikipagkwentuhanupang makakalap pa ng mga kinakailangang datos na naging daan upang ang mga mananaliksik at kalahok ay makapagpalagayang-loob. Ang

pakikipagkwentuhan ay nangyari pagkatapos ng pagtatanung-tanong kung saan ang mga mananaliksik at ang kalahok ay nagkaroon ng simpleng pag-uusap sa panahong nakalap na ang mga pangunahing datos. Sa panahong nagawa ang pakikipagkwentuhan at naging matagumpay ang pakikipagpalagayang-loob, nagtalaga ng petsa ang mga mananaliksik para sa masinsinang pag-uusap kasama ng mga kalahok. Ang metodong ito ay tinatawag na ginabayang talakayan. Dito nagkaroon ng mga tanong ukol sa mga paniniwala at kaugalian ng magsasakang magulang sa pagpapalaki ng kanilang mga anak. Bawat kalahok ay nagkaroon ng pagkakataong sumagot sa bawat tanong. Dito nailahad ng mga kalahok ang kanilang mga malalim nakaisipan at saloobin sa mga katanungan ng mga mananaliksik. Ang kanilang sagot ay sa paraan ng isang opinyon, pananaw o pagsang-ayon sa mga kasagutang nailahad.

Ang ginamit na metodo ay ang thematic analysis na kung saan ang mga nakalap na datos ng mga kalahok ang magiging basehan ng mga temang mapapalitaw. Sa pamamagitan ng metodong ito nagawa nitong tipunin at pagsamahin ang mga ideyang nailahad sa kasagutan ng mga kalahok

. Kinahinatnan at Pagtalakay

Sa kabanatang ito naipapaliwanag ang kinasapitan ng pagaaral na isinagawa ng mga mananaliksik. Dito ipinakita na ang bawat magulang na nabibilang sa pagsasaka ay may kaniya-kaniyang saloobin, opinyon at pananaw tungkol sa

paniniwala at kaugalian ng magsasakang magulang sa pagpapalaki ng kanilang mga anak. Dito ay tinalakay din ang mga temang napalitaw batay sa tugon ng magsasakang magulang.

Paniniwala sa Pagpapalaki ng Anak

Sa pagsusuri sa mga tugon ng magsasakang magulang, lumalabas ang iba’t ibang paniniwala nila sa pagpapalaki ng kanilang anak. Ayon sa mga kalahok, lahat sila ay sumang-ayon sa pananiniwala nilang isa sa mga naging paraan nila sa pagpapalaki ng kanilang mga anak ay ang madala ang mga ito sa isang maayos na paaralan. Itinuturing ng mga kalahok na isang malaking gampanin lalo na sa pagpapalaki nila sa kanilang mga anak ang sila ay makatapos.

“Kasjay met laeng mam, ibagbagak,nu han kayo agiskwela sikayo met lang maisagot ta agpamilya. Sikayon to kasta met lang saad yo kasla kanyam. Bumabbaket met tao haan met lumawlawa ti daga. Amin

nga kabalinam latta a ket ited mo. Kaskada jay ihemplom dagiti nakapaadal. Kala kitaem tay pamilya na marigrigat ngem kitaem kasla kasjay”(Mag#2).

(“Ganoon din mam, sinasabi ko sa mga anak ko na kapag hindi kayo mag-aaral kayo rin lang ang mahihirapan dahil kapag nagkapamilya na kayo ganoon din ang magiging kalagayan ninyo katulad sa amin, tumatanda ang tao hindi naman lumalaki ang lupang sakahan. Lahat ng kaya mong gawin para sa anak mo kailangan mong ibigay. Ipakita mo rin bilang isang ihemplo yung mga taong nakapagtapos na. Na sila mahirap din pero tingnan mo sila. Parang ganun.”)

21

Talahanayan 1. Paniniwala ng mga magsasakang magulang sa pagpapalaki ng kanilang anak

Paniniwala Bilang ng Pamilyang Sumang-ayon

Bahagdan (%)

1.Makapagtapos ang anak 5 100% 2. Hindi dapat mapagparusa sa anak 4 80% 3. Ang mag-asawa ay dapat magtulungan sa pagpapalaki ng anak.

4 80%

4. Pantay-pantay na pagtingin at pagdidisiplina sa anak 3 60% 5.Hindi dapat mapagpahiya kapag dinidisiplina ang anak 2 40% 6. Pagkakaroon ng takot sa Diyos 2 40% 7. Pagiging isang mabuting ihemplo 1 20%

Dito pumapasok ang pag-aaral ni Aguila (2006) na kung saan ayon sa kanyang pananaliksik, lubos ang tiwalang ibinibigay ng mga magulang sa kanilang mga anak patungkol sa kanilang pag-aaral. Isa rin sa mga sinang-ayunan nilang paniniwala mula sa kapwa magsasakang magulang sa pagpapalaki ng kanilang mgaanak ay ang pagbibigay ng pabuya at parusa sa bawat magagawang tama at mali. Lahat ng mga kalahok ay naniniwalang ang pagbibigay ng parusa ay nakadepende sa kung sino ang may sala at kung ano ang nagawa.Ayon sa kanila, bilang isang magulang maiging alamin ang buong pangyayari bago ibigay ang tamang paraan ng pagdidisiplina.Ayon kay Soliven (2012) ang tungkulin na alamin ng mga magulang ang pangyayari ay isang paraan ng pagsusumbong ng isang bata. Kailangang alamin ng magulang kung sino at ano ang ginawa.

Sumang-ayon din ang 80% na magsasakang magulang sa isa sa mga paniniwalang hindi dapat maging masyadong mapagparusa ang magulang sa kanilang anak dahil pwede itong maging dahilan ng kanilang pagrerebelde.Kaya’t sumang-ayon ang mga magsasakang magulang sa sagot ng kapwa nila magulang na ang pagdidisiplina sa anak o pagbibigay parusa sa kanila ay maging personal. Hindi hinihikayat ng mga magulang ang pagpaparusa sa harap ng ibang tao dahil tinitignan nila itong paraan ng isang pagpapahiya sa kanilang anak.Kasabay nito ang pag-sangayon ng 60% na magulang ay kailangang magkaroon ng pantay-pantay na pagtingin sa mga anak. Bagamat, 40% sa magulang na magsasaka ay nagsabing minsan ay nagkakaroon sila ng pagkiling sa kanilang mga anak na mas malambing kesa sa iba. “Haan adda met gamin ti anak mo nga nagloving ngay, wen nga, kiss nga kiss kenka ngem adda kayat na” (Mag#4) (“May mga anak ka rin kasi na malambing, yun bang halik ng halik sa iyo, pero meron pala siyang hihingiing pabor”)

Ayun kay Smith (2013), ang bawat pagbibigay parusa at pabuya ay paraan ng pagdidisiplina ng magulang sa kanilang mga anak, ay makakatulong na makapagbigay kamalayan at limitasyon sa bata sa kung ano ang katanggap-

tanggap at di katanggap-tanggap na pag-uugali sa isang lipunan. Ito rin ay gabay ng mga bata sa kanilangmoral, emosyonal at pisikal na paghubog. Isang paniniwala pa ng magsasakang magulang ay pagtutulungan nilang mag-asawa sa mga suliranin at pagdidisiplina sa bata. Naging tugon din ng mga kalahok ang pagkakaroon ng paniniwalang ang isang bata sa murang edad ay kailangang magkaroon ng takot sa Diyos na sinang-ayunan naman ng 40% magsasakang magulang. “Magkakasunod na yun, kapag may takot sa Diyos susunod ang katapatan at mapagkakatiwalaan, andun na lahat yun” (Mag#1) Naging tugon din ng mga kalahok ang pagiging isang mabuting ihemplo sa kanilang mga anak. Tinitingnan nila na ang impluwensyang maibibigay nila ay para rin sa kinabukasan ng kanilang anak. Sa mga tugon ng kalahok, lumalabas na malaki ang epekto ng bawat paniniwalang kanilang pinanghahawakan bilang isang magulang na magsasaka sa pagpapalaki ng kanilang anak. Dahil dito karamihan sa mga magulang na patuloy na pinanghahawakan ang personal nilang paniniwala ay nagkaroon ng pagkakataon na makita ang kanilang mga anak na magkaroon ng magandang buhay.

“Wen nakatulong met. Experience ko atoyen ta jay anak ko nagballog, ayna pinasardeng mi ngem binangon mi, innikkan mi met lang pinagnaknakmanan na,timmulong nga nagtaltaltalon, nagarado met, idi narigatanen imbaga na nga agiskwelan sunga pinagiskwela mi ngem pinag promise mi” (Mag#4). (“Oo, nakatulong naman. Naging karanasan na namin ito ng asawa ko. Dahil yung anak ko nagbulakbol. Kaya pinatigil namin siyang mag-aral at patuloy namin siyang pinagsasabihan. Pinagtrabaho namin siya sa bukid hanggang sa napagod at nahirapan na siya. Kaya ginusto na niyang bumalik sa pag-aaral. Pero kinausap namin siya na kailangan niyang mangako na tatapusin niya ito”)

Ang mga paniniwawalang ito ay pinaniniwalaan nilang malaki ang naitulong sa paghubog at kinasapitan ng kanilang mga anak.

22

Talahanayan 2.Tema sa Paniniwala ng magsasakang magulang.

Paniniwala Tema: Ang paniniwala ng magulang na mapag-

aral ang mga anak ay isa sa mga tinuturing

nilang malaking impluwensya na makatutulong

sa kasalukuyan at kinabukasan ng kanilang mga

anak.

Kaugalian sa Pagpapalaki ng Anak

Ang mga ilan pang pagsusuri sa mga tugon ng kalahok ay nagpapakita ng iba’t ibang kaugalian nila sa pagpapalaki ng kanilang mga anak.

Para sa magsasakang magulang ang may pinakamalaking bahagdan ng kaugalian nila ay ang pagtuturo ng disiplina at ang pagkakaroon ng magandang asal. Para sa mga magulang napakalaking bagay na maturuan ang mga bata ng magandang asal. Ito ay maaaring dalhin ng bata hindi lamang sa kasalukuyang buhay hanggang maging sa kanyang kinabukasan. Ayon kay Baumrind (1967) may apat na dimensyo ng interaksyon ang magulang sa anak. Tinukoy ni Baumrind ang mga ito bilang pagkokontrol ng mga magulang, maturity demand, kalinawan ng komunikasyon at nurturance. Isang matatawag na kalinawan ng komunikasyon ang pagtuturo ng magandang asal pagkat ito ay ang kagustuhan ng magulang na magkaroon ng kaugnayan sa kanilang mga anak sa pamamagitan ng paghingi ng kanilang opinyon at pagrarason upang makuha ang ninanais na pag-uugali. Ang pagtuturo ng magandang asal ay bahagi rin ng maturity demand kung saan ang mga anak ay inaasahang makagagawa ng isang bagay gamit ang kanilang buong kakayahan.

Ayon sa mga kalahok mahigpit nilang itinuturo ang paghingi ng permiso kung sila ay lalabas ng bahay kasabay nito ay ang pag-uwi ng kanilang mga anak sa tamang oras. Ayon sa mga magulang hindi ito isang uri ng paghihigpit bagkus ito ay ang kanilang pamamaraan para tukuyin ang mga kasama sa kanilang paglabas at itinuturing nilang pag-iingat sa kanilang mga anak ang pagbibigay ng oras sa kanilang pag-uwi. Ang kaugaliang ito ng mga magulang na Pilipino ay ipinakita sa artikulo ng philippinecountry.com (2006) na kung saan ay hindi maaaring umalis ang isang anak ng walang permiso mula sa magulang. Ang 80% na kalahok ay sumang-ayon sa kaugalian nilang ituro ang pagkakaroon ng responsibilidad, dahil ayon sa mga ito hindi nais ng mga magulang na makita ang kanilang mga anak na naghihirap sa buhay. Para sa mga magsasakang magulang, magkarugtong ang pagpupursige o ang pagiging responsable sa pag-angat ng kanilang mga anak.Kaugalian din ng 20% na magulang ang pagpalo sa anak bilang isang paraan ng pagpaparusa sa mga kasalanang kinasangkutan. Kahit may paniniwala silang hindi dapat mapagparusa ang isang magulang, ayon sa kanila nararapat ang pagpaparusa gaya ng pagpalo

depende sa bigat ng kasalanan. Sa mga kalahok na ama 40% ay umamin at nagsabing sila ay namamalo ngunit depende ito sa kasalanan at 20% naman mula sa mga ina ang nagsabi na hindi nila pinahihintulatang ang kanilang mga anak ay mapalo ng kanilang asawa. Sa artikulo ng philippinecountry.com (2006)ipinakita rito na ang mga batang anak ay may magkakaibang tingin sa kanilang mga magulang. Ang ama ay tinitignan bilang malakas at kailangang katakutan sa loob ng pamilya habang ang isang ina ay tinitignan bilang isang mapagmahal at mapagkalinga sa mga ito.

“Haanak gamin agbabaot ni mister laeng. Syak gamin nu agbaot nisunan itaray ko dagijay annak ko arakupek.” (Mag#4) (“Hindi kasi ako ang namamalo, si mister lang. Ako kasi kapag namalo na si mister itatakbo ko yung mga anak ko, yayakapin ko sila”)

Dito rin papasok ang pagkakaroon nila ng paniniwala na dapat ang mag-asawa ay nagtutulungan sa pagpapalaki ng kanilang mga anak habang ito ay sinusundan ng kanilang kaugalian sa magkaibang pamamaraan ng kanilang pagdidisiplina.

Isa pa sa mga naging tugon ng 40% kalahok ang kanilang pagsang-ayon sa paraan ng pandidispina nila sa pagbibigay ng pera na higit sa kinakailangan. Ayon sa mga magsasakang magulang nakaugalian nilang ibigay lang kung ano ang sapat lalo na’t ang halos ikinabubuhay nila ay nanggagaling sa kanilang pagsasaka. Samantalang 60% sa mga kalahok ay tinitignan na nakakabuti ang paniniwalang magbigay ng pabuya sa kanilang mga anak. Itinuturing nila itong isang paraan ng motibasyon para sa kanilang mga anak upang magpursige at maging isang mabuting anak sa hinaharap. “ti anak met gamin ket haan nga agpapada. Ket jay anak ko ket adda ti anak mo nga kelangan-aramidem ti kastoy ta igatangan ka ti kastoy-- tatnu maiduron”(Mag#4)

(“Ang anak naman kasi hindi pareparehas. Eh may anak akong sinasabihan kong gawin ang isang bagay at bibilhan ko siya ng bagay na gusto niya para siya ay magpursige”)

Ang mga tugon ng mga kalahok ay pagkumpirma sa teorya ni Bandura (1977) kung saan binigyang-diin niya na ang isang bata ay maaaring gawin ang isang bagay ng paulit-ulit lalo na ito ay may katumbas na papuri o pabuya mula

23

sa mga taong nakapaligid sa kanya. Ngunit hindi parin mawawala at napakahalaga parin sa mga kalahok ang pagtitipid. Isa rin sa mga nakaugalian nila na ang batang lalaki o ang anak na lalaki ang madalas nakakasama nila sa trabahong bukid samantalang ang mga babae nama’y sa gawaing bahay na binigyang-diin sa pag-aaral ni Aguila (2006) na kung saan ang mga anak na lalaki ay mas binibigyan ng mas mabibigat na trabaho kaysa sa mga babaeng anak. Bagamat sa mga magulang ito ay isang patas na gampanin para sa kanilang mga anak ano pa man ang kanilang sekswalidad.

Nakaugalian din ng mga magsasakang magulang na makasama ang kanilang mga anak hanggang sa sila ay mag-asawa. “Uray adda asawa na ti annak mon

kabkabalay mo pay latta” (Pam#5) (“Kahit na may mga asawa na sila kasama

mo parin sila sa iisang bahay”) Ito ay pinatunayan bilang isang tradisyunal na kaugalian ng pamilyang Pilipino na

hindi hinihikayat ng mga magulang na umalis ang kanilang mga anak na nasa wastong gulang sa kanilang pangangalaga. Ayon kay Aguila ito ay isang paraan ng pagkadepende ng mga anak mula sa emosyon at pisikal na pangangailangan na kung saan ang pagkakaroon ng malapit na loob mula sa murang edad ng bata ayon kay Jocano (2006) ay nagpapatatag sa interpersonal na kultura ng Pinoy.Itinuring nilang mahalagang pagsasama-sama ang kaugaliang kumain ng sabay-sabay. Ayon sa mga kalahok, ito ay ang oras nila para makausap, lalo pang makilala at madisiplina ang anak.

Ang mga kaugaliang ito ay itinuturing na isang paraan at pagpapakita ng iteraksyon ng magulang sa kanilang mga anak na ipinakita sa pag-aaral ni Baumrind(1967). Ang interaksyon na ito ay tinignan naman mula sa artikulo nila Alampay at Jocson (2011) bilang isang matibay na istratihiya sa pagdidisiplina at pagpapalaki ng anak.

Talahanayan 3. Kaugalian ng mga magsasakang magulang.

Kaugalian Bilang ng Pamilyang Sumang-ayon

Bahagdan (%)

1. Pagtuturo ng magandang asal 5 100% 2. Paguwi sa tamang oras 5 100% 3. Pagtuturo ng responsibilidad 4 80% 4. Pagsasama-sama ng mag-anak kahit may sarili ng pamilya 3 60% 5. Pagbibigay Pabuya 3 60% 6. Pagtitipid 2 40% 7. Pagbibigay parusa 1 20%

Para sa magsasakang magulang ang may

pinakamalaking bahagdan ng kaugalian nila ay ang pagtuturo ng disiplina at ang pagkakaroon ng magandang asal. Para sa mga magulang napakalaking bagay na maturuan ang mga bata ng magandang asal. Ito ay maaaring dalhin ng bata hindi lamang sa kasalukuyang buhay hanggang maging sa kanyang kinabukasan. Ayon kay Baumrind (1967) may apat na dimensyo ng interaksyon ang magulang sa anak. Tinukoy ni Baumrind ang mga ito bilang pagkokontrol ng mga magulang, maturity demand, kalinawan ng komunikasyon at nurturance. Isang matatawag na kalinawan ng komunikasyon ang pagtuturo ng magandang asal pagkat ito ay ang kagustuhan ng magulang na magkaroon ng kaugnayan sa kanilang mga anak sa pamamagitan ng paghingi ng kanilang opinyon at pagrarason upang makuha ang ninanais na pag-uugali. Ang pagtuturo ng magandang asal ay bahagi rin ng maturity demand kung saan ang mga anak ay inaasahang makagagawa ng isang bagay gamit ang kanilang buong kakayahan.

Ayon sa mga kalahok mahigpit nilang itinuturo ang paghingi ng permiso kung sila ay lalabas ng bahay kasabay nito ay ang pag-uwi ng kanilang mga anak sa tamang oras. Ayon sa mga magulang hindi ito isang uri ng paghihigpit bagkus ito ay ang kanilang pamamaraan para tukuyin ang mga kasama sa kanilang paglabas at

itinuturing nilang pag-iingat sa kanilang mga anak ang pagbibigay ng oras sa kanilang pag-uwi. Ang kaugaliang ito ng mga magulang na Pilipino ay ipinakita sa artikulo ng philippinecountry.com (2006) na kung saan ay hindi maaaring umalis ang isang anak ng walang permiso mula sa magulang. Ang 80% na kalahok ay sumang-ayon sa kaugalian nilang ituro ang pagkakaroon ng responsibilidad, dahil ayon sa mga ito hindi nais ng mga magulang na makita ang kanilang mga anak na naghihirap sa buhay. Para sa mga magsasakang magulang, magkarugtong ang pagpupursige o ang pagiging responsable sa pag-angat ng kanilang mga anak.Kaugalian din ng 20% na magulang ang pagpalo sa anak bilang isang paraan ng pagpaparusa sa mga kasalanang kinasangkutan. Kahit may paniniwala silang hindi dapat mapagparusa ang isang magulang, ayon sa kanila nararapat ang pagpaparusa gaya ng pagpalo depende sa bigat ng kasalanan. Sa mga kalahok na ama 40% ay umamin at nagsabing sila ay namamalo ngunit depende ito sa kasalanan at 20% naman mula sa mga ina ang nagsabi na hindi nila pinahihintulatang ang kanilang mga anak ay mapalo ng kanilang asawa. Sa artikulo ng philippinecountry.com (2006)ipinakita rito na ang mga batang anak ay may magkakaibang tingin sa kanilang mga magulang. Ang ama ay tinitignan bilang malakas at kailangang katakutan sa loob ng

24

pamilya habang ang isang ina ay tinitignan bilang isang mapagmahal at mapagkalinga sa mga ito.

“Haanak gamin agbabaot ni mister laeng. Syak gamin nu agbaot nisunan itaray ko dagijay annak ko arakupek.” (Mag#4) (“Hindi kasi ako ang namamalo, si mister lang. Ako kasi kapag namalo na si mister itatakbo ko yung mga anak ko, yayakapin ko sila”)

Dito rin papasok ang pagkakaroon nila ng paniniwala na dapat ang mag-asawa ay nagtutulungan sa pagpapalaki ng kanilang mga anak habang ito ay sinusundan ng kanilang kaugalian sa magkaibang pamamaraan ng kanilang pagdidisiplina.

Isa pa sa mga naging tugon ng 40% kalahok ang kanilang pagsang-ayon sa paraan ng pandidispina nila sa pagbibigay ng pera na higit sa kinakailangan. Ayon sa mga magsasakang magulang nakaugalian nilang ibigay lang kung ano ang sapat lalo na’t ang halos ikinabubuhay nila ay nanggagaling sa kanilang pagsasaka. Samantalang 60% sa mga kalahok ay tinitignan na nakakabuti ang paniniwalang magbigay ng pabuya sa kanilang mga anak. Itinuturing nila itong isang paraan ng motibasyon para sa kanilang mga anak upang magpursige at maging isang mabuting anak sa hinaharap. “ti anak met gamin ket haan nga agpapada. Ket jay anak ko ket adda ti anak mo nga kelangan-aramidem ti kastoy ta igatangan ka ti kastoy-- tatnu maiduron”(Mag#4)

(“Ang anak naman kasi hindi pareparehas. Eh may anak akong sinasabihan kong gawin ang isang bagay at bibilhan ko siya ng bagay na gusto niya para siya ay magpursige”)

Ang mga tugon ng mga kalahok ay pagkumpirma sa teorya ni Bandura (1977) kung saan binigyang-diin niya na ang isang bata ay maaaring gawin ang isang bagay ng paulit-ulit lalo na ito ay may katumbas na papuri o pabuya mula

sa mga taong nakapaligid sa kanya. Ngunit hindi parin mawawala at napakahalaga parin sa mga kalahok ang pagtitipid. Isa rin sa mga nakaugalian nila na ang batang lalaki o ang anak na lalaki ang madalas nakakasama nila sa trabahong bukid samantalang ang mga babae nama’y sa gawaing bahay na binigyang-diin sa pag-aaral ni Aguila (2006) na kung saan ang mga anak na lalaki ay mas binibigyan ng mas mabibigat na trabaho kaysa sa mga babaeng anak. Bagamat sa mga magulang ito ay isang patas na gampanin para sa kanilang mga anak ano pa man ang kanilang sekswalidad.

Nakaugalian din ng mga magsasakang magulang na makasama ang kanilang mga anak hanggang sa sila ay mag-asawa. “Uray adda asawa na ti annak mon

kabkabalay mo pay latta” (Pam#5) (“Kahit na may mga asawa na sila kasama

mo parin sila sa iisang bahay”) Ito ay pinatunayan bilang isang tradisyunal na kaugalian ng pamilyang Pilipino na hindi hinihikayat ng mga magulang na umalis ang kanilang mga anak na nasa wastong gulang sa kanilang pangangalaga. Ayon kay Aguila ito ay isang paraan ng pagkadepende ng mga anak mula sa emosyon at pisikal na pangangailangan na kung saan ang pagkakaroon ng malapit na loob mula sa murang edad ng bata ayon kay Jocano (2006) ay nagpapatatag sa interpersonal na kultura ng Pinoy.Itinuring nilang mahalagang pagsasama-sama ang kaugaliang kumain ng sabay-sabay. Ayon sa mga kalahok, ito ay ang oras nila para makausap, lalo pang makilala at madisiplina ang anak.

Ang mga kaugaliang ito ay itinuturing na isang paraan at pagpapakita ng iteraksyon ng magulang sa kanilang mga anak na ipinakita sa pag-aaral ni Baumrind(1967). Ang interaksyon na ito ay tinignan naman mula sa artikulo nila Alampay at Jocson (2011) bilang isang matibay na istratihiya sa pagdidisiplina at pagpapalaki ng anak.

Talahanayan 4. Tema ng Kaugalian ng magsasakang magulang

Kaugalian Tema: Ang kaugalian ng mga kalahok ay

itinuturing na interaksyon sa kanilang mga

anak hindi lamang sa kanilang pagkabata kundi

maging sa kanilang pagtanda.

Konklusyon

Batay sa nakalap na datos, ang sumusunod ay kongklusyon ng mga mananaliksik: 1. Ang mga magsasaka ay mayroong paniniwala na

malaki ang impluwensya at maidudulot ng pag-aaral para sa kanilang mga anak.

2. Ang iba’t ibang kaugalian ng magsasakang magulang ay itinuturing nilang pagkakaroon ng interaksyon sa kanilang mga anak na kanilang pinaniniwalaang nakakatulong sa

emosyonal at mental na pangangailangan ng anak ng mga kalahok.

3. Ang paniniwala at kaugalian ng mga magsasakang magulang sa pagpapalaki ng kanilang anak ay isang malaking impluwensya na maaring makatulong sa kanilang buhay sa kasalukuyan at sa kanilang kinabukasan. Napatunayan na ang iba’t ibang paniniwala at kaugalian ng mga kalahok ay nakahubog sa paglaki ng kanilang mga anak.

25

Rekomendasyon

Ang mga sumusunod ay ang mga nabuong rekomendasyon batay sa kinahinatnan ng pag-aaral:

1. Hinihikayat ng mga mananaliksik ang mga magulang na paigtingin pa ang kanilang personal na paniniwala sa pagpapalaki ng kanilang anak. Ang mga paniniwalang ito ay nagsisilbing gabay ng bawat magulang upang mahubog pa nila ang kanilang mga anak.

2. Patuloy nilang ituro at payabungin ang kanilang mga personal na kaugalian hindi lamang sa kanilang mga anak kundi sa mga kanilang magiging apo o di kaya nama’y sa mga mag-asawang ninanais magkaroon ng maayos na kahihinatnan sa kanilang mga anak.

3. Sa mga sumusunod na mananaliksik sa paksang ito, mainam na mas palawakin ang bilang ng

mga kalahok at pagdarausan ng pananaliksik upang magkaaroon pa ng mas malawak na pag-intindi sa pangangailangan at suliranin ng mga magsasakang magulang sa pagpapalaki ng kanilang mga anak. Maigi rin na ang mga susunod na kalahok sa ganitong pananaliksik ay mayroong 3 o higit pang anak upang matukoy pa ang iba’t-ibang paniniwala at kaugalian sa pagpapalaki ng kanilang mga anak. Magiging mainam din kung magkakaroon ng paghahambing mula sa mga paniniwala at kaugalian ng mga batang magulang at sa mga naunang henerasyon. O di kaya’y ang mga pagkakaiba-iba ng mga paniniwala ng mga Pilipino mula sa ibang lahi.

Sanggunian Annika (June 3,2014). My observations regarding child rearing in the Philippines

http://wanderlusting.me/lifein thephilippines/child-rearing-in-the-philippines/ Baumrind, D. (1967). Child care practices anteceding three patterns of preschool behavior.Genetic Psychology

Monographs, 75(1), 43-88 http://www.philstar.com/education-and-home/2012-10-04/855841/filipino-child-rearing-practices-delay-

maturity http://ls.ateneo.edu/module.php?LM=articles.detail&eid=1317625421191&id=1200296977945 http://www.healthtoday.net/FamilyWellness/2011/05May/ParentingPinoyStyle.aspx http://wanderlusting.me/lifeinthephilippines/child-rearing-in-the-philippines/ http://www.simplypsychology.org/classical-conditioning.html http://rmac-mx.org/influences-of-john-b-watsons-behaviorism-on-child-psychology/ http://www.lotsofessays.com/viewpaper/1692089.html

http://www.personalityresearch.org/papers/naik.html http://www.instructionaldesign.org/theories/operant-conditioning.html https://learningtheoriesandfamily.wordpress.com/ http://en.wikipedia.org/wiki/Erikson%27s_stages_of_psychosocial_development https://www.translate.com/filipino/qualitative-research-is-collecting-analyzing-and-interpreting-data-by-

observing-what-people-do-an/13417216 http://www.simplypsychology.org/bandura.html http://www.simplypsychology.org/information-processing.html http://www.philippinecountry.com/philippine_culture/common_family_traits.html

26

Farmers’ Level of Awareness and Acceptance

of the Proposed House Bill 4644

Sheena M. Estacio, Glen R. Estoque, Jayson G. Llego, Christian Jeff T. Mapile, and Madelyn P. Niño

Abstract

The study focused on the relationship between farmers’ level of awareness and their level of acceptance of the House Bill 4644 in terms of its contents, its possible effects, and the advantages and disadvantages of the merging. The relationships among their profile which includes age, gender, and educational attainment and their levels of awareness and acceptance were also explored. The study was a descriptive correlational research with 131 farmer respondents chosen through purposive sampling method. Majority of the respondents were male high school graduates whose age ranged from 40 to 50. The study found out that the respondents have low level of awareness and acceptance of the House Bill 4644 in terms of its contents and its possible effects while they have a slight awareness on the advantages and disadvantages of the merging. There is no significant relationship between the respondents’ profile and their level of awareness; although their educational attainment is significantly related to their awareness of the House bill. Further, there is a significant relationship between their educational attainment and their level of acceptance of the house Bill. However, their age and gender are not significantly related to their level of acceptance. Interestingly, their level of awareness and level of acceptance are significantly related. Keywords: farmers’ profile, House Bill 4644, possible effects, advantages and disadvantages of merging, level

of awareness, level of accpetance Introduction

Situational Analysis According to the No to Merger Agoo

Aringay Movement, the proposed merging of Agoo and Aringay towns to become an Agoo-Aringay City could impede the aim of Aringay to maximize significant areas in the town for economic development.

The movement finds it hard to understand how House Bill 4644 would support the merger when no study had outlined the desirability to achieve realistic goals. They believe that it must respect the unique characteristics and qualities of each town and thus are entitled to being heard by both of the governments of the two municipalities. The purpose of this study is to determine the level of awareness and acceptance of the farmers regarding the proposed House Bill 4644.

According to Diosdado N. Magpali (LDRRMO-I), Local Disaster Risk Reduction Officer in Agoo, La Union, at first Aringay is not connected on the planning of Agoo to become an official city but there is an issue when it comes to territorial dispute and boundaries. Agoo wants to claim Dulao, San Eugenio and Alaska because officials believed that these barangays are originally part of the town. Further, the officials also believed that Aringay is only a part of Agoo. This study aimed to find out the level of awareness and acceptance of the farmers of the said House bill. Results of the study will provide more knowledge and awareness on the possible outcomes that may happen in the merging of the two municipalities.

Independent Variables Dependent Variables Figure 1. The Research Paradigm

Profile of the Respondent

A. Age

B. Educational Attainment

C. Gender

D.

Level of Awareness as to: House Bill Contents

a. Possible Effects b. Advantages and Disadvantages

of the Merging c.

Level of Acceptance as to: a. House Bill Contents b. Possible Effects

c. Advantages and Disadvantages of the Merging

27

Statement of the Problem

The study aimed to find out the relationship between the level of awareness and acceptance of the farmers of House Bill 4644. Specifically, this study sought to answer the following questions:

1. What is the profile of the farmers in the selected barangays of Agoo and Aringay, La Union as to their: 1.1 age; 1.2 educational attainment; and 1.3 gender?

2. What is the level of awareness of the farmers in the following aspects of the House Bill 4644: 2.1 house bill contents; 2.2 possible effects;

2.3 advantages; and 2.4 disadvantages?

3. What is the level of acceptance of the farmers on the proposed House Bill 4644?

4. Is there a significan relationship between the profile of the respondents and their level of awareness of the House Bill 4644?

5. Is there a significant relationship between the profile of the respondents and their level of acceptance of the House Bill 4644?

6. Is there a significant relationship between the level of awareness of the farmers and their level of acceptance of the House Bill 4644?

Framework of the Study Merging of two or more municipalities in relation to the development of the economy is a common strategy of local government officials here in the Philippines. But with the situation of Agoo and Aringay La Union, there are many speculations - like merging of the two municipalities –that it has advantages and disadvantages to people. The purpose of this study is to identify the level of awareness of the farmers and their level of acceptance of the merging of the two municipalities.

While merging municipalities may improve the budgetary performance of a municipality, it may also bring negative effects in its wake. First, the level of services to the residents may be harmed. Second, there may be a loss of correspondence between the residents’ preferences and the municipality’s activities (Ben-Bassat and Dahan, 2009).

When the number of residents in the municipality rises, it becomes difficult to satisfy everyone’s preferences, especially if there is a large discrepancy between the various residents’ preferences. Ben-Bassat and Dahan, (2009) found a negative correlation between municipality size and the subjective satisfaction of its residents. Third, citizens have less choice when it comes to deciding in which municipality’s jurisdiction to reside (Tiebout, 1956).

Fourth, reducing the number of municipalities may decrease the competition among municipalities in attracting new residents.

This study examined the related observed anomalies in expected-utility theory, how

prospect theory integrates these anomalies into an alternative theory of risky choice, and explores some of the implications of prospect theory for international conflict and for bargaining and coercion in particular. One assumption is that political leaders of adversarial states behave differently when they are bargaining over gains than when they are bargaining over losses. Another is that crisis behavior may be more destabilizing than commonly predicted by rational choice theories because leaders are less willing to make concessions and more willing to risk large losses in the hope of eliminating small losses altogether (Levy, 2008).

Another theory that involves the level of awareness about this particular issue is Sigmund Freud’s level of consciousness that contains three different types of awareness. The first one is the conscious mind, where an individual is paying attention of what occurs at the moment or the present time. If people who are living in the town of Aringay are aware of the proposed House bill, there is a big possibility that their level of awareness is high, in other words the conscious mind can constitute a large part of the current awareness. Next is the preconscious mind which includes those things of which an individual is aware but does not focus much on what goes on around him. A person can choose to pay attention to some and can deliberately bring them to the conscious mind. The last one is the subconscious; thus, the individual thinks and acts independently.

Methodology

Research Design The research design used in this study is the descriptive correlational survey research. The descriptive correlational survey research design is

used in order to describe the present conditions of the level of awareness of farmers in selected barangays of Agoo and Aringay towards the merger of the two towns.

28

Sources of Data

An initial survey was conducted by the researchers among the heads of Agricultural Offices in selected barangays of Aringay and Agoo. Eighty farmers from selected barangays in Aringay La Union and 51 farmers from Agoo, La Union served as sources of data. The sample of 98 farmers was derived using the purposive sampling technique.

Intrumentation and Data Collection The main instrument used in this study is

a constructed questionnaire which served as the major means in collecting the needed data for the research problem. The first part identified the profile of the respondents according to age, educational attainment, and gender. The second part determined the level of awareness and level of acceptability of the respondents in terms of House

bill contents, possible effects of the House Bill 4644, advantages, and disadvantages of merging.

Data Analysis The statistical tools used in this study were frequency counts, percentage, average weighted mean and Pearson Product Moment Correlation. The four-point rating scale was used (Likert 4-point rating scale) to determine the level of awareness and level of acceptance of the house bill among the respondents. As to problem number four, five, and six, the researchers made use of Pearson Product Moment Correlation to determine the relationship of the profile and level of awareness of the farmers on the House Bill 4644; the relationship of the profile of the respondents and level of acceptance on the House Bill 4644 and the relationship of the level of awareness and level of acceptance of the farmers.


Profile of the Respondents Result shows that majority of the farmers

of Agoo and Aringay, La Union fall under the age range of 43-50. It implies that most of them are on middle adulthood. The table shows that most of the respondents are high school graduates. One reason why most farmers have low educational

attainment is poverty. Because they do not have enough money to support their education, they resulted in farming instead of finishing school at their younger age. Finding supports Quora (2014) who linked farmers’ low education to poverty and early exposure to manpower as the main cause of the first.

Level of Awareness of the Farmers on the Proposed House Bill 464

Result shows that the farmers are not

aware of the House bill (1.67). They are only slightly aware of three items namely: the merging itself, the annual income of the two municipalities, and the inability of each of the two municipalities to meet the requirements of becoming a city alone.

According to Tafarodi and Malone (1993), people initially believe everything they see and hear (Seeing is believing.) but then rapidly assess whether it is true or not and consequently reject or continue to believe things. In relation to the merging of the two municipalities of Agoo and Aringay, the respondent farmers believed that there will be merging but they reacted negatively because they were probably tired of working for their daily source of living. Another reason is they are so busy in farming and have no time to know the contents of the House bill.

In terms of the possible effects of the House bill, the respondents do not know what

might happen if the two towns will merge and become a city. It could be because these farmers are so busy with their lives that they practice “inattention.” The idea is that if one is not passionate about something or he or she is not after something, chances are, he or she might also not be aware of it.

In terms of advantages of the House bill, there is only a slight awareness of the respondents in terms of the advantages of the merging (1.75). It implies that there are a lot of things that the government officials of Agoo and Aringay need to work out in order to increase the people’s level of awareness on the advantages of the merging.

In terms of disadvantages of House bill, the respondents are slightly aware of the disadvantages of the merging (2.01). It implies that the government needs to do something in order to increase the level of awareness of the farmers on the merging.

29

Level of Acceptance of Respondents of the House Bill 4644 Results show that almost all of the farmers

are not willing with the merging of the two municipalities because they only believe in one thing; they give importance about their hometown and they do believe that if the two municipalities will merge, the original identity of their place will be gone. Ross, Lepper, and Hubbard (1975) believed that once one decided to believe something, she or he will tend to keep on believing it, even in the face of disconfirming evidence.

As to the possible effects, the farmers do not accept the merging as shown by the mean of 1.62 interpreted as “not accepted.” without knowing the purpose of the House Bill 4644 and the technical benefits of it.

As to the advantages of merging, the farmers’ level of acceptance has an average weighted mean of 1.71, which is interpreted as “not

accepted”. Many people do not easily accept innovative ideas. They stick to the old way of their lives or their comfort zone. The only problem is, most individuals nowadays do not take the risk to engage new ways of ideas for them to have better lives.

As to the awareness of the disadvantages of merging, the farmers are slightly aware on the heritage of Agoo that will be combined with Aringay; thus, the original identity of Aringay might be lost.

Table 1 shows the relationship between

the profile of the farmers and their level of awareness on the House Bill 4644. Pearson Product Moment Correlation was used in determining the relationship of the variables.

Table 1. Relationship between Profile of Respondents and their Level of Awareness of the House Bill 4644

Profile Awareness on House Bill Content

Awareness on Possible Effect

Awareness on Advantages

Awareness on Disadvantages

Age Correlation Coefficient

.008 .031 -.070 .025

Sig. (2-tailed) .931 .725 .421 .774 Educational Attainment

Correlation Coefficient

.157 .260** .228** .206*

Sig. (2-tailed) .072 .003 .008 .016 Gender Pearson

Correlation .194 .094 .089 .021

Sig. (2-tailed) .055 .358 .386 .835

Using the two-tailed test at 0.01 level of significance, the educational attainment and the level of awareness of the possible effects obtained .260 which is the highest between the age and gender. Result implies that the higher the educational attainment, the higher is the farmers’ level of awareness about the House Bill 4644 in the following: possible effects, advantages of merging, and disadvantages of merging.

Decision-making is influenced by aspirations and capabilities. Individual members and family aspirations are reflected in goals, values, and means of achievement. Capabilities include general farm knowledge. These are related to age, formal education, and social contact (Iowa, 1981).

In relation to age and level of awareness of an individual, there are various stages of cognition according to Jean Piaget. As an individual grows older, the schema or the cohesive repeatable action sequence is more interconnected and elaborate. A schema can be defined as a set of linked mental representations of the world, which are used both to understand and to respond to situations.

Table 2 presents the relationship between the farmer’s profile and their level of acceptance on the House bill. Pearson Product Moment Correlation was used in determining the relationship of the variables.

30

Table 2. Relationship between the Farmers’ Profile and their Level of Acceptance of the House Bill 4644

Profile Acceptance on House Bill Content

Acceptance on Possible Effect

Acceptance on Advantages

Acceptance on Disadvantages

Age


-.065 .055 -.036 -.060

Sig. (2-tailed)

.459 .529 .683 .505

Educational Attainment


.180* .164 .218* .178*

Sig. (2-tailed)

.039 .059 .012 .044

Gender

Pearson Correlation

.012 .081 -.021 .049

Sig. (2-tailed)

.903 .428 .837 .633

Using two tailed test at 0.05 level of

significance, the correlation coefficient between educational attainment and the level of acceptance of the House bill content is .180; the level of acceptance of the advantages of merging is .218 and the level of acceptance of the disadvantages of merging is .178. It implies that level of acceptance of the farmers is not based on their age. As to educational attainment, the higher their educational attainment, the higher their level of acceptance of the House Bill 4644, as well as the advantages and disadvantages of merging. Thus, there is a significant relationship between the last three paired variables.

According to Iowa State University Institute of Agriculture and Services, the level of acceptance of an individual has several stages through which an individual goes from the time he learns an idea until he adopts it. Awareness is only part of the acceptance of an individual. It is the first stage of acceptance wherein, the individual at this stage learns the evidence of the idea but has little knowledge of it (Iowa, 1981).

The correlation coefficients between the gender and the level of acceptance of the House bill content is .012; between the gender and the level of acceptance of the possible effect is .081; between the gender and the level of acceptance of the advantages of merging is -.021 and between the gender and the level of acceptance of the disadvantages of merging is .049. Results mean that there is no significant difference between the paired variables. This implies that their acceptance of the House bill in terms of the possible effects, the advantages of merging and disadvantages of merging is not based on their gender. Whether a farmer is a male or female, it does not predict their level of their acceptance of the House Bill 4644.

Table 3 presents the level of awareness of

the respondents and their level of acceptance of the House Bill 4644. Pearson Product Moment Correlation was used in determining the relationship of the variables.

Table 3. Relationship between the Level of Awareness of the Respondents and their Level of Acceptance of the House Bill 4644

Level of Awareness/Level of Acceptance

House Bill Content

Possible Effect

Advantages of Merging

Disadvantages of Merging

Kendall's tau_b

House Bill Content


.599** .645** .564** .474**

Sig. (2-tailed) .000 .000 .000 .000 Possible effect


.662** .626** .643** .480**

Sig. (2-tailed) .000 .000 .000 .000 Advantages of Merging


.757** .693** .731** .581**

Sig. (2-tailed) .000 .000 .000 .000 Disadvan-tages of merging


.290** .264** .336** .148

Sig. (2-tailed) .001 .003 .000 .107

31

Table 3 reveals a significant relationship between each paired variable at .01 level of significance. It implies that if they are aware of the House bill, there is a tendency that they will accept the possible effects, advantages and disadvantages of the house bill.

According to the vice mayor of Aringay, the information campaigns per barangays are still not implemented, the local government unit only conducted a meeting among barangay captains and teachers, but not all of them attended the meeting. The vice mayor also said that if the other residents are aware about merging, maybe, they only believed rumors about the information of merger of Agoo and Aringay.

The correlation coefficients mean that there is a significant relationship between the paired variables of the level of awareness and the repondents’ level of acceptance. This implies that if the farmers are aware of the possible effects of the merging, there is a tendency that they will accept the House Bill 4644, its possible effect, the advantages and the disadvantages of merging. As

to the respondents’ level of awareness and level of acceptance, correlation coefficients show that there is a significant relationship between the paired variables. This implies that they are aware of the advantages of the House Bill 4644. There is a tendency that they will accept the House Bill 4644, its possible effect, the advantages and the disadvantages of merging.

The correlation coefficients mean that there is a significant relationship between the paired variables, the level of awareness and the level of acceptance. This implies that if they are aware of the disadvantages of merging, there is a tendency that they will accept only the House Bill 4644, its possible effect, and the advantages of merging. As explained by Iowa (1981), awareness is the first step to acceptance. Thus, in order for someone to accept a certain concept, he has to be aware of it. The more aware the farmers are with the different pros and cons of the merging of the two towns to form a city, the more likely they are going to accept the merging.

Conclusions Based on the findings of the study, the following conclusions were drawn:

1. Most of the respondents are males. Majority of the respondents are high school graduates and most of them are aged forty three to fifty years old.

2. The farmers’ level of awareness of the House bill contents is low, together with the possible effects. There is only a slight awareness of the respondents in terms of the advantages and disadvantages of merging.

3. The level of acceptance of the farmers on the proposed House Bill 4644 is low

4. There is no significant relationship between the profile of the respondents

and their level of awareness of House Bill 4644, but educational attainment is significantly correlated with their level of awareness of House Bill 4644.

5. There is significant relationship between educational attainment of the respondents and their level of acceptance, while there is no significant relationship between age and gender as to their level of acceptance.

6. There is a significant relationship between the farmers’ level of awareness and their level of acceptance of the House Bill 4644.

Recommendations

Based on the findings and conclusions of the study, the following recommendations and suggestions are hereby presented.

1. As to the farmer’s level of awareness and acceptance, the farmers should know and accept new ideas of their local officials until they fully adopt, accept or reject such ideas.

2. For the local government officials who are conducting this kind of municipal amalgamation, they should consider the

farmers’ level of acceptance and awareness of the merging.

3. For the next researchers, the respondents should also be the government officials.

4. For the local government officials, there should be immediate and proper information campaign about the merging of the two municipalities.

5. For the future researchers, they can make a replication of this study with another set of variables.

32

Literature Cited Ben-Bassat and Dahan (2013, July) Municipal Amalgamation. Retrieved March 16,

2015, from http: // taubcenter. org.il/ wpcontent /files_mf/ amalgam _taubcenter .org.il_ tauborgilwp_ wpcontent_ uploads_ e2013. 02 mun icipa lamalgamation.pdf

Eufranio C. Eriguel (2014, June 11) EXPLANATORY NOTES: House Bill 4644.Retrieved July 1, 2015, from http: //www. congress. gov.ph /download /basic_ 16/HB04644.pdf

Levy, J. (2008, May 6) Loss Aversion, Framing, and Bargaining: The Implications of Prospect Theory forInternational Conflict. Retrieved August 4, 2015, fromhttp: //citeseerx .ist. psu.edu /viewdoc/ download?doi =10.1.1.336.796&rep=rep1&type=pdf

Iowa state university, How Farm People Accept New Ideas. Retrieved November 1 2015, from http://www.soc.iastate.edu/extension/pub/comm/SP15.pdf

Ross, Lepper and Hubbard (1975), Belief Perseverance. Retrieved October 31, 2015, from http://changingminds.org/explanations/theories/automatic_believing.htm

Saul McLeod (2015), Simply PsychologyRetrieved: November 2, 2015 http://www.simplypsychology.org/piaget.html

Tafarodi, G. and Malone (1993), Automatic Believing.Retrieved October 31, 2015, from http://changingminds.org/explanations/theories/automatic_believing.htm

Tiebout, (1956). A pure Theory of Local Expenditures. Retrieved July 1, 2015, from http://www.unc.edu/~fbaum/teaching/PLSC541_Fall08/tiebout_1956.pdf

Tribune Wires, (2014). Proposed of merger of 2 La Union towns opposed Retrieved September 8, 2015, from http://www.tribune.net.ph/nation/proposed-merger-of-2-la-union-towns-opposed

http://taubcenter.org.il/wpcontent/files_mf/amalgam_taubcenter.org.il_tauborgilwp_wpcontent_uploads_e2013.02municipalamalgamation.pdf

http://taubcenter.org.il/wpcontent/files_mf/amalgam_taubcenter.org.il_tauborgilwp_wpcontent_uploads_e2013.02municipalamalgamation.pdf

http://www.congress.gov.ph/download/basic_16/HB04644.pdf

http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.336.796&rep=rep1&type=pdf

http://citeseerx.ist.psu.edu/viewdoc/download?doi=10.1.1.336.796&rep=rep1&type=pdf

http://www.soc.iastate.edu/extension/pub/comm/SP15.pdf

http://www.simplypsychology.org/piaget.html

http://changingminds.org/explanations/theories/automatic_believing.htm

http://www.unc.edu/~fbaum/teaching/PLSC541_Fall08/tiebout_1956.pdf

http://www.tribune.net.ph/nation/proposed-merger-of-2-la-union-towns-opposed

http://www.tribune.net.ph/nation/proposed-merger-of-2-la-union-towns-opposed

33

Farming Strategies and Level of Satisfaction of Farmers

Jerry V. Alambra, Gerald T. Briones, Shaira T. Mapile and Delia M. Imperial

Abstract

The study aimed to find out how frequent farmers use farming strategies. It also aimed to determine if there is a relationship between farmers’ farming strategies and their level of satisfaction. Descriptive correlation was used. Result showed the farmers’ frequent use of the following strategies in organic farming: 1) crop diversity (3.56), 2) soil management (3.65), 3) weed management (3.60), and 4) controlling other organisms (4.07). The use of animal manure was occasionally used (2.65).

In terms of the use of synthetic chemical fertilizer, results showed the farmers’ frequent use (3.91). For Genetically Modified Organism, the famers never used (1.00). Organic farming and level of satisfaction had a computed value of 0>no significant difference. Conventional farming and level of satisfaction had a computed value of 1.455>no significant difference. Organic farming and level of satisfaction are significantly related in terms of crop diversity (.389), soil management (.196), weed management (.408), controlling other organisms (.373), animal manure (.274). Conventional farming and level of satisfaction had a computed value of .332 which showed a significant relationship in terms of the use of synthetic chemical fertilizers. Keywords: organic conventional farming, level of satisfaction Introduction

Situation Analysis Farmers are said to be one of the most

industrious workers in the community. They do their job for everyday living and they are working not just for them but for the environment and for the whole industry.

Modern agriculture depends on high input of chemical fertilizer and pesticide for crop production, but the resulting ecological and economic impacts have not been positive and have added environmental pollution and food safety due to chemical contamination. This issue has become a great concern not only in the country but worldwide (City Express Agay-ayatKadakayo Amin, July-September 2008). Pesticides have been linked with deleterious effects on human health and that of the environment. They may also damage the lungs and nervous system. In nature, pesticides pollute the air, water, and ground. By controlling insects and rodents, pesticides prevent the spread of disease and protect buildings from termite infestations. Even surgical instruments and operating rooms are disinfected with pesticides, according to the Environmental Protection Agency (Engel, May 2015). GMO’s, or Genetically Modified Organisms, is a form of scientific farming where crops are pumped full of chemicals to increase yield and size of crops. It is highly debated and is

becoming more and more common in everyday foods. However, just like a coin, it also has its two sides (Occupy Theory, 2014).

According to Bello (2013), genetic engineering destroys the structure of the particular sequence of a food’s genetic code and interrupts the functions of neighboring genes, which can give higher or can increase to possibly harmful or allergenic molecules. It can even change the nutritional value of the food produced.

As defined by Sustainable Agriculture (2008), organic farming is a production system that avoids or largely excludes the use of synthetically compounded fertilizers, pesticides, growth regulators and livestock feed additives. Fertilizers are a major cost item in Philippine agriculture. They play a crucial role in improving crop production. They increase yield and enable the country to attain sufficiency in food and agro-industrial crops. Fertilizers have also made crop production possible in unproductive soils. Fertilizer is believed to contribute 30 to 50 percent of the increase in yield in crops. However, these high fertilizer prices have become a cause for concern since they squeeze farm incomes (Mikey, 2009).

In the Philippines, agriculture consists of small, medium, and large farms ranging from subsistence to commercial production and these

34

farmers utilize conventional method like using high yielding varieties of chemical fertilizers. The major agricultural products are rice, corn, coconut, sugar, livestock, and poultry. In 2009, the production of rice was 16.27 million tons; corn – 7.03 million tons; coconut – 15.67 million tons; sugarcane – 22.93 million tons; bananas – 9.01 million tons; mango – 0.77 million tons; livestock and poultry – 4.10 million tons equaling to a 0.37 percent growth.

During the year 2014, however, there was an excess of 1.83 percent growth in the agriculture sector which may have contributed to the production increments in the crops, livestock and poultry subsectors. The gross earnings increased compared to the previous year’s earnings. This was supplied by the positive performance of most commodities from the crops, livestock, and poultry subsectors.


Telman and Unsal (UK Essays, 2005)

define life satisfaction as the pleasure that a person gets from his/her life. On the other hand, Wilson (UK Essays, 2005) defines life satisfaction as the view that a person would be completely happy if he/she is satisfied in all aspects of life. Research has shown empirically that people can develop and grow happiness by using strategies to actively engage with life, to notice the everyday pleasurable aspects of living, to challenge individuals with the use of people signature strengths in new ways and to explore and respond to what gives is meaningful life (Psychology of Satisfaction, 2007). Organic farming is an agricultural method that uses techniques like crop diversity. Monoculture is a type of crop where one type is harvested and cultivated in a particular location. Polyculture is also a type of crop rotation wherein different kinds of crops are harvested and cultivated in order to meet the increasing crop

demand and to produce the required soil microorganisms. If crop diversity grows wider, farmers would be allowed to reap the environmental and energy advantages of longer, more complex crop rotation. Organic farming minimizes chemical usage. It promotes biodiversity, and improves soil health with organic farming practices. Only natural methods are used in organic farming while conventional farming makes use of chemicals, synthetics, and other materials to manage weeds and pests. There have been arguments around whether or not conventional farming methods are safe for one’s health. One of the biggest differences that are seen repeatedly across all research between the two farming practices is the effect on the land. Many people are concerned that those growing practices promote unsafe chemical use, especially because the level of toxicity is said to be under a “safe” level (Messner, 2013).

Independent Variable Dependent Variable

Figure 1. Research Paradigm Statement of the Problem This study aimed to discover the farming strategies used by the farmers and their level of satisfaction. Specifically the research aimed to answer the following:

1. What farming strategy is frequently used by the farmers? 2. What is the level of satisfaction of the farmers in terms of:

2.1 Organic Farming; 2.2 Conventional Farming?

3. Is there a difference in the level of satisfaction of the farmers as to: 3.1 Organic Farming; 3.2 Conventional Farming?

4. Is there a relationship between the farming strategies and level of satisfaction of the farmers?

Farming Strategies A.Organic Farming Strategy as to:

Crop Rotation Weed Management Soil Management Animal Manure Controlling Other Organism

B.Conventional Farming Strategy as to: Synthetic Chemical Fertilizer Genetically Modified Organism

Level of

Satisfaction

http://freshconnect.com/the-truth-about-organic

35

Methodology

Research Design The study used descriptive correlational

research design, a statistical measure of a relationship between two or more variables. This design gives an indication of how one variable may predict another. The descriptive research design involved the collection of data, tallying the responses of the respondents, analysis and interpretation of the gathered data to describe the farming strategies, and level of satisfaction of the respondents in this study.

Sources of Data There were 43 respondents in the study. The

researchers chose Urayong, Bauang, La Union as locale for the study because the barangay produces papaya, dragon fruit, guapple, grapes, rice, and corn as their crops. Convenient sampling technique was used in selecting the respondents based on their availability and convenience. The duration of the study was from September to October 2015.

Instrumentation and Data Collection The main instrument used in this study is a

questionnaire. The questionnaire had two parts. The first part consisted of the different strategies used by the farmers as to the use of the organic farming and conventional farming. This

determined how frequent they were using these strategies. The second part had something to do with their level of satisfaction classified as highly satisfied, satisfied, dissatisfied, and highly dissatisfied. This part determined how well they are satisfied in using the strategies. The questionnaire underwent face and content validation by pool of agriculture experts which resulted in a computed value of 4.75 interpreted as “Very Highly Validity”. The researchers also conducted a reliability test at Urayong, Bauang, La Union to determine whether the questionnaire has consistent scores. The reliability value for the level of satisfaction using organic farming strategies was .795 which was interpreted as “acceptable” while conventional farming strategies was .873 which was interpreted as “good”.

Analysis of Data The statistical tools used to analyze the

gathered data of the study were: Pearson Product Moment Correlation Coefficient and t-test using SPSS. The Likert 5-point rating scale was used in interpreting how frequently the farmers used these strategies while the Likert 4-point rating scale was used in interpreting the level of satisfaction of the respondents.

Results and Discussion The topics discussed in this chapter include the different strategies used by the farmers such as organic farming and conventional farming and

their level of satisfaction towards their farming strategies.

Farming Strategies Used by Farmers Under organic farming, “controlling other

organisms” has the highest mean of 4.07 with a descriptive rating of “Frequent” and the lowest is the use of animal manure with a mean of 2.65 and a descriptive rating of “Occasional”.

On the other hand, the use of synthetic chemical fertilizer has the highest mean of 3.91. This may imply that the frequency of its use can

be attributed to its immediate availability. ”Genetically modified organism” has a mean of 1.00 showing that it is never used by the farmers. This maybe because some are not yet familiar with this strategy. The Department of Agriculture in Urayong, Bauang La Union discourages this type of technique.

Level of Satisfaction of the Farmers on the Organic and Conventional Farming Strategies Result shows that the farmers are satisfied

in using organic farming strategy. Farmers use organic farming strategy to have a desirable outcome especially for the quality of different

crops that can satisfy their own needs. Based on the above result, satisfaction in organic farming implies that it would have a positive effect when it comes to the environment and also human health.

Mean Score of the Level of Satisfaction of the Farmers towards Conventional Farming Strategy The level of satisfaction of the farmers

towards conventional farming strategy has a descriptive rating of “satisfied” with an average

weighted mean of 2.72. Some of the farmers said that it would be easier for them to use chemical fertilizers to keep away the pests while the crops

36

are growing. Using this strategy, it would increase yield and enable the country to attain sufficiency of food and agro-industrial crops. Although it gives undesirable effect to human health and environment, farmers use this strategy because it

gives a desirable outcome in terms of quantity and sometimes it also gives quality to crops and removes pests and insects immediately than organic farming strategy.

Level of Satisfaction of Farmers on the use of Organic and Conventional Farming Strategies Table 1 presents the distribution of the

level of satisfaction of farmers on the use of identified farming strategies. Table 1 shows that there is a significant difference between the level of satisfaction of organic farming strategies and conventional farming strategies. Farmers are much satisfied using organic farming than conventional farming. This implies that organic farming may have a positive effect on the safety of human health, environment, especially in soil and crops. Although both organic and conventional farming strategies have a desirable outcome in

terms of quantity and quality of crops, conventional farming gives undesirable effect to the environment and to human health. The respondents also said that they really used organic farming as a technique for the protection of soil and plants, but some of them are still using conventional farming to keep away the pests that may destroy their crops. As promoted by the International Federation of Organic Agriculture Movements (IFOAM), Organic Agriculture should sustain the health of soils, ecosystems and people.

Table 1.T-Test Distribution of the Level of Satisfaction of Farmers on the Use of Identified farming strategies

Farming

Strategies

Mean Std.

Deviation

t Sig. (2-

tailed)

Level of

Satisfaction

Organic

Farming

2.90860 .81258

1.455 .000 Conventional

Farming

2.72093 .32334

Relationship between Organic Farming Strategies and the Level of Satisfaction of the Farmers Table 2 shows the relationship among the organic farming strategies and the level of satisfaction of

farmers. Table 2. Correlation Analysis of the Organic Farming Strategy and Level of Satisfaction of Farmers

Organic Farming Strategies Level of Satisfaction using Organic Farming Strategies

Crop Diversity Pearson Correlation .389** Sig. (2-tailed) .010

Soil Management Pearson Correlation .196 Sig. (2-tailed) .208

Weed Management Pearson Correlation .408** Sig. (2-tailed) .007

Controlling Other Organisms Pearson Correlation .373* Sig. (2-tailed) .014

Animal Manure Pearson Correlation .274 Sig. (2-tailed) .075

*. Correlation is significant at the 0.05 level (2-tailed) **. Correlation is significant at the 0.01 level (2-tailed)

37

Crop Diversity and Level of Satisfaction of Farmers Crop Diversity is significantly related to the level of satisfaction with a computed value of .389 at .01 level of significance. This means that the farmers are satisfied in using crop diversity. Farmers claimed that pests have preferences for specific

crop that is why they do crop rotation to keep away the pests and that is why the respondents change their crops twice a year. This practice shows that crop rotation is beneficial to soil and in the increase of crop production.

Weed Management and Level of Satisfaction of Farmers Weed management is significantly related

to the farmers’ level of satisfaction. This means that the farmers are satisfied on the weed management in their farm. Weeds are disturbing kind of pest because they surround the plants and get the nutrients that are supposed to be taken by plants. Most farmers do manual picking of weeds or use grass rippers to eliminate weeds but some allow weeds to grow because it is quite burdensome to remove them. Result implies that

weed control is an important part of crop production. Any single method of weed control or the continuous use of the same herbicide program will lead to the build-up of weeds resistant or tolerant to that control method. An integrated approach to weed management that uses all available weed control strategies to manage weed populationss can reduce herbicide use and optimize economic returns (Omafra, 2009).

Controlling other Organisms and Level of Satisfaction of Farmers Controlling other organisms is

significantly related to the level of satisfaction as reflected in Table 2. This means that the farmers are satisfied in the control of other organisms which can reduce the pest in their farm and encourage predatory beneficial insects to help eliminate other pests in farm crops. Scientists use different pest control methods that range from choosing a pesticide that will be least harmful to beneficial insects to raising and

releasing one insect to attack another. There are, however, alternative pest control methods, such as biological pest control, that are less harmful to the environment and humans. Unfortunately, biological pest control method alone is rarely sufficient. Research suggests that an integrated approach, using pesticides, biological pest control, and other techniques may be the most effective (Cengage Learning, 2015).

Use of Synthetic Chemical fertilizer and Level of Satisfaction of Farmers

Table 3 below on the other hand shows the relationship among the conventional farming strategies and level of satisfaction of farmers. a. Cannot be computed because at least one of the variables is constant

The use of synthetic chemical fertilizers is significantly related to the level of satisfaction of the respondents with a computed value of .332 at .05 level of significance. This shows that the farmers are satisfied with the use of synthetic chemical fertilizers. This implies that their regular

use of synthetic chemical fertilizers may lead to a high possibility of toxicity or risk both on human health and environment. It is also possible that farmers maintain the use of chemical fertilizers in their farms because they are used to this kind of technique. Since nutrients are available to the plants immediately, improvement occurs in days. Synthetic Chemical fertilizers are highly analyzed to produce the exact ratio of nutrients desired and they are also inexpensive (Day, 2015).

Table 3. Correlation Analysis between Conventional Farming Strategy and Level of Satisfaction of Farmers

Conventional Farming Strategies Level of Satisfaction using Conventional Farming Strategies

Synthetic Chemical Fertilizer Pearson Correlation .332* Sig. (2-tailed) .030 N 43

GMO Pearson Correlation .a Sig. (2-tailed) . N 43

*. Correlation is significant at the 0.05 level (2-tailed).

38

Conclusions

1. The farming strategies frequently used by the farmers are crop diversity, soil management, weed management, controlling other organisms and the use of synthetic chemical fertilizer.

2. The respondents are satisfied in using organic and conventional farming strategies.

3. There is a significant difference between the level of satisfaction of the farmers and

the use of organic and conventional farming strategies.

4. Crop diversity, weed management, controlling other organisms, and the use of synthetic chemical fertilizers have a relationship with the level of satisfaction of farmers using conventional farming strategy.

Recommendations

1. Programs or projects that will enhance or enrich the farmers’ knowledge and skills in the use of these farming strategies should be conducted by agencies concerned with agricultural development.

2. The Department of Agriculture should introduce new innovations in farming techniques to enhance the level of satisfaction of farmers. Further information about the advantages and disadvantages of using GMO or

Genetically Modified Organism should be provided to farmers for them to understand better the nature of GMO.

3. Activities that will serve as a training or seminars for farmers should be prepared to promote enhancement in their farming techniques.

4. Future researches should be conducted along these areas and it is highly recommended that qualitative not only quantitative research approaches should be employed.

Literature Cited Andre, M. (July 30, 2013). Organic Farming vs. Conventional Farming. Retrieved

on September 15, 2015 from http://freshconnect.com/organic-farming-vs-conventional-farming/ Scott, B. and Cavanaugh, P. (2007) Positive Psychology or the Psychology of

Satisfaction.Retrieved from September 15, 2015 http: //poeticsofaging. org/wordpress /wpcontent/uploads/2011/11/Scott-Cavanaugh_Psych-of-Satisfaction-Poetics-of-Aging-2.pdf

Terry, C. and Langner, L. (October 12,2015) The Economic Implications of Organic Farmers. Retrieved on September 15, 2015 from http: //eap. mcgill. ca/ MagRack /AJAA /AJAA_2.htm

Rinkesh (2009) What is Organic Farming ? Retrieved on September 23, 2015 from http://www.conserve-energy-future.com/organic-farming-benefits.php Carating,et.al (November 29-30, 2010). STATE OF ORGANIC AGRICULTURE INTHE PHILIPPINES: THE PHILIPPINE COUNTRY REPORT. Retrieved on October 4, 2015 from www.afaci.org/file/anboard2/PHILIPPINES(word).pdf

Eoin, L. (April, 2012) It will take the best of organic and conventional Farming to feed the world Retrieved on September 15, 2015 from https: //www. The guardian. Com /science /blog/2012/apr/26/organic-conventional-farming-feed-world

FRED FELDMAN (2008) Whole Life Satisfaction Concepts of Happiness.Retrieved on on September 12, 2015 from http: //people. umass.edu /ffeldman /WLS_the _good_ May %2031 %2008%20_Theoria_.pdf

Mikey (January 11, 2009). The Philippine Fertilizer Industry. Retrieved on December 22, 2015 from http: //pino yagrib usiness. com/forum /agrinews /the_philippine _fertilizer_industry t950.0.html

Organic Farming Research Foundation (2015). Retrieved on January 8, 2016 from http://www.ofrf.org/organic-faqs Performance of Philippine Agriculture January-December 2014. Retrieved on July 9, 2015 from http://www.bas.gov.ph/?ids=downloads_view&id=790

Soils matter (March 18, 2015) WHY DO FARMERS USE FERTILIZERS? Retrieved on April 1, 2015 from https://soilsmatter.wordpress.com/2015/03/18/why-do-farmers-use-fertilizers/.

Sustainable Baby Steps (2009) Understanding the Effects of Chemical Fertilizers. Retrieved January 20, 2016 from http: //www. Sustaina blebabysteps .com/effects-of- chemical-fertilizers.html

http://freshconnect.com/organic-farming-vs-conventional-farming/

http://poeticsofaging.org/wordpress/wpcontent/uploads/2011/11/Scott-Cavanaugh_Psych-of-Satisfaction-Poetics-of-Aging-2.pdf

http://poeticsofaging.org/wordpress/wpcontent/uploads/2011/11/Scott-Cavanaugh_Psych-of-Satisfaction-Poetics-of-Aging-2.pdf

http://eap.mcgill.ca/MagRack/AJAA/AJAA_2.htm

http://www.conserve-energy-future.com/organic-farming-

http://www.afaci.org/file/anboard2/PHILIPPINES(word).pdf

https://www.theguardian.com/science/blog/2012/apr/26/organic-

https://www.theguardian.com/science/blog/2012/apr/26/organic-

http://people.umass.edu/ffeldman/WLS_the_good_May%2031%2008%20_Theoria_.pdf

http://people.umass.edu/ffeldman/WLS_the_good_May%2031%2008%20_Theoria_.pdf

http://pinoyagribusiness.com/forum/agrinews/the_philippine_fertilizer_industry%20t950.0.html

http://pinoyagribusiness.com/forum/agrinews/the_philippine_fertilizer_industry%20t950.0.html

http://www.ofrf.org/organic-faqs

http://www.bas.gov.ph/?ids=downloads_view&id=790

https://soilsmatter.wordpress.com/2015/03/18/why-do-

http://www.sustainablebabysteps.com/effects-of-%20%20%20%20%20%20%20chemical-fertilizers.html

http://www.sustainablebabysteps.com/effects-of-%20%20%20%20%20%20%20chemical-fertilizers.html

39

UK Essays (2005). Definition of Life Satisfaction Psychology Essay. Retrieved on April 5, 2015 from http: //www. ukessays. com/essays /psychology /definition-of-life-satisfaction-psychology-essay.php#ixzz3qVhmYtOU

Union of Concerned Scientist (2012) Sustainable Agriculture Techniques. Retrieved on February 5, 2016 fromhttp: //www. ucsusa. org/food_ and_ agriculture /solutions/advance-sustainable-agriculture/sustainable-agriculture.html#.VsQjH9xhnIV

http://www.ukessays.com/essays/psychology/definition-of-life-satisfaction-psychology-essay.php#ixzz3qVhmYtOU

http://www.ukessays.com/essays/psychology/definition-of-life-satisfaction-psychology-essay.php#ixzz3qVhmYtOU

40

Parental Favoritism sa Pamilya ng mga Magsasaka

Jaylee Ann F. Apilado, Mark Peter John B. Balderas, Grace Joy M. Hullana, and Kessy Ivy M. de Guzman

Abstract

Ang parental favoritism ay tumutukoy sa hindi pantay na pagtrato o pagtingin ng mga magulang sa kanilang mga anak. Layunin ng pag-aaral na ito na alamin ang kahulugan at dahilan ng pagkakaroon ng parental favoritism sa mga pamilyang magsasaka gamit ang mga maka-Pilipinong metodo sa pagkalap ng mga datos. Para sa pamilya ng mga magsasaka, ang parental favoritism ay ang hindi pareho o pantay na pagbibigay ng trato, pansin, atensyon, mga materyal na bagay at pinansyal na suporta sa mga anak. May pagkakaiba sa pananaw ng mga magulang at sa pananaw ng mga anak ukol sa pagkakaroon ng paboritong anak. Bagamat hindi ito pangkaraniwan o laganap sa pamilya ng mga magsasaka, batid nila ang mga dahilan ng pagkakaroon ng paboritong anak. Panimula Karamihan ng tao ay lumalaki sa isang pamilya na isa o higit pa na kapatid ang lalaki o babae. Bawat isa sa atin ay naghahangad na magkaroon ng isang mabuti at perpektong pamilya. Kaya ginagawa ng bawat magulang ang lahat ng kanilang makakaya upang mapabuti ang kanilang pamilya lalung-lalo na ang kanilang mga anak. Ngunit hindi maiiwasan ang pagkakaroon ng iba't ibang mga problema na maaring makaapekto at magdulot ng hindi pagkakaunawaan sa bawat miyembro nito. Ang relasyon sa pagitan ng magkapatid ay maaaring magkaroon ng marka sa pamamagitan ng paligsahan at labanan, ngunit maaari ring maging malapit o intimate na relasyon na mayroon sila sa childhood, adolescence, and adulthood (Buhrmester & Furman, 1990; Volling, 2003).

Ang favoritism ay espesyal o kakaibang pagtrato ng mga magulang o pagtingin ng mga magulang sa kanilang mga anak, isa o ilan sa mga anak ang pinapaboran nila kaysa sa iba nilang mga anak (Brody et al., 1998). Bilang kahalili, maari din na isa o higit pa sa kanilang mga anak ang nakakaranas ng negatibong pagtrato o disfavoritism. Ayon kay Schachter and Stone (1987), ang parental favoritism ay nagiging agawan at mahabang tema ng salungatan, paligsahan at inggit sa ibang mga kapatid. Ang bawat magulang ay magkakaiba. Ang mga paboritong anak ang

mas nakakaranas ng pagiging guilty o pagkaawa sa hindi paboritong kapatid na babae o lalaki, kung saan sila naman ang mas nakakaranas ng galit, pagkainggit, at resentment sa paborito at pinapapaborang kapatid (Angel, 2006; Brody, 1998). At dahil magkakaiba at may iba't iba o kanya-kanyang abilidad ang mga anak, hindi maiiwasan na ikumpara ng magulang ang kanilang mga anak at nagkakaroon ng paborito ang mga magulang na nagiging sanhi ng hindi pagkaka-unawaan, problema, kung minsa'y pag-aaway-away o pagbabangayan ng mga anak at pagseselosan. Mas nagkakaroon ng oras at mas pinagtutuunan nila ng pansin ang paborito nilang anak kaysa sa iba pa nilang mga anak. Mas prayoridad nila ito at mas binibigyan nila ng atensyon. Ito ay maaaring dahil mas magaling, mas maraming naibibigay na mga karangalan, talentado, mabait at iba pang mga bagay o rason kung bakit mas paborito nila ang isa nilang anak kaysa sa iba. At hindi nila namamalayan na nasasaktan at nagseselos na ang iba pa nilang mga anak. Nawawalan na sila ng oras para sa iba. Maraming mga iba't-ibang rason o dahilan ang bawat magulang, ganun din ang kanilang mga anak. Aminin man natin o hindi, walang magulang na magsasabing may paborito sila sa kanilang mga anak.

41

Balangkas ng Pananaliksik Ang favoritism ay isang salita na nangangahulugang mas gusto, mas pinapaburan o mas mahal mo ang isang bagay o tao. Katulad ng pagkakaroon ng paboritong anak. Mas binibigyan nila ng pansin at atensyon, pinapaburan,

prayoridad at mas mahal nila ang paborito nilang anak kaysa sa iba pa nilang mga anak na maaaring makaapekto at makasira sa relasyon ng mga magulang sa mga anak o anak sa mga magulang at sa buong pamilya.

Paradima ng Pananaliksik

Metodolohiya Ang disenyong ginamit sa pananaliksik ay qualitative research design. Ito ay ang pamamaraan ng mga mananaliksik upang ilarawan ang mga pansariling karanasan ng mga kalahok at ito’y bigyang kahulugan. Ang mga kalahok sa pananaliksik na ito ay mga pamilya ng magsasaka sa Brgy. San Miguel, Agoo, La Union. Sila ay pinili sa pamamagitan ng purposive sampling kung saan gagamitan ang mga kalahok

ng mga metodong nabanggit upang makakalap ng mga datos. Ang ginamit na metodo ay thematic analysis kung saan ang mga nakalap na kasagutan ng mga kalahok ang magiging basehan ng mga temang mapapalitaw. Sa pamamagitan ng metodong ito magagawa nitong tipunin at pagsamahin ang ideyang lalabas na kasagutan sa mga kalahok.

Kinahinatan at Pagtalakay

Pagpapakahulugan sa Parental Favoritism Hindi man eksakto o pare-pareho ang

mga pahayag ng mga kalahok, magulang man o anak, iisa ang ideya o temang lumabas sa mga pagpapakahulugan sa parental favoritism.

Sa pangkalahatan, ayon sa mga kalahok, ang favoritism ay ang pagbibigay ng hindi pantay na trato at atensyon at pagbibigay ng mga pabor sa isa o sa sino man sa mga anak. Ito ay maituturing na preferential treatment ayon kay Stepp (2011) na kung saan nararamdaman ng isang

anak na mas kaunti ang pagmamahal nila sa kanya o mas hindi siya gusto kaysa sa ibang mga kapatid.

Para naman sa mga anak na kalahok, ang pagpapakahulugan nila sa parental favoritism ay pareho sa pagpapakahulugan ng mga magulang. Ang parental favoritism ay ang pagbibigay nang hindi pantay na pagtrato, pansin, atensyon, mas pinapaburan at mas gusto ng mga magulang sa mga anak.

Ang Paboritong Anak

Karamihan sa mga magulang na kalahok (anim sa pito) ay nagsasabing pantay-pantay at pare-pareho ang pagtrato nila o wala silang paborito sa kanilang mga anak. Nabanggit na wala silang pinapanigan at pinapaburan. Pantay-pantay ang atensyon na binibigay nila maging sa mga gamit at sa iba pang mga bagay maliban na lamang kung talagang may kailangan ang isa sa kanilang mga anak. Lumabas din sa pananaliksik na mas malapit ang mga anak na babae sa kanilang ama

kaysa sa kanilang ina samantalang mas malapit ang mga anak na lalaki sa kanilang ina kaysa sa kanilang ama. Sumasang-ayon ito sa pag-aaral sa mga western family kung saan sinabing ang mga anak na lalake ay pinaniniwalaang mas gusto ng kanilang mga ina (Kiracofe & Kiracofe, 1990; Salmon et al., 2012). Ngunit hindi ito indikasyon ng parental favoritism. Tugma ito sa pag-aaral ni Scholte, et al. (2007) na nagsasabing ang pagkakapareho o pagkakaiba ng kasarian ng mga

Personal na karanasan

ng mga magulang at mga anak

Pakikipagkwen-

tuhan, Pagtatanung-

tanong, Pagdalaw-

dalaw

Pagpapaka-hulugan

ng isang pamilya ng

magsasaka sa

Parental Favoritism

42

anak ay walang epekto sa pagkakaroon ng paborito o mas malapit sa kanila. Pagkakaroon ng Parental Favoritism Mula sa mga nakalap na mga datos, napalitaw ng mga mananaliksik ang mga posibleng dahilan ng pagkakaroon ng parental favoritism. Inalam ang pananaw ng mga magulang at anak kahit pa may pagtanggi na may parental favoritism sa pamilya.

Ang mga sumusunod ay ang mga dahilan ayon sa magulang at anak: malapit na relasyon sa pagitan ng magulang at anak, pagdadala ng karangalan sa pamilya at kakayahang tumulong sa pamilya. Ang mga napalitaw na mga dahilan ay repleksyon ng kanilang saloobin patungkol sa kanilang nararamdaman o naoobserbahan sa loob ng kanilang pamilya pero hindi ito indikasyon na may nangyayaring parental favoritism sa isang pamilya.

Batay sa mga pahayag ng mga kalahok, ang parental favoritism ang siyang nagiging sanhi ng pagkakaroon ng selosan, inggitan, bangayan at awayan sa pagitan ng mga magkakapatid batay sa kanilang mga karanasan. Ito ay isang malubhang problema sa anumang pamilya na nakakaapekto sa lahat. Maaari itong magdulot ng positibo at negatibong epekto na siyang magiging dahilan ng pagkawasak o pagkakawatak-watak ng isang pamilya. Ayon kay Libby (2010), marami ring positibong epekto ang pagiging paboritong anak

katulad ng bosltered self-esteem kung saan sinasabing kasabay ng paglaki ng mga anak ang pakiramdam na may tiwala sa sarilli at may malakas na loob. Ito rin ay maaaring magresulta sa sikolohikal at problema sa pakikibagay sa mga hindi paboritong anak (Adler, 1931). Maaari ding magkaroon ng sama ng loob ang mga anak sa kanilang mga magulang maging sa kanilang mga kapatid. Maaari din itong maging sanhi ng mga sakit at humantong sa mga negatibong resulta ng pag-uugali. Ang pagkilala ng mga magulang sa parental favoritism ay nagsilbing paalala upang malaman ng isang pamilya ng magsasaka kung kailan nila dapat limitahan ang pagbibigay ng espesyal na trato sa mga ito. Dahil dito napapanatili ang pantay na pagtrato sa kanilang mga anak upang wala maging alitan sa mga ito.

Walang magulang ang magnanais na maging malupit sa kanilang mga anak ngunit sa pamamagitan ng kanilang mga kilos at pagkakaroon ng favoritism sa kanilang pamilya ay maaaring makasakit sa kanilang mga anak nang hindi nila napapansin. Ayon kay Bluethmann (2015), hindi mahalaga kung ikaw ang paborito o hindi, dahil ang hindi pantay na pagtrato ay may maling epekto para sa lahat ng mga kapatid.

Talahanayan 3. Mga napalitaw na dahilan ng pagkakaroon ng parental favoritism

Konklusyon

Ang mga sumusunod ay konklusyon ng mga mananaliksik batay sa mga nakalap na mga datos:

1. Ang parental favoritism ay ang pagbibigay ng hindi pantay o parehong trato, pansin, atensyon at pagbibigay ng hindi pantay na mga materyal na bagay at pinansyal na

suporta sa mga anak at hindi ito pangkaraniwan o laganap sa pamilya ng mga magsasaka ngunit ito ay karaniwan para sa ibang pamilya.

2. Iba ang pananaw ng mga magulang sa pananaw ng anak patungkol sa pagkakaroon ng paboritong anak sa

Mga Dahilan sa pagiging Paboritong anak

Mga tugon ng mga kalahok

Malapit na relasyon sa pagitan ng magulang at anak

“Ang turing ng kapatid ko best friend niya ang tatay namin.” (A-N.N-33)

Mas nakakatulong sa pamilya/bukid

“Kung sino yung mas nakakatulong ganun, ‘yong kung may kailangan lagi siyang nandiyan na tumutulong.Tumutulong sa bukid”.(M-I.C-51)

Nakakapagbigay karangalan sa pamilya

“Depende sa anak, lalo na kapag magaling yung anak mo, don nagsisimula ang paborito na yan. Kasi siyenpre kapag magaling ‘yong isa iyong iba hindi, yan na may masasabi na iyong isa”.(M-H.N-64)

"Paborito na parang mas gusto niya, ‘yong palaging nakakatulong sa kanila".(A-A.S-38)

43

pamilya nila. Maaaring para sa mga magulang ay wala silang paborito ngunit para sa mga anak ay mayroon silang paborito.

3. Ang mga mananaliksik ay nakabuo ng tema gamit ang thematic analysis

patungkol sa Parental Favortism. Napatunayan sa pag-aaral na ito na ang parental favoritism sa pananaw ng mga magulang ay isang batayan upang mapalabas ang iba’t ibang dahilan sa pagiging paboritong anak.

Rekomendasyon

Ang mga sumusunod ay ang mga nabuong rekomendasyon batay sa kinahinatnan ng pag-aaral:

1. Sa kabila ng pagiging abala ng mga magsasaka, nararapat lamang na bigyan nila ng sapat na oras o pagtuunan ng pansin ang bawat isa sa kanilang mga anak upang maiwasan ang anumang alitan o problemang maaaring mamagitan sa kanila. Kung maaari, kailangan nilang magkaroon ng oras sa kanilang pamilya o family day kahit minsan sa isang linggo upang mapanatili ng mga magulang ang pantay-pantay na trato sa mga anak.

2. Upang maiwasan ng mga anak na isiping may paborito ang kanilang mga magulang, kailangan nilang magtanong sa kanilang mga magulang tungkol sa mga bagay-bagay na nagagawa o naibibigay nila sa iba nilang mga kapatid upang maintindihan at maunawaan nila ito.

Kailangang magkaroon sila ng malawak na pag-iisip at malalim na pang-unawa.

3. Sa mga sikolohista at social workers, ang pagbibigay gabay sa mga pamilya ay may malaking maitutulong. Ang abot-kamay nilang serbisyo ay makakatulong sa pagharap nila at pagtugon sa mga isyu at problemang may kinalaman sa personal at pampamilya na aspeto ng kanilang pamumuhay.

4. Sa mga susunod na mananaliksik sa paksang ito, mainam na mas palawakin pa at dagdagan ang mga pipiliing kalahok upang malaman pa ang mga ibang dahilan at pananaw ng mga pamilya ng magsasaka. Maliban sa mga magulang, dapat ding kapanayamin ang dalawa o higit pa sa mga anak ng mga magsasaka upang mapalawak pa ang maipaparating na mga kaalaman at impormasyon sa mga babasa sa pananaliksik na ito.

SANGGUNIAN

Ahmed, R. A., Rohner, R. P., Khaleque, A., & Gielen, U. P. (2010). Parental acceptance and rejection: Theory, measures, and research in the Arab world. Retrieved from http://www.eric. ed.gov/contentdelivery/servlet/ERICServlet?accno=ED514028

Aldous, J., Klaus, E., & Klein, D. M. (1985). The understanding heart: Aging parents and their favorite children. Child Development, 56, 303-316. http://doi.org/bvkgbx

Buhrmester, D., & Furman, W. (1990). Perceptions of sibling relationships during middle childhood and adolescence. Child Development, 61, 1387-1398.

Brody, L. R., Copeland, A. P., Sutton, L. S., Richardson, D. R., & Guyer, M. (1998). Mommy and Daddy like you best: Perceived family favoritism in relation to affect, adjustment and family process. Journal of Family Therapy, 20, 269-291. http://doi.org/cx7pht

De Man, A. F., Wong, I. N., & Leung, P. W. L. (2003). Perceived parental favoritism and suicidal ideation in Hong Kong adolescents. Social Behavior and Personality: An international journal, 31, 245-252. http://doi.org/bfmtsc

Gilbert, P., & Gerlsma, G. P. (1999). Recall of shame and favouritism in relation to psychopathology. British Journal of Clinical Psychology, 38, 357-373. http://doi.org/c75nsf

Harris, T. (2007). Vulnerable to depression. British Journal of Psychotherapy, 23, 547- 562. http://doi.org/bct98j Hertwig, R., Davis, J. N., & Sulloway, F. J. (2002). Parental investment: How an equity motive can produce inequality.

Psychological Bulletin, 128, 728 – 745. Scholte, R., Engels, R., de Kemp, R., Harakeh, Z., & Overbeek, G. (2007). Differential parental treatment, sibling

relationships and delinquency in adolescence. Journal of Youth and Adolescence, 36, 661-671. http://doi.org/fbs86s Yahav, R. (2006). The relationship between children’s and adolescents’ perceptions of parenting style and internal and

external symptoms. Child: Care, Health and Development, 33, 460-471. http:// doi.org/bt4crf Zervas, L. J., & Sherman, M. F. (1994). The relationship between perceived parental favoritism and self-esteem. Journal of

Genetic Psychology: Research and Theory on Human Development, 155, 25-33. http://doi.org/cvs8wn

http://www.eric/

http://doi.org/bvkgbx

http://doi.org/cx7pht

http://doi.org/bfmtsc

http://doi.org/c75nsf

http://doi.org/bct98j

http://doi.org/fbs86s

http://doi.org/cvs8wn

44

Socio-Demographic Profile and Level of Perceived Anti-Social Tendency

of DMMMSU-SLUC Institute of Fisheries Students from Coastal Areas Angelica P. Gundran, Ysha Rae P. Lugto, Rea Kimberly

Tess L. Perado, and Zenaida D.C Pascua

Abstract

This study made use of descriptive research design with questionnaires as the data gathering tool. There were 47 respondents involved through total enumeration. Findings of the study are the following: 1) Majority of the respondents belong to nuclear family, family size that contains 4-6 members with monthly income of 5,000 and below; 2). Their level of perceived anti-social tendency and personal-related anti-social tendency had moderate probability; however, there is a low tendency in nuisance and environment-related anti-social tendency.

As to relationship of socio-demographic profile and level of perceived anti-social tendency, family structure and monthly family income have no significant relationship with their level of perceived anti-social tendency. On the contrary, family size and perceived level of anti-social tendency have significant relationship. Keywords: socio-demographic profile, perceived anti-social tendency, coastal areas Introduction Situation Analysis

Over the past 50 years, family structure has been changing (Blessing, 2006). In today’s generation, law has now the annulment process that separates couples when they are not already working well in their relationship. Their children might be staying either with their mother or father. There is also an expanded type family structure that includes both parental sides. These changes in family structures may be related to the possible antisocial behavior of an individual. Anti-social behavior is developed and shaped by circumstances relating to social interactions within the family, community, and educational environment (http://www.highbeam.com/, 2015).

One major goal of parents is to help children obtain social norms in order for an individual to avoid inappropriate social behaviors (Grusec, Eisenberg, Valiente, Grolnick, Farkas, 2002). There may be problems within those family structures and the parents themselves and those problems may be associated with the level of

perceived anti-social tendencies of the child. It is because parents are perceived to have a critical role in helping their children decrease involvement in anti-social acts and develop good habits instead (Millie & Andrew, 2004).

Single parents are expected to give fewer resources to their children and it is also expected that the children will have worst outcomes (Magnuson and Berger, 2009). Moreover, the economic status of the family also influences the social behavior of their children (Sharma, 2012). In addition, the population size of the community where an individual lives also becomes a factor in having antisocial behaviors. Analysis of the British Crime Survey stated that anti-social behaviors are more likely to be high in areas with greater proportions of residents (www.ipsos.com, 2015). In the Philippines, 60 percent of the population resides on coastal areas and it would double by 2025 (L. Agnes, et al., 2005).


Family system theory emphasizes that family will always be part of all other systems in the society. Whatever changes in the factors

within a family will cause big changes as well on other systems (Bowen, 1950). In this study, the researchers tried to find out the relationship

45

between socio-demographic profile and level of perceived anti-social tendency of the students from coastal areas. Thus, this theory provides explanation that whatever kind of family an individual belongs to, the number of their family members and their monthly family income will have that particular influence to how an individual creates or develops his/her social desires.

Those influences of family environment to an individual are explained by the social learning theory (Bandura, 1977). This theory wants to emphasize that the environment or other stimuli surrounding an individual can serve as a model in adapting a kind of behavior. In relation to the study, the family is the basic social unit; thus, it is the first model of an individual. Whatever an individual observes in the family affects how he/she socializes. This is because the home is the primary place where individuals meet their basic needs, learn about life and build their self-esteem (Fashbir, 2000). All actions or beliefs manifested by his/her family may be learned and imitated. Those behaviors learned at home may be applied when he/she steps out of the home. The behavior of peers could also be a factor that influences the behavior or beliefs he/she learned at home.

The social control theory proposed four elements in shaping the societal bonds of an individual and its environment. First is the attachment where an individual who obey norms is concerned with his/her attachment to other people. People are concerned with their sensitivity

to what other people will be thinking about them while individuals who develop anti-social behaviors have weak attachment to others and choose to be in their own and do things they want even though it may cause risks to other people and even to them. Second is the commitment to rules where anti-social individuals are not concerned with following norms. Individuals often stick with what they want without thinking of the possible threats of their behavior. Third is involvement in certain activities. An anti-social person wants to spend most of his/her time in delinquent behaviors rather than in usual activities that conform to norms that do not harm other people.

Personal anti-social behaviors discussed in the National Standard for Incident Recording (2011) in United Kingdom are behaviors directed to an individual or group rather than community at large. However, in this present study, the researchers focused only on the individual itself. This is because most of the behaviors in this category involve minor annoyance that can harm the physical, mental and emotional health of the individual doing anti- social behaviors. This is considered as minor annoyance because it only gives trouble to himself/herself rather than to a larger number of people. However, the behaviors on this category result in inability to perform daily tasks. On the DSMV, one of the criteria in “Anti-Social Personality Disorder” is the impairment of personality functioning. He/she has the sense of irresponsibility, impulsivity and risk taking (American Psychiatric Association, 2012).


Fig. 1 Research Paradigm Statement of the problem

This study determined the relationship between socio-demographic profile and the level of perceived anti-social tendency of Institute of Fisheries students from coastal areas. Specifically, it answered the following problems:

1. What is the socio-demographic profile of the respondents in terms of: 1.1 family structure; 1.2 monthly family Income; and 1.3 number of family members?

2. What is the level of perceived anti-social tendency of the respondents in terms of: 2.1 personal; 2.2 nuisance; and 2.3 environmental?

3. Is there a significant relationship between the respondent’s socio- demographic profile and the level of perceived anti- social tendency?

Socio-Demographic Profile 1.1 Family Structure 1.2 Monthly Family Income 1.3 Number of family members

Level of Perceived Anti-

Social Tendency

1.1 Personal 1.2 Nuisance

1.3 Environmental

46

Methodology

Research Design This study used a descriptive research design. It involves determining, assessing and describing the relationship of socio-demographic profile and level of perceived anti- social tendency of Don Mariano Marcos Memorial State University-South La Union Campus- Institute of Fisheries students from coastal areas.

Sources of Data The respondents were first year to fourth year students of DMMMSU-SLUC-Institute of Fisheries who live in coastal areas. Overall, the Institute of Fisheries has three sections in first year, two sections in second year, one in third year and two sections in fourth year during the first semester of school year 2015-2016. By the use of a questionnaire prepared by the researchers, a survey was concuted in every year and section who live in a coastal area. The questionnaire had only one question which determined if the respondents’ residence is in a coastal area or not. A total of forty seven (47) students from coastal areas were identified through total enumeration. Twenty seven (27) of them were males and twenty (20) were females.

Instrumentation and Data Collection The questionnaire for the socio-

demographic profile of the respondents contained three questions about the respondent’s family structure; monthly family income and the number of family members in one roof. Under family structure, the respondents answered by checking inside a box located at the left side the type of family structure they belong to - Nuclear Family, Extended Family or Single- Parenthood. On the right side of every type of family structure, there was a brief definition to avoid confusion. As to the monthly family income, the researchers gave ranges and also the number of family members.

The questionnaire was validated by the seven (7) Psychology teachers of the Humanities and Social Sciences Department of DMMMSU- SLUC CAS. In order to get the content validity, the questionnaire was administered first to the students of DMMMSU- SLUC CAS from coastal areas.

The questionnaire measured the level of perceived anti-social tendency in terms of personal, nuisance and environmental. Each category had twenty (20) items making it sixty (60) items in all. Each respondent rated himself/herself by checking the number that corresponds to how often he/she is doing the action or statement given.

To measure the reliability of the questionnaire, it was initially administered to the College of Arts and Sciences students from coastal areas. For the questionnaires on the socio- demographic profile and the level of perceived anti- social tendency, the researchers quantified the gathered data using the SPSS software and Chronbach Alpha. This resulted in a content reliability of .84. The two questionnaires had a content validity of 4.0.

Analysis of Data To quantify the data from the

respondents’ socio- demographic profile, frequency counts and percentages were used. These also determined the number and percentage of respondents that belonged to a certain category of family structure, number of family members and monthly family income. In finding out the relationship of the variables, Chi- Square Correlation was used because the variables correlated were categorical (independent variable) and ordinal (dependent variable). The SPSS software was used to compute the correlation of the socio-demographic profile and the level of perceived anti-social tendency of the respondents.

Results and Discussions

Socio – Demographic Profile of the Respondents Results show that majority of the

respondents belong to a nuclear family, followed by a single-parenthood family and extended family in descending order.

In terms of family monthly income, majority of the respondents have an income 5,000 and below. It implies that about 70 percent of the poor Filipino families are really found on rural- farming or fishing- areas (Manila Times, 2015). Looking at the number of family members of the respondents, majority belong to a medium size family (4-6 members) followed by large family size (7-10 members) and majority have a monthly income of 5,000 and below which is really

considered below the poverty line. This may indicate that workers in larger cities receive larger pay or might be receiving twice the earnings of those in rural areas. This might be due to more job options present in urban areas rather than in rural areas that mostly engage in fishing or farming.

As to the family size, most of the respondents have 4- 6 members staying in one roof. This range is the average or the medium number of family members. This is followed by 11 respondents having a large number of family members which falls within 7- 10 members. Meaning, there is really a big number of members in every house. It implies that the estimation of 60

47

percent of the population which resides in the coastal areas is true (L. Agnes, H. Agnes, Castro, Montebon, 2005). However, the large population is not really because of having a lot of extended families because even those in nuclear and single-

parenthood structure have large number of family members. The large size in these two family structures (Nuclear and Single-Parenthood) is the result of a large number of children.

Level of Personal Anti- Social Tendency

The respondents have moderate tendency to engage in personal- related anti-social behaviors. All respondents are in adolescent stage. According to Campbell (1969), one of the rights and obligation of an adolescent is to experiment with new roles and behaviors. Results show that the items on personal- related anti-social behaviors, usually fall in doing things on their own and harming oneself that is also prohibited and is contrary to the law. Harming oneself includes taking drugs, smoking and other vices. This implies that adolescents have the freedom to try new things, and they have that tendency to engage in anything they want even if it can harm them and can oppose norms. And more often, the reason behind those risky behaviors and other roles they wanted to experience is to cope with their peers and be one of them.

Moreover, another right discussed by Campbell is the want to become more independent. Some of the items on this category

of anti-social behavior are on doing tasks on their own, hates being told what to do, and do not want others to interrupt whatever they do. It means that an adolescent has the tendency to do things without the help of anyone because of the want to become independent. Result show that the respondents have moderate tendency (sometimes). There is nothing wrong in doing tasks alone or being an introvert. However, if a task is given to a group and an individual still chooses to do it on his/her own, it may affect his/her emotional aspects in dealing with people. He/she may be more comfortable and happy being alone but there could be a difficulty in dealing with people when the occasion calls for it. Even if a person is an introvert, he/she must still at least learn to affiliate with others. If an individual enjoys solitude and some daily activities may be affected, then it may not be really being an introvert only but it may have the tendency to engage in anti- social behaviors.

Level of Nuisance Anti- Social Tendency

Items on nuisance-related anti- social tendency fall on behaviors that are directed to other people. Since the respondents are on the adolescent stage, they may really have a low tendency to harm others because in this stage of development, peers are an important factor to an individual’s life. It is a stage where a person shifts his/her environment from family to peers (Psychology Today, 2005). Since peers are an important factor to their lives, an individual may manifest behaviors that will make him/her

conform to his/her peers. The approval of peers becomes more significant than an adult’s approval because people at this stage are seriously loyal to their peer group (Kellough, 2008). Moreover, the result of having low tendency to engage in nuisance-related anti- social behaviors shows that the respondents avoid behaviors that hassle other people especially their peers because people at this stage may have the fear of rejection (Kellough and Kellough, 2008).

Level of Environmental Anti- Social Tendency In terms of the environment-related anti-social tendency, the respondents fall under low probability of destroying and damaging the environment which includes plants and animals. The respondents are all adolescents and in this stage of development, social interaction between

their peers is more important. It is observed that only the serious anti-social actions fall under very low tendency like painting in walls, cutting trees and plants, using chemicals, burning trees for fun and breaking the windows of vacated houses.

48

Table 1. Relationship between the Socio-Demographic Profile of Respondents and their Level of Perceived Anti-Social Tendencies

Socio-Demographic Value Descriptive

Profile Equivalent Family Structure Sig. .131 2-tailed .718 Not Significant Monthly Income Sig. .001 2-tailed .976 Not Significant No. of Family Members Sig. 4.810

2-tailed .028 Signifi

Result shows that there is no significant

relationship between family structure and level of perceived anti- social tendency. It implies that whatever changes or whatever differences adolscents have in their kind of family, it is not really related to their tendency to engage in anti- social behaviors. Since all of the respondents are adolescents (16-19), peers play more important role in their lives. This stage shifts their environment from family to friends (K. Bucher & M. Lee Manning, 2010). Once an adolescent steps out of his/her home, it will now be his/her personal choice whether to stick to the behaviors learned from their family or to create and explore for their own identity. This is because people in this stage are searching for their identity (Raising Children Network, 2006-2015).

On the other hand, result also shows that there is no significant relationship between monthly family income and level of perceived

anti-social tendency. Even though there are a lot of studies saying that low family income affects an individual’s behavior, Pepler & Slaby (1994) stated that poverty is not really contribution to violent behaviors but it’s the insufficient income and lack of opportunity to access to their needed resources especially basic needs like food and water.

Majority of the respondents belong to a medium (4-6 members) family size followed by a large (7-10 members) family size. Even those who belong to a single- parenthood and nuclear family have large number of members in one roof. According to Rutter, et al., (1983), being raised in a family which consists of at least four children has a significant probability in engaging with delinquent behaviors. This is because parents with large family size have less time to discipline and supervise their children (Farrington & Loeber, 1982). Large family size is also said to be associated with aggression among the youth (Connor, 2012).

Conclusions Based on the findings of this study, the following conclusions were drawn:

1. Majority of the respondents belong to a nuclear family and only few of them belong to an extended family. As to the family size, most of the respondents belong to a medium size (4-6 members) family and few of them belong to a small size family (1-3 members). Majority of the respondents have a monthly income of 5,000 and below and few of them have a monthly income of 20,001 and above.

2. The respondents have moderate tendency as to personal-related anti-social tendency, low tendency on

nuisance-related and another low tendency on environment-related anti-social tendency. Generally, the respondents have a low tendency on the total level of perceived anti-social tendency.

3. There is no significant relationship between family structure and level of perceived anti- social tendency. There is also no significant relationship between monthly family income and level of perceived anti-social tendency. However, family size and level of perceived anti-social tendency are significant with each other because they are lower than .5.

49

Recommendations

1. The Guidance Office of the Institute must provide seminars about minimizing risky behaviors and handling peer pressures to avoid self-harm because result came out to be moderate in the tendency to engage on personal anti-social tendency. Meaning, the respondents have a moderate probability to harm themselves to get what they want, to search for their identity, and to experiment new things with peers even if it is against the norms.

2. The Institute must disseminate information about starting a small business as a student like loading business. The information can be disseminated by conducting seminars and training if needed which could help the students earn money without affecting their school works and for the students to help their parents financially because majority of the respondents have a

monthly income of 5,000 and below. The 5,000 and below monthly family income may not be enough for a family with 4- 10 members.

3. The Institute may also provide more scholarship opportunities for those students who belong to low-income families. If the Institute already has this kind of scholarship, then it must be disseminated to all the students.

4. Future researchers may focus on other communities like in the urban areas or in the cities because basing on the discussions above, violence and delinquent behaviors are more prone in urban areas. They can correlate the use of technologies/mass media of the adolescents to their level of perceived anti- social tendencies because different technologies/ media are mostly seen in urban areas.

Literature Cited Alber,J.R, Gaspar,R., Raymundo,M. (July, 2015). Who are in the middle class?

Retrieved on October 31, 2015 from http://www.rappler.com/thought-leaders/98624-who-are-middle-class\

American Acadamy For Pediatrics (August, 2015). Social and Emotional Challenges in Adolescence. Retrieved on October 23, 2015 from https://www.healthychildren.org/English/health-issues/conditions/adhd/Pages/Social-and-Emotional-Challenges-in-Adolescence.aspx

American Psychiatric Association (June, 2011). DSM-IV and DSM-5 Criteria for the Personality Disorders. Retrieved on October 30, 2015 from http://www.psi.uba.ar/academica/carrerasdegrado/psicologia/sitios_catedras/practicas_profesionales/820_clinica_tr_personalidad_psicosis/material/dsm.pdf

Blessing, Michelle (September, 2013). Types of Family Structure. Retrieved on January 12, 2015 from http://family.lovetoknow.com/about-family-values/types-family-structures

Brinkerhoff,D., White,L.(1985). Sociology. West Publishing Company. 50 W. Kellog Boulevard, U.S.A

Bucher, K., Lee Maning,M, (July, 2010). Developmental Characteristics During Adolescence. Retrieved on October 26, 2015 from http://www.education.com/reference/article/developmental-during-adolescence/

Connor, D. (2012). Aggression and Antisocial Behavior in Children and Adolescents: Research and Treatment. Guilford Press. 72 Spring Street,N.Y. 10012

Casey, A. (2013). Family Structure. Retrieved on October 23, 2015 from http://worldfamilymap.ifstudies.org/2013/articles/world-family-indicators/family-structure

Caskey, M., Anfara,V. (October, 2015). Developmental Characteristics of Young Adolescents. Retrieved on October 26, 2015 from https://www.amle.org/BrowsebyTopic/WhatsNew/WNDet/TabId/270/ArtMID/888/ArticleID/455/Developmental-Characteristics-of-Young-Adolescents.aspx

Cleveland Clinic (May, 2014). Social Development During Teen Years. Retrieved on October 23, 2015 from https://my.clevelandclinic.org/childrens-hospital/health info/ages-stages/adolescence/hic-Social-Development-During-the-Teen-Years

Connor, D. (2012). Aggression and Antisocial Behavior in Children and Adolescents: Research and Treatment. Guilford Press. 72 Spring Street,N.Y. 10012

Creel, L. (August, 2015). Ripple Effects: Population and Coastal Regions. Retrieved on October 15, 2015 from http://www.prb.org/Publications/Reports/2003/RippleEffectsPopulationandCoastalRegions.aspx

Dane, A., Kennedy, R., Spring,M., Volk,A., Marini,Z. Adolescent Beliefs about Antisocial Behavior. Retrieved on July 8, 2015 from http://www.brocku.ca/webfm_send/23503

Fomby, P., Sennott,C. (November, 2009). Changes in Family Structure: Consequences

http://www.rappler.com/thought-leaders/98624-who-are-

http://www.rappler.com/thought-leaders/98624-who-are-

http://family.lovetoknow.com/about-family-values/types-family-structures

http://worldfamilymap.ifstudies.org/2013/articles/world-family-indicators/family-

https://my.clevelandclinic.org/childrens-hospital/health

50

For Adolescents’ Behavior. Retrieved on January 12, 2015 from https://www.bgsu.edu/content/dam/BGSU/college-of-arts-and-sciences/NCFMR/documents/RB/RB-09-03.pdf

Gale, T. (2015). Antisocial Behavior. Retrieved on August 22, 2015 from http://www.encyclopedia.com/topic/Antisocial_behavior.aspx

Kaneshiro,K. (February, 2015). Adolescent Development. Retrieved on October 23, 2015 from https://www.nlm.nih.gov/medlineplus/ency/article/002003.htm

Living in the Philippines (2015). Family Structure. Retrieved on January 12, 2015 from http://www.livinginthephilippines.com/culture-and-people/philippine-culture/1308-family-structure

Millie, A. (Decmber, 2008). Anti- Social Behavior. Retrieved on July 8, 2015 from https://books.google.com.ph/books?hl=en&lr=&id=ngvJpBZ60DwC&oi=fnd&pg=PP1&dq=anti+social+behaviour&ots=0veZTNuz8P&sig=I9L4Z55zjLJrmdy78mCq9ndjXPI&redir_esc=y#v=onepage&q=anti%20social%20behaviour&f=false

Mirzaee, A. (July, 2014). Descriptive Research: Defining Your Respondents and Drawing Conclusions. Retrieved on February 10, 2015 from http://fluidsurveys.com/university/descriptive-research-defining-respondents-drawing-conclusions/

Morgaine, C. Ph.D. (2001). Family System Theory. Retrieved on January 11, 2015 from http://web.pdx.edu/~cbcm/CFS410U/FamilySystemsTheory.pdf

Nadeau,K. (2015). The Philippines. Retrieved on Ocotber 31, 2015 from http://family.jrank.org/pages/1277/Philippines.html

Olson, S. (June, 2013). Men Mature After Women- 11 years after, To be Exact- A British Study Reveals. Retrieved on October 16, 2015 from http://www.medicaldaily.com/men-mature-after-women-11-years-after-be-exact-british-study-reveals-246716

Parr,R.A. (June, 2009). The Effects of Family Size on Parenting Behavior and Child Development. Retrieved on Ocotber 31, 2015 from http://web.kssp.upd.edu.ph/csspbox/pdf/ThesisDissertationAbstract/AY2009_2010/The_Effects_of_Family_Size_on_Parenting_Behavior_and_Child_Development.pdf

Pickhardt, C.E. (January, 2012). Adolescence and the Myth of Independence. Retrieved on October 23, 2015 from https: //www. psychologytoday. Com /basics /adolescence

Pondoyo, G.A (2015). The Filipino Family. Retrieved on January 12, 2015 from http://www.scribd.com/doc/74642455/The-Filipino-Family#scribd

Rodgers, R. H., & White, J. (1993). Family Development Theory. Retrieved on January 11, 2015 from M.https: //www.google. com.ph /url?

Rutter,M., Griller,H., Hagell.A (1998). Antisocial Behavior by Young People. Cambridge University Press. The Pitt Building, Trumpington Street, Cambridge,CB21RP, U.K.

Ryan, R. (September, 2014). Parents' separation found to boost children's behavior problems, but only in high-income families. Retrieved on October 31, 2015 from http://www.eurekalert.org/pub_releases/2014-09/sfri-psf090314.

https://www.bgsu.edu/content/dam/BGSU/college-of-arts-and-

https://www.bgsu.edu/content/dam/BGSU/college-of-arts-and-

http://www.livinginthephilippines.com/culture-and-people/philippine-culture/1308-

https://books.google.com.ph/books?hl=en&lr=&id=ngvJpBZ60DwC&oi=fnd&pg=PP1&

51

Needs and Satisfaction Level of Farmers in the Selected Barangays of Agoo, La Union

Realiza S. Asperin, Conielyn A. Cunanan, Karren Mae S. Estacio, and Maria Elena V. Milan

Abstract This study focused on the relationship between the needs and satisfaction level of farmers in the selected barangays of Agoo, La Union. The study made use of descriptive research design and quota sampling technique. A self-constructed questionnaire on needs and satisfaction level was used to gather the needed data. Average weighted mean and Pearson Product Moment Correlation programmed in SPSS were employed for the data analysis. The farmers/ respondents’ had strong need/s when it comes to economic and personal needs. In spite of their strong economic and personal needs, the farmers’ satisfaction level is still high. The needs of the respondents are significantly correlated with their satisfaction level. Keywords: needs, satisfaction level

Introduction

Situation Analysis According to World Bank statistics,

agriculture in the Philippines employs 47 percent of the Filipino workforce as of 2013. According to FAO Statistics, the Philippines is the 8th largest rice producer in the world, accounting for 2.8 percent of global rice production. The Philippines is also the world's largest rice importer in 2010 (Reuters, 2011). In 2010, according to Bureau of Agricultural Statistics, nearly 15.7 million metric tons of palay (pre-husked rice) were produced. In the same year, palay accounted for 21.86 percent of gross value added in agriculture and 2.37 percent of GNP.

One of the hardest jobs one can ever experience is being a farmer (Pangilinan, 2010). Because of many typhoons that the country experiences yearly, it is hard to see earnings blown by just a blink as stated by Canada-based International Development Research Centre (IDRC) in 2009. As of now, food is the main concern of everyone and the government cannot meet local demand if the country loses its farmers (Pangilinan, 2013).

According to the World Bank, the percentage of agricultural land or the land of area here in the Philippines was last measured at 40.08 percent in 2009. The Philippines is still an agricultural country even if it is planned to have an industrialized economy by 2000. Most Filipinos

still live in natural resources and support themselves through agriculture specially farming.

Guttierez (2013) said that it is risky to manage a farm and to become a farmer because typhoons and other calamities that the Philippines experiences over the years can easily wipe out earnings. Some concerns about farmers especially those aging Filipino farmers is that quitting from farming has led to problems in some areas in the country which could really lead to food shortage and crisis. In places like central Luzon, farm owners are already having difficulty in finding or hiring farm workers during the time of planting and harvest that really needs a full force of labor (Bingabing, 2013).

The problems of farming are associated with poverty. So no farmer would want his/her children to become farmers (Badiola, 2013). When the school officials interviewed students of Kalinga Apayao State College (KASC) regarding their disinterest in taking agriculture courses, one answer given is the lack of employment opportunities in the farming sector (Bagtang, 2013). This is also supported by the latest labor force survey conducted by the National Statistics Office which identified the latest average wage and salary of the agricultural sector compared to non-agricultural sectors.

52

Framework of the Study Farmers in the Philippines Poor farmers, fisher folk and people indirectly employed by agriculture make up almost 60 percent of the country's labor force. Pangilinan also said that the average Filipino farmer is 57 years old with an educational attainment of Grade 4. He makes roughly P23,000 ($529)* a year and

owns just 1.5 hectares of land (Ranada, 2015). Data from the Department of Agriculture and Bureau of Agricultural Statistics shows that farming in the Philippines cannot support a family with the farmer’s average annual income that is about P20,000 or less than P2,000 a month (Alave, 2011).

Level of Needs

Human beings need water and food in

order to survive (Zulueta, 2006). In economics, the term resources cover the inputs used in the production of goods and services (Gabay et al., 2008). In the Law of demand, people buy more goods and services when their income increases but they will buy less if their income decreases, thus, affecting the demand for goods and services. Changes of incomes in people will change their demand for goods and services. An increase in income will either increase or decrease demand depending upon the kind of commodity present (Leano and Corpuz, 2008). The individual is never able to completely satisfy all his needs whether these are biological, psychological, or existential. Much of what he desires cannot be attained; hence, he is frustrated, in conflict, or is anxious (Taag et.al, 2009). According to Murray, if one or more needs are not fulfilled by an individual, that

individual will be under stress and to be able to relieve stress, he has to strive or do appropriate actions (Ariola, 2009).

Maslow’s hierarchy of needs or ordering motivational needs considers different motivational needs to be ordered in a hierarchy. It suggests that before more sophisticated higher-order needs can be met, certain primary needs must be satisfied. And in the theories of motivation, drive-reduction approaches suggest that when people lack some basic biological requirements, a drive to obtain that requirement is produced to satisfy one’s need. Primary needs that are essential for survival are food, water, sex, sleep, air, and comfortable temperature and the secondary needs represent the needs of the mind and spirit such as self-esteem, sense of duty, self-assertion, belonging, and giving and receiving affection

. Level of Satisfaction

One of the studies discovered that employees who engage in some self-deception were more satisfied in their lives and in their jobs (Erez and Judge, 2013). This means that they are contented with what they have in their lives. A self-actualizer is a person who is living creatively and fully by using his or her potentials. While the theory is generally portrayed as a fairly rigid hierarchy, Maslow noted that the order in which

these needs are fulfilled does not always follow this standard progression (Kendra, 2015).

There are certain factors in the workplace that can cause or lead to self-satisfaction and another factor can cause also dissatisfaction. These satisfaction and dissatisfaction are also caused by factors including the work itself and other factors around it (Dynamic Psychology handout, 2015).

Statement of the Problem The researchers determined the relationship of needs and satisfaction level of the farmers in terms of their economic and personal needs. Specifically, the study sought to answer the following problems: 1. To what extent or level do the respondents experience the needs in terms of: 1.1 economic and 1.2 personal needs? 2. What is the satisfaction level of respondents in terms of: 2.1 economic and 2.2 personal needs? 3. Is there a significant relationship between the economic needs and economic satisfaction of the respondents? 4. Is there a significant relationship between the personal needs and personal satisfaction of the respondents? 5. Is there a significant relationship between the economic needs and personal satisfaction of the respondents? 6. Is there a significant relationship between the personal needs and economic satisfaction of the respondents?

53

Conceptual Paradigm Independent Variable Dependent Variable

What we know… What we don’t know

Figure 1. The Research Paradigm

Methodology

Research Design This study made use of descriptive

correlation research design. This design is a non-experimental technique which aims to describe the relationship between two or more variables which involves observing and describing the behavior of a particular subject without influencing it (Shuttleworth, 2008). In order to achieve the objectives of this study, the researchers employed the research design which showed and analyzed the relationship between the level of needs and the satisfaction level of farmers. This method proved the value of the data gathered to arrive at the answers to the problems of the study. The data were gathered using a questionnaire subjected to statistical analysis by using frequency and average weighted mean for the level of needs and satisfaction level. The Pearson Moment Correlation Coefficient with the help of SPSS was utilized for the analysis of the significant relationship between level of needs and satisfaction level. Furthermore, this study determined the relationship between economic needs and economic satisfaction, personal needs and personal satisfaction, economic needs and personal satisfaction, and personal needs and economic satisfaction. Moreover, this study is limited to some extent of scope including to what farmers really need in terms of economic and personal factors. Results of this study can only be applied to the

farmers in selected barangays of Agoo, La Union for the year 2015-2016.

Sources of Data

The respondents were the farmers in the selected barangays of Agoo, La Union whose major source of living is farming. The researchers selected these farmers from the list certified by the Department of Agriculture (DA) and given to each barangay.

Using the stratified random sampling and utilizing Lynch Formula, farmers from Agoo, La Union specifically barangays Sta. Monica, San Pedro, and Sta. Rita Sur were chosen as respondents of the study. The number of farmers in each barangay is 46, 39 and 19 respectively with a total sample population of 105 respondents. The names of the participants were identified through quota sampling technique. The study was conducted from July 2015 to October 2015 when the first cropping of rice began. Instrumentation and Data Collection

The instrument and data gathering tool utilized was a survey questionnaire that measured the level of needs and satisfaction level of farmers in the selected barangays in Agoo, La Union. The questionnaire was constructed by the researchers based on the preliminary survey, readings and validated by psychology experts. The self-constructed questionnaire underwent validation resulting in a content validity of 4.0 which means that the questionnaire is highly valid with a reliability coefficient of 0.535. The questionnaire consisted of two parts. The first part

ECONOMIC

NEEDS

PERSONAL

NEEDS

ECONOMIC

SATISFACTION

PERSONAL

SATISFACTION

LEVEL OF NEEDS SATISFACTION LEVEL

54

is the level of needs of the respondents as to their economic and personal needs. The second part consisted of the level of satisfaction of farmers which included their economic and personal satisfaction. The researchers used Likert Scale to obtain a quantitative data for objectivity. The questions in the questionnaire are stated in Filipino for better and easier understanding. To maintain consistency in generating the questionnaire, the researchers used a uniform dialogue. Data Analysis

The Likert Four Point Rating Scale was used to quantify the level of needs and level of satisfaction of the farmers. Weighted mean (WM) was used to determine the level of needs in terms of economic and personal needs of the farmers in each indicator. For the degree and significance of relationship between level of needs and satisfaction level, the Statistical Package for the Social Sciences (SPSS) was used. In analyzing the relationship of the economic needs and economic satisfaction, personal needs and personal satisfaction, economic needs and personal satisfaction, the Pearson Product Moment Correlation was utilized

. Results and Discussions

Level of Economic Needs of Farmers The respondents have strong economic needs in farming. These economic needs include the need for capital for their farm; the need to have profit instead of loss; the need for machines/tools in their farm to become more productive; the need

for grants from the government for their farm such as seeds, fertilizers, etc.; and the need for farm-to-market roads so that vehicles can carry their crops to their customers

.

Level of Personal Needs of Farmers In general, the computed average

weighted mean of the level of personal needs of the respondents is M=3.35. This means that the respondents have strong personal needs. Because other people view farming as an unattractive job, farmers don’t feel socially accepted among other people. These top most personal needs include the

need for things like soap, toothpaste, powder, alcohol, lotion, etc. for their hygiene; need for a sense of belongingness with their co-farmers; need vitamins like Vitamin C, calcium, etc. for their health; need for plenty of rest; and the need for social acceptance as farmers

. Level of Economic Satisfaction of Farmers

In general, the computed average weighted mean in the satisfaction level of farmers as to economic need is 3.24 with the descriptive rating of agree or ‘’sumasangayon” which means that they are satisfied in terms of economic situation because they are satisfied with their job; they have wide

areas to plant; there’s a lot of customers because of quality crops with a low price; transportation is not a problem in delivering their crops to the market; and they can sell their crops even at low prices without losing anything in their profits.

Level of Personal Satisfaction of Farmers In general, the farmers are highly satisfied personally because they are happy being farmers. They value farming because this is their source of income. They perceive farming as one of the

fulfilling jobs because this is where they get food to eat. Another is that they are happy every time they are in the farm, and they are also happy when someone appreciates farming.

Table 1.Relationship between Economic Needs and Economic Satisfaction

Economic Needs Economic Satisfaction

Economic Satisfaction Pearson Correlation .315** 1 Sig. (2-tailed) .001

**. Correlation is significant at the 0.01 level (2-tailed).

55

Table 1 shows the relationship between

economic needs and economic satisfaction. Using Statistical Package for Social Sciences (SPSS), the researchers utilized Pearson Product Moment Correlation in order to analyze the responses of the farmers. The correlation coefficient r=.315 yielded a significance of P=0.001.This indicates a significant relationship between economic needs

and economic satisfaction among farmers. This implies that when the respondents meet their economic needs, it also affects their economic satisfaction. Meanwhile, if their economic needs are not met, they still tend to be satisfied. This is the reason why farmers are contented in spite of the notions that they have strong needs in terms of economic factors, but they still manage to be satisfied with what they have.

Table 2.Relationship between Personal Needs and Personal Satisfaction

Personal Needs Personal Satisfaction

Personal Satisfaction Pearson Correlation .634** 1 Sig. (2-tailed) .000

**. Correlation is significant at the 0.01 level (2-tailed).

Table 2 shows the significant relationship

between personal needs and personal satisfaction of the farmers. Using Statistical Package for Social Sciences (SPSS), the researchers utilized Pearson Product Moment Correlation in order to analyze the responses of the farmers.

Correlation coefficient r=.634 yielded a significance of P=0.000. This indicates a

significant relationship between personal needs and personal satisfaction among the farmers and the correlation is significant at 0.01 level (2-tailed). This implies that when the personal needs of the farmers are met, it reflects that they are also satisfied personally. When these personal needs are not met, the farmers are not satisfied.

Table 3. Relationship between Economic Needs and Personal Satisfaction

Economic Needs Personal Satisfaction

Personal Satisfaction Pearson Correlation .389** 1 Sig. (2-tailed) .000

**. Correlation is significant at the 0.01 level (2-tailed). Table 3 displays the significant

relationship between economic needs and personal satisfaction of the farmers. Using Statistical Package for Social Sciences (SPSS), the researchers utilized Pearson Product Moment Correlation in order to analyze the responses of the farmer.

The correlation coefficient r=.389 yielded a significance of P=0.000. This indicates a significant relationship between economic needs and personal satisfaction of the farmers and the correlation is significant at 0.01 level (2-tailed). This implies that when economic needs are reached, then there is a personal satisfaction.

Table 4.Relationship between Personal Needs and Economic Satisfaction of Farmers

Personal Needs Economic Satisfaction

Pearson Correlation .441** 1

Sig. (2-tailed) .000

**. Correlation is significant at the 0.01 level (2-tailed)

Table 4 displays the significant relationship between personal needs and economic satisfaction of the farmers. Using Statistical Package for Social Sciences (SPSS), the researchers utilized Pearson Product Moment

Correlation in order to analyze the responses of the farmers. The correlation coefficient r=441 yielded a significance of P=0.000. This indicates a significant relationship between personal needs and economic satisfaction of the farmers and the

56

correlation is significant at 0.01 level (2-tailed). Result implies that when personal needs are

obtained, the respondents are economically satisfied.

Conclusions

Based on the findings of the study, the following conclusions were drawn:

1. The respondents have a strong need in terms of economic need and personal needs.

2. In terms of their satisfaction level, the respondents are satisfied economically and they are highly satisfied personally.

3. Economic needs and economic satisfaction are significantly related.

4. Personal needs and personal satisfaction are significantly related with each other.

5. Economic needs and personal satisfaction are significantly related with each other.

6. Personal needs and economic satisfaction are significantly related with each other

Recommendations

1. Farmers should participate in seminars and should apply what they learn to sustain their economic and personal needs. There should be a livelihood program that will teach the farmers an alternative way of earning money aside from farming while waiting for the harvest time. This will help the farmers earn money for their daily expenses.

2. Farmers should also learn to save money for their personal needs so that in times of needs, they have something to use.

3. Farmers should maintain being happy, motivated, and glad being a farmer in spite of their needs that are unmet. They

should think positively in order to become more motivated. They should maintain the feeling of satisfaction, personally and economically.

4. There should be another study that would help the farmers become more productive and responsible not just in economic and personal aspects but for other aspects of their lives.

5. The researchers highly recommend that there should be a study that will compare the needs and satisfaction level of farmers in the different areas of Agoo, La Union or in the other places.

Literature Cited Abraham H. Maslow, Motivation and Personality. 2nd ed., Chapter 11 "Self-Actualizing

People: A Study of Psychological Health "Crop Production Statistics 2009".FAO Stat. FAO Statistics. Retrieved last October 27,

2015 from https://en.m.wikipedia.org/wiki/Agriculture_in_the_Philippines "Factbox - Top 10 rice exporting, importing countries". Reuters. 28 January 2011.

Retrieved last October 27, 2015 from https: //en.m. wikipedia. org/wiki /Agriculture _in_ the_ Philippines

Gabay, B. K. G. et al., (2008) Health Economics in the Philippine Context Book: Concept of Economics. Manila Philippines. Rex Bookstore. pp. 5-7. Retrieved last October 24, 2015.

Higgins, E. T. (1987). "Self-discrepancy: A theory relating self and affect". Psychological Review 94: 319–340.Retrieved last October 15, 2015. Retrieved last October 24, 2015

http://en.wikipedia.org/wiki/Agriculture_in_the_PhilippinesRetrieved last January 7, 2015

http://www.nationsencyclopedia.com/economies/Asia-and-the-Pacific/Philippines- AGRICULTURE.htmlRetrieved last January 7, 2015

http://www.unh.edu/campusjournal/2013/10/farmers-market-survey-reveals-high- customer-satisfactionRetrieved last January 7, 2015

http://pareonline.net/getvn.asp?v=5&n=11Retrieved last January 7, 2015 http://en.wikipedia.org/wiki/Two-factor_theoryWikipediaCC BY-SA 3.0. Retrieved last

January 7, 2015 http://www.manilatimes.net/aging-filipino-farmers-to-affect-food-security/12166/Retrieved

last January 7, 2015 http://www.irinnews.org/report/97550/filipino-farmers-a-dying-breedRetrieved last January 7, 2015 http://www.artofmanliness.com/2009/07/15/so-you-want-my-job-farmer/ Retrieved last January 10, 2015

http://www.cbc.ca/news/young-people-drawn-to-farming-by-income-job-opportunities- 1.1668323Retrieved last January 10, 2015 http://en.wikipedia.org/wiki/Satisfaction_theory_of_atonementRetrieved last January 12, 2015

http://www.tradingeconomics.com/philippines/agricultural-land-percent-of-land-

http://en.wikipedia.org/wiki/Agriculture_in_the_PhilippinesRetrieved%20last%20January%207

http://www.nationsencyclopedia.com/economies/Asia-and-the-Pacific/Philippines-

http://www.unh.edu/campusjournal/2013/10/farmers-market-survey-reveals-high-

http://www.manilatimes.net/aging-filipino-farmers-to-affect-food-security/12166/Retrieved

http://www.irinnews.org/report/97550/filipino-farmers-a-dying-

http://www.cbc.ca/news/young-people-drawn-to-farming-by-income-job-opportunities-

http://www.tradingeconomics.com/philippines/agricultural-land-percent-of-land-

57

areawbdata.html Retrieved last January 7, 2015 http://smallbusiness.chron.com/job-characteristics-theories-job-satisfaction-

15601.htmlRetrieved last January 12, 2015 http://en.wikipedia.org/wiki/Social_exchange_theoryRetrieved last January 12, 2015 http://www.spoars.org/journal/v3n4p2 Retrieved last January 12, 2015 http://www.rappler.com/business/industries/247-agriculture/63313-pangilinan- economic-growth-farmers-

fishermen-first Retrieved last March 17, 2015. http://study.com/academy/lesson/economic-needs-and-wants-definition-lesson-

quiz.html Retrieved last October 17, 2015 Kendra, C. "What Is Self-Actualization?".About.com."KEY FINDINGS Linking Employee

Satisfaction with Productivity, Performance, and Customer Satisfaction ."(PDF).

Leana, R.D. Jr. and Corpuz, R.M. (2008). Fundamentals of Economics with Agrarian Reform, Taxation and Cooperatives (A Modular Approach).Cel Muralla St., Intramuros, Manila. Mindshapers Co.,INC. pp. 104. Retrieved last October 24, 2015.

Strauman, T. J. (1989). "Self-discrepancies in clinical depression and social phobia: Cognitive structures that underlie emotional disorders?". Journal of Abnormal Psychology 98: 14–22. Retrieved last October 15, 2015.

Schacter, Daniel L., Gilbert, Daniel T., and Wegner, Daniel M. "Human Needs and Self Actualization".Psychology; Second Edition. New York: Worth, Incorporated, 2011. 486487. Print.

Taag, G.C. et al., (2009) General Psychology Course book (Revised Edition): Dynamics of Behavior. Pantoc, Meycauayan City 3020, Bulacan Trinitas Publishing, Inc. pp.139. Retrieved last October 10, 2015.

Zulueta, F.M. (2006). Anthropological and Sociological, Concepts and Perspectives. Quad Alpha Centrum Bldg. 125 Pioneer Street Mandaluyong City 1550. National Bookstore.pp4-16. Retrieved last October 24, 2015

http://smallbusiness.chron.com/job-characteristics-theories-job-satisfaction-

http://www.rappler.com/business/industries/247-agriculture/63313-pangilinan-%20%20%20economic-

http://study.com/academy/lesson/economic-needs-and-wants-definition-lesson-

58

Prosocial Tendency and Social Interaction Problems among Farmers

Charamine M. Hidalgo, Jessa Mae G. Jamile, Raisa Mae L. Paneda, and Kessy Ivy M. de Guzman

Abstract Social interactions are inevitable even among farmers. This study focused on farmers’ tendency to

display prosocial behaviors and how frequent they encounter social interaction problems. Using descriptive correlational research design, 131 farmers responded to an adopted questionnaire (Prosocial Tendency Measure-Revised) and a self-constructed questionnaire on social interaction problems. Statistical analysis indicated that farmers have a moderate prosocial tendency. However, they are most likely to help in emotional situations. They rarely experience problems in social interactions. Furthermore, a significant negative relationship exists between the two variables. Thus, farmers with high prosocial tendency experience less social interaction problems. Keywords: prosocial tendency, social interaction problems Introduction Situation Analysis

Farming first began in the Fertile Crescent, which stretches from Israel north to southeast Turkey then curves southeast to the Persian Gulf. However, agriculture was also invented independently in other parts of the world as well. Meanwhile farming spread from the Middle East to Europe. By about 4,000 BC people in central Europe were using oxen to pull plows and wagons. About the same time people in the Middle East began using donkeys as beasts of burden. Also about 4,000 BS horses were domesticated on the steppes of Eurasia (The Farming Revolution).

As the revolution in farming continued, farmers focused on improving their way of living and practice of agriculture, resulting in lessened social behaviors and interaction than what was practiced.

From the moment of birth, humans are social creatures. Indeed, without social interactions (the support of caregivers), no infant would survive. Even when we become capable of living independently, very few people seek to live in isolation (Lambert, 2013). Instead, people generally welcome social interactions, and no study of behavior would be complete without considering these interactions (Cherry, 2015).

Social behavior is a term used to describe the general conduct exhibited by individuals within a society. It is essentially in response to what is deemed acceptable by others. It involves avoiding behavior that is characterized as unacceptable. This type of human behavior primarily determines how individuals interact with one another within a group or society.

The changes in the society greatly affect the social interactions among people. Considering the escalating roles of farmers in the country, their jobs can influence people including their families and fellow farmers, and how they interact with them. However, despite the big roles the farmers have, farming is deemed a lowly job. Differing perceptions, especially the negative ones, can affect social interactions which may result in problems.

With this in mind, this study focuses on social behaviors, specifically prosocial behaviors, in the field of agriculture. Another aspect of social behaviors this study will look into is the problems encountered by farmers when interacting with other people. A significance of the study is that it will provide the researchers more knowledge in the social behavior of the farmers in selected barangays of San Fabian, Pangasinan, especially

59

on their prosocial tendency. Result of the study will importantly contribute to the following people: the farmers in order for them to overcome the problems affecting their social behavior and to have a great, open communication within their community that can lead into a healthy and intact

relationship; the community in order for them to be aware of the effect of interaction problems and to develop an open-mind about the social life and behavior of the farmers; and, future researchers, for them to have more input if they will work on similar topic.


The way people perceive themselves in relation to the rest of the world plays an important role in their choices, behaviors and beliefs. Conversely, the opinions of others also impact their behavior and the way they view themselves (Cherry, 2015). People show different behaviors toward others. It may be a positive or a negative behavior.

According to Simpson (2014), there are three factors in defining prosocial behavior. These are prosocial behavior, benevolence, and pure altruism. Prosocial behavior is any action intended to benefit another. It is defined as actions that benefit other people or the society as a whole (Twenge, Ciarocco, Baumeister, & Bartels, 2007). Another factor is benevolence which is defined as an action to benefit other people intentionally for external reward. Helping is encouraged by rewards. Lastly, pure altruism is an act that benefits other people intentionally for no external or internal reward.

Prosocial behavior is a pattern of activity, and altruism serves as the motivation to help others out of pure regard that benefits other people rather than how the action will benefit oneself. Warneken and Tomasello (2009) proposed a typology of prosocial behavior, comprising four elements. First is comforting; it is an act of providing emotional support to others. Second is sharing like giving food or other things to others. Third is informing, the act of providing useful information for others. Lastly is instrumental helping, the way of doing an action to help others on behalf of others’ goal.

There are a number of reasons why people engage in prosocial act. Several theoretical perspectives on helping are considered. These

include the evolutionary perspective. Evolutionary psychology is an approach in the social and natural sciences that examines psychological traits such as memory, perception, and language from a modern evolutionary perspective. It is the attempt to explain social behavior in terms of genetic factors that evolved over time, according to the principles of natural selection. It contends that life’s essence is gene survival. The three evolutionary processes or mechanisms most commonly proposed to explain why prosocial acts lead to evolutionary success are kin selection, reciprocal altruism, and group selection (Penner et al, 2004).

The idea of kin selection suggests that helping members of an individual’s own genetic family makes it more likely that their kin will survive and pass on genes to the future generations. Kin selection focuses on learning more about the proximal mechanisms that are responsible for kin selection, how the presumed genetic tendencies are translated into behaviors. Korchmaros& Kenny (2001) demonstrated that emotional closeness partially mediated the effects of genetic relatedness on willingness to help. Genes drive an individual in adaptive ways that have maximized the chance of survival (Myers, 2010).

In particular, the proposal that prosocial tendencies are passed from generation to generation via genes has two specific implications. The first is that there must be some physiological or neurological processes that facilitate prosocial behaviors. The second is that at least some of the processes that facilitate prosocial responses are inherited (Penner et al., 2004)

. Predictor Criterion

Figure 1.Research Paradigm Schematic Illustration of the Relationship between the Variables

of Predictor and Criterion

Level of Prosocial Tendency

a. Public b. Anonymous

c. Dire

d. Emotional

e. Compliant

f. Altruism

Social Interaction Problems

60

Statement of the Problem This study aimed to find out the relationship between prosocial tendency and social interaction problems of farmers. Specifically, it sought to answer the following questions:

1. What is the level of prosocial tendency of farmers in terms of: 1.1 public; 1.2 anonymous; 1.3 dire; 1.4 emotional; 1.5 compliant; and 1.6 altruism?

2. How frequent do farmers encounter problems in social interaction? 3. Is there a significant relationship between the level of prosocial tendency and the frequency of social interaction problems? Methodology

Research Design The research design used in the study was

descriptive correlational. This method was used to determine the relationship between prosocial tendency of farmers and their social interaction problems. It involved the collection of data, tallying of the responses of the respondents, analysis and interpretation of gathered data to describe the prosocial tendency and the social interaction problems of farmers. The relationship of the variables was analyzed and interpreted.

Data Sources The sources of data involved were the registered farmers in barangay Lipit-Tomeeng, San Fabian, Pangasinan. Convenience sampling approach was used in the recruitment of the respondents. This is a statistical method of drawing representative data by selecting people because of the ease of their volunteering or selecting units because of their availability or easy access. The approach to sampling was chosen on the basis of their knowledge of the information desired. The subjects were selected because they were easy to recruit, accessible and they were willing to participate for the study.

For the sampling of the population the researcher used Lynch’s Formula to acquire representative of the population. A total number of 131 respondents were selected from barangay Lipit-Tomeeng, San Fabian, Pangasinan.

Data Collection One of the main instruments used to gather the needed data is a self-constructed questionnaire while the other is adapted. The first part of the questionnaire, an adopted scale from the study “The Development of a Measure of Prosocial Behaviors for Late Adolescents” by Carlo & Randall known as Prosocial Tendency Measure-Revised (PTM-R), measured the level of prosocial tendency of the farmers. The last part is a self-constructed scale which measured the frequency of the social interaction problems.

PTM-R was used to measure the level of prosocial tendency of farmers. The Prosocial Tendencies Measure (PTM) originally was developed to assess self-report of six types of prosocial tendency among college individuals (Carlo & Randall, 2002). Participants were asked to rate the extent to which statements described themselves on a 5-point scale ranging from 1 (does not describe me at all) to 5 (describes me greatly).Data were coded such that high scores on each of these scales reflect a stronger endorsement.

The questionnaire measuring the social interaction problems of farmers was constructed through preliminary survey, asking the common social interaction problems of farmers. Answers from the preliminary survey served as the basis of the researchers to construct the questionnaires. These were validated by some professors of DMMMSU-SLUC in Guidance and Counselling, and in Psychology. The questionnaire had high validity with a mean of 4.24, meaning the questionnaire measured the variables that are supposed to be measured. Pilot testing was also done by the researchers to measure the reliability of the questionnaire. Originally the constructed questionnaire was composed of 20 items. The researchers removed some items to increase the reliability of the questionnaire, and only 17 items were retained. The questionnaire had a reliability of (17 items, Cronbach’s α = 0.77).

Data Analysis To describe the sample based on the data

gathered, the following statistical tools were used in the interpretation and treatment of the data gathered: 1) Average Weighted Mean –which determined and interpreted the prosocial tendency; 2) Five-Point Likert Scale which determined the level of prosocial tendency of the farmers and how frequent do farmers encounter the given social interaction problems. The computed weighted mean was interpreted based from the scale of very low to very high. This was used in order to quantify the gathered data on social interaction problems of farmers; and 3)

http://www.businessdictionary.com/definition/method.html

http://www.businessdictionary.com/definition/drawer.html

http://www.businessdictionary.com/definition/representative.html

http://www.businessdictionary.com/definition/data.html

http://www.businessdictionary.com/definition/unit.html

http://www.businessdictionary.com/definition/availability.html

http://www.businessdictionary.com/definition/access.html

61

Pearson Product Correlation Coefficient which was used in finding correlation between prosocial tendency and social interaction problem. Results and Discussion

Prosocial Tendency Result showed that the highest rated type of prosocial tendency is the subscale emotional with an average weighted mean of M=3.43 which is interpreted as high tendency. This indicates that farmers tend to help in situations that involve strong emotions. The remaining types of prosocial tendency (public, dire, compliant, anonymous, and altruism), on the other hand, were at the midpoint of the rating scale and were interpreted as moderate level of prosocial tendency. In general, they have a moderate level of prosocial tendency. Farmers have the tendency to help others in different situations.

Persons who tend to help across the 6 subscales of prosocial tendency measure were

more likely to take the outlook of others; they conform with others; they show more sympathy; they take the responsibility to themselves; and they are more likely to help in different situations (Carlo & Randall, 2002). Their reason why they help is to fit in the society.

However, the farmers in Lipit-Tomeeng tend to help more when strong emotions are involved or the person in need is highly emotional. Emotional appeals reflecting a person’s need for assistance effectively increase helping (Vaes et al. 2002). Emotion motivates prosocial action. The tendency to help is aroused by distress of others (Eisenberg & Fabes, 1991).

Social Interaction Problems Result shows that the farmers from Lipit-

Tomeeng sometimes experience social discomfort and clash of opinions with others. Also, they are sometimes doubtful about themselves and their ability when in public. The rest of the social interaction problems are rarely experienced by the farmers. In general, the social interaction problems have an average weighted mean of M=2.56 which is interpreted as rarely experienced by farmers. This implies that the farmers in

barangay Lipit-Tomeeng do not experience much social interaction problems. Environment affects socially interaction behavior of a person. It is said that people who live in rural areas have better social skills than those who live in the cities or urban areas. In a smaller tight-knit farming community, everyone in the community tends to interact, communicate, and know each other’s business(www.succeedsocially.com, 2015).

Table 1. Relationship between Prosocial Tendency and Social Interaction Problems

Legend: ***-significant at α=.001 N=131

Table 1 shows a significant negative

relationship between the level of prosocial tendency of farmers and how frequent they experience social interaction problems, r=-.652, p<0.001, N=131. This indicates that there is high correlation between prosocial tendency of farmers and their social interaction problems. This implies

that the higher the tendency the farmers demonstrate prosocial behaviour, the less frequent they experience social interaction problems. In other words, as the level of prosocial behavior increases, the frequency of social interaction problems of farmers decreases.

Conclusions

1. The farmers have moderate prosocial tendency which means they tend to help other people. However, when people are under emotional situations, farmers tend to be more helpful.

2. The farmers do not experience much social interaction problems. They have the ability to handle and maintain smooth interpersonal relationships.

Correlation Coefficient Significance (p)

Prosocial Tendency*Social InteractionProblem

r = -.652*** .000

62

3. The prosocial tendency and social interaction problems of farmers have a significant negative relationship. Thus,

farmers with high prosocial tendency experience least social interaction problems.

Recommendations

1. Farmers could practice more prosocial behaviors. That is, helping is done in different contexts—help is given to anyone who seeks helps, anytime, anywhere.

2. Farmers should maintain smooth interpersonal relationships they already have established since they rarely experience problems in dealing with people. Other individuals could learn from the farmers.

3. Improving prosocial tendency and skills could help not only the farmers but everyone, to reduce experience of problems in social interactions in order to have a harmonious community.

4. Psychologists and researchers could be of help by studying the characteristics and social skills of farmers that contribute to the rare experience of social interaction problem.

Literature Cited Alave, Kristine L. (2012). Philippines is running out of farmers. Retrieve of October 5, 2015 from http://business.inquirer.net/18611/philippines-is-running-out-of- farmers Azimpour, A. (2011).Validation of “Prosocial Tendencies Measure” in Iranian University Students. Retrieve on March 26, 2015, from http://www.jlsb.science- line.com/attachments/article/13/JLSB-2012-B7,%2034-42.pdf. Azimpour A., Neasi A., Shehni-Yailagh M., and Arshadi N. 2012.Validation of “Prosocial Tendencies Measure” in Iranian University Students. J. Life Sci. Biomed. Batson, C.D. (2005). Altruism and prosocial behavior. Batson, C.D. (1995). Prosocial Motivation: Why do we help others? Brice, T. (2006).10 Tips for Improving Social Interaction. Retrieve on October 10, 2015, from http://www.groco.com/readingroom/per_socialinteraction.aspx Bandura, A. (2001). Social cognitive theory: An agentive perspective. Annual Review of Psychology, 52, 1-26. Bandura, A. Self-efficacy: The exercise of control. New York: Freeman.http://learningtogive.org/papers/paper52.html. Retrieved on March 26, 2015. Boundless.“Evolutionary Perspectives.”Boundless Psychology. Boundless, 19 Sep. 2014. Retrieved on March 26, 2015 from https://www.boundless.com/psychology/textbooks/boundless-psychology- textbook/introduction-to-psychology-1/history-of-psychology-23/evolutionary- perspectives-118-12655/ Boundless.“Understanding Social Interaction.”Boundless Sociology. Boundless, 03 July 2014. Retrieved on March 26 2015 from https://www.boundless.com/sociology/textbooks/boundless-sociology- textbook/social-interaction-5/understanding-social-interaction-50/understanding- social-interaction-314-5912/ Carlo, G.,&Randall, B. A. (2002). The development of a measure of prosocial behaviors for late adolescents. Causes of Weak Social Skills (2015), Retrieve on October 10, 2015 from http://www.succeedsocially.com/relatedfactors. Cherry, K. A. (2011). What is diffusion of responsibility? Retrieved on October 23, 2015 from http://psychology.about.com/od/dindex/f/diffusion-of-responsibility.htm Eisenberg, N., and Fabes, R. A. (1998).Prosocial development. Eisenberg N, and Fabes RA. 1991. Prosocial behavior and empathy: a multimethod developmental perspective. Eisenberg, N., & Morris, A. S. (2001).The origins and social significance of empathy- related responding, Social Justice.Fournier, Gillian (2010). Social Responsibility Norm. Franzoi, S. (2003).Social Psychology.Boston: McGraw-Hill. Hoffman, M. L. (2000). Empathy and moral development: Implications for caring and justice. Cambridge. Korchmaros JD, Kenny DA. 2001. Emotional closeness as a mediator of the effect of genetic relatedness on altruism. Omoto AM, Snyder M. 2002. Considerations of community: the context and process of volunteerism. Penner LA, Brannick MT, Webb S, Connell P. (2004). The effects of the September 11, 2001attacks on volunteering: an archival analysis.

ttps://www.boundless.com/psychology/textbooks/boundless-p

ttps://www.boundless.com/sociology/textbooks/boundless-s

63

Penner, L. A., Dovidio, J. F., Piliavin, J. A., & Schroeder, D. A. (2005).Prosocial behavior: multilevel perspectives. PsychCentral.(2009). Social Responsibility Norm. Retrieve on March 2, 2015, from http://psychcentral.com/encyclopedia/2009/social-responsibility-norm/ Sober E, Wilson DS. 1999. Unto Others: The Evolution and Psychology of Unselfish Behavior."Social Groups." Cliffsnotes.com. Retrieved on March 26, 2015. Sprecher, S., Fehr, B. (2005).Compassionate love for close others and humanity.

Journal of Social and Personal Relatioships Stangor, Charles (2016). Retrieve on March 2, 2015, from http://catalog.flatworldknowledge.com/bookhub/reader/127?e=stangor-

ch02_s02 Twenge, J.M., Baumeister, R.F., DeWall, N.C., Ciarocco, N.J., Bartels, M.J. (2007). Social Exclusion

Decreases ProsocialBehavior. Journal of Personality and Social Psychology. Twenge, J. M., Foster, J. D. (2008). Mapping the scale of the narcissism epidemic: Increases in narcissism 2002-2007 within ethnic groups.

http://catalog.flatworldknowledge.com/bookhub/reader/127?e=stangor-

64

ESGPPA Scholars’ Psychological Profile and Academic Performance

Dionica Mae M. Alqueza, Abelyn Joy R. Dapiaoen, Alicia Mae M. Regacho, and Marcelina H. Ayson

Abstract

This study focused on the relationship between ESGPPA scholars’ psychological profile and their academic performance. The study made use of descriptive research design and employed total enumeration sampling technique. The 16 Personality Factors (16 PF), Emotional Profile Index (EPI), Academic Aptitude Test (AAT), and the DMMMSU-IQ Test were employed to gather the needed data. Frequency count and percentage were employed for the data analysis. The respondents have varied personal profiles. They have an average mental ability, aptitude and academic performance. They have stable personality and emotional traits. Age is significantly correlated with their academic performance, while their psychological profile (mental ability, personality traits, emotional traits, aptitude) is significantly correlated with their academic performance. Keywords: ESGPPA scholars, personal profile, psychological profile, academic performance, aptitude

Introduction

Situation Analysis Most Filipinos have high regard on

education. In this setting, the main reason for not attending school is lack of personal interest which may be associated with several reasons; one of which is poverty because of high cost of education. As of now, what the beneficiaries need to do is to help themselves as well as the government helps them to positively think about what is happening and what will happen. The beneficiaries would at least show significant improvement (85%) in school attendance and should have a regular check up on their health condition.

Poverty may then be a factor in affecting one’s life. The 4Ps is a government program that aims to help indigent and poor families in their development by giving social assistance and social development given the observation that low schooling, ill health and high malnutrition are strongly associated with the poverty cycle in the Philippines. It aims to create an environment in which people can improve their lives and lead

productive adjustments in accordance with their needs and interests (www.car.dswd.gov.ph). However, the Philippine Institute for Development Studies (2013) reported the rate of enrollees in 2007 (Pre-CCT period) and 2011 that remains the same even if these poor families have already benefited from this program. Nonetheless, these past years, since the expansion of the program, which is the implementation of the ESGPPA, there were 4,041 scholars as of Academic Year 2012-2013. According to Marie Grace Ponce, 4Ps Chief Information Officer, the rate increased and approximately 36,000 enrollees were recorded nationwide for the Academic Year 2014-2015 (Philippine Canadian Inquirer). This government’s program is not just about helping the poor to alleviate poverty but to improve their lives through the government’s “little help”. But, how can this program help the beneficiaries improve their performance in school? Will it help them develop a wholesome personality?

65


This study tries to explore the situation of the ESGPPA scholars (4Ps beneficiaries) in their academic performance as well as in their personality. Personality and academic performance are two different things but both can be affected by poverty. As to the psychological profile of the scholars, this study tries to see if the program has an effect on their psychological state through the conducted test presented to the beneficiaries. With these concerns, researchers will be able to deal with the beneficiaries’ character and be acquainted with the development the students. The researchers will try to determine if the Pantawid Pamilya Program, rather than the Extended Grant-in-aid Program for Poverty Alleviation of the government helped the beneficiaries improve or somewhat change their personality, health, and education.

This study consists of an independent variable: the personal profile which includes the beneficiaries’ age, gender, family structure and their parents’ occupation as well; and the psychological profile of the ESGPPA scholars as presented through the conducted tests including the intelligence quotient, personality test and aptitude test. Psychological profile includes the standardized test popularly known due to the qualities associated with them (validity, reliability, etc.). The researchers want to determine if these independent variables are related to the dependent variable which is the academic performance manifested by the respondents’ grade point average (GPA). On the other hand, the arrow represents the direction of the relationships of variables between the independent and the dependent variable.


Figure 1. Research Paradigm Statement of the Problem This study aims to find out the relationship between the personal profile, psychological profile and academic performance of the ESGPPA scholars in the College of Arts and Sciences in Don Mariano Marcos Memorial State University, SLUC, Agoo, La Union. The specific problems that needed answers include:

1. What is the personal profile of the ESGPPA scholars as to age, gender, family structure, and parents’ occupation?

2. What is the psychological profile of the respondents along mental ability, personality traits; and aptitude?

3. What is the academic performance of the respondents based from their grade point average (GPA)?

4. Is there a significant relationship between the personal profile and the academic performance of the respondents?

5. Is there a significant relationship between the psychological profile and academic performance of the respondents?

6. What extension program can be proposed based from the results of the study?

A. Personal Profile Age Gender Family Structure Parents’ Occupation

B. Psychological Profile Intelligence Quotient Personality Traits Emotional Traits Aptitude

Academic Performance GPA

Input to an Extension

Program

66

Methodology

Research Design The study used a descriptive research design. Descriptive research design attempts to describe the nature of the situation as it exists at the time of the study and to explore the causes of a certain phenomena. It is a purposive process of gathering, analyzing, classifying and tabulating data about prevailing conditions, practices, beliefs, trends and cause-effect relationship and then making adequate and accurate interpretation about such data (Calderon, 2011). This design was used to describe, analyze and interpret the characteristics of the ESGPPA scholars with the identified variables. The relationship among the variables are also analyzed and interpreted.

Data Sources There were 45 identified college student-beneficiaries, second year to fourth year, of the 4Ps program or the Expanded Student Grant-in-aid Program for Poverty Alleviation (ESGPPA) of the DSWD. They were enrolled in the various programs of the College of Arts and Sciences. Their grade point average and the data on their mental ability were obtained from the main Guidance Office of DMMMSU-SLUC. Total enumeration was employed as the sampling technique for the 45 beneficiaries were all involved as respondents of the present study.

Data Collection The instruments used in determining the psychological profiles of the respondents were standardized tests. These included the 16 Personality Factors (16 PF, 5th Edition) for their personality traits. This was made up of 16 primary and 5 global factors. Test-retest reliability showed that the primary factors have a reliability coefficient of 0.80 and the global factors, 0.87. On the other hand, the 16 PF scales were based on factor-analytic methods, and results of these methods provided evidence about the construct validity of the 16 PF as a test. The obtained validity coefficient was .76 (16 PF Fifth Edition with

Updated Norm, 2002). The figures indicate that the 16 PF as a measure of personality traits has sufficient reliability and validity. The Emotional Profile Index (EPI), on the other hand, described the emotional traits of the respondents. This was made up of 8 emotional dimensions; namely, Trustful (Tr), Dyscontrol (Dy), Timid (Ti), Depressed (De), Distrustful (Di), Controlled (Co), and Aggression (Ag). This test yielded information about certain personality traits conflicts. It had a reliability coefficient of .90 applying the test-retest method. Furthermore, the validity of the test was correlated to the scales of other tests (MMPI, EPPS, and CMS). All of the correlations reported are significant at .01 level of significance (EPI Manual). On the other hand, the aptitude of the respondents was determined using the Academic Aptitude Test. A coefficient of reliability of .94 was obtained by applying the Kuder-Richardson formula (AAT Manual). The grade point average of the second up to fourth year students, as a measure of the respondents’ academic performance was based from their second semester of the school year 2014-2015. The respondents’ mental ability was based from the results of the DMMMSU-IQ Test. The GPA and mental ability of the respondents were requested from the guidance counselor who is in charge of scholarship and from the registrar, respectively. To gather the data on the personal profile (age, gender, parent’s occupation and the family structure) of the respondents, a simple personal profile questionnaire was developed by the researchers. Data Analysis The statistical tools used were frequency counts, percentage, Pearson Product Moment correlation and coefficient for the analyses and interpretations of the gathered data.


Personal Profile of the Respondents

There were 45 respondents all in all, 11 were males and 34 were females. Their age bracket ranged from 15-18, 19-21 and 22-24. The family structures were nuclear family, single parent family, extended family and grandparent family. The father and mothers’ occupation were as well discussed. Majority (76% or 34) of the respondents are female while 24 percent or 11 are males. This shows that there were more females who were able

to avail of the ESGPPA scholarship. It was also observed that 67 percent or 30 respondents were under the age range of 15 up to 18 years old. This implies that they were in their adolescence during the conduct of the study. The greatest percentage of the respondents’ family structure belonged to the nuclear family (69% or 31), while only 4 percent or 2 respondents lived with their grandparents. As to the parents’ occupation, majority (60% or 27) of the respondents’ fathers’

67

occupation is farming while 2 percent or 1 respondent is a driver’s assistant. On the other hand, a significant percentage of the respondents’ mothers’ occupation is housekeeping (49% or 22);

only 2 percent or 1 respondents’ mother work is pedicure/manicure services. This shows that their parents’ occupations are more of the blue collar jobs.

Psychological Profile of the Respondents The psychological profile of the respondents was measured through the use of standardized tests; the DMMMSU IQ Test for their intelligence, the Academic Aptitude Test (AAT) for their aptitude

and the 16 Personality Factors and the Emotional Profile Index (EPI) for their personality traits. Results are shown below.

Respondents’ Mental Ability

The mental ability of the respondents based from the DMMMSU-IQ Test showed that majority (71.1% or 32) of the respondents have an average intelligence. Grantees maintain the minimum passing grade (no drop, no incomplete grade) to

continue availing the scholarship. Since the respondents’ IQ falls on the average, beneficiaries are expected to study hard at least get promoted to the next higher grade level (The Philippine Star, June 2015).

Respondents’ Personality Traits

The personality profile of the respondents based from the 16 Personality Factors, 5th edition showed that the respondents obtained six factors (A, B, C, E, G, Q1) with a low stem score (3) out of the 16 primary factors, while two of the five global factors were observed to be high (8, TM: Tough-mindedness) and low (3, IN: Independence) highsten scores respectively.

The respondents tend to be reserved, impersonal, distant, stiff, cool, skeptical, and aloof, like things rather than people, and they prefer working alone. They are more likely to be precise and rigid in doing things and in personal standards. They also tend to be critical, obstructive or hard, at times (low, warmth). Likewise, the respondents tend to be low in frustration tolerance for unsatisfactory conditions, changeable, evading necessary reality demands, easily emotional and annoyed, active in dissatisfaction (low, emotional stability). However, the respondents tend to give way to others, to be docile, and to conform. They are often dependent, confessing, and anxious for obsessional correctness (low, dominance). On the other hand, they may tend to be unsteady in purpose. They are often casual and lacking in effort for group undertakings and cultural demands. The respondents also tend to be confident in what they have been taught to believe and accept the tried and true, despite

inconsistencies, when something else might be better. They are cautious and compromising in regard to new ideas. Thus, they tend to oppose and postpone change; they are inclined to go along with tradition, more conservative in religion and politics and not interested in analytical intellectual thought (low, openness to change). In terms of the global factors, the respondents obtained a highsten score in Tough Mindedness(TM), which the respondents may portray a sense of being established, possibly to the degree of being set or fixed. That is, they may not be open to the other points of view, to unusual people and experiences. They also tend to be inflexible and lack of openness. They may have difficulty in accepting new viewpoints, including those that involve emotions. On the other hand, their low sten score in Independence(IN) indicates that they tend not to question instead they value agreeableness and accommodation more than self-determination or getting their way. External situations and other people tend to influence them, both in terms of forming opinions and shaping behavior. The respondents may be very uncomfortable or ineffective in situations that call for self-expression, assertiveness and persuasion. The respondents obtained an average sten scores in most of the primary and global factors. This implies that they have average, balanced or stable personality

. Respondents’ Emotional Traits The emotional traits of the respondents based from the Emotional Profile Index reflects their graphical profile. Results showed that the male

respondents tend to be high under Trustful. This implies that they tend to be accepting, trusting, obeying and gullible. They tend to take things at

68

their face value and would probably be described as dependable persons or are suggestible.

However, they are average in the other emotional dimensions (Dy, Ti, De, and Gr).

Emotional Profile of the Respondents On the other hand, the female respondents are low in the three emotional dimensions (Trustful, Dyscontrolled, and Gregarious) but high under Timid and Depressed. The respondents tend to be unaccepting, distrustful, disobedient and not very gullible. They do not take things at their face value (low, Trustful). Moreover, they have the tendency to be unadventurous, reluctant to try new things or to have new experiences and they are not impulsive. They tend to withdraw from social contacts (low, Dyscontrolled). Likewise, the respondents tend to be unsociable, unfriendly, unaffectionate, introverted and has the tendency to be isolated and withdrawn (low, Gregarious). They tend, also, to be cautious, careful and anxious. They worry about getting into trouble

and also about what other people think of them and say about them (high, Timid). Likewise, the respondents tend to be depressed, sad and gloomy. They seem to be dissatisfied with the aspects of their life. They feel deprived and probably pessimistic (high, Depressed). On the other hand, they have average profile under Distrustful, Controlled and Aggression. Result shows that males generally tend to have average or stable emotional traits. The findings have some correlation with some source which says that men are more highly on self-regard and independence than women and also do better on dealing with events that are immediately stressful (http://www.trainingzone.co.uk).

Respondents’ Aptitude Results show that majority of the respondents have an average aptitude (53.3% or 24). It implies that they have average capability or skill to do a task or work assigned to them. This contradicts the Indiana Code Rule 51 which states that a student with high capabilities shows the potential

for performing at, or an outstanding level of accomplishment in at least one domain when compared to other students of the same age, experience, or environment; and is characterized by exceptional gifts, talents, motivation, or interests (Richmond Community Schools, 2012).

Academic Performance Result reveals that 36 percent or 16 respondents have a GPA of 2.50 (about average performance) while 2 percent or 1 of them have a GPA of 1.75 (high performance). None of the respondents obtained a GPA of 1.50. So generally, ESGPPA Scholars are average in their academic performance. Since ESGPPA scholars came from

low-socio income family, it is assumed that they are motivated to do well in school. Along this line, Pedrosa et al. (2006) said that some students from deprived socio-economic and educational background do perform better than others coming from higher socio-economic area.

Relationship between Personal Profile and Academic Performance

Respondents’ Personal Profile and Academic Performance Table 1 displays the relationship between

the personal profile and the academic performance of the respondents. Table 1 shows that the personal profile and the academic performance of the respondents are significantly correlated at 0.01 level of significance (r = -.440). Thus, the null hypothesis which states that the personal profile and academic performance of the respondents are not significantly correlated is

rejected. This implies that older respondents tend to have better academic performance. This is related to Richardson’s concept that mature students perform well in most academic settings other than younger students. He also reasoned that mature students seek a deeper understanding of their academic work compared to younger students who may adopt a surface approach (http://pubs.sciepub.com).

69

Table 1. Respondents’ Personal Profile and Academic Performance

Personal Profile

Variable Gender Age Family Father’s Mother’s Structure Occupation Occupation Pearson r .178 -.440** .231 .256 .074

GPA Sig. (2-tailed) .241 .003 .128 .090 .631

Psychological Profile and Academic Performance of Respondents

Table 2 displays the relationship between academic performance and the psychological profiles of the respondents. Table 2. Respondents’ Mental Ability and Academic Performance

Variable Academic Performance Mental Pearson r -.469**

Ability Sig. (2-tailed) .001

Table 2 shows that the mental ability of

the respondents has an inverse significant correlation with their academic performance (r = -.469) at 0.01 level of significance. Thus, the null hypothesis which states that the mental ability and academic performance of the respondents are not significantly correlated is rejected. This implies that those respondents who have high mental ability tend to have a better performance at school. According Ormrod (2008), intelligence does not necessarily cause achievement; it is simply correlated with it. Although students with high IQs typically perform well in school, we cannot say conclusively that their high achievement is actually the result of their

intelligence. Intelligence probably does play an important role in school achievement, but many other factors - motivation, quality of instruction, family resources, parental support, peer group expectations, and so on - are also involved. Studies repeatedly show that performance on intelligence tests is correlated with school achievement (Brody, 1977; Gustafsson & Undheim, 1996; Sattler, 2001). On average, children with higher mental ability do better on standardized achievement tests; have higher school grades, and complete more years of education. In other words, IQ scores often do predict school achievement imprecisely (http://www.education.com).

Table 3. Respondents’ Personality Traits and Academic Performance

Personality Traits Academic Performance

G: Rule-Consciousness Pearson r -.335*

Sig. (2-tailed) .025 L: Vigilance Pearson r -.330*


Table 3 shows that the personality traits

(G: Rule-Consciousness, r = -.335 and L: Vigilance, r = -.330) and academic performance of the respondents are significantly correlated at 0.05 level of significance. This implies that those who are high under rule-conscious and vigilance tend to have better academic performance. Although academic performance has typically been associated with intelligence rather than personality (Sternberg & Kaufman, 1998), empirical evidence shows that both personality

and intelligence are important predictors of academic achievement, given their long-known association with learning (Busato, Prins, Elshout, & Hamaker, 1999). This relationship has been found in both high school and college levels of education. According to Barton, Dielman, and Cattell (1972), in the sixth and seventh grades, the higher achiever, in all four domains of science, social studies, mathematics, and reading, is intelligent and conscientious.

Emotional Traits and Academic Performance Result reveals that depression, an emotional trait, is significantly correlated with the academic performance of the respondents. Thus, the null hypothesis which states that emotional traits and

academic performance are not significantly correlated is rejected. This implies that those respondents who tend to be low in depression tend to have better academic performance. This

70

supports the concept that depression gives negative effect on students’ academic performance, instead of enhancing their academic performance, it decreases their performance because it is considered to be a negative emotion. Furthermore, Fredrickson (2001) suggested that

positive emotions enhance academic competence because they encourage exploring, integrating diverse materials, and broadening potential methods of solving problems (http://www.ncbi.nlm.nih.gov).

Table 4. Respondents’ Aptitude and Academic Performance

Academic Performance

Aptitude Pearson r -.416**


Table 4 shows that the aptitude and

academic performance of the respondents are inversely correlated (-.416) at 0.01 level of significance. This implies that those respondents who have high aptitude tend to have better academic performance. Common knowledge says

that if an individual has the skill or capability in doing something, tendency of performing well in school is possible. This is related to the concept of Sackett which says that people with higher scores end up doing better (http: //www. psychologicalscience.org).

Conclusions The following conclusions were derived from the findings of the study:

1. Majority of the ESGPPA scholars are female. The respondents are in their adolescence during the conduct of the study. They belonged to the nuclear family. Their parents performed blue collar jobs.

2. The respondents, generally, have an average mental ability and aptitude. They also have a stable personality and emotional traits.

3. The ESGPPA scholars have an average academic performance.

4. There is a significant relationship between the age and academic performance of the respondents.

5. There is a significant relationship among the mental ability, personality traits, emotional traits and aptitude; and academic performance of the respondents.

6. An Extension Program was proposed based on the results of the study.

Recommendations Based from the conclusions, the following recommendations are forwarded:

1. Regular follow up on the academic performance of the ESGPPA scholars may be conducted by the guidance counselor/s in-charge of scholarship. This would help them maintain such scholarship or improve better their grades. Other concerns or problems may also be asked by the guidance counselor from the scholars.

2. A Personality Development Program/Training may be conducted by the department to help the respondents improve in areas where they are low in their personality and emotional traits. Topic on enhancing academic performance may also be included for the improvement of their mental ability.

3. Longitudinal study on the academic performance of the scholars in various

types of scholarships may be suggested. This is to assess the consistency of their performance.

4. A comparative study on the academic performance of scholars and non-scholars may also be considered. This may give motivation to them to further their studies.

5. Information dissemination on the results of this study may be disseminated for the scholars to have some information on their status. This may be done through the help of the Junior Counselor’s Club of the Humanities and Social Sciences Department.

6. A similar study may be conducted to include ESGPPA scholars from other colleges. Problems of the scholars may be looked into as well by the next researchers.

71

Literature Cited Boado, RJY, “The Profile and Level of Familial Involvement of the College of Arts and Sciences’ Academic

Scholars”; March 2013 http://www.car.dswd.gov.ph/programs-services/core-programs/pantawid-pamilyang-pilipino-program-4ps.

Retrieved on January 12, 2015 http://www.trainingzone.co.uk/partners/press/men-and-women-have-different-kinds-emotional-

intelligence-high-eq-both-sexes-key-work Retrieved on October 28, 2015). http://www.psychologicalscience.org/index.php/news/releases/do-aptitude-tests-really- predict-your-performance.html http://www.ncbi.nlm.nih.gov/pmc/earticles/PMC3482624/#R55 Retrieved on November 09, 2015 http://www.education.com/reference/article/iq-school-achievement/ Retrieved on November 10, 2015 http://rawanmed.pressible.org/wai/does-personality-affect-academic-performance Retrieved on November

09, 2015) http://pubs.sciepub.com/education/2/9/8/ Retrieved on October 28, 2015). http://education.stateuniversity.com/pages/2306/Out-School-Influences-Academic-Success.html Retrieved on October 28, 2015). Ronda, Rainier Allan,“4Ps student-beneficiaries told to maintain passing grade”, The Philippine Star, June 14,

2015 wikipedia.org/wiki/Pantawid_Pamilyang_Pilipino_Program Retrieved January on 07, 2015.

pantawid.dswd.gov.ph/index.ph/about-us. Retrieved on January 07, 2015. www.fo6.dswd.gov.ph/2014/07/pantawid-pamilya-extends-age-coverage-of-children-beneficiaries/

Retrieved on March 12, 2015 www.car.dswd.gov.ph/programs-services/core-programs/pantawid-pamilyang-pilipino

program-4ps. Retrieved on January 12, 2015).

http://www.car.dswd.gov.ph/programs-services/core-programs/pantawid-pamilyang-pilipino-program-4ps.%20Retrieved%20on%20January%2012

http://www.car.dswd.gov.ph/programs-services/core-programs/pantawid-pamilyang-pilipino-program-4ps.%20Retrieved%20on%20January%2012

http://www.trainingzone.co.uk/partners/press/men-and-women-have-different-kinds-emotional-intelligence-high-eq-both-sexes-key-work%20Retrieved%20on%20October%2028

http://www.trainingzone.co.uk/partners/press/men-and-women-have-different-kinds-emotional-intelligence-high-eq-both-sexes-key-work%20Retrieved%20on%20October%2028

http://www.psychologicalscience.org/index.php/news/releases/do-aptitude-tests-really-

http://www.ncbi.nlm.nih.gov/pmc/earticles/PMC3482624/#R55

http://www.education.com/reference/article/iq-school-achievement/%20Retrieved%20on%20November%2010

http://rawanmed.pressible.org/wai/does-personality-affect-academic-performance%20Retrieved%20on%20November%2009

http://rawanmed.pressible.org/wai/does-personality-affect-academic-performance%20Retrieved%20on%20November%2009

http://pubs.sciepub.com/education/2/9/8/%20Retrieved%20on%20October%2028

http://education.stateuniversity.com/pages/2306/Out-School-Influences-Academic-Success.html%20%20%20%20%20Retrieved%20on%20October%2028

http://education.stateuniversity.com/pages/2306/Out-School-Influences-Academic-Success.html%20%20%20%20%20Retrieved%20on%20October%2028

http://www.philstar.com/author/Rainier%20Allan%20Ronda/

http://www.fo6.dswd.gov.ph/2014/07/pantawid-pamilya-extends-age-coverage-of-children-beneficiaries/

http://www.car.dswd.gov.ph/programs-services/core-programs/pantawid-pamilyang-pilipino

72

Parenting Styles of Single Parents and their Relationship with the Personality and Emotional Stability of their Children

Charmaine B. Dumaguin, Clarissa E. Mamuyac, Ma. Aida V. Ocol, and Maria Elena V. Milan

Abstract This study focused on the relationship between the parenting style of single parents and the

personality and emotional stability of their children. The study made use of descriptive research design and purposive sampling technique. The questionnaire on Parenting Styles, Panukat ng Pakikipagkapwa ng Batang Pilipino and Panukat ng Emosyon were used as instruments to gather the needed data. Average weighted mean and the use of Pearson Product Moment Correlation programmed in SPSS were employed for data analysis. The single parent respondents practice authoritative type of parenting style. Their children are well adjusted in their personality and with high emotional stability. The parenting style of the single parents is significantly correlated with their children’s personality. And the parenting style of single parents is not significantly correlated with the emotional stability of their children. Keywords: emotional stability, personality, single parents, parenting styles Introduction

Situation Analysis Parenting is defined as the act of raising a

child or children. It is the normative patterns of behaviour and tactics that parents use to socialize and control their children (Wentz & Russell 2009). There are a lot of reasons why parents eventually become single parents. There are classifications to consider in order to be labelled as a single parent. One of these is when the partner or spouse dies. Another is single parent by decision, which results in divorce, legal separation, church annulment, mutual decision to separate, with or without legal agreement, being abandoned or left by spouse, and or decision to leave spouse. Moreover, single parent can be classified as single-by-choice where a parent gives birth to a child and chooses not to marry, legal adoption through agency, and or by means of raising their relative’s child or children (effectivepapers.blogspot.com., 2011).

Data from the National Statistics Office indicate that more than 37 percent of the 1.8 million babies born in the Philippines in 2008—at least 666,000—had unmarried mothers, representing a worrying increase of over 12 percent from the previous year and an upswing that has become a trend in recent times (Philippine Daily Inquirer, 2015). Of the household population in 2007, 45.3 percent were married while 44.3 percent

were never married. The rest of the household population was categorized as follows: widowed (4.3%), divorced/separated (1.2%), common law / live-in marital arrangement (4.5%), and unknown marital status (0.4%) (Webmaster, 2015). These surveys do not clearly state if those registered as single parent have children or may have regained their status after an annulled marriage.

The statistics above is far more than the real statistics of today. That’s why it is indeed novel to study and add the body of knowledge of what is already known to many about single parenthood and its relationship to the personality and emotional stability of the children. It would also notify single parents about the benefits and privileges they may have such as livelihood, self-employment and skill development, employment-related benefits, psychosocial, educational, health and housing services (REPUBLIC ACT NO. 8972, An Act Providing for Benefits and Privileges to Solo Parents and Their Children, Appropriating Funds Therefore and for Other Purposes).

This study seeks to answer and prove some of the misconceptions and speculations when it comes to having a solo parent in a family. It will serve as the window to have a glimpse of the story behind every condition experienced by

73

single parents and their children. It will help to broaden the understanding of people in the society to those who have this situation. Also, to be an eye opener to people who plan to have a

family in the near future. Lastly, for people to be aware of the existence of this kind of condition in or out of the bounds of marriage and to think more rationally before engaging into such relationship

. Framework of the Study A successful marriage is somewhat

inclined with the word “happy ending”. But in the real life sense, not all marriages that start well, end the way couples wanted it to be.

Separation of parents can directly affect

the behavior of their child. And this condition becomes a gate channel to misbehaviors and abnormalities to children involved. The experience of severe parental emotional unavailability leads to serious growth delays as well as psychological difficulties in young children (Harden, 2013).

Social Learning Theory (Observational

Learning) by Albert Bandura (1977) states that Mediating processes occur between stimuli & responses and behavior is learned from the environment through the process of observational learning (McLeod, 2011). People learn from one another by means of observation, imitation, and modeling (Learning Theories, 2014). Considering the rewards and punishment a child would gain, and the environment raised from, greatly affects not only the child, but also the environment around.

Another theory for the personality and

parenting style is the Baumrind Theory of Parenting Styles (1966). The way the parent treats his or her child highly influences the drives the child develops (Radwan, 2015). Family system exercised in the family has a big role in the child’s personality and behavior. Parenting styles such as authoritative, authoritarian, and permissive are also the focus. The way parents react has a lasting impact to their children (Williams, 2015).

The James-Lange theory of William James

and Carl Lange in 1870’s explains that subjective experience of emotion is a consequence of perceiving own emotional responses (Sincero, 2012). It is the action or emotional response that comes before the sensation or perception of the emotion. These responses include pounding of the

heart, rapid breathing, and or feeling of weakness or trembling of arms and legs.

The theory proposed by Walter Cannon

and Philip Bard (1920-1930) which is the Cannon-Bard Theory proves that emotions and body changes occur at the same time. Unlike in the James-Lange theory, the emotional experience occurs as soon as the cortex receives the message from the thalamus; it does not depend on feedback from internal organ and skeletal responses (Sincero, 2012). This theory suggests that different physiological states correspond to different experiences of emotion.

Another theory is the Schachter and

Singer’s Two-Factor Theory (1960) which states that people’s experience of emotion depends on two factors: physiological arousal and the cognitive interpretation of that arousal. It means, when people think of the physiological symptoms of arousal, they seek explanation and connect it to the environment (Sincero, 2012). This theory agrees with the conception of James-Lange theory in which people experience emotion because of physiological arousal. Also, it agrees with Cannon-Bard Theory that different physiological arousal results in different emotions.

All theories mentioned above are some

proofs that the parenting styles of the parents together with the personality and emotional stability of a child are being affected by the different physiological arousal in the body and different personality trais. Also, emotions may vary depending to the physiological arousal and the cognitive interpretation of that arousal (Schachter and Singer’s Two-Factor Theory). The observations that a child uses to observe may also affect his way of living if the process of imitation and modeling happens (Social Learning Theory). Another is the family systems theory by Dr. Murray Bowen, which states that families are systems of interconnected and interdependent individuals, none of whom can be understood in isolation from the system

Statement of the Problem The study aimed to determine the relationship of parenting styles of single parents with the personality and emotional stability of their children. It sought to answer the following:

1. What is the dominant parenting style practiced by the single parents? 2. What is the personality of the children as measured by Panukat ng Pakikipagkapwa ng Batang

Pilipino? 2.1. Affiliation or Pakikipagkapwa 2.2.Courtesy or Pagkamagalang

74

2.3.Obedience or Pagkamasunurin 2.4. Humility or Pagkamapakumbaba 2.5.Understanding or Pagkamaunawain 2.6.Trust or Pagkamapagtiwala 2.7. Thoughtfulness or Pagkamaalalahanin 2.8. Helpfulness or Pagkamatulungin

3. What is the emotional stability of the children as to: Perception of Emotions Managing Emotions in the Self Managing Others Emotions Utilizing Emotions

4. Is there a significant relationship between the parenting styles practiced by the single parents to the personality of their children? 5. Is there a significant relationship between the parenting styles practiced by the single parents to the emotional stability of their children? Independent Variable Dependent Variables

Figure 1. Research Paradigm Methodology

Research Design Descriptive research was used in the

study. Descriptive research is a way of collecting information about the situation and their relationship. This research determined the parenting style of the single parents, the personality and emotional stability of their children and their relationship with each other.

Sources of Data

The researchers selected single parents and their children from Sto. Tomas, La Union, specifically from Barangay Linong, Balsaan, Poblacion, Namboongan, Tococ, and Lomboy. These single parents have children belonging to age bracket from 7-12 years old. For every single parent, one of his or her children was asked to answer the questions that assessed his/her personality and emotional stability. This study is limited only to those who are covered by the characteristics given in the definition of terms. The researchers used purposive sampling as sampling method. Members of the sample were those who were available and those who fitted the criteria specified by the researchers.

Instrumentation and Data Collection The researchers used a questionnaire-

rating scale type to assess what kind of parenting style single parents practiced with their children. The questionnaire on parenting style is a standardized questionnaire adapted from the study entitled “The Attitude of Parents towards their Children and their Parenting Style” (Orine &Urgel, 2005). This 30-item test determined whether the single parent practices authoritarian or permissive style of parenting.

In assessing the personality of the children, the Panukat ng Pakikipagkapwa ng Batang Pilipino was used. It was specially designed to assess the personality of Filipino children. This test composed of 65 items, each having four answer choices. It had subdimensions namely: affiliation or pakikipagkapwa, courtesy or pagkamagalang, obedience or pagkamasunurin, humility or pagkamapakumbaba, understanding or pagkamaunawain, trust or pagkamapagtiwala, thoughtfulness or pagkamaalalahanin, helpfulness or pagkamatulungin.

A. Personality of Children as measured by Panukat ng Pakikikapwa ng Batang Pilipino

a. Affiliation or Pakikipagkapwa

b. Courtesy or Pagkamagalang

c. Obedience or Pagkamasunurin

d. Humility or Pagkamapakumbaba

e. Understanding or Pagkamaunawain

f. Trust or Pagkamapagtiwala

g. Thoughtfulness or Pagkamaalalahanin

h. Helpfulness or Pagkamatulungin

B. Emotional Behavior of Children as to:

a. Perception of Emotions b. Managing Emotions in

the Self c. Managing Others

Emotions d. Utilizing Emotions

Parenting Style

1. Authoritarian 2. Authoritative

3.Permissive

75

Finally, in assessing the emotional stability of the children, the Panukat ng Emosyon which was adapted from the study entitled “Parenting Styles and Emotional Intelligence of Children” (Castillo, et.al. 2014) was used. It was composed of 33 items that were categorized into four, perception to emotions, managing emotion in the self, managing others emotions and utilizing emotion.

Analysis of Data Average weighted mean was used to

determine and interpret the parenting style of the respondents imposed, personality of children and their emotional stability.

Pearson Product Moment Correlation programmed in the micro stat was used to

determine the significant relationship between the parenting style imposed by the respondents with the personality and emotional stability of their children.

The questionnaire on parenting style and Panukat ng Emosyon was used to assess the parenting style of the single parents and the emotional stability of their children.

In scoring and interpreting the personality of children respondents, corresponding template per dimension was used. These responses were added in every dimension and were written on the profile sheet provided. The scores obtained had a corresponding interpretation.

RESULTS AND DISCUSSION Parenting Style of Single Parents Result shows that single parents practiced authoritative style of parenting to their children. It obtained an average weighted mean of 2.55 with the descriptive rating of always. This signifies that the single parents consider the view and interest of their children when it comes to decision making. They are the type of parents who care for the proper development of their children by

guiding them in a rational manner. They listen to their children, encourage independence, place limits, express warmth, and nurturance, allow children to express opinions, and administer fair and consistent discipline (Kendra Cherry, 2015).With this kind of parenting style, their children are to be the most self-reliant, self-assertive, exploratory and content

.

Personality of the Children in Different Dimensions When it comes to the trait of affiliation or

pakikipagkapwa, in which the children associate themselves with others, it obtained an average weighted mean of 75.07 which means these children are well-adjusted. With an average weighted mean of 71.47 and a descriptive rating of well adjusted, result shows that the children are respectful to people. Result implies that that they demonstrate courtesy or pagkamagalang in words or deeds to people, especially to older ones.

Obedience or pagkamasunurin allows children to obey or to follow rules, regulations and order of people with power and authority. It scored 69.77 which means that they are well adjusted in this dimension. Moreover, humility or pagkamapakumbaba trait of the children got an average weighted mean of 67.8 with a descriptive rating of well adjusted. This indicates that they are considerate in dealing with their family, relatives, friends, and others. Understanding or Pagkamaunawain trait of the children scored 72.43 with a descriptive rating of well adjusted. It implies that the children used to grasp the meaning of a situation, not just merely their present status as having a single

parent but the deeper meaning of this situation. In terms of trust or pagkamapagtiwala, they are more likely to have reliance to God, family, friends and others as well.

Thoughtfulness or pagkamaalalahanin refers to the children’s consideration for others. This dimension obtained an average weighted mean of 72.13 which means that they are well adjusted in this dimension. Finally, the helpfulness or pagkamatulungin trait of the children scored 68.9 with a descriptive rating of well adjusted. This indicates that the children are happy in giving aid or assistance to someone.

All dimensions of the personality of the children respondents got an average weighted mean of 71 which falls under the well-adjusted category. This signifies that the children of single parents are well adjusted in all paces or dimensions of their lives. The status of their family or their condition as being raised with a single parent does not affect greatly their personality. It does not hinder them to develop these traits but they became the people whom others could depend on.

76

Frequencies and Percentages of the Personality of Children One child needs an improvement in

developing his/her personality. 30 percent or 9 children are considered to be fairly adjusted when it comes to their personality. There are 56.7 percent or 17 children who are well adjusted in

developing their personality. 10.0 percent or 3 of the children of single parents are very well adjusted. Thus, more than half of the children respondents have well-adjusted personality.

Emotional Stability of the Children In terms of the ability of the children to

accurately perceive and identify their own emotions, this obtained an average weighted mean of 2.61 which has a descriptive rating of high. On the other hand, managing emotions in the self got 2.93 which falls under the descriptive rating of high. Managing others’ emotions is the ability of the children to manage and benefit from others’ emotions. This obtained an average weighted mean of 2.95 with a descriptive rating of high.

Moreover, utilizing emotions which is the ability to understand and use their emotions in a positive way got an average weighted mean of 2.87 with a descriptive rating of high.

With all the categories included in measuring the emotional stability of the children, they all got a high descriptive rating which implies that the children of single parents are highly emotionally stable.

Frequencies and Percentages of the Emotional Stability of Children This shows that there are five or 16.7

percent of the children who fall under the category of low and very high emotional stability. 20 or 66.7 percent of the children respondents belong to

high emotional stability category. Therefore, majority of the children have a high emotional stability.

Table 1. Relationship between Parenting Style of Single Parents and Personality of their Children

Parenting Style of Single Parents and Personality of Their Children

Pearson r Sig. 2 tailed

.968

*Correlation is significant at the 0.05 level (2-tailed). Table 1 shows that the parenting style of the single parents is not significantly related to the personality of their children. Parenting style has no significant relationship with the personality of their children r = .968, p < .05. Result indicates that the parenting style used by the single parents in raising their children does not affect the personality of their children.

Even if the parents practice a certain type of parenting style, the personality of their children stays the same as it was built. But their personalities are in the well-adjusted category which means that they can adapt to the wavering changes in every developmental stage they are exposed.

Table 2. Relationship between Parenting Style of Single Parents and Emotional Stability of Their Children

Parenting Style of Single Parents and

Pearson r Sig. 2 Tailed

1.000

*Correlation is significant at the 0.05 level (2-tailed).

Table 2 shows that the parenting style of the single parents has no significant relationship with the emotional stability of their children (r = 1.000, p < .05). This implies that the parenting style practiced by the single parents in raising their children does not have any significant relationship with the emotional stability of their children at all. But then, their children still have a high emotional stability. It is because the warm way of parenting their children is an important factor in their emotional development. Parents can help their

children develop into emotionally stable people by giving them a supportive environment, positive feedback and by being role models of healthy behavior and interactions (Murphy, 2014).

The relationship of parenting styles of single parents with the personality and emotional stability of their children are both not significantly related to each other. Result may be traced to the fact that the parents are torn into two roles- being a father and mother. It may also be the result of the limited number of respondents being studied.

77

It affects the normal distribution of variables in representing the three types of parenting styles. With this, result was not as expected as it should

be. It obviously negates the claims of other people and results of previous researches.


1. Most of the single parents practice the authoritative style of parenting their children.

2. The children of the single parents are well adjusted in the development of their personality.

3. The emotional stability of the children respondents is highly stable.

4. The parenting style of single parents and the personality of their children are not significantly related to each other.

5. There is no significant relationship between the parenting style of single parents and the emotional stability of their children.

Recommendations Based on the conclusions of the study, the following recommendations were drawn:

1. Authoritative parenting style is recommended as a good model to use in raising children especially for single parents.

2. Authoritative parenting style would produce a high emotional stability of children.

3. Further studies should consider more male respondents and broader area to study.

Literature Cited effectivepapers.blogspot.com., 2011. http://www.education.com/reference/article/parenting-styles1/ https://www.families.com/blog/parenting-styles http://en.wikipedia.org/wiki/Social_behavior (Retrieve on January 11, 2015) http://www.sparknotes.com/psychology/psych101/emotion/section1.rhtml (Retrieved Radwan, M. F. (2015). How parenting styles impact children. Retrieved last October 1,

2015 fromhttp://www.2knowmyself.com/how_parenting_styles_impact_children REPUBLIC ACT NO. 8972, An Act Providing for Benefits and Privileges to Solo Parents and Their Children, Appropriating Funds Therefore and for Other Purposes). Republic Act No. 8972: An Act Providing For Benefits And Privileges To Solo Parents

And Their Children, Appropriating Funds Therefore And For Other Purposes. Q & A: Solo Parent's Welfare Act and Parental Leave. (2008, March 3). Retrieved last Wentzel, K. et. al. (2009, Dec 23). Parenting Styles. Retrieved from

from http://effectivepapers.blogspot.com/2011/04/research-paper-on-single-mothers.html Philippine Daily Inquirer, Single moms in double bind. (2015, May 1). Retrieved last August 5, 2015 from http://opinion.inquirer.net/84563/single-moms-in-double-bind

Research Paper on Single Mothers. (2011, April 7) . Retrieved last January 27, 2015 on January 11, 2015)

Williams, S. (2015). Parenting Styles. Retrieved last October 1, 2015 from

http://www.education.com/reference/article/parenting-styles1/

https://www.families.com/blog/parenting-styles

http://en.wikipedia.org/wiki/Social_behavior

http://www.sparknotes.com/psychology/psych101/emotion/section1.rhtml

http://www.2knowmyself.com/how_parenting_styles_impact_children

http://effectivepapers.blogspot.com/2011/04/research-paper-on-single-mothers.html

http://opinion.inquirer.net/source/philippine-daily-inquirer

http://opinion.inquirer.net/84563/single-moms-in-double-bind

78

Level of Satisfaction on Agricultural Information Services

Christian B. Adriatico, Nimshi A. Boado, Gladys F. Gali, Erika Jane G. Laranang, and Delia M. Imperial

Abstract

In this modern day of information technology, telecentres provide the rural farmers with prompt and reliable information about what is happening in areas of improved seedlings, better methods of cultivation and fertilizer application, pest and weed control/eradication, new advances in livestock production and disease control etc. Where rural farmers experience constraints in accessing agricultural information, traditional media such as rural radio, have been used in delivering agricultural messages to them (Munyua, 2000). The lack of access to basic agricultural knowledge and information by rural farmers may be a result of certain constraints that have made them stick to their old traditional methods of farming system and animal husbandry practice, hence resulting in poor crop and livestock productivity. Information and knowledge are very vital in agricultural development of any community. Thus, if they are poorly disseminated as a result of certain constraints, the community’s agricultural development becomes highly impeded. Therefore, this study was designed to investigate the problems of farmers when it comes to the information dissemination set by the Department of Agriculture. Keywords: agriculture, information, farmers, dissemination, technology Introduction

Situation Analysis In a rapidly changing world, food and

agricultural innovation systems in developing countries are facing new and increasingly complex challenges. Fighting poverty, ensuring food and nutrition and security while protecting the environment still remain a major challenge being faced by global development practitioners today (Statrasts, 2004).

Agricultural information interacts with and influences agricultural productivity in a variety of ways (Statrasts, 2004). It can help inform decisions regarding land, labor, livestock, capital, and management. Agricultural productivity can arguably be improved by relevant, reliable, and useful information and knowledge. Hence, the creation of agricultural information by extension services, research, education programmes, and others is now often managed by agricultural organizations that create information systems to disseminate information to farmers so that farmers can make better decisions in order to take advantage of market opportunities and manage continuous changes in their production systems. Therefore, there is a need to understand the functions and use of particular agricultural information systems in order to manage and improve them.

Empowering farmers starts with information. In these times of uncertainty related to climate change and climate variability, credible information on weather updates, new technologies, government schemes, and market prices can enable them to make better choices and decisions.

According to Oladele (1999), the efficiency of technologies generated and disseminated depends on effective communication which is the key process of information dissemination. The development of agricultural technologies requires among other inputs, a timely and systematic transmission of useful and relevant agricultural information (messages) through relatively well educated technology dissemination (extension) from formal technology generation system (research) via various communication media (channels) to the intended audience farmers (Oladele, 1999). It is expected that the message from the client (effect) be passed back to the source or research (feedback) for the communication process to be complete.

Agricultural information disseminated by different information sources need to be determined. It is imperative therefore to identify

79

the sources of agricultural information utilized by farmers. Some questions readily come to mind such as: What are these information sources? What are the channels through which the farmers get information on agricultural practices? What are the sources preferred by these farmers? The Asia Pacific Region has been on the forefront of generation and transfer of modern agricultural technologies. However, much still

needs to be done to promote better and more effective methods of technology transfer in order to achieve increased output and higher incomes for small-scale farmers. While many farmers know the nature of their problems in the field, research and extension workers' absence of knowledge of socio-economic conditions stop farmers from adopting technologies and pursuing technological solutions to their problems.


Information dissemination is a core principle of Extension (Orr, 2003). If information is to be used, it must be disseminated in a way that best facilitates its use by agricultural producers. However, information is delivered in a multitude of methods and the challenge is to determine which method is most appropriate to the targeted population.

Previous studies have noted farmers' preferences for informational delivery methods depending on a variety of demographic characteristics such as age, income, formal education, and farm size (Iddings & Apps, 1992). Landowners living in the urban/rural interface have diverse interests and unique concerns (Creighton, Baumgartner, & Gibbs, 2002).

Extension must provide information that makes a difference (Astroth, 1990). Extension provides an important linkage between farmers and researchers, and farmers have come to value the services they receive from Extension (Ekanem, Singh, Tegegne, & Akuley-Amenyenu, 2001).

Research indicates that people use different sources depending on the kind of information they are seeking (Pounds, 1985). One study showed family, friends, and neighbors, along with newsletters, bulletins and fact sheets, magazine articles, printed dealer/sales materials, and farm organizations/associations were most frequently used as information sources (Phipps, Murphy, Maddox, & Neas, 2001).

However, Richardson reported (1995) that regardless of a great diversity in the interests of a targeted audience, preferred delivery methods were remarkably similar. Orr stated that while Extension still uses meetings, on-farm visits, and field days to some extent, much information can be found in media formats such as the Internet, videos, and computer software packages. Thus, the need to know the audience is imperative to determine the preferred methods of information dissemination. Participatory approaches to assess the issues and problems confronting the community are often utilized to understand their information needs. Adult individuals in the community may not be in a position to articulate their information needs as clearly as research and academic communities. However, by holding interactive sessions with the community members, educators can identify topics of relevance to their survival,

and accordingly interpret the kind of content going to be of use to them, understand their linguistic concerns and preferences, and their media preferences for communication (Oladele, 1999).

If the approaches to agricultural development programs are to work, the government needs to take new approaches to information dissemination and management that grow out from a clear understanding of what farmers information needs are.

The information needs may be grouped into five headings: agricultural inputs; extension education; agricultural technology; agricultural credit; and marketing. Modern farm inputs are needed to raise small farm productivity. These inputs may include fertilizers, improved variety of seeds and seedlings, feeds, plant protection chemicals, agricultural machinery, and equipment and water. An examination of the factors influencing the adoption and continued use of these inputs will show that information dissemination is a very important factor. It is a factor that requires more attention than it now gets. The general lack of awareness among farmers can be attributed to their high level of illiteracy. This contributes to the low level of adoption of agricultural production technology. Extension is a type of education which is functional rather than formal. It is better provided by extension workers whose main task is to convey information in a meaningful form to farmers.

Another major constraint to agricultural information dissemination is the inadequacy of existing extension programs. Some of these programs are conceived without well thought out plans and are prepared in a hurry without the farmers whose attitudes are to be changed making any input. Such agricultural information packages can neither sustain the farmers' interest nor effect the desired attitudinal change. Farmers' interests are disregarded even more as most of the agricultural innovations are written and broadcast in English instead of the local language.

Satisfaction is not only a close proxy for concepts such as perceived effectiveness but also a predictor of future actions by the cooperative’s members. A review of the literature reveals that there is consensus about the positive influence of satisfaction on the relationship and the desire, by

80

active members, to continue that relationship or leave it. This desire to continue is considered one dimension of the commitment of members (Kumar et al. 1995; Kim and Frazier 1997; Barraud-Didier et al. 2012) and the end result of the process of interaction between the parties (Frazier 1983). Parties who are satisfied with a relationship will be more interested in maintaining it than in starting a new relationship, given the uncertainty that any new relationship may bring (Ramsey and Sohi 1997).

The main goal of this study is to determine if there is a relationship between the preference and the satisfaction of the farmers on the mode of agricultural information services set by the Department of Agriculture. The study will consist of the preference of farmers as the independent variable and the level of satisfaction of farmers on the mode of agricultural information services as the dependent variable.

Independent Variables Dependent Variable

Fig 1. Research Paradigm Statement of the Problem

This study aimed to determine the relationship between the preference and the level of satisfaction of the farmers on the mode of agricultural information dessimination set by the Department of Agriculture. Specifically, it sought the answer to the following questions.

1. What is the preferred information dissemination of farmers provided by Department of Agriculture?

2. What is the level of satisfaction of farmers on the information dissemination set by Department of Agriculture?

3. Is there a significant relationship between the preferred mode of dissemination of farmers and their level of satisfaction on the information set by the Department of Agriculture?

Methodology

Research Design In order to achieve the objectives of this study, the researchers employed the descriptive research design which intended to analyse the relationship between the preferences and the satisfaction of the farmers on the mode of agricultural information services.

Sources of Data

To gather the necessary data for this study, the researchers employed the purposive sampling technique to determine the respondents for this study. The respondents were 37 farmers from Sta. Rita Central Agoo, La Union. The number of respondents was determined by the chairman of the barangay on the basis of a list provided by the municipal agriculturist.

Instrumentation and Data Collection The data gathering tool was a

questionnaire constructed by the researchers based on their readings and was validated by experts from the field of agriculture and the academe. The researchers also conducted

informal interviews to various farmers within the municipality of Agoo, La Union.

The questionnaire was made up of two (2) parts. The first part consisted of items regarding the various modes of information dissemination being utilized by the Department of Agriculture. The respondents were asked to rank these different modes by indicating a value from one to five, five being the most preferred and one as the least preferred. These values are intended to measure the preferences of the farmers. The second part of the questionnaire intended to measure the level of satisfaction of the respondents. The items pertain to the different modes of information dissemination. The 4-point Likert scale was applied to these items to obtain quantitative data as well as to minimize subjectivity.

Likewise, the Likert Four-Point Rating Scale was used to measure the degree of preference and satisfaction of farmers on the mode of agricultural information services set by the Department of Agriculture.

Farmers’ Preferred

Mode on Agricultural

Information

Dissemination

Farmers’ Level of

Satisfaction

81

Analysis of Data After data have been gathered by the

researchers, statistical analysis was performed to

empirically interpret the gathered information.

The statistical tools used were ranking, median

and Spearman’s Correlation Coefficient

.


Preferences of Farmers on Agricultural Information The respondents preferred seminars with

a frequency of 12. The respondents chose seminar because it’s the most common among the other preferences. The topic on pest control and management was chosen by the respondents. It implies that the respondents are more interested on the topic that will be very helpful in their farming.

As to the venue/site/place the activity will be conducted, the actual site ranked the highest. The farmers don’t want to go to very far places because it will be time consuming for them.

The respondents also preferred monthly and every six months for them to have an information dissemination services.

In terms of the speakers, the respondents prefer an agriculturist to be the speaker of the seminar. It implies that the farmers want to hear some techniques in farming from an expert.

The necessary information could be useful to farmers at different stages of farming; harvesting, marketing, and food storage. According to Oladeji (2011), storage of farm produce is not the sole duty of farmers but other stakeholders like investors who do not have knowledge of farming but have the scientific knowledge of storage and financial capability to buy farm produce in large quantity at the peak of harvest season. Bala and Sharma (2008) suggest that farmers should have the latest information regarding new farming techniques and innovations. According to Farooqet al (2007) the most commonly used sources of information were fellow farmers, printed material, television, and private sector

. Level of Satisfaction of Farmers on Agricultural Information Dissemination

With the highest average weighted mean of 3.86, the farmers are very staisfied with skilled speakers/ trainers. The lowest average weighted mean of of 3.08 falls under clear and readable visual imagery. This means the famers are staisfied in terms of clear and readable visual imagery.

According to (Oladeji, 2011 & Meitei, 2009), limited manpower of agricultural extension agents will positively affect the level of farmers information literacy in rural remote areas. Therefore advertisements in different formats are

proposed as a good way of promoting awareness among farmers and investors (Oladeji, 2011). Agricultural cooperative is another channel for farmers’ awareness and information literacy for improved farm produce towards food security. Creation of agricultural farm centers for town meeting, where generated information by librarians can be processed and made available to farmers at need would be of importance to boost farmers’ information literacy

. Relationship between the Farmers’ Preferences and Level of Satisfaction

Table 3 shows that there is no significant relationship between the farmers’ preferences and their level of satisfaction. It is not based on the mode of preference of the respondents if they will be satisfied or not. Goals of the department of agriculture self-reliance and sustainability, Agri-Pinoy focuses on the natural resource endowments of the Philippines, and how to manage them so that they are not exhausted, while enhancing their competitive advantage. So by any means of the department of agriculture in giving information, the satisfaction of the farmers

is not dependent to which mode they prefer. Whatever kind of information dissemination the Department of Agriculture give to the farmers, they are still satisfied/disatisatisfied despite that they have preferences.

Based on previous literature, Molnar (1985) expected to find global well-being positively related to theoperator's and spouse's off-farm employment, total family income, and size of farm. Conceptually, however, the quality of farm work is a proximate criterion of the farmer's experience in the structure of work.

82

Table 1. Relationship between Farmers’ Preferences and their Level of Satisfaction

Spearman's rho

satisfaction


1.000 .231

Sig. (2-tailed) . .170 N 37 37

preferences


.231 1.000

Sig. (2-tailed) .170 . N 37 37

Conclusions Based on the findings of the study, the researchers arrived at the following conclusions:

1. The farmers in Sta. Rita Central Agoo, La Union have certain preferences on the Agricultural Information Services provided by the Department of Agriculture.

2. The farmers in Sta. Rita Agoo, La Union are very satisfied on the information dissemination set by the Department of Agriculture.

3. The farmers’ preference on the information dissemination and their level of satisfaction are not significantly related.

4. Recommendations

Based from the conclusions in this study, the researchers, thus, recommend:

1. Similar studies which maybe of a larger scale should be of primary interest to extension personnel to indicate the types of information farmers may desire. This would allow extension personnel to provide timely and useful information.

2. Training facilities be made available in the institutions specially established to train agricultural workers so that products of such institutions are well prepared to provide improved quality of agricultural messages to farmers. Training needs of

extension workers be identified in the areas of agriculture and communication to serve as guide to organizing training seminars periodically to fill the gaps in knowledge and skills of farmers.

3. All media channels should be explored to create awareness in local language to encourage understanding and implementation of ideas and programs in the easiest ways possible. This calls for a well equipped farm community hall where farmers could meet and be addressed on their information need.

Literature Cited Advameg, Inc. 2013 . Philippines-Agriculture. Retrieved July 13, 2015: 1:09 AM from

http://www.nationsencyclopedia.com/economies/Asia-and-the-Pacific/Philippines-AGRICULTURE.html

Ali, M. S. S., Hassan, M. S., Samah, B. A., & Shaffril, H. A. M. (2010). Decision making in producing agricultural television programmes in Malaysia. Paper accepted for presentation at International Conference. Future Imperatives of Communication and Information for Development and Social Change. Bangkok, December 20-22, 2010. Retrieved June 16, 2015, from http://www.jcconference.co.cc/.It

Bureau of Agricultural Statistics, Philippines.2011) Rice in the Philippines. Retrieved October 10, 2015 at 7:26 PM from http: //irri.org /index.php? option=com_ k2&view=item&id=10718:rice-in-the-philippines&lang=en

Dangcalan, Carlo 2011 . Poverty is a hindrance to good education. Retrieved October 11, 2015, 11:23 PM from http: //www. sunstar. com.ph/ davao/opinion/2011/06/11/dangcalan-poverty-hindrance-good-education-160658

Dono, P. 2009 .IFAD.Enabling poor rural people to overcome poverty in the Philippines Engel, J., D. Kollatt and R. Blackwell. 1978. Consumer behavior, (3rd ed). Insdale, Illion: Dryden Press.

http://www.jcconference.co.cc/.It

http://www.sunstar.com.ph/davao/opinion/2011/06/11/dangcalan-poverty-hindrance-good-education-160658

http://www.sunstar.com.ph/davao/opinion/2011/06/11/dangcalan-poverty-hindrance-good-education-160658

83

Khushal, R., C.S.Raghubanshi and R.K.Sinha.1976. Purchasing Behavior Pattern of the Consumers and Their Brand Preferences for Washing Soaps. Indian journal of marketing, 7(12): Dec

Kirkpatrick.2009 .Financial and Emotional Stress in Farm Families. Retrieved October 12, 2015, 2:35 PM at http://fyi.uwex.edu/farmfinances/2009/07/16/financial-and-emotional-stress-in-farm-families

Maskey, R.K. and K.E. Weber, 1996. Evaluating factors influencing farmers, Satisfaction with their irrigation system: A case from the hills of Nepal. Irrig. Drain. Syst., 10: 331-341.

Mayo Foundation for Medical Education and research. 2013 .Heat exhaustion. Retrieved September 21, 2015 at 7:37 from http: //www. mayoclinic. Com /health/heatexhaustion/DS01046/DSECTION=causes

Meyer, Kerry. 2013. Wait! That Plant is Drowning. Retrieved October 23, 2015 at 12:39 AM from http://www.provenwinners.com/learn/wait-plant-drowning

Oladeji,J.O(2011, March).Farmers’ perception of agricultural advertisements in Nigerian newspapers in Ibadan municipality, Oyo State,Nigeria Journal of Media and Communication Studies Vol. 3(3), pp. 97-101,[ Available online http://www.academicjournals.org/jmcs ]

Oladele, O. I. (2006). Multilinguality of farm broadcast and agricultural information access in Nigeria. Nordic Journal of African Studies, 15(2), 199-205.

Olowu Terry A. (2011) Assessment of Agricultural Information Needs For CTA’s Product and Service in Africa, Caribbean and Pacific (ACP) State – Country Study: Nigeria Available on [www.cta.int]

PAGASA.2011 .Current Climate Trends. Retrieved September 21, 2015 at 2:56 pm fromhttp://kidlat.pagasa.dost.gov.ph/cab/climate_change/CurrentClimateTrends.html

Psychology Press & Routledge.2013 .Why do People Help. Helping for mastery and Connectedness. Retrieved October 10, 2015 at 10:01 PM from http://psypress.co.uk/smithandmackie/resources/topic.asp?topic=ch14-tp-02

Sartorelli et. al. 2013 .Skin Photoaging in Farmers Occupationally Exposed to Ultraviolet Radiation. Retrieved September 20, at 11:20 PM from http://www.ncbi.nlm.nih.gov/pubmed/23520884

State Government of Victoria.2013 .Rural Issues – Losing the Farm. Retrieved September 21, 2015 at 7:54 from http: //www .better health. vic.gov. au/ bhcv2 /bhcarticles.nsf/pages/Rural_issues_losing_the_farm

Singh, J.D. and Raghbir Singh. 1981. A Study of Brand Loyalty in India. Indian Journal of Marketing, 11(7):15-21 (July).

Sophie Clayton. 2010 .Cracking the mystery of chalky rice. Retrieved October 12, 2015, 11:32 PM from http: //irri. org/index .php? option= com_ k2& view=item&id=10616&lang=en

US Environmental Protection Agency.2013 .Agriculture and Food Supply. Retrieved August 11, 2015 at 2:00 PM from http://www.epa.gov/climatechange/impacts-adaptation/agriculture.html

Walsh, Bryan. 2011 .Climate Change Begins to Cut into Crop Yields

http://www.mayoclinic.com/health/heat-exhaustion/DS01046/DSECTION=causes

84

Extent of Beliefs, Values, Health Conditions and Productivity Level of Farmers in Macalva, Agoo, La Union

Roxanne F. Carrera, Rodessa Mae G. Corpuz, Jessa E. Estimo, and Maria Elena V. Milan

Abstract

This study focused on the relationship of beliefs, values, health conditions and productivity level of farmers in Macalva, Agoo, La Union. The study made use of descriptive research design and simple random sampling technique was used to determine the respondents. A constructed questionnaire on attitude (values and belief), an adapted questionnaire on health, and the revised Short-Form 36 were employed to gather the needed data. Pearson Product Moment Correlation was used to determine the relationships among the farmers’ beliefs, values, health conditions and productivity level. Findings showed that majority of the respondents are males and most of them belong to the oldest bracket of farmers. The farmers slightly believe in superstitious beliefs. They also slightly value work values. The farmers are productive in terms of harvesting crops and are able to manage their time and money. Keywords: work values, belief, health conditions, productivity level Introduction Situation Analysis Farming is an inherently dangerous profession due to the need to work with potentially dangerous machinery, chemicals, and livestock, working at heights or near pits and silos, and the effects of environmental factors such as bad weather, noise and dust. Added to these everyday farm hazards are those generated by the increasing industrialization of farming such as larger machinery, increased land and capital intensiveness, concentrated livestock production and fewer farmers (Hodne, 1999). Farmers’ occupational attitudes relate to the productivity of goods in their farms. A person’s occupational activities over a period of time influence his social attitudes and give him an occupational attitude of life. Occupational attitude is a set of evaluations of one's job that constitute one's feelings toward, beliefs about, and attachment to one's job.

In agriculture, farmers’ occupational attitude is sometimes called “rural attitudes” which is a part of the collective traits that is frequently called as the “rural mind”. (American Journal of Sociology, 2010) By attitude the researchers understand “a process of individual consciousness which determines real or possible activity of the individual in the social world”. By

“rural attitude” the researchers understand the disposition on the part of the rural population to react in social situation in a characteristic manner. In this, the farmers do not differ from other men. He has the same original nature. The apparent differences are due to social rather than to biological factors (Smith, 2012). Attitudes are widely discussed throughout the social psychology literature where it is defined as reflection of a person’s tendency to feel, think, or behave in a positive or negative manner towards the object of the attitude. In farming, there is the triangulation of attitudes, behaviors, and influences. Triangulation refers to obtaining information by approaching it from two or more different areas. In this case, the farmers’ attitudes to core safety issues are assessed by examining their behaviors and the information sources that influence these attitudes and behaviors. This reveals where the three factors lie in relation to each other and how they impinge on each other. These findings can then be related to the concepts that have been raised in this review, for example, farmers who have been found to have positive attitudes and positive behaviors may have been influenced by farming associations (Luther, 2012).

85

Similarly, farmers who have negative attitudes and negative behaviors may be influenced by other farmers who believe that there is no need to change their working practices or occupational attitudes which may cause the change in the productivity of their farms. Productivity, in its simplest definition, is the output per unit of input. Productivity is influenced by many factors including the input of the individual farmer. The measurement of individual farmer productivity is of interest from several perspectives. For a society or an industry, productivity is one of many factors that serve as indicators of the success of the farm or the status of life of a farmer.

In the field of health economics, the loss of farmer’s productivity due to an illness is counted in the indirect costs of the analysis. Models for health economics vary and are beyond the scope of this article, but one approach, that of human capital, directly links the farmer’s productivity loss with a cost. Hence, changes in labor input, the number of work days lost due to illness, are translated directly to lost productivity using market wage rates. The final perspective is at an individual farmer level, where there is interest in measuring individual farmer productivity in order to describe the impact of a condition on ability to work, or the effects of an intervention such as work station changes on the ability of a person to work productively. In this way farmer productivity is measured as an outcome state. Quality of life and productivity are two important measures in health outcomes that, unlike many health measures, usually require the use of self-reported surveys for accurate assessment because of their subjective nature. Health-related quality of life (HRQOL) measures general or domain-specific well-being directly related to physical and mental health aspects of life. Measuring both HRQOL and productivity of farmers from co-farmer perspective have become much more significant fields of research in recent years because of the increasingly important roles farmers have assumed in healthcare. In fact, farmers have control not only over influential health program, but also the very environments – physical, emotional, and social.

Healthy and satisfied farmers contribute greatly to the productivity and efficiency of any farm. There are two effects on health state valuation that need to be considered when it is determined that a person’s productivity will not be normal. First, role functioning in paid or unpaid work, which describes an ability to perform work-related functions and be a productive member of society, is an aspect of health that is affected by changes in productivity. In general, existing HRQOL instruments already capture this element of reduced productivity as one of its dimensions. In the SF-36, for example, role functioning is captured in the RP and RE scales.

Second, loss of productivity could lead to loss of income and unpaid production, which could have an effect on health state. (US Panel on Cost-Effectiveness in Health and Medicine) This phenomenon leads to a valuation of imperfect HRQOL based on lost income rather than based directly on lost productivity. Generic HRQOL questionnaires such as SF-36 and EuroQol intentionally do not ask questions specifically related to income effects. Even if productivity could be measured using non-obtrusive, objective methods (which would severely limit the job functions that could be studied) and only HRQOL measurement required regular measurement, successfully implementing a longitudinal study on the relationship between HRQOL and productivity would be logistically complex and of questionable reliability and validity due to burden and fatigue error of the respondents from asking the same set of questions regularly over a long period of time. Instead, a more reasonable and empirically testable relationship is a cross-sectional study of productivity and HRQOL which by itself presents a great challenge. Lamers et al. (2005) concluded that using HRQOL to model productivity costs was not recommended. However, their study was based on a short, general questionnaire (EQ-5D) on people with a specific condition (lower back pain). In addition, their study is a secondary analysis on existing data which weakens their argument and underscores the need for a study specifically designed to measure both workforce productivity and HRQOL.

Framework of the Study In the year 632, Romans studied about farmer’s occupational attitude through observation. Agriculture has made a sort of pseudo-approach to scientific method in the form of the application of magic to planting and tillage. Farmers’ conventional thinking has been liberally mixed with superstitions. In the early 19th century, animals were the chief source of power in farming. Later in the century, steam power gained in

importance. During World War I gasoline- (petrol-) powered tractors became common, and later diesel engines became prevalent. In the developed countries, the number of farm workers has steadily declined in the 20th century while farm production has increased because of the use of machinery. Many psychometrically validated HRQOL instruments exist for both general and specific

86

population use. Standards tests such as QALY (Quality Adjusted Life Years) and Short-Form-36 (SF-36) are commonly used to test and validate new instruments to measure various aspects of health. Instruments to measure HRQOL can be divided into two types; generic and specific. Generic instruments include all instruments that are not specific to one segment of the population while specific instruments consider populations in a specific domain such as a certain age or disability group. Health profiles offer the advantage of being able to measure different aspects of health status in any population, regardless of any underlying condition or characteristic, allowing for effective, and broad comparisons of general health. Like other utility measurements, however, health profiles may not be as responsive to changes in inputs like specific instruments. One of the largest studies of health profiles ever administered, the Medical Outcomes Study (MOS) was a cross-sectional and longitudinal study designed to evaluate adult patients on health status and treatment in different health care settings. The study was conducted in Los Angeles, Boston, and Chicago from 1986-1987 using a 245-item baseline questionnaire that includes both generic and specific questions. In the cross-sectional study, adult patients (n = 22,462) considered health treatment and status, while a sample of those patients (n = 2349) with diabetes, hypertension, heart disease, or depression were surveyed before and after treatment for the longitudinal study.

MOS was designed with two purposes in mind: 1) to determine whether differences in patient outcomes can be explained by differences in system of care, clinician specialty, and technical and interpersonal style of the clinician; and 2) to develop practical tools for routine monitoring of patient outcomes, including clinical results; physical, social, and role functioning in daily living; patient perceptions of general health and well-being; and patient satisfaction with treatment received. Probably the most sensitive, reliable, and validated of the survey measures designed to measure HRQOL is the SF-36. As a generic QOL measure, the SF-36 is by far the most widely used instrument according to a literature review by Garratt et al. (2002). The popularity of the instrument can be attributed to the delicate balance it has achieved between brevity and comprehensiveness. The SF-36 is composed of two summary measures, physical component summary (PCS) and mental component summary (MCS). Each has four scales. PCS consists of physical functioning (PF), role-physical (RP), bodily pain (BP), and general health (GH). The PF scale consists of ten questions which relate to normal physical activities such as carrying groceries, climbing stairs, and bathing. The RP scale comprises four questions relating to limitations in work or daily

activities due to physical health. This makes this scale of particular interest because the questions are directly related to productivity. The BP scale has two questions regarding the magnitude and interference of physical pain. Lastly, the GH scale has five questions related to general health and also has significant correlation with the mental health measure as well as the physical health measure. MCS also consists of four scales: vitality (VT), social functioning (SF), role-emotional (RE), and mental health (MH). The VT scale describes energy and fatigue level using four questions. The SF scale consists of two questions which ask about the effect of physical and emotional health on normal social activities. Both VT and SF have significant correlations with the physical health measure. The RE scale consists of three questions regarding the effect of emotional health problems on work and daily activities similar to the RP scale from a mental health perspective. Like RP, this scale is of particular interest because it asks questions related to productivity. Finally, the MH scale comprises five questions regarding general mental health. Many published articles have described psychometric and quality testing the survey has undergone, including seminal papers by Ware et al. (1992), McHorney et al. (1993), and McHorney et al. (1994).16 And although the SF-36 includes work-related items (the 7 items comprising the RP and RE scales) and is the most common instrument with which productivity instruments are compared, it cannot be used as an effective standalone productivity instrument because the relevant items in the survey are binary and cannot provide a useful measure of productivity. The most significant component of indirect costs is unfortunately very difficult to calculate. Traditionally, absenteeism has received much more attention as a field of inquiry because employers have recognized the benefits of being able to effectively measure and reduce a visible but sometimes overlooked source of costs. To be sure, absenteeism is not always easy to measure because, although missed days due to reported sickness can be compiled rather easily from employer files, employees often take sick days for personal reasons. Also, with increased telecommuting rates, some employers are having an increasingly difficult time measuring absenteeism rates with accuracy. Nonetheless, there is support for a strong correlation between employer-reported and employee-reported absenteeism rates. Some of the seminal and review papers found in the literature address other aspects of absenteeism, including its relationship to job satisfaction, the effect of reporting absenteeism in social contexts, and new ways of valuing absenteeism-related costs. In recent years, however, presenteeism has become much more prominent in productivity studies as the extent and severity of its role in workforce productivity has become increasingly

87

apparent. Brouwer et al. (2002) examined workforce productivitybefore and after absence to determine the amount of lost productivity that is unaccounted for when considering only actual days absent due to an episode of illness. Although the workers sample size was small (n = 51), the analysis revealed an increase in production losses by 16% when adding presenteeism costs to absenteeism costs alone. Note, however, that their measure of presenteeism does not include episodes unassociated with absence from work. In fact, a few other studies found in the literature concluded that costs associated with presenteeism can exceed those of absenteeism and medical treatment combined, making quality measures of presenteeism even more crucial. For certain chronic health conditions, including allergy, arthritis, asthma, and migraine, Goetzel et al. (2004) found that a whopping 70-80% of combined employer direct (medical and pharmacy) and indirect (productivity) costs come from presenteeism alone. Measuring overall workforce productivity loss from the employer perspective, including both presenteeism and absenteeism, typically involves creating and implementing self-reported employee surveys. In some cases where

performance may be measured using objective measures such as number of items produced or length of customer service calls taken, productivity as measured by presenteeism and absenteeism can be measured using numerical indices that are relevant and easily understood. However, self-reported workforce surveys are the only practical method that can be used in a variety of settings and job functions to measure workforce productivity. Overall, the literature review exposed several gaps in the measurement of HRQOL and productivity: First, there is no accepted gold standard for measuring productivity among a general population. Second, the relationship between HRQOL and productivity has not been clearly defined, theoretically and empirically. Third, there are no studies comparing the effect of physical and mental HRQOL components on productivity. Fourth, no existing studies have looked at differences between production and knowledge-based jobs or between regular and flexible time jobs in measuring HRQOL and productivity. Fifth, studies have not examined the impact of missed work due to health on increased productivity and the resulting combined impact on social functioning.

Independent Variables Dependent Variable

Figure 1: Research Paradigm

The paradigm shows the relationship of the independent variables to the dependent variable. It shows how beliefs, values and health conditions of farmers would affect their productivity level. Statement of the Problem

This study sought to determine the relationship between beliefs, values and health conditions to the productivity level of the farmers. Specifically, it answered the following:

4. What is the extent of the farmers’ belief towards their work? 5. What is the extent of the farmers’ value towards their work? 6. What is the extent of the farmers’ health condition? 7. What is the productivity level of the farmers? 8. Is there a significant relationship between the beliefs and productivity level of farmers? 9. Is there a significant relationship between values and productivity level of farmers? 10. Is there a significant relationship between health conditions and productivity level of the

farmers? Methodology Research Design

The researchers used the descriptive research design in organizing the presentation, description, and interpretation of the gathered data.

Descriptive research is a scientific method which involves observing and describing the

behavior of a subject without influencing it in anyway. Data Source

This study was conducted at the barangays of Macalva Central, Macalva Sur, and

BELIEFS,

VALUES

And

HEALTH

CONDITIONS

PRODUCTIVITY

LEVEL

88

Macalva Norte, Agoo, La Union. The respondents of this study involve farmers and their family.

The research aims to gather data in the relationship between the beliefs, values, health conditions, and productivity level of farmers. This study is limited to their values and superstitious beliefs in their work, perceived health conditions, and perceived productivity level.

The researchers found out that there are two hundred forty four (244) farmers in the three barangays. Demographic information collected from survey participants included gender (male or female); age group (20-30, 31-40, 41-50, 51-60, 61-70, 71 and above); and highest educational attainment (college graduate, college undergraduate, vocational course, high school graduate, high school undergraduate, elementary graduate, and elementary undergraduate). Table 1 summarizes all demographic information obtained from the surveys. Since the researchers also had a good group sizes for males and females, they conducted a group comparison between the two genders. The table shows that male respondents have a higher number than female respondents which are seventy eight while females are three. As to their age group, there are 34 total numbers of respondents whose ages range from 51-60. (20-30 is 3; 31-40 is 10; 41-50 is 14; 51-60 is 34; 61-70 is 14; and 71 and above is 6). As to the highest educational attainment, twenty five took vocational courses. Data Collection

The main instrument that was used in this study is a questionnaire. The first part is

constructed by the researchers and the second part is an adapted and revised questionnaire on health- SF 36. The constructed questionnaire consists of 30 items which focused on determining the beliefs, values, health conditions, and productivity level of the farmers. These questionnaires were checked and validated by the panel’s members.

The original SF 36 comprised of 36 questions but then it was reduced to 12 items because the other items are not suitable for Filipino farmers. The SF-36 was chosen because it is the most well-known and best validated generic instrument to measure health related productivity of the farmers. Moreover, as a generic instrument, the SF-36 measures different aspects of health conditions simultaneously without merging results into a single measure. In the same way, productivity is a multi-faceted measure that provides value when its components can be distinctly identified. Data Analysis After gathering all the data needed through administering questionnaires, the proponents analyzed the data through statistical tools.

To analyze and interpret the results of the study, the researchers used frequency counts, percentage, weighted mean, and Pearson Product Moment Correlation to find the relationship between belief, values, health condition and productivity level of farmers.

For the distribution of the respondents’, percentage was used while for the significant relationship, Pearson Product Correlation Coefficient using SPSS were used respectively

. Results and Discussions

Beliefs of the Farmers in Macalva, Agoo, La Union

Result shows that the farmers still believe in superstitious beliefs and are still practicing them. Why it falls in the moderately agree level? “It is observed that we are now in a modern time where machineries and other infrastructures have been invented and farmers also believe that their work would become easier if they would use them”

(Santos, 2014). But then, not all farmers can afford these so still they are forced to live and practice the superstitious beliefs they used to believe in. Item number 1 (highest weighted mean) says that the farmers must not cut their hair or shave or eat salt fish because if they do any one of these things the stalks of rice will grow short.

Values of the Farmers

The average weighted mean is 3.36 which falls under the Slightly Value range. Farmers’ values play a big role in a working place because it will affect all aspects of their work. Just like the farmers who had numerous values, they are expected to do this to have a good working atmosphere. In the table, there are items that are strongly agreeable for the respondents. Item

number 1 and item number 9 which shows that the spiritual aspects of Filipino farmers are healthy. Farmers nowadays do not value things so much. They are doing things not because they value it but because they are intended to do it. For instance, they sent their children to school because it was one of the responsibilities of a parent like them. (Santos, 2014).

89

Health Condition of the Farmers All of the items have weighted means that fall under Fair except item number two- Compared to one year ago, how would you rate your health?- and item twelve- How much of the time were you able to do the following tasks?- which fall under Poor. The farmers rated their health as poor and

they have difficulties in doing tasks most of the time. The average weighted mean, 3.11, means that the farmers have a Fair Health Condition. It implies that the farmers are experiencing body pains which cause them difficulties in doing their tasks most of the time.

Productivity Level of Farmers The farmers are productive as shown by the average weighted mean of 3.67. This implies that the farmers harvest high amount and good quality of product; and they can manage their time and money productively. Item one and ten were labeled as Highly Productive. The farmers in Macalva, Agoo, La Union are productive not only because they produce high amount of output of their work like harvesting

more crops per year, having a good quality of products, planting more than one product etc. but also on how they manage their money in order to sustain the needs of their family; and time as well. Being productive can also be seen on how the farmers could maintain a healthy soil in their fields where they are plant their crops by using organic fertilizer.

Relationship between Beliefs and Productivity Level of farmers Table 1 displays the relationship between beliefs and productivity level of farmers. The computed Pearson Correlation is -.037 means that there is a significant relationship between farmers’ beliefs and productivity level. Negative correlation results to an inverse relationship between the variables which means that farmers are highly accepting of superstitious beliefs in farming. The researchers observe that the farmers are preoccupied with these superstitious beliefs such that there will be no more chance for them to think of new strategies on how they could make their work faster and better as what other farmers in other countries are doing. Table 1: Correlation between Beliefs and Productivity Level

Beliefs Productivity

Beliefs

Pearson Correlation 1 -.037


N 10 10

Productivity Pearson Correlation -.037 1 Sig. (2-tailed) .919

N 10 10

Relationship between Values and Productivity Level of Farmer

Table 2 displays the relationship between values and productivity level of farmers. Table 2 shows that the correlation is 0.292 which means that there is no significant relationship between the values and productivity level of farmers. Farmers

nowadays didn’t value things that much, what matters to them is that they are doing what is right and necessary for their family and to other people. (Santos, 2012).

Table 2: Correlation between Values and Productivity Level

Values Productivity

Values Pearson Correlatio 1 .292 Sig. (2-tailed) .413 N 10 10

Productivity Pearson Correlation .292 1 Sig. (2-tailed) .413 N 10 10

90

Relationship between Health Condition and Productivity Level of Farmers Table 3 displays the relationship between health condition and productivity level of farmers. Table 3 presents the correlation between the health status and productivity level of farmers using Pearson Correlation is 0.272 which means that there is no significant relationship between the variables.

Farmers still go to their fields and do their work even when they are experiencing body pains. It does not matter how they feel as long as they can stand and walk they will go to field to perform their tasks. Therefore, health has nothing to do with the farmer’s productivity. (Santos, 2012)

Table 3. Correlation between Health Condition and Productivity Level

Health Condition Productivity

Pearson Correlation 1 .272 Health Condition Sig. (2-tailed) .446 N 13 10 Pearson Correlation .272 1 Productivity Sig. (2-tailed) .446 N 10 10

Conclusions

Based on the findings of the study, the following conclusions were drawn: 1. Farmers slightly believe on the superstitious beliefs towards their work. 2. Farmers slightly believe on their work values. 3. The farmers have fair health conditions. 4. The respondents are productive in their work as farmers. 5. Beliefs of farmers have an effect on their productivity. 6. Values of farmers have no effect on their productivity. 7. Health condition of farmers has no effect on their level of productivity.

Recommendations Based on the findings of the study, the following recommendations were drawn:

1. Researchers should have further research about agricultural Filipino beliefs and values. 2. Farmers should be helped physiologically and psychologically by having medical missions that

will benefit the farmers regarding their health; and seminars such as about farming and stress management that will improve the farmers’ knowledge on farming and enhance their abilities in managing their emotional problems.

3. Researchers should conduct a study that would measure the quantitative output as counterpart of the quantitative analysis of their level of productivity.

Literature Cited Brouwer W, Meerding WJ, Lamers LM, Severens H. The relationship between productivity and health-related

quality of life: an exploration. Pharmacoeconomics 2005;23:209-18. Brouwer WBF, Koopmanschap MA, Rutten FFH. Productivity losses without absence: measurement

validation and empirical evidence. Health Policy 1999;48:13-27. Goetzel RZ, Long SR, Ozminkowski RJ, Hawkins K, Wan S, Lynch W. Health, absence, disability, and

presenteeism cost estimates of certain physical and mental health conditions affecting U.S. employers. J Occup Environ Med 2004;46:398-412.

Koopman C, Pelletier K, Murray J, et al. Stanford presenteeism scale: Health status and employee productivity. J OccupEnvironMed 2002;4:14-20.

Koopmanschap M, Burdorf A, Jacob K, Meerding WJ, Brouwer W, Severens H. Measuring productivity changes in economic evaluation — Setting the research agenda. Pharmacoeconomics 2005;23:47-54.

Kumar RN, Hass SL, Li JZM, Nickens DJ, Daenzer CL, Wathen LK. Validation of the Health-Related Productivity Questionnaire Diary (HRPQ-D): Results from a phase 1 multicenter clinical trial. J Occup Environ Med 2003;45:899-907.

Lerner D, Amick BC, Rogers WH, Malspeis S, Bungay K, Cynn D. The work limitations questionnaire. Med Care 2001;39:72-85.

Lerner D, Adler DA, Chang H, et al. Unemployment, job retention, and productivity loss among employees with depression. PsychiatrServ 2004;55:1371-8.

Meerding WJ, Ijzelenberg W, Koopmanschap MA, Severens JL, Burdorf A. Health problems lead to considerable productivity loss at work among workers with high physical load jobs. J ClinEpidemiol 2005;58:517-23.

91

Osterhaus JT, Purcaro O, Richard L. Validity and responsiveness of the Work Productivity Survey: A novel disease-specific instrument assessing work productivity within and outside the home in subjects with rheumatoid arthritis. [abstract]. Ann Rheum Dis 2008;67Suppl II:573.

Shikiar R, Halpern MT, Rentz AM, Khan ZM. Development of the Health and Work Questionnaire (HWQ): an instrument for assessing workplace productivity in relation to worker health. Work 2004;22:219-29.

Stewart WF, Ricci JA, Chee E, Morganstein D, Lipton RB. Lost productive time and cost due to common conditions in the US workforce. JAMA 2003;290:2443-54.

Stewart WF, Ricci JA, Leotta C, Chee E. Validation of the work and health interview. Pharmacoeconomics 2004;22:1127-40.

Van Roijen L, Essink-Bot ML, Koopmanschap MA, Bonsel G, Rutten FF. Labor and health status in economic evaluation of health care. The Health and Labor Questionnaire. Int J Technol Assess Health Care 1996;12:405-15.

Wang PS, Beck A, Berglund P, et al. Chronic medical conditions and work performance in the health and work performance questionnaire calibration surveys. J Occup Environ Med 2003;45:1303-11.

92

Konsepto ng Midlife Crisis sa mga Magsasaka

Erica Lyn D. Estacio, Lenneth S. Quinto, Melody D. Tano, and Kessy Ivy M. de Guzman

Abstract

Ang midlife crisis ay ang emosyonal at sikolohikal na reaksyon ng isang tao sa mga nararanasang krisis sa edad na 40 hanggang 60. Layunin ng pag-aaral na ito na alamin kung gaano kalaganap ang midlife crisis sa mga magsasaka, kung ano ang pagpapakahulugan nila rito, kung ano ang kanilang mga karanasan na may kaugnayan rito, at kung ano ang mga manipestasyon nito sa kanila. Sa pamamagitan ng isang sarbey, napag-alamang ang midlife crisis ay laganap sa animnapu’t tatlong porsyento (63%) ng mga kalahok. Sa pamamagitan ng retrospective-autobiographical design na ginamitan ng pagtatanong-tanong at pagdadalaw-dalaw nakalap ang iba pang datos. Mula rito ay nalamang ang mga krisis na naranasan ng mga magsasaka ay umiikot sa tatlong aspeto ng kanilang buhay: pisikal, sosyal at pinansiyal. Napalitaw rin ang limang tema hinggil sa sintomas ng midlife crisis sa mga ito: panghihinayang sa mga nabigong hangarin, hangaring makapag-ambag sa lipunan, hangaring ibalik ang lumipas na kabataan, takot sa pagtanda at hindi pagkakontento sa uri ng pamumuhay. Keywords: krisis, magsasaka, midlife crisis Panimula “Middle aged”, binigyang kahulugan sa pananaliksik na ito bilang mga taong nasa pagitan ng edad na 40 hanggang 60 (Lachman et al., 2015; Lachman, 2004), ay kumakatawan sa labingwalong porsyento (18%) ng populasyon. Sa Pilipinas na mayroong kabuuang populasyon na humigit kumulang sa 100 milyon, ang porsyentong ito ay nangangahulugan ng 17 milyon na mga katao ayon sa Philippine Statistics Authority (2012). Ang importansya ng bahaging ito ng populasyon ay hindi lamang nakabatay sa dami nito kundi dahil sakop din nito ang malaking parte ng buhay ng tao. Ang midlife ay isang mahabang yugto, na maaaring tumagal ng higit sa 20 taon. Maraming mga bagay ang dapat pag-aralan sa yugtong ito ngunit masasabing hindi ito lubos na napag-uukulan ng pansin (Lachman, 2004). Isa na rito ang maraming espekulasyon, na ang midlife ay isang yugto ng hindi maiiwasang “krisis” (Lachman 2004, Cohen 2006, Levinson 1978). Ang midlife crisis ay unang ginamit ni Elliot Jacques sa kanyang artikulong “Death and the Midlife Crisis” (Gatling et al., 2014). Sa kanyang pag-aaral sa mga personal na karanasan ng mga alagad ng sining, natuklasan niya, na sa pagsapit ng middle age, nakararanas ang mga ito ng krisis na dulot ng reyalisasyon sa kanilang mortalidad at paglipas ng panahon, mula sa kanilang

kapanganakan tungo sa nalalabing oras ng kanilang buhay (Shek, 1996). Sa isang pagsusuri sa mga literaturang Kanluranin, iminungkahi ni Levinson (1978) na ang midlife crisis ay isang normal na pangyayaring mararanasan halos lahat ng tao sa isang punto ng pagiging middle aged (Freund at Ritter, 2009) ngunit sa isa ring pag-aaral na ginawa sa Tsina noong 1996 ni Daniel Shek upang suriin ang midlife crisis sa mga kababaihan at kalalakihang Tsino, natuklasan niyang hindi nakararanas ang mga ito ng midlife crisis (Shek, 1996). Dahil dito, marami pang pag-aaral ang ginawa at ginagawa hanggang sa ngayon upang lubos na maunawaan ang isyu ng midlife crisis at kung may kinalaman ang uri ng kultura sa pangyayaring ito. Karamihan sa mga pag-aaral na ito ay isinagawa sa Kanluraning lipunan at hanggang sa ngayon ay wala pa ring naitatalang pagsusuri tungkol dito sa Pilipinas. Sa katunayan, ang midlife crisis ay napag-usapan lamang sa Pilipinas dahil sa pag-amin ng artistang si Sharon Cuneta na dumanas siya ng midlife crisis. Ngunit sa kabuuan, wala pang nailalathalang pag-aaral tungkol sa bagay na ito sa Pilipinas. Ang mga nasa edad na 40-60 ay malimit na bigyang-pansin ng mga mananaliksik sa Pilipinas kung kayat nabuksan ang kaisipan ng mga mananaliksik na suriin ang yugtong ito ng buhay

93

partikular na sa mga magsasaka. Sa kabila ng malaking tungkuling ginagampanan ng mga magsasaka sa ating lipunan ay hindi sila napag-uukulan ng pansin. Mabibilang ang mga pag-aaral patungkol sa kanila at maging sa mga suliraning kanilang hinaharap. Ang mga magsasaka sa Pilipinas ay karaniwang nasa edad na 57, pasok sa edad kung kailan sinasabing nagaganap ang midlife crisis (Saliot, 2013). Sinasabing magkaibang-magkaiba ang kultura ng mga Kanluranin sa mga Silanganin (Yalom, 1980) kung kayat mabibigyang linaw sa pag-aaral na ito kung may pagkakatulad sa

pagpapakahulugan ng mga Kanluranin ang pagpapakahulugan ng mga middle aged na magsasakang Pilipino sa midlife crisis. Bibigyang diin sa pag-aaral na ito kung ano ang pananaw ng isang magsasakang Pilipino sa midlife crisis at kung ito ay laganap sa kanilang bilang. Sisipiin din ng pag-aaral na ito ang kalikasan at manipestasyon ng midlife crisis base sa mga personal na karanasan ng mga magsasaka. Nilalayon din ng pag-aaral na ito na madagdagan ang literatura patungkol sa midlife crisis sa Pilipinas dahil sa kakulangan nito.

Paradima ng Pananaliksi Input Proseso Awtput

Pigura 1. Pagpapaliwanag sa konsepto ng midlife crisis sa mga magsasaka Kinahinatnan at Pagtalakay Sa kabanatang ito, naipapaliwanag ang paglaganap ng midlife crisis sa mga agsasaka. Dito rin binigyang kahulugan ng mga magsasaka ang midlife crisis. Iisa-isahin ding tinalakay ang karanasan at manpestasyon ng mga magsasaka na may kaugnayan sa midlife crisis

Pagkalaganap ng Midlife Crisis sa mga Magsasaka Ang nakalap na datos sa ginawang sarbey ay mula sa 81 mga kalahok na pawang mga nasa pagitan ng edad na 40-60. Batay sa resulta ng nasabing sarbey, lumalabas na laganap ang midlife crisis sa animnapu’t tatlong porsyento (63%) ng mga kalahok.

Talahanayan 1 Frequency Distribution at Porsyento ng Pagkalaganap ng Midlife Crisis

f %

Sobrang Laganap

Laganap

Bahagyang Laganap

Hindi Gaanong Laganap

Hindi Laganap

0

17

34

30

0

0

21%

42%

37%

0

Kabuuan 81 100%

Pagkalaganap 51 63%

94

Hinggil sa Pagpapakahulugan ng mga Magsasaka sa Midlife Crisis Sa pagsusuri lumabas ang iba’t ibang pagpapakahulugan ng mga magsasaka sa Midlife Crisis Talahanayan 2. Mean at Average Weighted Mean ng mga Kasagutan sa Sarbey.

Pahayag M

1. Wala akong ni katiting na pinagsisisi sa kinalabasan ng mga desisyon ko noon.

2. Nakakapagod para sa akin ang pag-aalaga ng aking mga anak, apo, at matatandang

kamag-anak.

3. Nararamdaman ko na nasa tugatog ang aking kalusugan.

4. Kung may sapat na mapagkukunan, nais kong bumili ng mga bagay na

pampaganda/pampagwapo.

5. Tanggap ko ang mga pagbabago sa aking pisikal na itsura na dulot ng aking edad.

6. Kung sapat ang badyet, nais kong subukin ang pag inom ng mga dietary supplement

upang madugtungan pa ang aking buhay.

7. Kawili-wili ang aking kasalukuyang trabaho o gampanin.

8. Tinuturuan ko ang mga kabataan dahil nais kong baguhin ang mundo.

9. Hindi ako nag-aalala na ako'y tumanda.

10. Mayroon akong biglaang kagustuhang matuto ng bagong laro, instrumento o kasanayan.

11. Hindi ako basta basta nadadala ng inis at galit pag may nangyaring hindi kanais nais.

12. Gusto kong maglakbay sa ibang lugar at sumubok ng bagong pakikipagsapalaran.

13. Hindi ikinakasama ng loob ko ang mga maliliit na bagay na nagagawa o nasasabi ng mga

taong nasa paligid ko.

14. Pakiramdam ko ay bigo ako sa pag-abot ng aking mga mithiin.

15. Mayroon akong maayos na relasyon sa mga taong nakapaligid sa akin kabilang na ang

aking pamilya at maging ang ibang tao.

16. Madalas akong nag-iisip tungkol sa kamatayan sapagkat iyon ay ikinatatakot ko.

17. Sa puntong ito ng buhay ko, alam ko na ang dahilan kung bakit ako nabubuhay.

18. Wala na akong nararamdamang pagnanasa para sa aking asawa/kabiyak/kinaksama.

19. Napupunan pa rin ng aking asawa/kabiyak/kinakasama ang aking mga sekswal na

pangangailangan.

20. Hanggang ngayon, hindi ko pa rin alam kung saan patungo ang buhay ko.

21. Alam kong may hangganan ang buhay at hindi ko ikinakatakot ang kaisipan tungkol sa

kamatayan.

22. Madalas akong magkaroon ng di-pagkakaunawaan sa mga taong nasa paligid ko.

23. Natupad ko na ang lahat ng gusto kong mangyari sa buhay ko.

24. Ako ay nagiging maramdamin kaysa karaniwan.

25. Wala akong pagnanais na umalis kung saan ako naroroon ngayon.

26. Madali akong magalit pag may mga pangyayaring hindi ko inaasahan.

27. Hindi ako intresadong mag-aral at tumuklas ng mga bagong kaalaman.

*4.40

2.85

*2.59

2.68

*2.74

4.48

*2.35

4.67

*2.41

2.78

*3.62

2.98

*2.93

2.73

*2.78

2.86

*2.33

2.47

*2.47

2.33

*2.86

2.78

*2.73

2.93

*2.98

3.62

*2.78

95

28. Kapag naiisip ko na ako ay tatanda, nakakaramdam ako ng takot at pag-aalala.

29. Tanggap ko na ganito na ang kalagayan ng mundo at wala na akong magagawa pa upang

baguhinito.

30. Nakakabagot at nakakasawa ang aking kasalukuyang trabaho o gampanin.

31. Wala sa isip ko ang uminom ng mga dietary supplement upang humaba ang aking

buhay.

32. Hindi ako nasisiyahan sa aking imahe na nakikita ko sa harapan ng salamin.

33. Wala sa isip ko ang bumili ng mga gamit na pampagwapo o pampaganda.

34. Pakiramdam ko ay unti-unti ng humihina ang aking resistensya dulot ng aking edad.

35. Nalilibang ako sa pag-aalaga ng aking mga anak, apo at matatandang kamag-anak.

36. Kung makababalik lamang ako sa nakaraan, babaguhin ko ang mga naging desisyon ko

noon.

2.41

*4.67

2.35

*4.48

2.74

*2.68

2.59

*2.85

4.40

Average Weighted Mean 3.03

Batay sa sarbey ang pinakanararanasang sintomas ng mga kalahok patungkol sa midlife crisis ay ang mga sumusunod: (8) “Tinuturuan ko ang mga kabataan dahil nais kong baguhin ang mundo.” (M=4.67); (6) “Kung sapat ang badyet, nais kong subukin ang pag inom ng mga dietary supplement upang madugtungan pa ang aking buhay.” (M=4.48); (36) “Kung makababalik lamang ako sa nakaraan, babaguhin ko ang mga naging desisyon ko noon” (M=4.40). Samantala, madalang lamang na maranasan ng mga kalahok ang mga sumusunod na sintomas: (20) “Hanggang ngayon, hindi ko pa rin alam kung saan patungo ang buhay ko.”, (M=2.33); (30) “Nakakabagot at nakakasawa ang

aking kasalukuyang trabaho o gampanin.”, (M=2.35); (28) “Kapag naiisip ko na ako ay tatanda, nakakaramdam ako ng takot at pag-aalala.”, (M=2.41). Ang average weighted mean para sa ginawang sarbey ay 3.03, nangangahulugan ito na ang mga sintomas na nakapaloob sa sarbey ay madalas na nararanasan ng mga kalahok. Samantala sa antas naman ng pagkalaganap ng midlife crisis sa mga kalahok, nangangahulugan itong laganap ito sa kanila. Ang resulta ng sarbey ay sang-ayon sa mga ginawang pag-aaral nina Levinson (1978) at Cierna (1985) na ang midlife crisis ay isang normal na pangyayaring mararanasan ng isang tao pagsapit niya ng edad na 40-60.

Hinggil sa mga Naranasang Krisis

Sa pamamagitan ng pagbabalik tanaw ng mga kalahok, ibinahagi nila ang mga karanasang itinuturing nilang krisis. Sa pangkalahatan, magkakatulad ang mga karanasan ng mga kalahok

sa kabila ng pagkakaroon ng pagkakaiba-iba sa kung paano nila ito hinarap. Ang mga krisis na nabanggit ay nakapaloob sa tatlong aspeto ng kanilang buhay: pinansiyal, sosyal, at pisikal.

Pinansiyal

Ito ay may kinalaman sa perang pantustos para sa mga pangunahing pangangailangan ng mga kalahok. Lahat ng kalahok (100%) ay nagsabing nakaranas sila ng krisis sa pinansiyal na aspeto. Pinatitibay ito ng pag-aaral nina Ramesh at Madhavi (2009), kung saan ay napag-alamang pangunahing krisis na kinakaharap ng mga magsasaka ay mga problemang pinansiyal na may kinalaman sa mga utang at bayarin. Ayon sa GMA News, Investigative Documentaries (2013) nangunguna sila sa listahan

ng mahihirap, na sa kabila ng pagsisikap sa init ng araw buong taon ay hilahod pa rin sa hirap ng buhay. Sa halos isang taon na pagsubaybay ng programang Investigative Documentaries (2013) sa ilang pamilya ng magsasaka para sukatin ang kanilang kita, lumalabas na hindi sapat para sa kanilang mga pangangailangan ang salapi mula sa kanilang ani. Dahil dito, karamihan sa mga kalahok ay naghahanap ng ibang mapagkakakitaan upang sa ganoon ay madagdagan ang kanilang kita.

96

Talahanayan 3. Pananaw sa Tindi ng Hirap na Naranasan Batay sa Bilang ng Anak

May anak na tatlo pataas May anak na dalawa pababa

“Talagan mairap na bilay ed saraman ya

panaon. Dakel so krisis ta kailangan moy

manpabaleg tan manpaaral ya anak.”

(Talagang mahirap ang buhay noong mga

panahong iyon. Madaming krisis dahil

kailangang magpalaki at magpaaral ng mga

anak.) (MA67)

“Talagan mairap iman ya panaon. Maerap na

40-60 (edad). No 40 kasi, manpapa-aral kami

ni labat ni ray anak mi ed saraman. Et pigara

ra? Anim-era, nantutumbukan ni. Sobray irap

ya bilay.”

(Ito yung panahong talagang mahirap.

Mahirap ang edad na 40-60. Pag 40 palang

kasi nagpapalaki palang kami ng mga anak

noon. Eh ilan sila? Anim, sunod-sunod pa.

Sobrang hirap ng buhay.) (TS63)

“Para ed siac, aliwan mairap ya maong ta

anggapo met so anak min pinan-aral mi.”

(Para sa akin ay hindi naman masyadong

mahirap kasi nga wala kaming anak na

pinalaki at pinag-aral.) (LA71)

“Agko ibibilang ya mairap ya maong. Siguro

kasi saksakey met labat na putot ko, pero no

dakel, ay agko labat anta. Agkami met kasi

nairapan ya manpa-aral ta saksakey to met.”

(Hindi ko ibinibilang na masyadong

mahirap. Siguro dahil iisa lang ang anak ko,

pero kung madami, ay ewan ko nalang.

Hindi naman kasi kami nahirapang mapaaral

dahil iisa lang niya (anak). (MC64)

“Mairap itan ya panaon. Mairap ya talaga. Nu

dakel siguroy anak mi, maiirap ni”

(Mahirap iyan na panahon. Mahirap ang

buhay. Siguro kapag nagkaroon kami ng

madaming anak mas mahirap pa.) (RA63)

Sosyal Ang mga krisis na naranasan ng mga kalahok sa sosyal na aspeto ay tumutukoy sa relasyon ng mga ito sa ibang tao at sa iba’t ibang gampanin sa mga magulang, anak, mga nakababatang henerasyon at sa lipunang kanilang ginagalawan. Bukod dito, itinuturing din nilang krisis ang mga naranasang hindi pagkakaunawaan sa ibang tao, partikular na sa kanilang pamilya. Ang pagkakaroon ng maayos na relasyon sa pamilya ang pangunahing pinagmumulan ng kasiyahan ng isang middle aged (North et al., 2008). Ang kawalan ng suporta mula sa kanila ay nakapagdudulot ng kalituhan at kaguluhan hanggang sa ito ay mauwi sa stress (Lachman, 2004). Isa pang itinuturing nilang krisis ay ang

pakiramdam na wala silang magawa hinggil sa

mga nakikitang hindi magandang pag-uugali ng

mga makabagong henerasyon. Sa terminong

ginamit ng isang kalahok, sinabi niyang ang mga

kabataan ngayon ay bastos, kaya nangangailangan

ang mga ito ng pagdidisiplina. “Nu untakken ki

met la, agyo la anta nu panun to yo la eran

disiplinaen eray anak yo” (Kapag tumanda na rin

kayo, hindi niyo na rin alam kung paano

didisiplinahin ang mga anak niyo) (PQ68 at FQ62,

p.76). Ito ay ayon sa isang kalahok nang kanyang

isalaysay ang kanyang karanasan hinggil dito.

Kaugnay ito ng konsepto ng generativity ni

Erikson (1968), kung saan ang pangunahing

alalahanin ng isang middle aged ay ang magabayan

ang mga susunod na henerasyon.

Pisikal

Ang aspetong ito ay kumakatawan sa mga krisis na naranasan ng mga kalahok hinggil sa mga pagbabagong naganap sa kanilang kalusugan. Siyam mula sa sampung (90%) mga kalahok ang nagsabing nakaranas sila ng krisis sa mga pagbabago sa kanilang katawan sa pagsapit nila sa edad na 40 hanggang 60. Ayon sa kanila, nagsimula ang panghihina ng kanilang katawan mula sa nabanggit na edad. Naroon ang mabilis na pagkahapo at pagkakaroon ng iba’t ibang

karamdaman sa dugo at panunaw, panlalabo ng paningin at pagbabara ng ugat sa binti. Sa patuloy na pag-unlad ng edad ng isang tao, patuloy rin ang pagtaas ng mga problema sa kalusugan partikular na sa mga nasa mababang sosyo-ekonomikong antas ng lipunan (Lachman, 2004) kung saan nabibilang ang mga magsasaka. Kaugnay nito, dalawa sa mga kalahok ang nagsabing nagkaroon sila ng stress ulcer. Tatlo rin

97

sa kanila (30%) ang nagkaroon ng hypertension sa pagsapit ng middle age. Pagharap ng mga Magsasaka sa mga Pinagdaanang Krisis

Sa dami ng pinagdaanang krisis ng mga kalahok, hindi lamang sila umasa sa kanilang pansariling kakayahan. Habang gumagawa sila ng paraan upang harapin ang krisis sinasamahan din nila ito ng panalangin sa Poong Maykapal bilang paghingi ng gabay upang malampasan ang krisis. Anim sa mga kalahok (60%) ay nagsabing sa bawat krisis na kanilang

pinagdaanan ay ang Diyos ang kanilang ginawang sandigan lalong-lalo na sa mga panahon ng kagipitan. “Ag met simmabi may oras ya labay ko lay unsuko ta wadtan labat so Katawan” (Hindi naman dumating iyong puntong gusto ko nang sumuko kasi andiyan ang Diyos). Ito ay ayon sa isang kalahok (JV63,p.52).

Hinggil sa Manipestasyon ng Midlife Crisis sa mga Magsasaka Batay sa mga naging karanasan ng mga kalahok, nagawang itala ng mga mananaliksik ang mga manipestasyon ng midlife crisis sa mga magsasaka. Sa pamamagitan ng mga manipestasyong ito ay nakabuo ng ilang tema ang

mga mananaliksik ukol sa sintomas ng midlife crisis sa mga magsasaka (at ang mga manipestasyon nito). Makikita ito sa Talahanayan 4.

Talahanayan 4. Tema at Manipestasyon ng Midlife Crisis sa mga Magsasaka

TEMA MANIPESTASYON

Panghihinayang sa mga nabigong hangarin

depresyon pagsisisi sa mga nagawang desisyon pagbabalik-tanaw sa mga bagay na hindi nagawa

Hangaring makapag-ambag sa lipunan

pagdidisiplina sa mga anak at sa mga nakababatang henerasyon pagtulong sa mga nangangailangan pagsali sa pulitika upang makapaglingkod sa ibang tao

Hangaring ibalik ang lumipas na kabataan

pagpatol sa ibang babaeng dulot ng kantsaw ng mga kaibigan (sa mga lalaki) pagdalo sa mga reunion upang makasalamuha ang mga dating kakilala

Takot sa pagtanda paghahangad na pagbutihin ang kalusugan sa pamamagitan ng pag-inom ng mga bitamina, pag-eehersisyo at pagkain ng masusustansyang pagkain

Hindi pagkakontento sa uri ng pamumuhay

kawalan ng gana sa buhay paghahanap ng ibang mapagkakakitaan paghahanap ng mga bagong pakikipagsapalaran

Panghihinayang sa mga Nabigong Hangarin Sa pangangalap ng mga mananaliksik ng mga datos para sa pag-aaral, napag-alaman nilang ang mga kalahok ay hindi nakapagtapos ng pag-aaral. Karamihan sa kanila ay nakatuntong lamang ng elementarya at hindi man lang natapos ang ika-anim na baitang. Ayon sa kanila, ang mga dahilan nito ay ang pagiging likas na mahirap ng buhay noong kanilang kabataan at ayon rin sa kagustuhan ng kanilang mga magulang. Kung kaya, nais man nilang makapag-aral ay nauwi na lamang sila sa pagtulong sa bukid hanggang sa malimutan na nila ang hangarin nilang makapag-aral. Sa pagdating ng panahong bumubuo na rin sila ng sarili nilang pamilya at nakararanas ng matinding hirap, saka lamang nila naaalala ang halaga ng may sapat na pinag-aralan

Samantala, ang depresyon sa kanila ay dulot ng iba’t ibang pangyayaring hindi inaasahan na sumisira sa mga orihinal nilang mithiin. Apat na mga kalahok (40%) ang nakaranas ng depresyon. Dalawa sa kanila ay dahil sa pagkamatay ng kanilang anak. Hangarin man nilang magkaroon pa ng anak ay hindi na nangyari dahil pareho na silang may edad. Panghihinayang at paghihinagpis ang naging bunga nito sa kanila. . Sa kabila ng maraming maaaring maging dahilan ng depresyon ng isang tao, lumalabas sa pag-aaral na ginawa ni Faris (2012) na mas mataas ang tsansang makaranas ng depresyon ang mga taong mayroong mas mababang pinag-aralan kaysa mga taong may mataas na pinag-aralan. Ayon pa sa kanya, mas madalas ding makaranas ng

98

depresyon ang mga taong nasa edad 45 hanggang 64. Hangaring Makapag-ambag sa Lipunan Ayon kay Erikson (1968), isang normal na katanungan para sa isang middle aged kung may nagawa siyang mabuti para sa lipunang kanyang kinabibilangan. Sa sariling paraan ng mga kalahok ay sinubok nilang gumawa ng hakbang upang maisakatuparan ito. Ang hangaring ito ay hindi lamang nakasentro sa paggabay at pagdisiplina sa

mga kabataan bagkus pati na rin sa pagtulong at pagsilbi sa iba Sa pamamagitan ng mga salaysay na ito, makikita ang malaking papel na ginagampanan ng mga middle aged sa pagbabahagi ng kanilang mga karanasan at sa pagsasalin ng mga bagay na kanilang pinapahalagahan sa mga nakababatang henerasyon (Lachman, 2004).

Hangaring Ibalik ang Lumipas na Kabataan Sa middle age nagsisimula ang mga palatandaang ang isang tao ay tumatanda na. Nagsisimulang mapuna ang mga wrinkles, nagsisimulang malagas ang mga ngipin, at tumubo ang mga putting buhok. Ang mga pagbabagong ito sa kaanyuan ng isang tao nagmumula ang hangaring ibalik ang lumipas na kabataan. Isa sa mga lalaking kalahok ang umamin na pumatol siya sa ibang babae dulot ng kantsaw o buyo ng kanyang mga kaibigan. Sa kabilang banda, hindi niya ito itinuturing na panloloko kundi isang bagay na hindi maiiwasan.

Kakikitaan din ng sintomas na ito ang isa sa mga kalahok na nagsabing kaya siya nananatiling bata ay dahil palakaibigan siya, “sikaton ugaw ak nin nengnengen kasi maka-aro ak, anggano busy ak, wala nin sensya so oras kon man-hi ed saray naabet ko” (Kaya bata akong tingnan ay dahil palakaibigan ako. Kahit busy ako, may oras pa akong mag-hi sa mga makakasalubong ko.) (PQ68,p.77). Inamin din niyang mahilig siyang dumalo sa mga reunion at salusalo kasama ang kanyang mga dating kaklase at kaibigan.

Takot sa Pagtanda Dulot ng Mga Problema sa Kalusugan Siyam sa mga kalahok (90%) ay nagsabing nakaranas sila ng pagbabago sa kanilang kalusugan sa pagsapit nila sa mga edad na 40-60. May mga hindi rin pinalad na magkaroon ng karamdaman. Kung kaya, para sa mga kalahok, ang middle age ay panahon ng tumataas na problema sa kalusugan partikular na sa mga nasa mababang antas ng lipunan gaya ng mga magsasaka (Lachman, 2004).

Ang midlife ay kadalasang panahon kung kailan nagsisimulang magkaroon ng sakit o karamdaman ang isang tao. Ito ay ayon sa ginawang pag-aaral ni Lachman et al. (2015). Sa kabila ng katotohanang ang mga ito ay maaaring malunasan at makontrol sa pamamagitan ng mga gamot at tamang diet, ang mga ito ay nakapagdudulot ng stress dahil ang mga ito ay nagsisilbing palatandaan ng pagbaba ng resistensya dahil sa pagtanda (Lachman, 2004).

Hindi Pagkakuntento sa Uri ng Pamumuhay

Ang sintomas ng midlife crisis na ito ay may

dalawang manipestasyon. Una na rito ang

pagkasawa sa buhay na dulot ng kabuuang hirap

na dinaranas nila sa araw-araw. Ito ay dahil sa

kagustuhan nilang maiahon sa hirap ang pamilya

ngunit hindi sapat ang kanilang kinikita. Sabi

nga ng isa sa mga kalahok, “Wala met imay panaon

ya unsasawa ak met la, naibabagak lad sarilek ya

grabe met lan kairapan ya.”(Mayroon din iyong

panahon na nagsasawa na rin ako at nasasabi ko

na sa sarili ko na sobra namang kahirapan ito.)

(JV63,p.51).

Konklusyon

Batay sa mga nakakalap na datos, ang mga

sumusunod ang naging konklusyon ng mga mananaliksik:

1. Ang midlife crisis ay laganap sa mga magsasaka.

2. Ang kahulugan ng midlife crisis para sa kanila ay dulot ng mga responsibilidad at

99

tungkuling dapat nilang gampanan sa kanilang pamilya lalong-lalo na sa kanilang mga anak.

3. Mayroong iba’t ibang kuwento ng paghihirap, pakikibaka, pagsasakripisyo at pagtitiis ang naranasan ng mga kalahok. Ang pangunahing krisis na kanilang naranasan ay tungkol sa mga problemang

pinansiyal na kakambal ng responsibilidad na mapalaki at mapag-aral ang kanilang mga anak. Malaking salik para sa kanila ang aspetong espiritwal sa pagharap sa mga suliranin at krisis na naranasan.

4. Ang midlife crisis sa mga magsasaka ay may iba’t ibang sintomas at manipestasyon

Rekomendasyon

Batay sa kinahinatnan ng pag-aaral, ang mga sumusunod ay ang nabuong rekomendasyon:

1. Sa mga sikolohista, iminumungkahi na bigyang pansin ang midlife o middle age upang magkaroon ng mas malinaw na pang-unawa ang mga tao sa midlife crisis. Mainam ring gawin ito sa mas malaking bilang ng mga kalahok upang malaman pa kung ano ang iba pang suliranin na kinakaharap ng mga magsasakang nasa midlife. Iminumungkahi rin ng mga mananaliksik na isaalang-alang ang pagkakaiba sa pagitan ng mga karanasan ng mga kalalakihan at kababaihang nagdaraan sa midlife crisis.

2. Dahil ang kahulugan ng midlife crisis para sa mga magsasaka ay mula sa mga responsibilidad at tungkuling kanilang ginagampanan, ang suporta at pang-unawa ng mga mahal sa buhay ang pangunahing kailangan ng mga magsasakang nagdaraan sa midlife crisis.

3. Para sa mga magsasakang nagdaraan sa midlife crisis, mabuting maibahagi nila ang kanilang mga karanasan sa kanilang

mga kapwa magsasaka nang sa gayon ay malaman nilang hindi lamang sila ang nakararanas nito. Dahil ang pinakaugat ng krisis para sa mga magsasaka ay ang pinansiyal na mga suliraning kanilang kinakaharap, makatutulong nang malaki kung magkakaroon nang maayos na programa ang gobyerno para sa kanila upang tumaas ang kanilang kita. Sa pamamagitan nito ay maiibsan ang kanilang mga suliraning pinansiyal. Malaking tulong kung mabibigyan ng mga scholarship programs ang mga karapat-dapat na anak ng mga magsasaka, yamang ang kanilang pangunahing hangarin ay ang mapag-aral sila at mabigyan ng magandang kinabukasan.

4. Mainam kung matutulungan ang mga magsasakang nagdaraan sa midlife crisis sa pamamagitan ng Stress Management Program yamang ang pangunahing pinagmumulan ng kanilang krisis ay dahil sa mga nararanasang stress sa iba’t ibang aspeto ng kanilang buhay.

Sanggunian Cojuangco, T. (2010, November). Midlife Crisis Coping. Retrieved from Dealing with Midlife Crisis:

http://www.philstar.com/sunday-life/633642/dealing-with-midlife-crisis Freund, A. M., & Ritter, J. O. (2009, July 2). Midlife Crisis: A Debate. Behavioural Sciences Section. Retrieved

from www Lachman, M. E., Teshale, S., & Agrigoroael, S. (2015). Midlife as a Pivotal Period in the Life Course: Balancing

Growth and Decline at the Crossroads of Youth and Old Age. International Journal of Behavioral Development

Marcos, F. (1981, May 15). Official Gazette. Retrieved from GOVPH: http://www.gov.ph/1981/05/12/talumpati-ni-pangulong-marcos-sa-araw-ng-magsasaka-may-15-1981

Neugarten, B. (1968). Middle age and aging: A reader in social psychology. Chicago: University of Chicago Press.

North, R. J., Holahan, C. J., Moos, R. H., & Cronkite, R. C. (2008). Family support, family income, and happiness: A 10-year perspective. Journal of Family Psychology, 475-483.

Pe-Pua, R., & Protacio-Marcelino, E. (2000). Sikolohiyag Piliino (Filipino Psychology): A Legacy of Virgilio G. Enriquez. Asian Journal of Social Psychology, 49-68.

Philippine Statistics Authority. (2012). The Age and Sex Characteristics of the Philippine Population. Retrieved from Philippine Statistics Authority: https://psa.gov.ph/sites/default/files/attachments/hsd/pressrelease/Philippines_0.pdf

Robinson, O. C., Wright, G. R., & Smith, J. A. (2013). The Holistic Phase Model of Adult Crisis. Springer Science+Business Media New York 2013.

Rook, K. (2003). Exposure and reactivity to negative social changes: a preliminary investigation Setya, K. (2014). The Midlife Crisis. Philosopher's Imprint.

100

Stumpf, K.R. (2015, August 24). Midlife Crisis Coping. Retrieved from What is midlife Crisis: http://www.midlifecrisismarriageadvocate.com/mlc.html

The Age and Sex Structure of the Philippine Population: (Facts from the 2010 Census ). (2012). Retrieved from Philippines statistic authority: https://psa.gov.ph/sites/default/files/attachments/hsd/pressrelease/Philippines_0.pdf

Twachtman-Cullen, D. (2009). The Cutting Edge. Autism Spectrum Quarterly. Unnamed. (2014, November 18). Health: How to Prevent Midlife Crisis. Retrieved from Puso ng Pamilyang

Pilipino: http://www.psuongpamilya.com/health-how-to-prevent-midlife-crisis/ Weaver, Y. (2009). Mid-Life - A Time of Crisis or New Possibilities? Existential Analysis 20.1. Wethington, E., Kessler , R., & Pixley, J. (2004). Turning points in adulthood. How healthy are we? A national

study of well-being at midlife. Yabut, H. Y. (2013). Isang paglilinaw sa mga Paniniwala at Pagpapakahulugan sa mga Ispiritwalidad at

Relihiyon ng mga Pilipino. Diwa E-Journal Tomo1, Bilang 1.

101

Self-Concept of Kaingin Farmers Krystell Pearl K. Boac, Cindy A. Casuga, Myra P. Druja,

and Pearl Natalie B. Estrada Abstract In this study, the researchers wanted to determine the level of self-concept of kaingin farmers and the factors affecting their self-concept because some articles had mentioned that kaingin farmers are labeled as criminal agriculturists causing a possible negative outlook on them, resulting in their low self-concept. Qualitative research design was used in the study. A self-concept test developed by De Leon and Viloria was used to measure the level of the self-concept of the farmers. Interviews and focus group discussion were conducted to the respondents to validate their responses in the self-concept test. The study found that the level of the self-concept of kaingin farmers is high. The factors affecting their self-concept are spiritual, age, financial, family, economic, social, health, political, gender role, work and socio-economic factors. Keywords: self-concept, kaingin

102

Perceived Parenting Style, Temperament, and Level of Aggression of the BS Psychology Students

Angel May Regacho, Jay Ar A., Rimorin, Allilah Marish Tandang, and Marcelina H. Ayson

Abstract

This study focused on the relationship among the BS Psychology students’ parents parenting styles, temperament and their level of aggression. It made use of descriptive research design. Random sampling technique was used to determine the 192 respondents. The respondents’ level of aggression was determined through the Buss and Perry Aggression questionnaire, while their temperament was assessed through the standardized Thurstone Temperament Schedule. Their Parents’ parenting style was determined using the Parenting Styles Instrument of Danao and Gayo. Average weighted mean and the SPSS software were employed for the data analysis. Findings showed that the respondents have extreme level of temperament and their parents employ eclectic parenting style. Parents have moderate physical and verbal aggressions. Reflective female respondents tend to be physically aggressive. Furthermore, significant relationship exists between parenting style and level of aggression. Keywords: temperament, perceived parenting style, aggression Introduction Situation Analysis

Parenting styles represent the standard strategies of parents to their children. The quality of parenting is more essential than the quantity spent with the child. The effect of parenting style to child development has been interesting to psychologists. Children raised in dramatically different environments can grow up with remarkably similar personalities. Children who share the same environments can grow up

astonishingly with different personalities. Researchers have uncovered the convincing links between parenting styles and the effects of these to children. Baumrind (2007) conducted a study on more than 100 preschool-ages using the naturalistic observation and other research methods. She identified four important dimensions of parenting: authoritarian, authoritative, permissive, and uninvolved.


Positive parenting styles include maintaining a close relationship with others, being self-reliant, spending time with children, and knowing their identities. Children have different likes and dislikes. Parents will tell that methods of discipline and teaching do not work in one size that fits all manners because every child responds differently due to the fact that children have different personalities. Baumrind (2001) introduced four parenting styles. The first is, authoritarian parenting, in which children are expected to follow the strict rules established by parents, and

if the children break the rules they usually get punished. Authoritarian parents fail to explain the reason behind these rules and have high demands to their children but not responsive to their children. As a result, children are obedient and proficient but they rank lower in happiness, social competence, and self-esteem.

The second type is authoritative parenting where parents establish rules and regulations that their children are expected to follow. When children fail to meet their expectation, they are more nurturing and forgiving rather than punishing. Their disciplinary

103

methods are supportive rather than punitive. They are assertive but not intrusive and restrictive. They wanted their children to be assertive, socially responsible, self- regulated, and cooperative. Consequently the children are happy, capable, and successful (Maccoby, 2002).

The third is the permissive parenting style. Parents rarely discipline children because they have relatively low expectations of maturity and self- control. Children who rank themselves low in happiness and self-regulations experience problem in life with authority and perform poorly in school.

The fourth style is the uninvolved parenting style which is characterized by few demands, low responsiveness, and little communication. These parents fulfill the basic needs of the child. They are generally detached

from the life of the child. They may also reject and neglect the needs of their children. As a result children, lack self-control, have low self-esteem, and are less competent than their peers.

Researchers found several reasons of aggressions. The first is the culture. Berkowitz (2003) suggested that expressed aggressive action depends on the interaction of innate propensities with learned inhibitory responses and the nature of social situation.

Do temperaments of a person really affect his aggression? How he is brought up and nurtured by his parents? The paradigm (Figure 1) explains the interplay between the independent variables (temperament and type of parenting styles used by the parents’ respondents) and the dependent variable (level of aggression)

Independent Variables Dependent Variables

Statement of the Problem The study determined the temperament, parenting style of the parents of the respondents, and the level of aggression of the BS Psychology students in College of Arts and Sciences. Specifically, it sought answers to the following questions:

1. What is the temperament of the students as measured by the Thurstone Temperament Schedule?

2. What is the extent of use of the parenting style of the respondents’ parents along: 2.1 autocratic; 2.2 democratic; and 2.3 permissive parenting styles?

3. What is the respondents’ level of aggression along: Physical; and Verbal 4. Is there a significant relationship between the temperament and level of aggression of the respondents? 5. Is there a significant relationship between parenting styles of and level of aggression?

Methodology

Research design The descriptive research design was employed in this study. Descriptive research design attempts to describe the nature of the situation as it exists at the time of the study and to explore the causes of a certain phenomena. It is a purposive process of gathering, analyzing, classifying, tabulating data about prevailing conditions, practices, beliefs, trends, and cause-effect relationship (Calderon, 2011). This design is apt for the study since it aimed at determining and

describing the temperament, parenting styles, and level of aggression of the respondents. Data were gathered through standardized (Thurstone Temperament Schedule) and adapted instruments (Parenting Styles and Level of Aggression).

Data Sources The respondents were students from the BS Psychology program. The program has the biggest number of enrollees among the courses

A. TEMPERAMENT

Active

Vigorous

Stable

Sociable

Impulsive

Reflective

Dominant B. TYPES OF PARENTING

STYLES

Autocratic

Democratic

Permissive

LEVEL OF AGGRESSION

Verbal

Physical

104

offered in the College of Arts and Sciences. Its total enrolment for the first semester of the school year 2015-2016 is 371. The Lynch formula was employed to determine the actual number of respondents. There were 192 respondents. They were identified through simple random sampling technique, specifically the lottery method.

Data Collection and Analysis Data were gathered through the following instruments: Thurstone Temperament Schedule (TTS), Parenting Style, and the Level of Aggression Questionnaires.

The Thurstone Temperament Schedule (TTS) is a standardized test used to identify the respondents’ temperament (active, vigorous, impulsive, dominant, stable, sociable, and reflective).Interpretations of these dimensions were those extreme percentile scores from high to very high and from low to very low. The reliabilities of the seven areas of this schedule were computed using the spilt-half (odd-even) method (0.63). They were further estimated through the Spearman-Brown correction (0.70).The validity of the TTS was studied using

the biserial coefficients of correlation between the ratings and actual test performance. The validity coefficients ranged from 0.81 to 0.98. These indicate that behavior can be described accurately by the TTs.

To identify the parents’ parenting style, the researchers adapted the instrument from the thesis entitled “College of Sciences Academic Scholars’ Practices and their Parents’ Parenting Styles” by Eric Bonn C. Danao and Apple Mae S. Gayo (2009). This questionnaire identifies three types of parenting styles, namely: autocratic, democratic, and permissive. The researchers had their questionnaire validated by three faculty members from the Behavioral Science Department.

On the other hand, the respondents’ level of aggression was measured through The Level of Aggression Questionnaire by Perry and Buss (2004). This was content validated by some experts in the field and obtained AWM = 3.5 which is described as highly valid. These items were translated in Filipino by a Filipino language expert for better understanding by the student-respondents.

Results and Discussion Temperament of the Respondents The male respondents manifest extreme temperaments. The same percentage (4 or 11%) was obtained by the respondents under sociable and reflective. This implies that the respondents tend to enjoy the company of others, make friends easily, and are sympathetic, cooperative, and agreeable in their relations with others (sociable). However, they tend to like meditative thinking and enjoy dealing with theoretical rather than practical problems. They usually prefer to work alone with materials requiring accuracy and fine detail (reflective) based on the Thurstone Temperament Schedule Manual. On the other hand, a number of the respondents are very low in the seven dimensions. That is, 9 or 25 percent of the respondents tend not to like being “on the go.” They probably speak, walk, write, work, and eat slow even if they do not have to (active, VL). Likewise, 12 or 32 percent of them tend not to enjoy active sports requiring the use of the hands or tools, and outdoor occupations. They usually tend not to enjoy physical activities which require a lot of energy (vigorous, VL).

Moreover, 10 or 27 percent tend not to be happy-go-lucky. They probably do not like to take chances and make decisions quickly (impulsive, VL). On the dominant (VL) area, 13 or 35 percent of the respondents showed very low capacity for taking initiative and assuming responsibility. They enjoy less in organizing social activities, promoting new projects, and persuading others.

On the sociable (VL) area, 16 or 43 percent are less sociable, and they do not probably enjoy the company of others, have difficulty making friends, and are less sympathetic, uncooperative and disagreeable in their relations with others.

Finally, 8 or 21 percent tend not to like meditative thinking and do not enjoy dealing with theoretical problems; rather they prefer practical problems. They usually prefer not to work alone with materials requiring accuracy and fine detail reflective, (VL). In summary the male respondents manifest extreme temperaments from high to low. Generally, however, they tend to be more of very low temperament.

Temperament of the Female Respondents The female respondents also manifest extreme temperaments. There are 21 or 14 percent of them

who are very highly active. Meanwhile, 24 or 15 percent enjoy active sports, work requiring the use

105

of their hand or tools, and outdoor occupations (Vigorous, VH).

Moreover, 40 or 26 percent like meditative thinking and enjoy dealing with theoretical rather than practical problems. They prefer to work alone, with materials requiring accuracy and fine detail (reflective, VH). On the other hand, 44 or 28 percent of the female respondents tend not to like being “on the go.” Furthermore, 17 or 11 percent tend not to enjoy active sports requiring the use of the hands or tools, and outdoor occupations. They do not usually enjoy physical activities requiring a lot of energy (Vigorous, VL).

Moreover, 44 or 28 percent tend not to be happy-go-lucky. They probably do not like to take chances and make decisions quickly (impulsive, VL).

On the dominant (VL) area, 27 or 11 percent showed very low capacity for taking initiative and assuming responsibility. They enjoy less in organizing social activities, promoting new projects, and persuading others.

On the sociable (VL) area, 62 or 40 percent are less sociable, and they do not probably enjoy the company of others, have difficulty making friends, and are less sympathetic, uncooperative, and disagreeable in their relations with others. They have difficulty making friends and are less sympathetic, uncooperative, and disagreeable in their relations with others. The female respondents manifest extreme temperament from very low to high. Generally, females tend to have very low temperament.

Result shows that the respondents’ parents sometimes used (AWM = 1.82) the autocratic parenting style. They claimed that their parents sometimes used to force them to concentrate more in their studies because of the

credits and recognition that they will soon receive (WM = 2.08).

Likewise, the parents of the respondents sometimes impose curfew hours or time limit (WM = 1.92); and, they (parents) sometimes choose the school they (respondents) are going to enroll in (WM = 1.82). However, the respondents claimed that their parents allow them to watch TV during school days (WM = 1.51). Furthermore, parents of the respondents sometimes used (AWM = 2.17) democratic parenting style. The respondents claimed that their parents sometimes excuse them from household chores when they see that they are busy studying their lessons or doing school projects (WM = 2.19). Likewise, their parents sometimes use to offer reasonable progressive challenges and permit them to develop at their own pace (WM = 2.16). However, the respondents considered their parents to be very encouraging when they correct their mistakes and develop their potentials (WM = 2.41). Finally, the respondents’ parents also sometimes use (AWM = 1.86) the permissive parenting style. The respondents claimed that their parents sometimes allow them to decide on their studies (WM = 2.24). Their parents sometimes allow them to watch TV during school days (WM = 2.09). Likewise, their parents sometimes allow them to go to bed late at night (WM = 1.90). However, their parents never allow them to have night life with friends during weekends (WM = 1.61) but they mind if they go to school or not (WM = 1.47). Generally, the parents of the respondents sometimes use the three parenting styles (autocratic, democratic, and permissive) in rearing their children.

The Respondents’ Level of Aggression

Findings show that the respondents have moderate physical aggression (AWM = 2.07). There are indications that the respondents, to some extent, possess moderate characteristic of this aggression. They claim that they can think of no good reason for hurting another person (WM = 2.79). Although, when they are given enough provocation, they may hit another person (WM = 2.61). Moreover, compared to average persons, the respondents have less frequency of getting into fights (WM = 1.46); and, it is not their characteristic to threat people they know (WM = 1.61).

This further reveals that the respondents have, likewise, moderate verbal aggression (AWM = 2.44). Looking closely at the statements of verbal aggression, there are indications that the respondents, to some extent, possess moderate characteristic of this aggression. They claim that although they flare up quickly, they can get over it quickly as well (WM = 2.83). They may tell their friends openly when they disagree with them (WM = 2.68); and that when people annoy them, they may tell what they think of them (2.55). Likewise, the respondents think that their friends are not really argumentative (WM = 2.04).

106

Temperaments and Aggression of the Respondents Table 1 shows the correlation between the male respondents’ temperaments and their level of

aggression. Table 1 shows no significant difference between the male respondents’ temperament and their level of aggression at 0.05 level of significance. Based on this, the null hypothesis which states that the male respondents’ temperament and level of aggression have no significant correlation is accepted. This implies that the respondents’ temperaments do not influence their aggression. Table 1.Temperament and Aggression of Male Respondents

Level of Aggression Areas of Temperament

Active

Vigorous Impulsive Dominant Stable Sociable Reflective

Physical

Pearson r .323

.131

013

.263

.309

.304

-.031

Sig. (2-tailed)

.39 .736 .974 .494 .419 .426 .938

Verbal Pearson r -.486 -.616 -.554 -.374 -.584 -.758 -.705

Sig. (2-tailed)

.329 .193 .254 .466 .223 .081 .117

Temperament and Aggression of Female Respondents Table 2 shows that the females’

temperament (reflective) and levels of aggression (physical) are significantly correlated at 0.05 level of significance. Thus, the null hypothesis which states that the respondents’ temperament and level of aggression have no significant correlation

is rejected. This implies that females who are reflective tend to be physically aggressive. Females, in this study, who tend to work alone but when given enough provocation, they would hit others and would to resort to violence to protect their rights.

Table 2.Temperament and Aggression of Female Respondents

Level of Aggression Areas of Temperament

Active

Vigo-rous

Impul-sive

Dominant Stable Sociable Reflec-tive

Physical

Pearson r

.351

.400 .489 .539 .556 .660 .786*

Sig. (2-tailed)

.355

.287 .182 .134 .120 .053 .012

Verbal Pearson r

.616 .743 .331 .738 .468 .412 .270

Sig. (2-tailed)

.193 .090 .522 .094 .349 .417 .605

Table 3 shows that there is no significant

relationship between parenting styles and level of aggression. It implies that the parenting style of the respondents does not lead to the aggressive

behaviour of the child. This proves that the respondents’ parents parenting style and their level of aggression have no significant correlation

.

Correlation between Parenting Styles and Aggression of the Respondents

Table 3. Respondents’ Parents Parenting Styles and Level of Aggression

Variables

Mean

Standard Deviation

R

Sig. (2-tailed)

Parenting Styles 2.2160 .42256 -.093

.742

Aggression 1.9500 .27469

107

Conclusions The following conclusions were constructed based from the salient findings of the study: 1. The respondents have extreme temperaments (from very low to very high). 2.The parents of the respondents have eclectic parenting styles. 3. The respondents have moderate level of aggression.

4. There is a significant correlation between the female respondents’ temperament and level of aggression. 5. There is no significant correlation between

parenting style and level of aggression.

Recommendations The following are recommended based from the derived findings and conclusions: 1. A personality development program may be

considered with emphasis on improving one’s temperament along those areas which are low based on the findings of the study. The same personality development program may be forwarded to include topic managing one’s aggression so as to decrease if not eliminate it.

3. The above mentioned program may also include topics that will control, somehow, the

influence of one’s temperament with aggression in order to achieve a wholesome personality particularly females.

4. A Similar study may be conducted to include other respondents/courses in the College of Arts and Sciences.

Literature Cited Beth Greenwood, The Baumrind Theory of Parenting Styles Retrieved on http://everydaylife.globalpost.com/baumrid-theory-parenting-styles-6147.html Bernstein et, al. Essentials of Psychology. Retrieved on March11, 2015 from http://www.parentsinapinch.com/the-importance-of-temperament/ Carlsmith et, al., Type and Theories on Temperament. Retrieved on March11, 2015 from http://www.apt-nc.org/type-theories/temperament-theory/ Dr. L.L. Thurstone (1999) Thurstone Temperament Schedule David W. Keirsey, Keirsey Temperament Sorter.Retrieved on March11, 2015 from http://en.wikipedia.org /wiki/Temperament from Wikipedia, the free encyclopedia Douglas,et,al.theBottomLineRetrievedonMarch11,2015fromhttp://psychologyabout.com/o d/developmentalpsychology/a/parenting-style.html Hobbes et, al.What Is Aggression? Retrieved on March 11, 2015 from https://www.google.com.ph?gfe_rd=cr&ei=ZHAAVZC3BYyK8qEgiyd4cq&GW S_RD+ssl#q=what%20is%20aggression Immanuel Kant and Hermann Lotze, What is Temperament? - Definitions, Meaning &TypeRetrieved on March 11, 2015 from https://www.google.com.ph/?gfe_rd=cr7ei=ZHAAVZC3BYyK8QeGIYD4CQ& gws_rd=ssl#q=what%20 is %20 temperament Kendra Cherry, The Four Styles of Parenting. Retrieved on March11, 2015 from http://en.wikipedia.org/wiki/Parenting_styles Nisbett (2003), Influences On Aggression. Retrieved on March 11, 2015 From http://wps.prenhall.com/hss_aronson_socpsych_6/64/16429/4205930.cw/- /4205978 Professor Robert Gass, (2015) Argumentativeness and verbal aggressiveness. Retrieved from http://oregonstate.edu/instruct/comm 321/gwalke/VerbalAggressive.html Therose T. P. et al (March 2012). Personal values, Occupational Temperament and Abilities of the Third Year students Wiley et.al (2013) The Brief Aggression Questionnaire: Psychometric and Behavioral Evidence for an Efficient Measure of Trait Aggression

http://everydaylife.globalpost.com/baumrid-theory-parenting-styles-6147.html

http://www.parentsinapinch.com/the-importance-of-temperament/

http://www.apt-nc.org/type-theories/temperament-theory/

http://en.wikipedia.org/wiki/David_W._Keirsey

http://en.wikipedia.org/wiki/Keirsey_Temperament_Sorter

http://en.wikipedia.org/

http://psychology/

https://www.google.com.ph/?gfe_rd=cr&ei=ZHAAVZC3BYyK8qEgiyd4cq&GW

https://www.google.com.ph/?gfe_rd=cr&ei=ZHAAVZC3BYyK8qEgiyd4cq&GW

http://en.wikipedia.org/wiki/Immanuel_Kant

http://en.wikipedia.org/wiki/Hermann_Lotze

http://www.google.com.ph/

http://psychology.about.com/bio/Kendra-Cherry-17268.htm

http://oregonstate.edu/instruct/comm321/gwalker/VerbalAggressive.html

108

Level of Self-Concept and Attitude towards Work of Grape Farmers

Johaness O. Dela Peña, Rochelle J. Mamuyac, Fredalie U. Sabado and Zenaida D.C. Pascua

Abstract

Agriculture’s critical role calls for imperative attention to help farmers be more productive since they are the key workforce of the said sector. One way of doing this is to look at the relationship between their personal life and work.

Self-concept refers to how a person perceives and assesses himself. Consistent with other researchers, individuals form a self-concept around work. Findings suggest that self-concept is related to life and workplace success. Meanwhile, attitudes towards work are favorable or unfavorable reactions or tendencies regarding one’s work. This paper investigated the relationship between levels of self-concept and attitude towards work of farmers. The study was conducted among 17 grape farmers. Data were collected through Robson SCQ and Attitude towards Work Questionnaire. A significant positive relationship is established between the levels of self-concept and attitude towards work of the farmers, r = .687, p < .01. Results indicate that the level of self-concept of farmers have something to do with their attitude towards work. Keywords: family, attitude towards work, farmers, self-concept Introduction

Situation Analysis

Kaingin, a traditional upland farming, has always been condemned because of the perception that it contributes to the denudation of vast upland areas. According to Saguin (2012), kaingin, also known as ‘slash and burn’, consists of cutting and or burning of forest lands to convert to agricultural lands, pasture for livestock, or for a variety of other purposes.

Studies show that a positive self-concept is important. Hereford (n.d.) further says that if one sees himself or herself in a positive and healthy light, his/her life experiences will be positive and healthy.

There are six specific domains related to self-concept: 1)social - the ability to interact with others; 2)competence - ability to meet basic needs; 3)affection - awareness of emotional states; 4) physical - feelings about looks, health, physical condition, and overall appearance; 5) academic - success or failure in school, and 6) family - how well one functions within the family unit. So if one’s self concept is negative, probably it may influence these domains (Bracken as cited in Cherry, n.d.).

Meanwhile, the humanistic approach states that self-concept includes three components: self-worth, self-image, and ideal self.

Self-worth (or self-esteem) is what people think about themselves. Carl Rogers (1947) believed feelings of self-worth developed in early childhood and were formed from the interaction of the child with the mother and father. Self-image is about how people see themselves which is important to good psychological health. Kaingin farming is being discriminated in the society. The Philippines has a total land area of about 30 million hectares covering more than 7,100 islands. About 53 percent (15.88M hectares) of the total land area is forestland although only about 5.4M hectares have forest cover (Philippine Forestry Statistics, 2000). Kaingin farming is said to be prohibited in the Philippines because of its damage in the environment. The Philippine Forestry Development Forum (2014) said that whenever a land of the public domain is burned or the timber therein is cut or destroyed without license or permit, the actual occupant shall be presumed to have burned, cut or destroyed its timber. According to Dressler (2015), indigenous kaingin is viewed as an 'illegitimate agriculture' and as the primary cause of deforestation. He also pointed out that the state agencies continue to label and classify kaingin farmers as primitive,

109

backward, and unproductive, because they waste valuable forest resources, particularly timber.

Other people’s perspective towards farmers who are engaging in kaingin may lead towards a self-concept that is not favorable to the farmers themselves. Myers (2010) said that other people’s judgments play an important part in determining one’s self-concept. When others think well of an individual, it helps him think well of himself. On the other hand, if other people give labels to an individual, later on, these ideas tend to be incorporated into his self-concept and behavior. An individual may suffer from low self-esteem when subjected to social disapproval basically because of one’s need to belong (Leary, 2004).

Considering the importance of a positive self-concept and the societal image of kaingin farmers, the researchers decided to study the development of the self-concept of the kaingin farmers and the possible factors behind it. This study is conducted for some reasons. Kaingin farmers are viewed negatively by the society as mentioned above and in this study; the researchers are interested if this condition may have something to do with their self-concept. Results may bring about some activities that may be of help to the farmers in enhancing their self-concept and could lead toward a better outlook of oneself.

Framework of the Study Self-concept has been generally defined as the totality of a complex, organized, and dynamic system of learned beliefs, attitudes, and opinions that each person holds to be true about his or her personal existence (Purkey, 1988). Basically speaking, it is a perception of oneself. Lu Wen-Ling (2007) affirmed what Shavelson et al. said that these perceptions are developed over an individual’s experience with his or her environment. Also, the way one thinks about himself is affected by reinforcements, evaluations of significant others, and one’s attribution for one’s behavior. De Leon and Viloria (2004) also emphasized the importance of a person’s relation to his or her environment in the development of a self-concept, believing that it is not inherent.

According to De Leon and Viloria (2003), self-concept has several different components: physical, academic, social, and transpersonal. Physical self-concept relates to that which is concrete like what an individual looks like, the type of clothes he wears, what kind of house he lives in and the like. Academic aspect relates to an individual’s performance at school or how well he or she learns. The social aspect of self-concept talks about how the person relates to the supernatural or unknown.

Avelino and Sanchez (1996) claimed that self-concept is formed through interpersonal relationships. An individual’s interpersonal core evolves by having interaction with other people. The most prominent proponent of self- concept theory is Carl Rogers (1947). He viewed the self as a social outcome, created from one’s interpersonal relationships and trying hard to achieve consistency. He also described the self as the most important element in human personality as well as personal adjustment. One needs a positive regard

both from others and from oneself. He also explained that a person needs encouragement coming from an inviting environment for him or her to be able to reach self-actualization.

On the otherhand, Goffman (1969) argued that people are so focused in maintaining the impression that they are living up to the standards of others. In connection with kaingin farmers, according to articles, other people think that these farmers have not met the standards of the society because of their livelihood. These days according to DeWall (2013), kaingin farmers are dubbed as criminal agriculturists. Furthermore, people have the tendency to condemn the farmers for the destruction of upland areas. They also suffer disapproval from people who do not understand that it is their means of living. They seemed to be in an environment wherein people unjustly blame them for deforestation. In the same light, there is almost no reinforcement given to them as far as their job is concerned, because people see it as unlawful. There seems to be no encouragement from their environment as well. Their reference groups have difficulties on their cognitions as to what helps them acquire positive self-appraisal. Lastly, real, anticipated or imagined social rejection causes shame and guilt to them (DeWall, 2013).

As such, the researchers of this study wanted to find out the self-concept of kaingin farmers and the factors affecting it. To answer these problems, they administered a self-concept test, conducted interviews, and focused on group discussion. They analyzed the gathered data and came up with an objective perception of the self-concept of kaingin farmers.

110

Statement of the Problem The researchers wanted to find out the level of self-concept of kaingin farmers. Specifically, they sought answers to the following problems:

3. What is the level of self-concept of the farmers? 4. What are the factors affecting their self-concept?

Methodology Research Design A qualitative research design was used to describe and interpret the respondents’ self-concept through interviews and analysis of the gathered data. Qualitative research design was the researchers’ choice in this study because of some reasons. First, it was used to gain an understanding of underlying reasons, opinions, and motivations of the respondents. Second, it was also used to uncover trends in the thoughts and opinions of the respondents, and to dig deeper into their problems. Qualitative research design analyzed the respondents’ attitude and behavior with regard to their self-concept. Thematic analysis was used to interpret and categorize the responses of the kaingin farmers. Sources of Data

This study measured the self-concept of kaingin farmers who are currently residing in Agoo, La Union, specifically in the barangays of San Agustin East and Macalva Norte. Since the design of the study is qualitative, the researchers made use of purposive sampling. They chose specific farmers within the population to participate in the study. The researchers selected four farmers – two (2) from San Agustin East and two (2) from Macalva Norte. The researchers gathered the data during the first semester of the school year 2015-2016. Instrumentation and Data Collection

To validate if the prospective respondents fit the qualification of a kaingin farmer as defined, a preliminary interview was conducted. The researchers interviewed the farmers individually. They indirectly confirmed if they are kaingin farmers by answering questions about how they converted certain upland area into an agricultural field.

The researchers administered a self-concept test (developed by De Leon and Viloria) to the farmers. It was used to measure the level of the self-concept of the kaingin farmers. The items were presented both in Filipino and English. The self-concept test was individually administered in San Agustin East. In Macalva Norte, it was administered to the 2 respondents simultaneously.

A final interview was conducted to the farmers in order to verify their responses on the self-concept test and also to find out the factors that influenced the ascertained level of their self-concept. Before the interview, the researchers looked for the traits where each respondent is high on the self-concept test and made guide questions basing from the interpretation of high scores for each trait. Like the preliminary interview, the final interview was conducted individually. It consisted of open-ended questions. Each respondent was asked questions only on the traits where he/she scored high on the self-concept test to know if the subjective perception of his/her self-concept is consistent to their responses as observed by the researchers.

The researchers also conducted a Focus Group Discussion (FGD). They gathered the respondents together in the residence of a barangay councilor of Macalva Norte. The farmers were encouraged to participate in the conversation. The researchers served as facilitators and record-keepers. The researchers used the guide questions on the final interview. This time, they asked all the questions for each trait on the self-concept test. The flow of the discussion was directed based on the answers of the respondents. The focus group discussion was conducted to validate the farmers’ responses on the self-concept test and to find out the factors affecting their self-concept. Also, it was conducted to find out if the farmers’ responses when grouped together differ from their responses when they were interviewed individually. Analysis of Data The researchers tabulated, tallied and analyzed the results of the self-concept test to provide answers to one of the research problems. Responses on the Self-Concept Test were analyzed using frequency counts and average weighted mean (De Leon and Viloria, 2003).

The researchers recorded the interviews and the focused group discussion. They used thematic analysis the on data gathered from the final interview and from the focused group discussion to determine possible categories of factors that may have contributed to the development of self-concept of the respondents.

111


Level of Self-Concept of Farmers

The level of the self-concept of the farmers is unexpectedly high. They obtained a high rating in the following traits: self-confidence, kindness, intelligence, sociability, independence,

humor, emotional maturity, generosity, understanding attitude, personal appearance, perseverance, thoughtfulness, religious sense, courage, conscientiousness, and leadership while they are average in tactfulness and assertiveness.

Factors Affecting the Self-Concept There are factors affecting the self-concept of kaingin farmers. The factors that influence the farmers’ level of self-concept are political, social,

age, socio-economic, spiritual, gender roles, economic, health, financial, family, and work.

Conclusions

Based on the findings of the study, the following conclusions were drawn: 1. Kaingin farmers have a high level of self-concept. 2. There are factors that affect the self-concept of the farmers namely: political, social, age,

socio-economic, spiritual, gender roles, economic, health, financial, family and work. Recommendations Based on the conclusions of the study, the following recommendations are offered: 1. Since the level of self-concept of the farmers is already high, the researchers recommend it to be sustained. They proposed a seminar for the sustenance of the level of their self-concept which can be conducted by the Psychology Department as an extension activity. Since the researchers named too many factors in this study, it is recommended that future

researchers conduct a factor analysis where similar or interrelated factors can still be merged. 3. The future researchers are also encouraged to widen the scope of the study by considering other variables that are possibly related to the research. An increase in the number of the respondents is suggested for the data to be more representative of the whole population. 4 .It is recommended that future researchers be conducted to other respondents to further validate the responses.

Literature Cited Adalikwu, C. (2012). How to build self-confidence, happiness, and health. Authorhouse:

Bloomington, Indiana. Agle, B. et al. (2014). Research companion to ethical behavior in organizations. The

Lypiants.Edward Publishing Inc.: Scottland. Alimbuyugen, M. M., et al. (2009). General Sociology coursebook. Trinitas Publishing, Inc.:

Philippines. Bacon, P. A. (2010). Development of self-concept in diverse students. Retrieved on November 1,

2015 from http://www.education.com/reference/article/development-self-concept-diverse/ Baer, D. (2014). This personality predicts success, Retrieved on November 2, 2015 from http://www.businessinsider.com/conscientiousness-predicts-success 2014-4 Brown, J. (2013). 8 Reasons why you should be more independent. Retrieved on October 31,

2015 from http://addicted2success.com/life/8-important-reasons-why-you-should-be- more-independent/

Brownell, P. (2015). Spiritual competency in Psychotherapy.Library of Congress Cataloging-in- Publication Data. Springer Publishing Company, LLC

Bruneau, M. (Febuary, 2015).9 Signs of emotional maturity.Retrieved on October 30, 2015 from http://www.mindbodygreen.com.

Burton, N. (November, 2014).The secret of self-esteem. Retrieved on October 31, 2015 from https://www.psychologytoday.com

Carolan, N. (2008). Student perceptions of the senior project graduation requirement. Dissertation submitted to the graduate faculty of North Carolina State University.

Cherry K. (n.d.). What is self-concept. Retrieved on July 7, 2015 from

http://www.education.com/reference/article/development-self-concept-

http://addicted2success.com/life/8-important-reasons-why-you-should-be-

112

http://psychology.about.com Coalition against Land Grabbing & United Tribes of Palawan. (2015). Palawan: Stop Blaming

indigenous people's farming practices (kaingin) for deforestation. Retrieved on July 7, 2015 from https://intercontinentalcry.org

Del Leon, M. and Viloria M. (2003). Development of a self-concept test for the BS Psychology students of DMMMSU-SLUC.Research Study of Psychology

Deutschendorf, Harvey (2015). 7 Habits of highly persistent people. Retrieved on October 31, 2015 fromhttp://fastcompany.com/3044531/7-habits-of-highly-persistent-people

Dillon, C. (2013).The Kindness Theory. Retrieved on October 27, 2015 fromhttp://thekindnesstheory.blogspot.com/

Formica, M.J. (2008). Negative self-perception and shame. Retrieved on July 7, 2015 from https://www.psychologytoday.com

Green, R. (2009). Your self-concept and faith: How Does One Influence the Other One? Retrieved on October 31, 2015 from http://www.confidentwoman.com.au/self-concept-spirituality/2009/11/4/your-concept-of-self-and-faith-how-does-one-influence-the-ot.html

Hamm, T. (2015).The value of personal appearance. Retrieved on October 31, 2015 from http://www.thesimpledollar.com.

Hensel, D. (2008). The relationship among the health status, healthy lifestyle and Nursing self- concept among professional nurses, Retrieved on November 1, 2015 from https: // books .google.com.ph

Hereford, Z. (n.d.). Develop a healthy self-concept. Retrieved on July 7, 2015 from http://www.essentiallifeskills.net

Ladd, C. T. (2010). Building assertiveness in four steps. Retrieved on November 1, 2015 from http://psychcentral.com.

Lee, S. H. et al. (2015). Self-concept in fairness and rule establishment during a competitive game: A Game Computational Approach. Retrieved on November 1, 2015 from http://journal.frontiersin.org/article/10.3389/fpsyg.2015.01321/abstract

Martin R. A. (2010). The Psychology of humor. Elsevier: USA Matulo, A. (2011). The influence of social, political, and economic. Retrieved on November 1,

2015 from http://www.studentpulse.com/articles/554/the-influence-of social- political-economic-factors-on-the-development-and-form-of-zulu-religious-activity-in-the19th-20th-centuries

McLeod, S. A. (2008). Self-Concept. Retrieved on October 29, 2015 from www.simplypsychology.orghttp://scienceblogs.com/neurophilosophy/2009/12/17/felli ng-the-pain-of-others/

Myers, D. G. (2010). Social Psychology. McGraw Hill Companies, Inc.: New York. Ofuoku, A. (2013). Leadership effectiveness among farmer’s self-help Groups in Central

Agricultural Zone of Delta State, Nigeria and its implication for improved Agricultural Extension Service. Retrieved on November 1, 2015 from http: // www.researchgate.net

Owens, M. (2015). Four personality traits that make you an effective leader. Retrieved on November 2, 2015 from http://www.entrepreneur.com/article/245394 Philippine Forestry Statistics. (2000). Forest Management Bureau, DENR, Quezon City. Prive, T. (2012). Top ten qualities that make a great leader. Retrieved on November 1, 2015

from http://www.forbes.com/sites/tanyaprive/2012/12/19/top-10-qualities-that-make -a-great/leader/

Reardon, K. (2007). Courage as a skill. Retrieved on November 1, 2015 from http://hbr.org/2007/01/courage-as-a-skill.

Rhonheimer, M. (2011). The perspective of morality: Philosophical Foundation of Thomistic Virtue Ethics. CUA Press

Routledge, C. (2009) Is religion good for your health? Retrieved on October 31, 2015 from https://www.psychologytoday.com/blog/more-mortal/200908/is-religion-good-your- health

Saguin, M. (2012). Kaingin system in the Philippines. Retrieved on July 5, 2015 from https://prezi.com

Scott, S. R. (2009). Med Maternity and Pediatric Nursing. Library of Congress Cataloging-in- Publication Data. Williams & Wilkins at 530 Walnut street Philadelphia PA 19106

Shah, A. (2001). Political factors. Retrieved on November 1, 2015 from http://www.globalissues.org/article/133/political-factors,

Shukla, A. (2009).10 Reasons Why Personal Appearance is so Important. Retrieved on October 31, 2015 from http://www.paggu.com.

Sincero, S. M. (2012). Self-Concept Theory. Retrieved on October 29, 2015 from https://explorable.com.

Smith, C. (2014). What makes us generous. Retrieved on October 31, 2015 from https://www.bigquestionsonline.com.

http://www.simplypsychology.orghttp/scienceblogs.com/neurophilosophy/2009/12/17/felli

http://www.forbes.com/sites/tanyaprive/2012/12/19/top-10-qualities-that-

https://www.psychologytoday.com/blog/more-mortal/200908/is-religion-good-your-

113

Stets J.E and Burke P.J. (n.d.). A Sociological Approach to self and identity. Thesis submitted to the Department of Sociology Washington State University.

Swemson, D. S. (2005). Society, spirituality and the sacred, 2nd Ed. Published by Broadview press 2005. Book Publishing Industry Development program

Tardanico, S. (2013). Ten traits of courage leaders. Retrieved on November 1, 2015 from http://www.forbes.com/sites/susantardanico/2013/01/15/10-traits-of courageous

leaders/, Tyrrell, M. (2001). Key social skills. Retrieved on October 31, 2015 from http://www.self-

confidence.co.uk/articles/6-key-social-skills

http://www.self-/

114

BS MATHEMATICS

115

On Cyclic Numbers

Judy-Anne T. Elcano, Jerry O. Dulatre, Ma. Jolina Jane S. Magaro, and Ralph Vincent E. Alambra

Abstract

A cyclic number is a special kind of number that has interesting properties. It is a (p-1)-digit integer that when multiplied by 1, 2, 3, . . .(p-1), it produces the same digits in a different order or forms a cyclic permutation. Cyclic numbers are generated by the full reptend primes.

This study gave answer to the following statements: 1) Prove existing properties and theorems of cyclic numbers, 2) Come up with new properties of cyclic numbers, 3) Develop a computer program using Java to list elements of cyclic numbers, 4) Provide applications of cyclic numbers to other areas of mathematics and in real-life situations. The researchers gathered information regarding cyclic numbers: its definition, known properties, and formulas. Through further observations, they came up with propositions and theorems on cyclic numbers. They used computer tools such as online calculators for computing huge values in generating its elements and created a program in Java which lists the elements of cyclic numbers. Keywords: clock face representation, cyclic numbers, full reptend primes, Java programming, Midy’s Theorem Introduction

Situation Analysis There exists a world of mathematics out

there which when profoundly scrutinized, would be very stunning to the human mind. Mathematics can be admired for its consistency, everlasting growth, and the ties it has with all of mankind’s intellectual endeavours. In mathematics, there is an unending discovery. Mathematicians of all times have lent a lot of time in observing, computing, investigating and analyzing the results they have found in their extensive studies. When there are perceived inconsistencies, they expand the boundaries of what can and cannot be true. In mathematics, there are always mysteries. Hence, curiosity to unveil the things and reasons behind these arises. There is always an urge to search for answers to the different questions. And as people continue to discover things, they find amazement. For mathematics is not just a difficult matter like what others say and believe, but it is also a world full of fun, wonders and beauty, a world to be appreciated for its interesting revelations.

One of the branches of pure mathematics is Number Theory, also known as higher arithmetic. It is concerned with the properties of different kinds of numbers. It is one of the oldest parts of mathematics, alongside geometry, and has

been studied at least since the ancient Mesopotamians and Egyptians. Perhaps because of its purely mathematical nature, Number Theory has often been considered as a central and particularly beautiful part of mathematics. Carl Friedrich Gauss, one of the greatest theorists of all time and sometimes referred to as the “Prince of Mathematicians”, has called Mathematics the “Queen of Science” and referred to Number Theory as the "Queen of Mathematics" (Planetmath, 2004).

In mathematics, especially in Number Theory, different types of numbers are studied: even numbers, odd numbers, whole numbers, natural numbers, integers, real numbers, irrational numbers, rational numbers, prime numbers, and more. Another important type of number with interesting properties is known as cyclic number. This is a special kind of number which has interesting properties. A cyclic number is defined as an integer which has digits in cyclic permutations when the successive multiples of number are computed. If the multiples of an integer with successive numbers are calculated, then it is found that the same digits appear in each number, but in a

116

different order. This order of digits is found in cyclic or circular pattern (MathTutorCircle, nd).

Cyclic numbers are defined in the following general form (b^(p-1)-1)/p where, b = Base of the number system and p = Prime number, provided that b is not divisible by p. In mathematics, usually the decimal number system is used. Therefore in mathematics, the form for

cyclic number is (〖10〗^(p-1)-1)/p. It is not necessary that each and every prime number would yield the cyclic number. The prime numbers that provide cyclic numbers are termed as full reptend primes. The initial values of primes (from 1 to 500) which produce cyclic numbers using this form in the decimal number system are listed: 7, 17, 19, 23, 29, 47, 59, 61, 97, 109, 113, 131, 149, 167, 179, 181, 193, 223, 229, 233, 257, 263, 269, 313, 337, 367, 379, 383, 389, 419, 433, 461, 487, 491 and 499 (MathTutorcircle, nd).

It is said that the set of cyclic numbers is infinite. The first 8 cyclic numbers are 142857, 0588235294117647, 052631578947368421, 0434782608695652173913, 0344827586206896551724137931, and

0212765957446808510638297872340425531914893617, 016949152542372881355932203898305084745762711864406779661, and 016393442622950819672131147540983606557377049180327868852459 (Mathamazement, nd).

This study focused mainly on the structure and known properties of cyclic numbers. The researchers aimed to find out if there are other possible properties of the said kind of numbers, and if there is a pattern that is followed. They observed and proved these existing properties and theorems. The researchers came up with new propositions on cyclic numbers. They also created a computer program that would list the elements of the set of cyclic numbers under 10,000.

This study is another proof that

Mathematics has a lot of interesting and

wonderful things to be studied and discussed. It

encourages the students to engage in similar

works that may develop and improve their

knowledge and skills.

Statement of Objectives The main objectives of this study are to: 1) Prove existing properties and theorems on cyclic numbers. 2) Come up with new propositions on cyclic numbers. 3) Develop a computer program using Java to generate cyclic numbers. 4) Provide applications of cyclic numbers to other areas of mathematics and in real-life situations. Methodology

Research Design This study is a pure research which was

conducted solely for the purpose of theory development and refinement. The researchers started to know the meaning of cyclic numbers. They have gathered information from different sources such as Mathematics books like in Number Theory, Algebra and Calculus, and also math-related websites with the aid of the internet. They have watched some educational videos about their topic which may help them understand more of it. Definitions, properties, formulas and other important matters regarding the topic were very useful in the study. It involved many computations and calculations since the study is on numbers. The researchers went through trial and error method. They have tried to relate the

topic into different areas of Mathematics. Different methods and operations have been done. The researchers also made use of computer tools such as online calculators for computing huge values.

Sources of Data The researchers made use of the main and

mini libraries of the school (DMMMSU-SLUC) and University of the Philippines Baguio library in gathering different information. Books, magazines and journals in mathematics were also utilized. They used the internet in finding details with respect to cyclic numbers. Here, they have found videos which helped them understand the topic better.

117

Results and Findings

With further observation and analysis on related topics in Number Theory and Algebra, the following results were obtained:

1. Proofs on Existing Properties and Theorems

The researchers have given expansion to the six existing properties and theorems. They also

proposed some proofs of these properties and theorems.

These are the existing properties on cyclic numbers: 1. The cyclic numbers are always integers.

2. When a cyclic number (p-1)-digit integer is multiplied by 1, 2, 3, . . . (p-1), it 3. When cyclic numbers are multiplied by their generating prime, the result is a

string of 9s. 4. When cyclic numbers are multiplied by multiples of their generating primes

np, the resulting number shall be(n-1) + [(〖10〗^(p-1)-1) – (n-1)]. 5. When split into two, three, four or more regarding base 10, 100, 1000, . . by its digits and added, the result is a sequence of 9's. 6. The order of the digits in the successive products of cyclic number is found to

follow the cyclic or circular pattern.

2. Propositions on Cyclic Numbers Aside from the six existing properties on cyclic numbers, the researchers have

made the following propositions: 1. Cyclic numbers are always obtained from repeating decimals but not all repeating

decimals produce cyclic numbers. 2. Cyclic numbers can be formed from 1/(2n+1) where n € Ζ^+ but not all which are in the form 1/(2n+1) are cyclic numbers. 3. Cyclic numbers are always composite. 4. A cyclic number is divisible by 3.

5. A cyclic number is divisible by 9. 6. A cyclic number is divisible by 11. 7. Cyclic numbers always end in 1, 3, 7, and 9.

8. For every (p – 1)-digit cyclic number, there is also (p – 1) number of cyclic permutations.

9. Denote C_pn as a cyclic number and let n be any number. Let C_pn be a permutation of the cyclic number. For every C_pn , the multiples are given by pn – (p – n).

10. The sum of the digits of a cyclic number can be represented as 3n and 9n where n is any positive integer.

11. For any two cyclic numbers C_p and C_7 where C_7 is the smallest cyclic number, the possible greatest common divisor (gcd) of C_p and C_7 , denoted by gcd(C_p ,C_7) is either 99 or C_7 itself. Hence, 99 is a multiple of all cyclic numbers and C_7 is a multiple of some cyclic numbers.

3. Generating Cyclic Numbers The researchers, with the help of BS in Computer Sciences students, have developed a computer

program using JAVA, which lists and displays the elements of cyclic numbers generated by the full reptend primes under 10,000.

4. Application of Cyclic Numbers The clock face representation of the cyclic numbers shows an interesting pattern and symmetry that

can be used as design for any purposes such as background, lanterns and other fields where this design fits. They can also be examples of complete graphs K10 . Cyclic numbers are also related to Abstract Algebra and can be tools in recreational mathematics and in cryptography. Conclusions After an extensive research on cyclic numbers, these are the conclusions of the study:

1. The researchers have come up with their proofs on the existing properties and

118

theorems, some of which need more knowledge on Number Theory. 2. There are 11 additional propositions on cyclic numbers formulated by the researchers in this study. 3. The computer program Cyclics, created by the researchers can be utilized to aid the number theorist in identifying the cyclic numbers produced by the full reptend primes less than 10,000. 4. Cyclic numbers are applicable in creating designs due to their interesting pattern and

symmetry. These can also be related to Graph Theory since the clock face representations of the cyclic numbers form complete graphs K_10. It can also be used as material for mathematical tricks and puzzles that can give challenge and leisure time for people especially to those who love discovering things and mathematics. It is also applicable to the society, more specifically in creating numbers in bank notes, cards, passwords, PIN codes and others that make use of numbers that are difficult to generate the purpose of providing security and privacy.

Recommendations After undertaking the extensive study of cyclic numbers, the following were recommended: 1. Future researchers may look for a pattern on the full reptend primes which are used in generating cyclic numbers. Furthermore, additional properties and propositions may be formulated based on the patterns observed. 2. Future researchers may conduct a study on the following topics related to cyclic numbers: Artin’s conjecture Carmichael numbers Midy’s Theorem

Parasitic numbers 3. Future researchers may improve the program which the researchers have developed and continue listing elements of cyclic numbers from full reptend primes greater than 10,000, or they may create another program to generate cyclic numbers. 4. Future researchers may further investigate about the relation of cyclic numbers in Abstract Algebra specifically regarding units group. They may also give other applications of cyclic numbers in other fields of Mathematics. They may also develop a computer program for the Cyclic Cipher.

Literature Cited Abdul-Baki, B. (2005). Extended Midy’s Theorem(pdf). Retrieved on October 11, 2015

from http://vixra.org/pdf/1305.0081v1.pdf. Brenton, L. (2008). Remainder Wheels and Group Theory(pdf). Retrieved on January 19,

2016 from http://www.maa.org/sites/default/files/pdf/upload_library/22/Polya/ Brenton.pdf.

Chegg (n.d.). Definition of Arithmetic Sequence and Series. Retrieved on January 19, 2016 from http://www.chegg.com/homework-help/definitions/arithmetic-sequen ces-and-series-27.

De Leon, C. M. (2009). Elementary Algebra. Quezon City: JTW Corporation. Encyclopedia Britannica. (2015). Number Theory. Retrieved on February 15, 2015

from http://www.britannica.com/EBchecked/topic/422325/number -theory. Everything2. (2005). Midy’s Theorem: Fractions and Decimals and Primes. Retrieved on

October 12, 2015 from http://everything2.com/title/Midy%2527s+Theorem. Gilfeather & Del Regado. (1999). Mathematics Experience-Based Approach

Introduction: Pentathlon Institute, Inc. Hildebrand, A.J. (2011). Elementary Number Theory Definitions and Theorems(pdf).

Retrieved on February 15, 2015 from http://www.math.uiuc.edu/~hildebr/453/nt- notes-all.pdf.

Kline, J. (n.d.). A Graphical Analysis of Midy’s Theorem(pdf). Retrieved on October 12, 2015 from http://sand.truman.edu/~dgarth/klinecapstone.pdf.

Leithold, L. (1996). The Calculus 7. Singapore: Addison-Wesley Publishing Company, Inc. Lewittes, J. (2006). Midy’s Theorem for Periodic Decimals(pdf). Retrieved on October

12, 2015 from http://arxiv.org/pdf/math/0605182.pdf. Lyons, J. (2012). Caesar Cipher. Retrieved on January 21, 2016 from http://practical

cryptography.com/ciphers/caesar-cipher/. Martin, H. W. (2007). Generalizations of Midy’s Theorem on Repeating Decimals(pdf).

Retrieved on October 12, 2015 from http://www.emis.de/journals/INTEGERS/ papers/h3/h3.pdf.

Merriam, Webster. (2015). Merriam-Webster Dictionary.

http://vixra.org/pdf/1305.0081v1.pdf

http://sand.truman.edu/~dgarth/klinecapstone.pdf

http://arxiv.org/pdf/math/0605182.pdf

119

Numberphile. (2013). Cyclic Numbers [Video File]. Retrieved on February 13, 2015 from http://www.youtube.com/watch?v=WUlaUalgxql. Planetmath.org (n.d.). Cyclic number. Retrieved on January 30, 2015 from http://planettmath.org/cyclicnumber.

Samson, D. and Breetzke, P. The Beauty of Cyclic Numbers(pdf). Retrieved on February 14, 2015 from http://www.amesa.org.za/LTM%2016_2.pdf.

Scheer, B. (2009). Math 453,Section 13, Spring. Retrieved on February 14, 2015 from http://math453spring2009.wikidot.com/forum/t-144549/full-repetnd-prime.

Tappe, W. (2005). Type of Numbers. Retrieved on January 30, 2015 from http://www. mathgoodies.com/articles/numbers.html.

The Enneagram Institute. Learn the Enneagram(Introduction to the Enneagram). Retrieved on October 12, 2015 from https://www.enneagraminstitute.com/how-the- enneagram-system-works/.

The Starman’s Math Index. Repeating Decimals and Cyclic Numbers(2012). Retrieved on October 11, 2015 from http://thestarman.pcministry.com/math/rec/Repeat Dec.html.

Tutor Circle. (n d). Cyclic Numbers. Retrieved on January 30, 2015 from http://math. tutorcircle.com/number-sense-cyclic-numbers.html.

Vance, E. P. (1973). Modern Algebra and Trigonometry 3rd Edition. Mandaluyong City, Philippines: Addison-Wesley Publishing Co. Inc.

Wayne B. (2014). Cyclic numbers. Retrieved on January 30, 2015 from https://brilliant.org/discussions/thread/cyclic-numbers/.

Weisstein, E. W. (n d). Cyclic Number. Retrieved on January 30, 2015 from http:// mathworld.wolfram.com/CyclicNumber.html.

Weisstein, E. W. (n d). Complete Graph. Retrieved on January 21, 2016 from http:// mathworld.wolfram.com/CyclicNumber.html.

Wright, M. L. Cycles of Digits(pdf). Retrieved on February 14, 2015 from http://www. mrwright.org/docs/cycles.pdf.

http://planettmath.org/cyclicnumber

http://www.amesa.org.za/LTM%2016_2.pdf

http://math453spring2009.wikidot.com/forum/t-144549/full-repetnd-prime

https://brilliant.org/discussions/thread/cyclic-numbers/

120

Performance Efficiency in Research and Extension

of DMMMSU-SLUC Students

Mary Grace V. Molina, Jesabell S. Medina, Rubyrose S. Navarro, Ginalyn D. Suguitan, and Eduard M. Albay

Abstract

This study determined the performance efficiency in research and extension of the students of the colleges and institutes of DMMMSU-SLUC using Data Envelopment Analysis (DEA) during the school years 2012-2013 to 2014-2015. It also determined the following: 1) efficiency score of the colleges/institutes along research and extension; 2) peer group and weight of the colleges/institutes along research and extension; 3) virtual input and output of the colleges and institutes along research and extension, and 4) the colleges/institutes with the best practices in research and extension.

Findings showed that: all the five colleges/institutes of DMMMSU-SLUC are fully efficient in research, while 3 or 60 percent were inefficient and 2 or 40 percent were fully efficient in extension. The fully efficient colleges/institutes have their own college as their peers and weights in research. College/Institute A and B have D and E as their peers, while the peer of college/institute C is E in extension. College/institutes A, B, and C have different weights to consider form their peers. Fully efficient colleges/institutes do not have virtual inputs and virtual outputs. Only A, B, and C posted virtual inputs and virtual outputs in the extension indicator. The colleges/institutes have the best practices in research while only college/institute E had the best practices in extension. Keywords: Data Envelopment Analysis, peers and weights, performance efficiency, virtual input, virtual output Introduction Situation Analysis

Lagrada (2007), as cited by Baldemor (2010), stated that the strategic approach to quality assurance is based on developing the capacity of higher education institutions to design and deliver high quality programs to meet the needs of the country and to achieve standards comparable to those of universities in other countries with which the country competes with. The role of tertiary education institutions is viewed in different perspectives such as: (1) an institution that works for the preservation and transmission of knowledge; (2) an institution that operates as service enterprise that provides instruction, training and services in response to consumer demands; (3) a producer of human resources to satisfy the trained manpower needs of the community; and (4) an institution that provides instruction, research and public services to its consumers. DMMMSU is grounded in its dedication to fulfill its four-fold functions in terms of instruction, research, extension and production. It continues to apprehend the dynamic roles of research and extension service and community concerned in the life of the university.

The University Research and Extension Office (UREO) provides direction for the

coordination of research programs, projects and activities. The UREO acts as a staff of the University President through the office of the Vice President for Research Development and Extension (DMMMSU Research Manual, 2014).

The University Research Programs aims to help improve the quality of living of its clients. In response to global competitiveness, DMMMSU research programs are on national and regional thrusts. These thrusts are classified as export winners, basic domestic needs and other priority area.

On the other hand, the Campus Extension Unit aims to verify and disseminate appropriate technologies and information in response to the priority needs of its clients and to contribute to the development of communities in the province, region and nation (DMMMSU Extension Manual, 2014).

The extension programs of the Institute of

Agriculture focus on: Professor in the Barangay, Black Pepper Production and Training, DMMMSU-KOICA Partnership Project, Swine Artificial Insemination Project and Training, Mushroom Production and Training and Establishment of Malunggay Project.

121

The Institute of Fisheries aims for the commercialization of the following: deboned bangus (smoked and marinated), nutri-enriched noodles, nutri-enriched cantoon, calcium-enriched cookies, calcium-enriched polvoron, and seaweed chips as well as hatchery of Brackish Enhanced Saline Tilapia (BEST).

The College of Education focuses on its projects like the Adopt a Daycare Center, Adopt an Elementary School, Adopt a High School, Assist a College, DMMMSU-SLUC CE-LGU-Agoo Partnership Program, Share-A-Ware, Literacy and the Agoo Technical Vocational Education Training Center (ATVETC). Meanwhile, the College of Arts and Sciences focuses on: Adopt-An-Institution, Professor in the Barangay and technical assistance and advisory services.

On the other hand, the Institute of Community Health and Allied Medical Sciences prioritizes the BP Taking/Health Teaching, School Nursing “Health is Wealth, Adopt-An-Institution (SBFCAI) and Professor in the Barangay.

Lastly, the College of Computer Sciences focuses on: advanced computer skills development training for elementary, training for educators in the econd District of La Union and Professor in the Barangay.

The Campus Research and Extension aims to generate, verify and disseminate appropriate technologies/information responsive to the priority needs of its various clienteles. Strategies include the (1) establishment of linkages with other agencies international, national and local for possible research and extension projects and

programs collaboration and for funding, (2) strengthening research and extension income generating programs, and (3) adaptation of interdisciplinary approach in research and extension program development and implementation.

Among the key implementers of the various research and extension programs and projects of the colleges and institutes of the DMMMSU – South La Union Campus are the students. They serve as service arms in realizing the objectives of their colleges and institutes in terms of research and extension. Also, the students are contributory factors in the performance of their respective colleges and institutes in these identified functions.

Meanwhile, performance evaluation is an important part of assessment and monitoring procedures of any institution. Results of the evaluation would serve as bases in sustaining the strengths of the institution and in enhancing or improving its weaknesses. Also, evaluation opens opportunities for institutions to plan, re-plan, and redesign their existing programs and projects.

Because evaluation of performance efficiency is an integral part of assessing the strengths and weaknesses of an institution, the researchers conceptualized this study with the primary goal of assessing the performance efficiency of students of the colleges and institutes of DMMMSU-SLUC in terms of research and extension using the Data Envelopment Analysis (DEA) during the school years 2012-2013 to 2014-2015.

Statement of the Problem

The main objective of this study was to determine the efficiency of the colleges and institutes of Don Mariano Marcos Memorial State University - South La Union Campus, along research and extension using Data Envelopment Analysis (DEA).

Specifically, this study sought answer to the following questions:

1. What is the efficiency score of each college/institute along research and extension? 2. What is the peer group and weight of each college/institute along research and extension? 3. What is the virtual input and output of each college and institute along research and extension? 4. What are the colleges and institutes operating with best practices in terms of research and extension? Framework of the Study

The university supports research that lead to the innovation, integration and circulation of new knowledge which are contributory to its mission. At the same time, DMMMSU also recognizes that research is fundamentally bound to the quality of its teaching, programs, and outreach or community extension projects.

To advocate this worthwhile endeavor and to preserve integrity in the research and scholarly activities of its manpower, DMMMSU has instituted a number of policies that deliver an institute for research practice in the university.

These policies shall apply to all university research activities. For any faculty member or staff who conducts research, he/she abides to the research infrastructure, policies, procedures, standards and ethical practices of the university. The level to which the various colleges and institutes of the university adheres to the policies on research determines their efficiency.

Data Envelopment Analysis (DEA) is a relatively new “data oriented”, non-parametric approach for evaluating the performance of complex entities called Decision Making Units

122

(DMUs) which converts multiple inputs into multiple outputs. DEA as a linear programming procedure computes a comparative ratio of outputs to inputs for each DMU, which is reported as the relative efficiency score. In a relatively short period of time, DEA has grown into a powerful, quantitative, analytical tool for measuring and evaluating efficiency and has been successfully applied in many contexts worldwide. The reasons behind DEA significance and importance is that it requires minimal assumptions about how the factors of production relate to each other and assessment by DEA relates to ‘best’ or ‘efficient’ rather than average behavior.

DEA involves the use of linear programming methods to construct a non-parametric piecewise surface (or frontier) over the data (Tim Coelli, 2015).

The purpose of this paper, therefore, is to describe Data Envelopment Analysis as a new way for organizing and analyzing data and to present the applications of this methodology in information and communication technologies (Violeta Cvetkoska, 2011). Data Envelopment Analysis (DEA) has been recognized as a valuable analytical research instrument and a practical decision support tool. It has been credited for not requiring a complete specification for the functional form of the production frontier nor the distribution of inefficient deviations from the frontier. Rather, DEA requires general production and distribution assumptions only. However, if those assumptions are too weak, inefficiency levels may be systematically underestimated in small samples. In addition, invalid assumptions may cause inconsistency with a bias over the frontier. Accordingly, the ability to modify, test and select production assumptions is essential in conducting DEA-based research. Nevertheless, the DEA models currently available offer a limited variety of alternative production assumptions only.

Data Envelopment Analysis (DEA) is a very powerful service management and benchmarking technique originally developed by Charnes, Cooper and Rhodes (1978) to evaluate nonprofit and public sector organizations. DEA has since been proven to locate ways to improve service not visible with other techniques (Sherman and Zhu, 1996).

As pointed out in M. Martic, M. Novakovic, and A. Baggia (2009), the DEA can be described as data-oriented as it effects performance evaluations and other inferences directly from the observed data and with minimal assumptions. The efficiency of a Decision Making Unit (DMU) is measured relative to all other DMUs with the simple restriction that all DMUs lay on or below the extreme frontier.

A fundamental assumption behind this method is that if a given DMU, A, is a capable of producing Y (A) units of output with X (A) inputs, then other DMUs should also be able to the same if they were to operate efficiently. Similarly, if DMU B is capable of producing Y (B) units of output with X (B) units of input, then other DMUs should also be capable of the same production schedule. DMUs A, B, and others can then be combined to form a composite DMU with composite inputs and composite outputs. Since this composite DMU does not necessarily exist, it is typically called a virtual producer (Anderson, 1996 in Abay, 2013).

Because DEA evaluates relative efficiency, it will always be the case that at least one DMU will be characterized as efficient by either of the models. However, there will always be at least one point of intersection between these two frontiers. Moreover, the region of the intersection will generally expand a DMU set to be efficient with the CCR model. The greatest spread between the envelopments will then constitute extreme points that define the boundaries of the intersection between the CCR and BCC models (R.D. Banker et al.).

Charnes Cooper Rhodes (CCR) Model CCR model was developed in 1978 by

Charnes et al. It is a model which is based on the assumption of constant returns to scale. CCR model can be input or output oriented. The choice of input or output oriented models depend on the properties of Data Making Units (DMUs) in the production process. The input oriented model minimizes the utilization of inputs for a given level

of outputs. The output oriented model maximizes the production of outputs for a given level of the inputs (Emine Demet, Mecit, 2004). The concepts presented above are relevant ideas to determine the efficiency of the different colleges and institutes of DMMMSU-SLUC in terms of research and extension.

123

Methodology

Research Design The researchers utilized the descriptive-evaluative research design to determine the performance efficiency of the different colleges and institutes of Don Mariano Marcos Memorial State University - South La Union Campus along research and extension using Data Envelopment Analysis (DEA).

Source of Data The data for this study were collected from the research and extension offices of the five colleges and institutes, namely College of Art and Sciences (CAS), College of Computer Science (CCS), Institute of Agriculture (IA), Institute of Community Health and Allied Medical Sciences (ICHAMS) and Institute of Fisheries (IF) of the Don Mariano Marcos Memorial State University South La Union Campus along research and extension from school years 2012-2013 to 2014-2015. The College of Education was not included in this study because the college was not able to provide the needed data.

Data Gathering and Instrumentation The performance efficiency in research

and extension from SY 2012-2013 to SY 2014-2015 of the colleges and institutes were determined using the DEA software. A questionnaire adapted from studies of Baldemor (2010) and Albay (2013) was used to gather the data for the input and output indicators.

For research, the input variables were the number of on-going researches, number of

research staff/personnel, and number of linkages (local to international) while the output variables were the number of researches completed, number of published researches (local to international) and number of researches presented (local to international).

In extension, the input variables were the number of on-going extension projects, number of extension staff/personnel, and number of linkages. Outputs variables included the number of completed extension projects and number of clients served in the projects.

To secure ethical aspect of this study, the colleges and institutes were represented by codes, using capital letters A to E, in chapters 3 and 4 where the results of the analysis were discussed. This is to maintain utmost confidentially of the identities of the colleges and institutes. These codes were assigned by the researchers through lottery method.

Data Analysis In this study, the researchers used the Data Envelopment Analysis (DEA) software to determine the efficiency score of the different colleges and institutes of DMMMSU-SLUC along research and extension. It employed the Multi-Stage Input-Oriented Constant Returns-to-Scale-Model. The DEA software is available online which processed the data in this study and generated the efficiency scores, peers and weights, and virtual input and virtual output of the colleges and institutes.

Findings 1. One hundred percent of the five colleges and institutes or 100 percent were fully efficient in research. As to extension, 2 or 40 percent were fully efficient and 3 or 60 percent were inefficient. 2. The colleges/institutes have their own college as their peers and weights in research. On the other hand, inefficient A posted fully efficient D and E as its peers. Inefficient A needs to adapt 12.8 percent from the best practices of D and 10 percent from the best practices of E in terms of extension. The peers in extension of college/institute B are colleges/institutes D and E with weights equivalent to 39.6 percent and 8.2 percent, respectively. The peer of college/institute C is E and the weight to be adapted is 4.9 percent. 3. One hundred percent of the colleges/institutes have no virtual input and virtual output. As to extension, the virtual inputs of college/institute A

for the number of extension projects, number of students involved, and number of linkages are 81.10 percent, 81.10 percent and 87.80 percent, respectively. For college/institute B, the corresponding virtual inputs are 25.70 percent, 8.5 percent, and 66.86 percent. Moreover, college/institute C needed decrease by the following percentages: 82.14 percent in the number of extension projects, 63.04 percent in the number of students involved, and 89.29 percent in the number of extension linkages. For the virtual output, the colleges/institutes A, B, and C needed an increase in the number of completed extension programs by 579.1 percent, 456 percent, and 161 percent, respectively. 4. Colleges/institutes A, B, C, D, and E are operating with the best practices in Research. In extension, college/institute E had the best practices.

124

Conclusions

The following conclusions were made based on the findings: 1. All the colleges/institutes are fully efficient in research. Colleges/institutes D and E are fully efficient and colleges/institutes A, B, and C are inefficient. 2. The fully efficient colleges/institutes pegged their own college as their own peers and weights in research. Inefficient A has D and E, inefficient B has D and E, and inefficient C has E as their peers

in extension with various weights to be considered. 3. Fully efficient colleges/institutes have no virtual input and virtual output in research, while, inefficient colleges/institutes had varied virtual inputs and virtual outputs. 4. All colleges/institutes are operating with the best practices in Research. On one hand, only college/institute E had the best practices in Extension.

Recommendations

The following recommendations are

advanced based on the findings and conclusions of this study.

1. It is recommended that the colleges and institutes of DMMMSU-SLUC may continue implementing their current best practices in the different indicators in order to sustain their fully efficient performance. They may consider initiating innovations in their current research and extension programs. The inefficient colleges/institutes may consider re-evaluating and redesigning their extension programs and activities so that the use of their input should be minimized while pursuing to maximize their outputs. 2. The colleges and institutes may continue to evaluate their programs and project in research and extension in order to determine their strength and weaknesses. They may exert their best efforts and aspire to become reference or model for improvements by other colleges and institutes in various indicators including research and extension. 3. The colleges/institutes may review their respective virtual inputs and outputs to determine their target values and percentages of

decrease/increase in their input and outputs to maximize their efficiency in their various functions. They may consider the data in their planning of extension and research programs, projects, and activities. The colleges and institutes may adapt the best practices of the other colleges and institutes who are considered as their peers in order to sustain their efficiency or enhance their performance efficiency. Sharing of best practices among colleges and institutes is encouraged. 4. The colleges and institutes are encouraged to purposively work hard to become a reference or model of efficiency in all the performance indicators in order to be considered operating with the best practices. Administrators may exert more efforts in initiating innovations in all their projects and programs and make sure that their resources are used properly to produce the desired amount of products or outputs. 5. Future researchers may conduct similar study to validate the results of this study. They may include variables other than those included in this study. They may also consider the use of DEA in evaluating the performance efficiency of other colleges, institutions, or organizations in their research studies.

Literature Cited Albay, E. M. (2013). Performance efficiency of College of Computer Science of State

Universities and Colleges in Region I: a data envelopment analysis (DEA) study. Philippines: DMMMSU-SLUC.

Baldemor, M.R. (2010).Performance Efficiency of DMMMSU Colleges and Institutions: a data envelopment analysis (DEA) study. College of Graduate Studies, DMMMSU-SLUC

Banker, R.D., Cooper, W.W., Seiford, L.M., Thrall, R.M. and Zhu, J, Returns to scale in different DEA models, 345–362, 2004, with permission from Elsevier Science.

Coelli Tim (2015). A Data Envelopment Analysis (Computer) Program, Centre of Efficiency and Production Analysis. Department of Econometrics. University of New England

Armidale, NSW, 2351 Australia Cvetkoska, Violeta (2011), Data Envelopment Analysis Approach and its Application in

Information and Communication Technologies. Faculty of Economic. University Ss Cyril and Methodius, Skopje, Skopje, R., Macedonia

125

DMMMSU SLUC Revised Extension Manual 2014 pp. 23-24 Farlex (2015). Ineffecient. Retrieved November 3, 2015, from www.freedictionary.com

Investopedia (2012). Efficiency. Retrieved October 22, 2015 from www. Investopedia.com Macmillan (2015). Efficiency. Retrieved October 26, 2015 from

www.macmillandictionary.com Martic, M.M., Novakovic, M. S., Baggia, A. (2009). Data Envelopment Analysis- Basic

Models and their Utilization University of Belgrade, Faculty Organization Sciences Jove, Ilicia 154, 11000 Belgrade, Serbia, University of Maribor, Faculty Organization Sciences, Kidriceva cesta 55a, 4000 Kranj, Slovenia Mecit, Emine Demet (2004). A new constrained Data Envelopment Analysis approach

with Correlation Coefficients for Balanced Weight Distribution. Hacettepe University Department of Statistics 06800, Beytepe, Ankara, Turkey Seiford, L. M., (1996), Data Envelopment Analysis: The Evolution of the State of the Art

(1978-1995). The Journal of Productivity Analysis 7, 99-137 Sherman and Zhu, (1996). Data Envelopment Analysis Explained. Retrieved October 22, 2015

from www.goggle.com W.W. Cooper, L.M. Seiford and J. Zhu. Data Envelopment Analysis. Retrieved October

23, 2015 from www.researchgate.net/publication/226038831

http://www.goggle.com/

http://www.researchgate.net/publication/226038831

126

On Voronoi Diagram

John Bryan V. Serrana, Diane S. Castro, Jenica M. Rocapor, and Ronald L. Aquino

Abstract

This study focused mainly on constructing Voronoi Diagram with the aid of computer application Geogebra, proving other existing properties of Voronoi Diagram, discovering new propositions and theorems of Voronoi Diagram, and providing applications of Voronoi diagram in other areas of mathematics and in real-life. The researchers came up with the following conclusions: 1) there are six steps in constructing a Voronoi diagram using the computer application Geogebra; (2) the minimum number of bounded Voronoi region bV(r)min as Ns ≥ 4 is 1 and the maximum number of bounded Voronoi region bV(r)max as Ns ≥ 4 is Ns – 3; (3) the formula to compute for the total number of edges of Voronoi diagram is 2Ns + Nr – 3, where Ns – Nr ≥ 3; (4) the formula to compute for the total number of edges of bounded Voronoi region is Ns + 2Nr – 3, where Ns – Nr ≥ 3; (5) the formula to compute for the total number of vertices of Voronoi diagram is Ns + Nr – 2, where Ns – Nr ≥ 3; (6) the total number of edges corresponds to the total number Delaunay Edges; (7) the total number of vertices corresponds to the total number of Delaunay Faces; (8) by the used of the computer application Matlab one may generate the total number of edges and vertices of Voronoi diagram; and (9) Star Voronoi Diagram (SVD) is a Voronoi diagram with n sites such that each of the (n-1) sites is on the smallest convex hull and is equidistant to a common fixed site c. Keywords: convex hull, convex polygon, Delaunay Triangulation, Voronoi Diagram Introduction

Situation Analysis Every day, people use mathematics

although they are not aware of it. Mathematics is just all around human life. In this modern world, Mathematics is only deemed just a subject to be taught and learned but it is more than that. Many abhor mathematics, but looking at it in a perspective, people will realize its beauty. Mathematics is a world of discoveries. It embraces the subjects of arithmetic, algebra, calculus, probability, statistics, and many other special areas of research. One of the branches of pure mathematics is geometry. It deals with the deduction of the properties, measurement, and

relationships of points, lines, angles, and figures in space from their defining conditions by means of certain assumed properties of space (Meriam-Webster Dictionary, 2012).

Voronoi diagram is one of the fundamental structures of Computational Geometry. The concept is a simple but intuitively appealing one. In its definition, Let P= {p1, p2, … , pn} be a set of points in two-dimensional Euclidean plane. These are called the sites. Partition the plane by assigning every point in the plane to its nearest site. All those points assigned to pi form the Voronoi region V(r).

Fig.1. The Voronoi diagram. The red dots are the sites, and the solid black lines the boundaries of the Voronoi regions.

127

The concept and definition of the Voronoi diagram are quite straightforward. The Voronoi diagram is the result of a simple interpolation method. The definition of the Voronoi diagram is: A space containing points (sites) that is divided into regions in such a way that every location within each region is closest to the site that lies within that region compared to all other sites. The boundaries of the regions represent the locations that are equidistant from two or more sites (see Figure 1).

Voronoi Diagram has several interesting properties, (1) Each Voronoi region V(Pi) is convex, (2) V(Pi) is unbounded if and only if pi is on the convex hull of the point set, (3) If v is a Voronoi vertex at the junction of V(P1), V(P2), and V(P3), then v is the center of the circle C(v) determined by P1, P2, and P3, (4) C(v) is the circumcircle for the Delaunay triangle corresponding to v, (5) The interior of C(v) contains no sites, (6) If Pj is a nearest neighbor to

Pi, then (Pi, Pj) is an edge of D(P), (7) If there is some circle through Pi and Pj that contains no other sites, then (Pi, Pj) is an edge of D(P). The reverse also holds: For every Delaunay edge, there is some empty circle (O'Rourke, 1997).

The Voronoi diagram has been used in different fields of science since many years. According to Okabe, Boots et al. (1992), Descartes published several examples of a Voronoi diagram in his books Le monde de Mr Descartes, ou Le Traité de la Lumiere published in 1644 (but written between 1629 and 1633) and in Part lll of Principia Philosophiae, also published in 1644, Descartes uses Voronoi-like diagrams to show the disposition of matter in the solar system and its environs (see Figure 1.1). Both Dirichlet (1850) and Voronoi (1908) were one of the firsts to publish work that concerned the Voronoi diagram of which the publication is undisputed. This is the reason that the Voronoi diagram is also called the Dirichlet tessellation.

Fig.2. The disposition of matter in the Solar Systemand its environs by Descartes (S is the sun; E is a star; RQD represents the

path of a cornet; polygonal areas represent heavens)

Since the 1970's there have been many extensions and generalizations of the Voronoi diagram in many fields. Some of the more well-known generalizations are the additively/multiplicatively weighted Voronoi diagram, power diagram, Voronoi diagrams of lines, sets of points, polygons, as well as visibility-shortest-path diagrams with barriers. This research study mainly focused on constructing a Voronoi diagram with the aid of computer application Geogebra, proving other existing properties of Voronoi diagram, discovering and proving new propositions and theorems of Voronoi diagram, and providing applications of Voronoi diagram in other areas of mathematics and in real-life. Developing an algorithm to construct a Voronoi diagram on higher dimensional surfaces is not the extent of the study.

The students will use this study as basis of finding other ways of mathematical concept behind things not from just a typical math book.

It may serve as reference material for their future studies and may help them improve their knowledge and mathematical ability.

The researchers may use the study as a reference for further studies especially to those who are also interested in conducting such study related to it.

The teachers may use it as a basis in instruction. It will also serve as their guide in teaching, specifically in the field of computational geometry.

The administrators may use it as a manuscript which can be preserved as a source to be used in future affairs and in other concerns of the university.

Finally, this research study is important because it may serve as an eye opener for the readers. It would encourage them to draw in works using the concepts and applications of Voronoi Diagram.

Statement of Objectives

This study aimed to: 1. Construct a Voronoi Diagram with the aid of computer application Geogebra. 2. Prove other existing properties of Voronoi diagram. 3. Discover new propositions and theorems of Voronoi diagram. 4. Provide applications of Voronoi diagram in other areas of mathematics and in real life.

128

Methodology

Research Design The study is a pure research. The researchers constructed a Voronoi diagram with the aid of computer application Geogebra. They proved existing properties of Voronoi diagram with the use of books, journals, magazines, and the internet. Through learning and observing, the researchers discovered new properties and theorems and proved them. Also, the researchers developed an algorithm to compute for the total number of edges and vertices of Voronoi Diagram. The researchers provided applications of Voronoi diagram in other areas of mathematics and in real-life. The researchers watched videos in youtube to have better understanding about Voronoi

diagram. They conducted extensive library works to find on reliable resources like mathematics books, specifically on computational geometry.

Sources of Data The researchers used the mini library and the main library at DMMMSU-SLUC to search for important data. They also visited other libraries such as UP Baguio Library and Saint Louis University Library. For some other information of the study, they used books, journals, magazines and the internet. The researchers also consulted people who are experts in computational geometry.


Through observations on the behavior and structure of Voronoi Diagram, the following results were obtained:

1. Constructing Voronoi Diagram using Geogebra

The researchers have developed an algorithm to construct a Voronoi Diagram. The first step is to open Geogebra application, upon opening click Basic Geometry. Then, input n sites, and find the nearest neighbors of each side using circle with center through point. Connect each site with their nearest neighbors, without making a line that crosses another. Next, draw the perpendicular bisector for each Delaunay line, and find the intersection of each face of Delaunay triangle and mark it as a point. Lastly, draw the Voronoi Diagram V(P) byconnecting the intersection in each face of Delaunay triangle.

2. Proofs on Existing Properties and Theorems The researchers have given proofs to the 6 existing properties of Voronoi Diagram.

These are the existing properties of Voronoi Diagram: 1. V(Pi) is unbounded if and only if Pi is on the convex hull of the point set.

2. If v is a Voronoi vertex at the junction of V(P1), V(P2), and V(P3), then v is the center of the circle C(v) determined by P1, P2, and P3

3. C(v) is the circumcircle for the Delaunay triangle corresponding to v. 4. The interior of C(v) contains no sites.

5. If Pjis a nearest neighbor to Pi, then (Pi, Pj) is an edge of D(P). 6. If there is some circle through Pi and Pj that contains no other sites, then (Pi, Pj) is an edge of D(P). The reverse also holds: For every Delaunay edge, there is some empty circle. 3. Propositions and Theorems on Voronoi Diagram

Aside from the 6 existing properties on Voronoi Diagram, the researchers have made the following propositions:

1. The total number of Voronoi edges is equal to the total number of edges of D(P). 2. The total number of Voronoi vertices is equal to the total number of faces of D(P). Three additional theorems with a corresponding corollary were constructed and proven by the

researchers. 1. If the number of sites Ns ≥ 4, there exists a bounded Voronoi region bV(r). i) the minimum number of bounded Voronoi region bV(r)min as Ns ≥ 4 is 1. ii) the maximum number of bounded Voronoi region bV(r)max as Ns ≥ 4 is Ns – 3 2. Let Ns be the number of sites and Nr be the number of sites inside the smallest convex hull, then the total number of edges Q of Voronoi diagram V(P) is defined by: Q = 2Ns + Nr – 3, where Ns – Nr ≥ 3. Corollary 1: Let Ns be the number of sites and Nr be the number of sites inside the smallest convex hull, then the total number of edges Qn of bounded Voronoi region bV(r) is defined by: Qn = Ns + 2Nr − 3, where Ns – Nr ≥ 3.

129

3. Let Ns be the number of sites and Nr be the number of sites inside the smallest convex hull, then the total number of vertices P of Voronoi diagram V(P) is defined by: P = Ns + Nr – 2, where Ns – Nr ≥ 3. 4. Applications of Voronoi Diagrams Voronoi Diagrams have a surprisingly variety of application. It is interrelated to topics in Graph Theory specifically on Star graph and Wheel graph since the dual of Star Voronoi diagram is a Wheel graph. Voronoi Diagrams are also relevant to the community; they can be seen in amusement, plantations, and designs.

Conclusion

Based on the results obtained from the completion of the four objectives, the following conclusions were made:

1) In the construction of Voronoi Diagram using the computer application Geogebra,

2) there are eight steps to follow. 3) Six existing properties of Voronoi

Diagram have been observed and given simple proof. Through observation, one special kind of Voronoi Diagram is found and named as Star Voronoi Diagram.

4) There are 3 new theorems, 2 new properties and 1 new corollary that have

been discovered. Also, an algorithm that can generate the total number of edges and vertices of Voronoi diagram has been developed using the computer application Matlab.

5) Voronoi Diagrams are interrelated to topics in Graph Theory such as Star graph and Wheel graph. These Voronoi Diagrams are also relevant to the community, they can be seen in amusement, plantations, and designs.

Recommendations

For future research and improvements in the branch of Computational Geometry, the following recommendations are drawn from each corresponding conclusion:

1) A research can be conducted to construct a 3D Voronoi diagram using any computer

2) application other than Geogebra that can create higher dimensional surfaces.

3) 2) Future researchers may prove existing properties and theorems of Voronoi diagram in higher dimensional surfaces.

4) 3) The discovery of other noticeable properties, new propositions, and theorems of Voronoi Diagram in higher dimensional surfaces can also be studied.

5) 4) The study of the Voronoi Diagram may be applied in other areas of Mathematics and in real-life models that relates in the arts and other fields. Finding such applications could be of great contribution in the area of mathematical research.

Literature Cited Asano, Tetsuo., Katoh, Naoki. Angular Voronoi Diagram with Applications, Retrieved on

April 15, 2015 from http:// www.jaist. ac.jp/~ tasano/ papers /asano Angular Vaoronoi DiagramwithApplications.pdf.

Aurenhammer, Franz., Klein, Rolf. Voronoi Diagram, Retrieved on June 02, 2015 from http://www.pi6.fernuni-hagen.de/downloads/publ/tr198.pdf.

Beni, Leila Hashemi., Mostafavi, Mir Abolfazl., Pouliot, Jacynthe, (nd). Voronoi diagram: An adaptive spatial tessellation for processes simulation, Retrieved on April 15, 2015 from http://cdn.intechopen.com/pdfs-wm/10324.pdf.

Boots, B., (nd). Spatial Tessellations, Retrieved on September 03, 2015 from http://www.geos.ed.ac.uk/~gisteac/gis_book_abridged/files/ch36.pdf

Computational Geometry Lecture 10: Voronoi diagrams, (nd). Retrieved on May 31, 2015 from http://www.cs.uu.nl/docs/vakken/ga/slides7.pdf.

de Berg, Mark., Cheong, Otfried., Kreveld, Marc van., Overmars, Mark, (1997). Computational Geometry Algorithms and Applications Third Edition, Retrieved on September 03, 2015 from http: //yjs.j xust.cn :801/ gis/(S (ctn1zaq sp4zfsth5p0ghf30h))/uploads/ 20143403033435.pdf.

der Putte, Tom van, (n.d.). Using the discrete 3D Voronoi diagram for the modelling of 3D continuous information in geosciences, Retrieved on April 15, 2015 from https://www.google.com.ph/#q=voronoi+diagram+undergraduate+thesis.

http://www.pi6.fernuni-hagen.de/downloads/publ/tr198.pdf

http://cdn.intechopen.com/pdfs-wm/10324.pdf

http://www.geos.ed.ac.uk/~gisteac/gis_book_abridged/files/ch36.pdf

http://www.cs.uu.nl/docs/vakken/ga/slides7.pdf

130

Dickerson, Matthew., Eppstein, David., Wortman, Kevin A., (1997). Planar Voronoi Diagrams for Sums of Convex Functions, Smoothed Distance, and Dilation, Retrieved

on June 02, 2015 from http://arxiv.org/pdf/0812.0607.pdf. Dobrin, Adam. A Review Of Properties And Variations Of Voronoi Diagrams retrieved on

May 16, 2015 from https://www.whitman.edu/Documents/Academics/ Mathematics/dobrinat.pdf. Du, Qiang., Wang, Desheng. Anisotropic Centroidal Voronoi Tessellations and their

Applications, Retrieved on May 31, 2015 from http://www1.spms.ntu.edu.sg/~desheng/dwacvt.pdf. Mehlhorn, K., St. Meiser., C. O'Dunlaing. On the Construction of Abstract Voronoi

Diagrams, Retrieved on September 03, 2015 from https://people.mpi-infmpg.de/~mehlhorn/ftp/AbstractVoronoiDiagrams.pdf.

Millman, David L., Degeneracy Proof Predicates for the Additively Weighted Voronoi Diagram, Retrieved on May 16, 2015 from https: //www. cs.nyu. edu/web /Research/MsTheses/millman_david.pdf.

O'Rourke Joseph. (1997). Computational Geometry in C Second Edition, Retrieved on May 31, 2015 from http://crtl-i.com/PDF/comp_c.pdf.

Okabe, Atsuyuki., Boots, Barry., Sugihara, Kokichi., Chiu, Sung Nok, (1992). Spatial Tessellations: Concepts and Applications of Voronoi Diagrams Second Edition, Retrieved on September 03, 2015 from http:// samples. Sainsburyse books.co.uk /9780470317853_sample_384503.pdf.

Papadopoulou, Evanthia., Lee, D.T., The Min-Max Voronoi Diagram of Polygons and Applications in VLSI Manufacturing, Retrieved on March 30, 2015 from http://www.inf.usi.ch/faculty/papadopoulou/publications/isaac02.pdf

Skiena, Steven S, (2008). The Algorithm Design Manual Second Edition, Retrieved on May 31, 2015 fromhttp://sist. sysu.edu.cn/~ isslxm/DSA /textbook/ Skiena. The AlgorithmDesignManual.pdf

Skyum, Sven. A simple algorithm for computing the smallest enclosing circle, Retrieved on April 15, 2015 from http: //ojs. statsbiblioteket. dk/index.php /daimipb/ article /view File/6704/5821.

Snow, J. (1855). On the Mode of Communication of Cholera. London: John Churchill, Retrieved on March 07, 2015 from http: //www.ph.ucla.edu /epi/ snow /snow book. html.

Voronoi Diagrams retrieved on April 15, 2015 from http://www.cs.utah.edu/~suresh/compgeom/voronoi.pdf.

WolframMathWorld.com (2010) retrieved on March 30, 2015 from http://mathworld.wolfram.com/VoronoiDiagram.html.

http://arxiv.org/pdf/0812.0607.pdf

https://www.whitman.edu/Documents/Academics/

http://www1.spms.ntu.edu.sg/~desheng/dwacvt.pdf

https://people.mpi-infmpg.de/~mehlhorn/ftp/AbstractVoronoiDiagrams.pdf

https://people.mpi-infmpg.de/~mehlhorn/ftp/AbstractVoronoiDiagrams.pdf

http://crtl-i.com/PDF/comp_c.pdf

131

Miscues in Applying the Different Techniques of Integration

Myca D. Posadas, Kenneth Vincent C. Carbonell, Joan Fe V. Lagare, Edwin M. Tagudin, and Ralph Vincent E. Alambra

Abstract

This study was conducted to determine the miscues in applying different techniques of integration. An achievement test was developed to determine the common errors in the techniques of integration. The test was found satisfactorily valid and with a reliability coefficient of 0.89 considered as highly reliable. Findings revealed that the students had performed satisfactorily in applying the different techniques of integration. Miscues were identified based on the analyzed results. On integration by parts, miscues were as follows: recalling the formula for integration by parts; choosing the appropriate expression for dv; integrating dv to find the value of v; differentiating u to get the value of du; substituting the values for u and dv in the formula ∫ udv = uv − ∫ vdu; and integrating the expression ∫ vdu then simplifying for the final answer. On integration of powers of trigonometric functions, no miscue out of the seven competencies was identified. On integration of trigonometric substitution, miscues were as follows: determining the appropriate technique of integration; solving for dx and transforming the expression in terms of the trigonometric functions; and evaluating the integral containing the trigonometric functions. On integration rational function by partial fraction, miscues were as follows: determining the appropriate techniques of integration; performing long division for improper rational fractions, factoring denominators of the integrand; multiplying the least common denominator to both sides of the equation; equating coefficients and solving for the values of the numerators of each partial fraction; and solving for the integral of the partial fractions separately. Keywords: competencies, integration, miscues, performance, techniques Introduction

Situational Analysis Mathematics is very crucial that from the

commencement of the educational system, it has been integrated as a component in the curricula of every school. It is a long growing field that continues to expand as man encounters new challenges in and out of the discipline. This constancy continues to ensure even in the modern world where the construction systems now call for ability and imagination by observing and finding relationship in a real world (Fernandez et al., 2011).

Calculus is the branch of mathematics that deals with the findings and properties of derivatives and integral of functions, by methods originally based on the summation of infinitesimal difference. The two main topics are differential calculus and integral calculus.

Learning mathematics is not easy. Teachers should have high knowledge to spare for the students. Students must have the interest in learning mathematics in order for them to survive in their education purposes.

To keep up with the unchanging time, the methods of teachings and the approaches to learning have to be modernized. This century brings critical needs for the manipulative skills to handle problems generated by the technological and scientific age. One such demand is on the field of mathematics, considering that mathematics is the foundation of all sciences (Dela Cruz et al., 2006).

Framework of the study

Calculus, the electric battery, the

telephone, the steam engine, the radio- all these ground breaking innovations were hit upon by multiple inventors working parallel with no knowledge of one another (Johnson, 2010).

Mathematics instruction may assume the

function of providing students with operational commands of calculating, reasoning and

providing methods in mathematics-pure mathematics, applied mathematics or both (Soares, 2006).

Most of students have difficulty solving mathematics problems. The mere mentioning of the word “Math”, a certain fear comes out. This study aimed to determine and to estimate the students’ common miscues in applying the different techniques of integration.

132

The researchers determined the respondents’ common errors in applying the different techniques of integration. The study was conducted at the Don Mariano Marcos Memorial State University – South La Union Campus, Agoo, La Union during the second semester school year 2015-2016. The respondents were the Bachelor of

Science in Mathematics second year students. The researchers developed an achievement test which was validated by pool of experts. The respondents answered the achievement test to determine their common errors. Results were analyzed and the miscues in applying the different techniques of integration were known.

Statement of the problem

This research study aimed to determine the miscues in applying the different techniques of Integration. Specifically, it aimed to answer the following: 1. What is the performance of the BS Mathematics students in the following topics?

a. Integration by parts b. Integration of powers of trigonometric functions c. Integration by trigonometric substitution d. Integration of rational functions by partial fraction

2. What is the overall performance of the respondents in applying the different techniques of integration? 3. What are the miscues in applying the different techniques of integration? Methodology

Research Design This is essentially a descriptive research which determined the miscues in applying the different techniques of integration. The researchers developed an achievement test to determine the common miscues in applying the different techniques of integration.

Source of Data The respondents were the 30 second year Bachelor of Science in Mathematics students who took up Calculus II during the first and second semester of the school year 2015-2016 at Don Mariano Memorial State University – South La Union Campus. Instrument and Data Collection The instrument used in gathering the needed data is the achievement test constructed by the researchers. The test covered the topics in Calculus II specifically in applying different techniques of integration.

The achievement test was subjected to pilot testing by third year BS Mathematics students who finished Calculus II during the first and second semester of school year 2014-2015. Results of the given test were the major source of data for the study. The answers of the respondents described their ability in Calculus II. It determined the common miscues of the respondents regarding in their application of different techniques of integration.

Procedure The study involved the following procedures: 1.) Preparation of achievement test in different techniques of integration.

A set of questions concerning the different techniques of integration was made. It was a 56 – item questionnaire and the items were primarily derived from the questions in the book Calculus Seventh Edition by James Stewart and The Calculus 7 Third Edition by Louise Leithold. 2.) Validation of the achievement test in different techniques of integration.

The questions were validated by the experts to make sure that the answers were all true as shown in Appendix E. 3.) Conduct of the pilot testing.

The achievement test was given to the 30 third year BS Mathematics students who finished Calculus II. The students were given 90 minutes to finish the test. After checking and tallying, SPSS computed the reliability value of 0.89 which means that the prepared achievement test is reliable to use for the research study. 4.) Conduct of achievement test in different techniques of integration.

The validated achievement test was conducted to 30 BS Mathematics second year students. The students were given 90 minutes to finish the test.

5.) Verifications of answers from the students.

After the test, a series of verification followed. The answers were double– checked to ensure high reliability on the detection of miscues. In addition, key answers were validated by the calculus teachers to ensure that the key answers were correct.

6.) Identification of miscues.

Wrong answers due to wrong solution, error in calculation, and no solution on each item

133

were tallied. If 51 percent of the respondents got the wrong answer on a particular question, it was included as a miscue. Statistical Tool

The researchers used the following statistical tools in determining the common miscues in applying different techniques of integration: 1.) frequency counts to determine the

number of miscues committed by the respondents in the assessment test; 2.) ranking to denote which of the topics in Calculus II students find to be difficult and; 3.) taking the percentage to describe the distribution of the different miscues committed by the respondents. The researchers used the formula P= (f/N) x 100, where P is the percentage, f is the responses of the students and N is the total number of the students

. Results and Findings

The following results were obtained: 1. The students performed satisfactorily in the two techniques of integration namely integration by partial fractions and integration by trigonometric substitution with the mean scores 6.47 and 4.37 respectively. Furthermore, they executed a very satisfactory performance in integrating powers of trigonometric functions with the mean equal to 10.90. Lastly, the respondents have shown a fair performance in integration of rational functions by partial fractions with the mean score of 4.97. As to the variability of the scores, two techniques specifically the integration of powers of trigonometric functions and integration by trigonometric substitution have clustered distributions with the value of the standard deviation equal to 2.5146 and 1.7006 respectively. The other two techniques, integration by parts and integration of rational functions by partial fractions, were scattered around the mean with standard deviations equal to 2.5244 and 2.3 correspondingly. 2. The overall performance of the students in applying the different techniques of integration is satisfactory with a mean equal to 24.80. The scores were clustered around the mean with the standard deviation equal to 7.4018. 3. The Bachelor of Science in Mathematics students in DMMMSU – SLUC have the following miscues in applying different techniques of integration as revealed by the results of the achievement test.

3.1 On integration by parts, six out of the eight competencies are considered as miscues and they were as follows: recalling the formula for integration by parts; choosing the appropriate expression for dv; integrating dv to find the value of v; differentiating u to get the value of du; substituting the values for u and dv in the formula ∫▒udv=uv-∫▒vdu; and integrating the expression ∫▒vdu then simplifying for the final answer. 3.2 On integration of powers of trigonometric functions, no miscue out of the seven competencies was identified. 3.3 On integration of trigonometric substitution, three out of the five competencies reflected the miscues and they were as follows: determining the appropriate technique of integration; solving for dx and transforming the expression in terms of the trigonometric functions; and evaluating the integral containing the trigonometric functions. 3.4 On integration of rational function by partial fraction, six out of the seven competencies revealed the miscues of the students and they were as follows: determining the appropriate techniques of integration; performing long division for improper rational fractions, factoring denominators of the integrand; multiplying the least common denominator to both sides of the equation; equating coefficients and solving for the values of the numerators of each partial fraction; and solving for the integral of the partial fractions separately.

Conclusions In view of the forgoing, the researchers arrived at the following conclusions:

1. The performance of the students in integration by parts is considered satisfactory. This means that the students should exert more effort and study more on the topics specially in getting the derivative of u, integrating dv. On integration of powers of trigonometric

functions, the average performance is gleaned to be very satisfactory. This indicates that the students should perform more practice exercises in order to master the concepts and to improve their performance. On integration of trigonometric substitution, the average performance is satisfactory. This means that the students must put more focus in studying the different steps in solving

134

integrals which involve trigonometric substitution. On integration of rational functions by partial fractions, the average performance is fair. This suggests that students should devote more time in studying steps in the technique specially in factoring the denominator of the fractions, solving the values of the numerators A and B, and integrating each of the partial fractions separately.

2. The overall performance of the students in the applying the different techniques of integration is considered satisfactory. And the scores were clustered around the mean. In general, as revealed by their test results, students had a satisfactory performance in applying the different techniques of integration due to the miscues committed. Some of them had no perseverance in studying the different techniques of integration. Most of them

solved or computed hastily and carelessly. Hence, the wrong answers were committed. After solving the operations in the problems, most students did not even check if they have placed the appropriate signs.

3. The students committed a number of miscues in the three techniques specifically integration by parts, integration by trigonometric substitution, and integration of rational functions by partial fractions. No miscue was identified in integration of powers of trigonometric functions. In general, as revealed by results of the achievement test, students had satisfactory overall performance in applying the different techniques of integration. This is due to the miscues committed by them.Correcting or preventing the existence of these miscues will result to an improved performance.

Recommendations Based on conclusions of the study, the following are highly recommended and suggested:

1. There is a need for greater emphasis in teaching the topics which are found to be difficult for the students. Instructors must give assignments after discussion to reinforce students’ acquisition of the topics just discussed. Extra points be given to students who are solving problems in class to encourage other students to do the same.

2. Students may exert more effort in learning different methods in solving the problems to improve their performance. They may devote more time in studying mathematics to obtain high grades and do their responsibilities to do practice exercises every time in order to master the concepts.

3. Remedial activities to overcome and minimize the miscues in applying the different techniques of integration committed by the students are recommended. This will serve as a possible ways of correcting the miscues to achieve optimum learning of the topics. The use of worksheets, CAI, skill books and other instructional materials are encouraged to reinforce their learning capabilities.

4. The first step of the solutions should be mastered first before going to the more advanced and complicated phases.

5. Recalling the basic concepts that will be used first such as some topics in algebra, plane trigonometry, basic differentiation and integration formulas, and others is also recommended before discussing each of the different techniques of integration.

Literature Cited Chung, S.K. (2014). Understanding Basic Calculus. CreateSpace Independent

Publishing.: Hong Kong. Dulnuan, R. and Bautista, R. (2013). Proposed Modules in Selected Topics in Differential Calculus (Calculus II). (Unpublished Thesis) DMMMSU – SLUC. Garcia, S. and Sabado, M. (2010). The Mathematics Competencies of First Year

Students of the College of Sciences in DMMMSU. (Unpublished Thesis) DMMMSU – SLUC. Larson and Hostetler, (1987). Brief Calculus with Applications Alternate Second

Edition. D.C. Heath Leithold, L. (1996). The Calculus 7. Pearson Education Asia Pte.Ltd.: Singapore. Love, C. and Rainville, E. (1962). Differential and Integral Calculus Sixth Edition.

Macmillan Co.: New York. Mendoza, A. and Fernandez F. (2006). Mathematics Achievement of DMMMSU, College

of Sciences Freshmen. (Unpublished Thesis) DMMMSU – SLUC.

135

Spiegel, M. (1963). Schaum’s Theory and Problems of Advanced Calculus. McGraw-Hill Inc.: USA.

Stewart, J. (2012). Calculus 7th Edition. Brooks/ Cole, Cengage Learning: USA. Suguitan, V. and Suniega, L. (2009). Miscues in Solving Problems on Selected Topics in Linear Algebra. (Unpublished Thesis) DMMMSU – SLUC.

136

Development of Modules on Selected Topics in Number Theory

Rosel R. Boadilla, Marvie B. Suguitan, Suzzane P. Tablazon, and Daisy Ann A. Disu

Abstract

The modules on selected topics in Number Theory were constructed and validated to guide the students in developing and enriching their mathematical skills in the said subject matter.

Specifically, this study answered the following questions: (1) What is the content validity in terms of objectives, content, illustration, examples and exercises?; (2) What is the face validity of the developed modules on selected topics in Number Theory?; and (3) What are the suggestions, comments given by the evaluators as to content and face validity modules?

The construction of the material considered the following steps: (1) planning and organizing; (2) writing the modules’ draft; (3) writing the modules for validation; 4) validation of the developed modules in terms of objectives, content, illustration, examples and exercises; and (5) revising and writing the final modules. The content and face validity of the material were done through the evaluation of six (6) experts in the field. Weighted mean was used in computing the analysis of the data gathered. Results were tabulated and corrections and suggestions were considered in writing the final module. The content validity rating is “Highly Valid”, and the face validity is “Highly Valid”, obtained from the evaluators’ rating. As a result, the researchers recommend that this module be placed in the library as a reference for students and teachers, and that, a try-out may be done to students who will take up Number Theory to test the effectiveness and reliability of the material. Keywords: Number Theory, modules, congruences, content validity,face validity Introduction

Situation Analysis Modules help promote effective

classroom teaching and make the learning process a meaningful activity. The modules, especially in math subjects, provide practice pages for students to do math drills, quizzes and tests about their math lessons. Teachers and home schooling parents may use them to help students grasp math concepts and principles. Since there are modules available for each grade level, students may continue to use them to help retain information they learned throughout school. The use of the modules, workbooks, worksheets, self-learning kits and instructional materials is a method of teaching that offers the most available opportunities for the students to work by themselves. This method is an effective tool in knowledge acquisition and behaviour modification as advocated by psychologists and educators that have been proven by number of studies (Acosta, et.al 2002).

Number Theory, as a discipline, comprises a major part of mathematics involving mostly integers. It is one of the best subjects in mathematics as it mostly occupies the broad and

wide definition of integers. Some topics included in this subject are linear congruences, number theoretic function, order of an integer and primitive roots, indices and quadratic residues. This research was developed primarily because of scarcity of references. The mini-library of the College of Arts and Sciences (CAS) and the main library of DMMMSU-SLUC has a number of books in Number Theory, most of which are intended for graduate studies and not mainly suited for the conceptual understanding of undergraduate students. Hence, this research benefits students and teachers of Number Theory as it produces modules on the selected topics to further activate the learning experiences of these clients. The researchers have chosen this topic because they understand the hardships of students in Number Theory. They want to help guide the students to develop and enrich their mathematical skills like analyzing, performing, calculating and solving exercises in Number Theory.

137

Statement of the Problem The study dealt on developing modules on selected topics in Number Theory. Specifically, it sought answers to the following questions: 1. What is the extent of the content validity of the developed modules in terms of:

a. objectives; b. content; c. illustration/Examples; and d. exercises?

2. What is the extent of the face validity of the developed modules? 3. What are the suggestions/comments given by the evaluators as to the content and face validity of the developed modules? METHODOLOGY

Research Design The researchers focused on the development and validation of modules on selected topics in Number Theory by using descriptive-evaluative design method. It intends to develop and validate educational output so that this can be utilized.

Scope of Delimitation This study was conducted at Don Mariano Marcos Memorial State University-South La Union Campus in Agoo, La Union during the school year 2015-2016. For the study, the modules covered the following topics in Number Theory: Module I: Linear Congruences Module II: Number Theoretic Functions a. Φ (n) b. σ (n) c. ح(n) d. μ (n)

Module III: Order of an Integer and Primitive Roots

Module IV: Indices Module V: Quadratic Residues

Development of the Module

1. Planning and Organizing

The researchers gathered various reference materials and relevant facts and information to be included in every topic selected from the modules.

Each module included the following parts:

Objectives: These are specific statements about the lesson and the expected outcome from the students after finishing the lesson.

Content: This part contains discussion of definitions, theorems, and other properties related to the given topic.

Illustration/Examples: These are additional problems in the module that are solved step – by – step to further understand the topics.

Exercises: These are the problems and questions to be solved and answered by the students to enhance their skills and to attain the stated objectives. Answers for the exercises are provided, but these are compiled at the very end of the modules (Appendix F.)

2. Writing the Draft of the Lessons The researchers started writing their first draft after they have set their ideas and have written a plan/outline. The first draft is only one part of the whole writing process that leads to a finished, presentable, and a valid module. The first draft was constructed to elicit ideas for a perfect presentation, and to allow researchers to extract some content to shape and change into a finished module.

The materials consisted of five modules with different lessons in Number Theory. Module I: Linear Congruences

Module II: Number Theoretic Functions ∅ (n)

σ (n) (n) ح μ (n)

Module III: Order of an Integer and Primitive roots Module IV: Indices

Module V: Quadratic Residues

3. Writing the Modules for Validation The first drafts of the modules were

submitted to the adviser for corrections and improvement. A lot of suggestions, comments and corrections were given by the adviser for the betterment of the modules.

After incorporating all the said suggestions, comments, and corrections, the first drafts were revised and finalized for validation.

4. Validation of the Developed

Modules The content and face validity of the

module were established by seeking the help of six

138

competent experts in this field (3 validators for content and 3 validators for face).

The researchers depended on the points and arguments given by the experts in the validation of the modules.

The validators are qualified in validating the modules based from their highest attainment and their expertise in teaching mathematics.

5. Revising and Writing the Final Copies of Modules

The final revision was done after the examination and validation of the experts. The comments and suggestions were considered and incorporated in writing the final copies of the modules.

The questionnaire used in the study of Ofiaza (2010) was used by the researchers in gathering the needed data for this study. Part I refers to the content validity of modules in terms of its objectives, content, illustration, examples and exercises. Part II refers to the face validity of the modules. Experts from the different colleges of Don Mariano Marcos Memorial State University South La Union Campus served as evaluators. They provided constructive suggestions for the improvement of the modules on selected topics in Number Theory.

Data Analysis

The developed instructional material comprised of five modules in Number Theory. Every lesson had set of exercises. The set of exercises are intended to enhance the computational skills and knowledge of the students for a particular topic in Number Theory. The extent of content and face validity of the modules were tabulated in terms of the level of attainment of the criteria given in the questionnaire. Results in the evaluation of the validation were tabulated. Weighted means were used to scale the responses. The formula used in computing the results is, Formula: WM=∑▒fX/N where: WM = Weighted Means X = Validator’s Rating N = Number of criteria f = frequency

For the overall weighted means, the scales used in interpreting the data for the questions are:

Numerical value Range Verbal Description 5 4.50-5.00 Very Highly Valid (VHV) 4 3.50-4.49 Highly Valid (HV) 3 2 .50-3.49 Moderately Valid (MV) 2 1.50-2.49 Valid (V) 1 1.00-1.49 Not Valid (NV)

Results and Discussions The developed instructional material underwent content and face validation. The modules were evaluated by six experts in the field and evaluation was done per module. After the evaluation, the data gathered were tabulated and computed using weighted means. The comments and suggestions of the expert evaluators were also incorporated in the final copy of the five modules. The following are the salient findings of the research: For Module I (Linear Congruences), the average weighted mean of the evaluators’ rating on its content validity, which is inclusive of the five (5) criteria, is 4.27, which means that the content of the module is highly valid.

For Module II (Number - Theoretic Functions), the average weighted mean of the

evaluators’ rating is 4.26 which means that the content of the module is highly valid. For Module III (Order of an Integer and Primitive Roots), the average weighted mean of the evaluators rating is 4.27, which means that the content of the module is highly valid.

For Module IV (Indices), the average weighted mean of the evaluators’ rating is 4.27, which means that the content of the module is highly valid. For Module V (Quadratic Residues), the average weighted mean of the evaluators’ rating is 4.20, which means that the content of the module is highly valid. In general, the content validity of the modules had an overall average weighted mean of 4.26 which is highly valid.

139

In terms of the face validity of Module I, the evaluators gave an overall rating of 3.73, which means that the module is highly valid.

For Module II, the evaluators’ overall rating is 3.54, which means that the general appearance of the module is highly valid.

For the face validity of Module III, the evaluators’ overall rating is 3.73, which means that the appearance of the module is highly valid.

For the face validity of Module IV, the evaluators’ overall rating is 3.73, which means that the appearance of the module is highly valid.

For the face validity of Module V, the

evaluators’ overall rating is 3.73, which means that the appearance of the module is highly valid.

In general, the level of face validity of the modules had an overall average weighted mean of 3.89 which means highly valid.

Conclusions Based on the findings of the study, the researchers concluded that:

1. The extent of the content validity in terms of objectives, content, illustrations, examples and exercises is very highly

valid. It means that the modules can be

used as effective materials on the transfer

of learning. Modules covered the

objectives of each lesson and they were

represented items of the course, Number

Theory. Exercises are simple and

appropriate to the students as to the

quality of the questions and exercises.

These are also evenly distributed among

modules. The solutions are effective and

the exercises test the real abilities of the

students.

2. The face validity of the modules is

highly valid. This means that the modules

were observed to have to have proper

formatting of text, enough spacing of

words and sentences, systematic

presentation of the lessons and clear and

understandable symbols and notations.

Evaluators’ Comments and Suggestions:

1. Observe proper positioning of symbols/numbers and others. Consider as well the text formatting for each section.

2. Be consistent in the format of the equations especially in module.

3. Be clear and consistent in explanations.

Recommendations As a result of the study, the following are recommended by the researchers:

1. The modules may undergo a try – out to students who will take up Number Theory to test the effectiveness and reliability of the material.

2. Future researchers who will be conducting a similar study may use this

research as their guide and reference materials.

3. Since the modules were validated, the researchers recommend this study and it should be reproduced and be placed in the library for students’ use and references.

Literature Cited Adler A., Coury J. (1995). The Theory of Numbers.A Text and Source. Andrews, G.E. Number Theory. New York: Dover, 1994 from

http://www.mathWorld.Wolfram.com/NumberTheory.html Andrews, G.E.; Berndt, B.C.; and Rankin, R.A (Ed.), Ramanujan Revisited: Proceedings

of the Centenary Conference, University of Illinois at Urbana-Champaign, June 1-5 1987. Boston, MA: Academic Press, 1988. http: //www.mathWorld. Wolfram.com/NumberTheory.html

Anglin, W.S. The Queen of Mathematics: An Introduction to Number Theory. Dordrecht, Netherlands: Kluwer, 1995.http: //www.mathWorld.Wolfram. com/Number Theory.html

Apostol, Tom M. (1976). Introduction to Analytic Number Theory. Undergraduate Texts in Mathematics. Springer. ISBN 978-0-387-90163-3

Apostol, Tom M. (1976). An Introduction to the theory of Numbers. (Review of Hardy and Wright.) Mathematical Reviews (MathSciNet) MR0568909.American Mathematical Society.

Bach, Eric; Shalliit, Wolfgang (2008). The Fourier Transform of Functions of the greatest common divisor. Electronic Journal of Combinational Number Theory A50.

Bach, Eric; Shalliit, Jeffrey. (1996). Algorithmic Number Theory (Vol I: Efficient

http://www.mathworld.wolfram.com/NumberTheory.html

http://www.mathworld.wolfram.com/NumberTheory.html

140

Algorithms), MIT Press Series in the Foundation of Computing, Cambridge, MA. Berbon, Mervin John P. and Cruz, Christine V. (January 2012). Proposed Modules in

Selected Topics in Theory of Equations.UndergraduateThesis.DMMMSU-S LUC.Agoo, La Union. Boeyens, Jan C.A. and Levendis, Demetrius C. (2008). Number Theory and the

Periodicity of Matter. Burton. Elementary Number Theory. (1980). Allyn and Bacon, Inc: USA

Davenport, Harold; Montgomery, Hugh L. (2000).Multiplicative Number Theory. Graduate texts in mathematics 74(revised 3^rded). Springer.

Fine, Benjamin and Rosenberger, Gerhad. (2006). Number Theory an Introduction via the Distribution of Primes.

Guiliten, Irish S. and Ocon, Reshin G. (March 2011).Development and Validation of An Instructional Material in Circular Functions. UndergraduateThesis.DMMMSU-SLUC.Agoo, La Union

Long, Calvin T. (1972). Elementary Introduction to Number Theory (2nd ed.), Lexington: D.C. Health and Company, LCCN.

Pettofrezzo, Anthony J.; Byrkit, Donald R. (1970). Elements of Number Theory, Englewood Cliffs: Prentice Hall, LCCN.

Sandifer, Charles. (2007). The Early Mathematics of Leonhard Euler, MAA, ISBN 0-883 85-559-3

Schroeder, M.R. (2009). Elementary Number Theory.

141

Algorithms on 2-Factorization of Some Special Graphs

Kathlyn Joy A. Gangey, Germelyn B. Hugo, Charmaine Joy P. Peria, and Tjaart Jan B. Estrada

Abstract

This study dealt with the algorithms on 2-factorization of some special graphs. A simplified proof of Petersen’s theorem is presented, and an algorithmic approach was used. The theorem served as a guide in constructing the algorithms on 2-factorization of some special graphs, particularly complete graphs with odd vertices, complete bipartite graphs with even vertices and complete tripartite graphs. The use of GraphTex 2.0, an add-on to the Latex software, is also introduced. GraphTex was used to generate accurate drawings of all the graphs discussed in the research. Some possible applications on 2-factorization of some special graphs in real-life situations are also presented in the last portion of the discussion. In particular, applications on art and designs and in computer local area networks are presented in this paper. Keywords: algorithm, complete graph, complete bipartite graph, complete

tripartite graph, GraphTex, 2-factorization Introduction

Situation Analysis Mathematics is the science of numbers

and their operations, interrelations, combinations, generalizations, and abstractions and of space configurations and their structure, measurement, transformations, and generalizations.

Graph Theory is now a very important part of mathematics with countless applications and technology, computing of science. This field of mathematics can be applied for many issues, ranging from operational research and chemistry to genetics and linguistics, and from electrical engineering and geography to sociology and architecture.

Graphs are beneficial models of both natural and human-made structures. Graphs are used in many disciplines, including mathematics, hard sciences and social sciences. They make appearances in corporate settings, serving as useful tools into different fields.

Graph Theory concerns the relationship among lines and points. In particular, it involves the ways in which sets of points, called vertices, can be connected by lines or arcs, called edges. Graphs in this context differ from the more familiar coordinate plots that portray mathematical relations and functions.

The exploration in mathematics grew wider and wider that led the mathematicians and researchers improve everybody’s viewpoint about mathematics. They have shared their knowledge and contributed ideas. One of these inputs is the

discovery of graphs. The mathematicians, as well as the researchers tried to make this discovery broader and that led to new concepts of mathematics. Among the results in Graph Theory in the 18th century are Petersen’s results on the factors and factorizations. Petersen’s Theorem states: A graph is 2-factorable if and only if it is regular of even degree. Julius Petersen showed in 1891 that this necessary condition is also sufficient: any 2k-regular graph is 2-factorable. If a connected graph is 2k-regular and has an even number of edges, it may also be k-factored, by choosing each of the two factors to be an alternating subset of the edges of an Euler tour. This applies only to connected graphs; disconnected counterexamples include disjoint unions of odd cycles, or of copies of K2k+1 (Petersen, 1891).

Dalibor and Froncek, n.d, proved that “if each factor is a union of disjoint cycles, then it is called 2-factorization. If a 2-factor is connected, it is a spanning cycle. A 2-factorable graph must have all vertex degrees even. Complete graphs K2n are not 2-factorable. K2n-1 complete graphs are 2-factorable. By applying the same argument to each component, we may assume that G is connected and 2k-regular with vertices v1 , . . . , vn. Let C be an Eulerian circuit of G, followed in a particular direction. Define a bipartite multigraph H with vertices u1 , . . . , un and w1 , . . . , wn by including an edge ui wj for each time that vj follows vi on C. Since C enters and leaves each vertex k times, H is k-regular. By the Marriage Theorem, H has a 1-

142

factor. A 1-factor in H designates one edge “leaving” vi (incident to ui in H) and one edge “entering” vi (incident to wi in H). These edges form a 2-factor of G.” Dalibor and Froncek proved it by analyzing properties and existing results about 2-factorization.

2-factors have multiple applications in Graph Theory, Computer Graphics, and Computational Geometry. A Hamiltonian cycle is then a 2-factor, and in one sense, it is the simplest 2-factor as it is composed of a single cycle. In another sense, it may be the most difficult 2-factor to find, as one must force a single cycle. To the researchers’ knowledge, there are no efficient algorithms for finding the 2-factor in general graph. In some cases an algorithm that computes such a 2-factor is also given. One such algorithm is due to Petersen. Petersen's result establishes the existence of 2-factors in 2k-regular graphs only. Gopi and Epstein proposed an algorithm to compute 2-factors of 3-regular graphs. Their algorithm computes a perfect matching of the input graph. The edges that are not in the computed matching define a 2-factor. Diaz-Gutierrez and Gopi present two different methods to compute 2-factors of graphs of maximum degree 4.

The method consists of first computing a perfect matching on the input graph, after removing the edges in the matching from the input graph, and computing a new matching on the remaining subgraph. The 2-factor is defined by the edges in the union of both perfect matching. In all appearance, their algorithm does not work on graphs with an odd number of vertices even when these are 4-regular. In fact, there are graphs with an even number of vertices where this algorithm also fails. The second method by Diaz-Gutierrez and Gopi is called the template substitution algorithm. In this method, vertices of degree 4 are replaced by templates, constructing by six vertices, to obtain an inflated graph. A perfect matching of the inflated graph can be translated into a 2-factor of the input graph given that exactly two outside vertices of a template connect to vertices of other templates. This algorithm is efficient for 4-regular only.

The studies cited above are among the numerous applications and results published to further cultivate combinatorial processes, particularly 2-factorizations. This study aimed to provide more contributions to the area.

Statement of the Objectives

This study regarding algorithms on 2-factorization of some special graphs aimed to: 1. Show simplified proof of Petersen’s Theorem; 2. Utilize GraphTex to generate accurate drawings of 2-factorization of some special graphs; 3. Formulate algorithms in finding 2-factorization of the following special graphs:

a. Complete graph Kn, where 𝑛 =2𝑘 + 1, for some integer 𝑘, b. Complete bipartite graph of the form Kn,n, where 𝑛 = 2𝑘, for some integer 𝑘, c. Complete tripartite graph of the form Kn,n,n, for any integer 𝑛,

4. Relate 2-factorization of some special graphs in real life situations. Methodology

Research Design This study utilized the pure research design to come up with algorithms on 2-factorization of some special graphs. This study developed through extensive research to introduce new potential algorithms in Graph Theory. The researchers focused on analyzing and exploring on some special graphs like regular graphs of even degree. Also, the researchers simplified Petersen’s Theorem by dividing it into its necessity and sufficiency parts, and applying an algorithmic approach to establish the needed arguments. To strengthen the results of this study, the researchers used mathematics books, the internet, published papers and especially their knowledge in Graph Theory. Furthermore, algorithms and applications on 2-factorization of some special graphs are introduced to obtain the results of the study.

Sources of data

The concepts on algorithms on 2-factorization of some special graphs are studied through pure research. Theorems and concepts were purely researched in mathematics books, published papers and through the help of internet. The findings and concepts of this research to introduce algorithms on 2-factorization of some special graphs are used in coming up with new concepts. A theorem which was proved by Petersen J. (1891) states that “A graph is 2-factorable if and only if it is regular of even degree”. This theorem was used by the researchers as a guide for verifying if the given graphs are truly 2-factorable. Also, only simple graphs were the graphs to be studied.

143

Results and Discussions

1. On Petersen’s Theorem Petersen’s Theorem states that “A graph is 2-factorable if and only if it is regular and of even degree.”

It is very useful in determining if a graph is 2-factorable or not. The researchers’ curiosity about Petersen’s Theorem led the completion of one of the objectives of this research which was, to analyze and understand Petersen’s Theorem, and come up with a simplified proof. An algorithmic approach to the proof, aided by figures was completed by the researchers. The proof provides the readers with an easier way to understanding the Petersen’s Theorem.

2. On Using Graphtex 2.0 The researchers also utilized GraphTex in order to present accurate drawings on the 2-factors of some

special graphs. Complete graphs, complete bipartite graphs and complete tripartite graphs has been drawn and displayed. Steps on how to generate GraphTex was also presented to give knowledge and help users utilize the software application correctly.

3. On Constructing Algorithms of the Special Graphs Algorithms on 2-factorization of some special graphs are presented through examples. Special graphs

are said to be 2-factorable if the degree of every distinct vertex is even and can be factorized into 2-factor factorization.

1. Complete Graphs A complete graph is a simple undirected graph in which every pair of distinct vertices is connected

by a unique edge. Algorithm 1. Algorithm on finding the 2-factorization of K_n, where n be an odd integer.

Step 1. Label the vertices from v_1 to v_n. Step 2. Let i={1,2,3,…,(n-1)/2} Step 3. Connect {v_n to v_(n+i)} where subscripts are taken mod n from the set {1,2,3,…n} Step 4. Do this for all 1≤i≤(n-1)/2 Step 5. If i=(n-1)/2, stop and the factorization is complete.

Remarks on Complete Graphs K_n. Remark 1. For any complete graph K_n, which is 2-factorable, the number of 2-factors of complete

graphs is equal to (n-1)/2 2-factors. Remark 2. For any complete graph K_n, which is 2-factorable, the number of edges of every 2-factor

of complete graphs is equal to n.

2. Complete Bipartite Graphs A complete bipartite graph is a special kind of bipartite graph where every vertex of the first set is

connected to every vertex of the second set.

Algorithm 2. Algorithm on finding the 2-factorization of〖 K〗_(n,n), where n be an even integer.

Step 1. Let A={x_1,x_2,…〖,x〗_n } and B={y_1,y_2,…,y_n } be the independent sets of K_(n,n). Step 2. Let i=1 and j=n. Step 3. Form cycle graph C4 with vertex set {x_(i,) y_j,x_j,y_i} then connect the corresponding vertex in A to B. Step 4. If i=(n/2) stop and the factorization is complete. Otherwise, add 1 to the current value of i. Similarly, subtract 1 to the current value of j, and repeat step 3.

Remarks on Complete Bipartite Graphs K_(n,n). Remark 1. For any complete bipartite graph K_(n,n), which is 2-factorable, the number of 2-factors of complete bipartite graphs is equal to n/2 2-factors. Remark 2. For any complete bipartite graph K_(n,n), which is 2-factorable, the number of edges of every 2-factor of complete bipartite graphs is equal to 2n.

3. Complete tripartite Graphs A complete tripartite graph is the k=3 case of a complete k-partite graph. In other words, it is a

tripartite graph (a set of graph vertices decomposed into 3 disjoint sets such that no two graph vertices within the same set are adjacent) such that every vertex of each set graph vertices is adjacent to every vertex in the other two sets.

Algorithm 3. Algorithm on finding the 2-factorization of 〖 K〗_(n,n,n), where n be an odd or an even integer.

Step 1. Let i = 1 and x = 0. Step 2. Let V1 = {a_i,b_i,c_i,…,n_i}, V2={a_i^',b_i',c_i',…,n_i'}, and V3 ={a_i',b_i^'',c_i^'',…,n_i''} be the independent sets of K_(n,n,n,). Step 3. Connect vertex i of V1 to vertex i+x in V2 where x is taken mod n from the set {0,1,…,n-1}.

144

Step 4. Connect vertex i+x of V2 to vertex i+x in V3 where x is taken mod n from the set {0,1,…,n-1}. Step 5. Connect vertex i+x of V3 to vertex i in V1 where i+x is taken mod n from the set {0,1,…,n-1}. Step 6. If i=n, proceed to step 7. Otherwise, add 1 to the current value of i and repeat from step 3. Step 7. If x=n-1, stop and the factorization is complete. Otherwise, let i=1 and add 1 to the current value of x, then repeat from step 3.

Remarks on Complete Tripartite Graphs K_(n,n,n). Remark 1. For any complete tripartite graph K_(n,n,n), which is 2-factorable, the number of 2-factors of complete tripartite graphs is equal to n 2-factors. Remark 2. For any complete tripartite graph K_(n,n,n), which is 2-factorable, the number of edges of every 2-factor of complete tripartite graphs is equal to 3n.

4. On Real-Life Applications of 2-Factorizations 1. Arts and designs particularly Christmas Lanterns. Christmas lanterns can be a real life application of 2-factorization. Consider Christmas lantern that

lights with three different colors as a graph. As the first color lights up the other color will also light up after the other. Every light color is a 2-factor of it and as all its colors lightened up, completeness of the graph can be seen.

2. Local Area Network. A Local Area Network (LAN) is a group of computers and associated devices that share a common

communications line or wireless link and typically share the resources of a single processor or server within a small geographic area (for example, within an office building). Usually, the server has applications and data storage that are shared in common by multiple computer users. Consider the computers as vertices, the modem as the medium of connection of computers which we will call the edge, and the server to complete the cycle. The network administrator which is the server has the rights to access and give access to other computers to also connect with each other. Factors can be made if the server wishes to give rights to computers to access at most two computers. In this case, there could be possible 2-factorizations that will appear in networking. Suppose there are 7 personal computers that are arranged in a room. The connection of the 7 PCs maybe grouped into three ways, where in each possible grouping, all the PCs are still connected via LAN.

Conclusions Based on the results obtained from the completion of the four objectives, the following conclusions are made.

1. Theorems found in Graph Theory books that are quite complicated to read, can be simplified further with the aid of figures and an algorithmic approach. The algorithmic approach helps the reader in having a much deeper understanding of the statements in each step of the proof.

2. Graphs can be generated through the use of GraphTex 2.0, an add-on of the LaTex software. Using this computer application, users could draw and present more accurate drawings of graphs.

3. Complete graphs, complete bipartite graphs and complete tripartite graphs are

some special graphs that are 2-factorable, according to Petersen’s Theorem. 2-factorization of these special graphs, K_n where n is odd, complete bipartite graphs K_(n,n) where n is even, and complete tripartite graphs K_(n,n,n) can be found by following the algorithms. The algorithms performed are accurate and drawings can be done to verify the resulting 2-factorization.

4. Algorithms on 2-factorization of some special graphs may be applied in real-life situations. They may be used to create different arts and designs, particularly making Christmas lanterns. Local area networks may also be one of the applications of the 2-factorization.

Recommendations For future research and improvements in the branch of factorizations, the following recommendations are drawn from each of the corresponding conclusions.

1. Other theorems that are consequences of Petersen’s Theorem could be studied further if they can be proven in a simpler, algorithmic approach similar to what was presented in this research.

2. Graph Theorists and researchers involved in Graph Theory should use GraphTex to draw graphs more accurately, especially in cases where the size of the graph is large.

3. More researches on k-factorization of graphs be conducted to construct more algorithms that can be used to factor

145

graphs. The remarks for each algorithm may also be proven by future researchers.

4. Find more applications of 2-factorization, in real life problems, particularly those which require grouping of objects.

Literature Cited Akiyama, J. and Kano, M. (2007) Factors and Facorization of Graphs, Retrieved from

gorogoro.cis.ibaraki.ac.jp/web/papers/FactorGraphVer1A4.pdf last January 17, 2015 Algorithm. (2009). BusinessDictionary, The Free Dictionary, Retrieved from

http://www.businessdictionary.com/definition/algorithm.html last January 13, 2015 Chartrand, G. and Oellerman, O. (1993). Applied and Algorithmic Graph Theory.

McGraw-Hill, Inc. Chartrand, Gary, and Zhang, Ping. (2005). Introduction to Graph Theory. McGraw-Hill

Int. ed. Dalibor Froncek and Xie Yingtai (Chengdu University). (n d). A Graph Invariant and 2 –

factorizations of a graph, Retrieved from http://arxiv.org/ftp/arxiv/papers/1111/1111.0406.pdf last January 29, 2015

Gervacio, S. (2008). GraphTex 2.0: 2-D and 3-D Drawings and Graphs inTex and Latex. C & E Publishing, Inc.

Graph Factorization. (2010). Wikipedia, The Free Encyclopedia, Retrieved from http://en.wikipedia.org/wiki/graph_ factorization last January 13, 2015.

Gross, Jonathan and Yellen, Jay. (2006). Graph Theory and its Applications Second Edition. New York.

Harary, Frank (1969). Graph Theory. Addison-wesley Publishing Company, Inc. Johnsonbaugh, Richard. (2001). Discrete mathematics Fifth Edition. Prentice Hall. Leithold, L. (1996). The Calculus 7. Singapore: Addison-Wesley Publishing Company,

Inc. Matching and Independence. (n d). Graph Theory, Retrieved from

http://www.math.uiuc.edu/~kostochk/math581/Chapter2-3.pdf last January 27, 2015 Muhammad, Rashid Bin. (2012). Graph, from Algorithmic Graph Theory, Retrieved from

http://www.personal.kent.edu/~rmuhamma/ GraphTheory/My GraphTheory/defEx.html last January 24, 2015.

Pirzada, Shariefuddin and Dharwadker, Ashay. (2007). Graph Theory, Orient Longman and Universities Press of India, Retrieved from http:// www. dharwadker. org/ pirzada /applications/main.html last Janury 17, 2015

Plummer M. (2003). Graph factors and factorization. C & E Publishing, Inc. Skiena, S. (2008).The Algorithm Design Manual. Springer. Stevens, B. (n d). Pancomponented 2-Factorizations of Complete Graphs, Retrieved from

http://www.sciencedirect.com/science/article/pii/S0012365X05002670 last February 2, 2015 Wallis, W. (2007). A Beginners to Graph Theory Second Edition. New York Weisstein, E.W. (1999). Complete Graph, Retrieved from

http://mathworld.wolfram.com/html last February 12, 2016 Weisstein, E.W. (1999). Complete Bipartite Graph, Retrieved from

http://mathworld.wolfram.com/html last February 12, 2016 Yayimli, A. (2007) Graph Theory and Application: JTW Corporation.

http://www.businessdictionary.com/definition/algorithm.html%20last%20January%2013

146

On Lucky Primes and Their Application to Rivest, Shamir, and Adleman (RSA) Cryptosystem

Nialle Loui Mar T. Alcantara., Julie Ann Marie S. Cabilatazan, Jhun-Jhun A. Mayugba, and Daisy Ann A. Disu

Abstract

This research study dealt with the formulation of an algorithm in finding lucky primes while methodically testing the primality of each. New and different behaviors of lucky primes and related concepts have been explored and exploited to come up with underlying propositions that were supported by proofs made by the researchers. Using these properties, the researchers developed a computer application using the Python programming language in order to generate lucky primes up to certain limit. They tested the viability of using lucky primes as a substitute cryptovariable in a computer program that implements the RSA cryptosystem in encrypting and decrypting messages. Keywords: algorithm, cryptosystem, cryptovariable, lucky primes, Python, RSA Introduction

Situation Analysis Humans are known for their insatiable

hunger for knowledge – their curiosity. Because of this fascinating nature, humans tend to question almost anything that is occult and mysterious to them. This curiosity then pushes them to reconcile with the world of the unknown and unexpectedly come up with bizarre and out of this world experiments and theories among others. This curiosity of man to distinguish relations and connections between things motivated the development of mathematics.

Mathematics is defined as “the study of relationships among quantities, magnitudes and properties, and of the logical operations by which unknown quantities, magnitudes and properties may be deduced" (Microsoft Encarta Encyclopedia, 2009).

Number Theory, sometimes called higher arithmetic, is a branch of pure mathematics that deals with numbers itself as they are varied according to their structure and properties they convey. It is solely devoted on the study of the properties of objects made out of integers, and it is primarily focused in the study of prime numbers (Weisstein, n.d.).

The notion of lucky numbers was first introduced by Gardiner, Lazarus, Metropolis, and Ulam in a paper in 1956 which they suggested

calling its defining sieve, “the sieve of Josephus Flavius” because of the striking similarity between the counting- out game in the Josephus Problem (Weisstein, nd.).

Lucky numbers are positive integral numbers that endured after completely performing and carrying out the following series of procedures and steps: Write all odd numbers. The first odd number greater than one (1) is three (3), so disregard every third (3rd) number from the list. The first odd number greater than three (3) in the remaining set of numbers is seven (7), so strike out every seventh (7th) number. This method is done until every number where is a lucky number less than the given limit. The sieving process is continuous and can be extended until infinity. The numbers that remain are then called lucky numbers (Weisstein, n.d.). The first few lucky numbers according to the On-Line Encyclopedia of Integer Sequences [OEIS] A000959 (Sloane, n.d.) are 1, 3, 7, 9, 13, 15, 21, 25, 31, 33 ... etc. It is of an entirely different subject matter from the lucky numbers of Euler.

Lucky primes, on the other hand, are lucky numbers that are also prime numbers. In a sense, such numbers are said to be doubly "lucky" because they survived two different sieves: the sieve of Eratosthenes and the sieve of lucky

147

numbers. Listed in A031157 of the OEIS (Sloane, n.d.), are the first few lucky primes: 3, 7, 13, 31, 37, 43, 67, 73, 79, 127, 151, 163, 193 ... etc. As of the present time, no further advancement in the study of lucky numbers and lucky primes has been made and published.

Mathematical theory and computer science practice became the bases of modern cryptography. One type of cryptography that relies heavily on such mathematical theories is the so-called Public-Key Cryptography [PKC]. According to Hellman and Diffie (1976), Public-Key Cryptography is a two-key cryptosystem that involves the secure communication of two parties over a non-secure line without having to share a secret key (as cited in Kessler, 2015). PKC is dependent on the existence of so-called one-way mathematical functions that are easy to compute while their inverse function is relatively difficult to perform (Kessler, 2015). For example, multiplication of two integers is easier to accomplish than doing the inverse operation which is factorization. Also, calculating a number raised to an exponent is less difficult than carrying out the inverse operation on logarithms.

The internet promotes the sharing of data wherever and whenever it is needed. The nature of

these data ranges from general information, research articles, and private and sensitive information which include credit card numbers, home addresses, contact information, and even social media account passwords. In order to keep this information safe against possible interception from malicious third parties, the implementation of the public-key cryptosystem such as the RSA cryptosystem is used.

With the curiosity and will to know why such numbers dubbed as lucky has scarcely been researched and studied in a field where number sets are the favorite area of concern, this study is then centered on establishing a different algorithm in finding lucky primes. Moreover, it also explored and analyzed the different prime number generating formulas and techniques and the different properties and underlying behaviors exhibited by the said number set. In addition, a computer application was developed that generates a list of lucky primes up to a given limit. This study also looked at the implementation of lucky primes as a viable substitute on prime numbers as the main component in producing the two different keys in a Public-key Cryptography – public and private keys and then subsequently using it in the RSA cryptosystem.

Objectives of the Study

This study aimed to analyze and expound the properties of lucky numbers particularly those of lucky primes. The following were the main objectives:

1. To formulate an algorithm specifically for finding lucky primes. 2. To observe the different behaviors of lucky primes and come up with underlying propositions. 3. To develop a computer application using Python programming language that will generate lucky

primes up to a certain limit. 4. To generate a new cryptovariable using lucky primes as a substitute, and implement it in the RSA

cryptosystem computer program developed using the Python programming language. Methodology Research Design

The study utilized a descriptive research method, specifically that of pure research design to analyze and explore lucky numbers (particularly lucky primes), and the prevailing algorithm, theorems, and propositions to generate them. Also, included in the study are the lingering and noteworthy relationships between lucky numbers and prime numbers and the striking similarity between the sieve of Eratosthenes and the sieve used in producing lucky numbers. Results therein were amalgamated to develop a novel computer application that will generate lucky primes. The different observable properties and notable numerical evidences regarding that of lucky primes will then be used and implemented in producing a new set of keys – public and private and use it as a viable substitute to the commonly used prime numbers in the Rivest, Shamir, and Adleman (RSA) Cryptosystem. To reinforce the results of this study, the researchers used mathematics books, published papers, the

internet, and especially their knowledge in the field of Number Theory. Furthermore, the introduction of the different algorithms between the two sieves coupled with the creation of the said computer program has been employed to obtain the results of the study.

Sources of Data

The concepts on the analysis of lucky primes and the development of the computer program that generates them have been studied through pure research. Theorems and conceptual definitions of terms have been purely searched from mathematics books, published papers related to the study, and through the help of the internet. The fortitude and knowledge of the researchers including the concepts involved in this research to analyze lucky primes have been used in coming up with new concepts and a fully functional computer program that will generate a string of lucky primes and use those numbers as a substitute to the ordinary prime numbers used as

148

a cryptovariable in the Rivest, Shamir, and Adleman (RSA) Cryptosystem.


Algorithm for Finding Lucky Primes

Theorem 1:

Subsequently, write The algorithm is as follows:

1. Consider the set of lucky numbers 2. Choose p, q, k to get x such that x is a nonprime and p, q, k satisfy the condition in Theorem 1. 3. After determining and , sieve out the nonprimes in in the form of

Repeat Step 2 until all nonprimes were sieved out in the set, giving only the list of lucky primes.

Formulated Propositions A. Form

Proposition/s: 1. All lucky numbers can be written in the form values of for some values of a, where

a is a non-negative integer. 2. Not all numbers that can be written in the form or for some values of, where is a non-negative integer,

are lucky numbers. 3. All lucky primes with the exception of the first lucky prime, are only in the form of for some values

of, where is a non-negative integer. 4. Not all prime numbers that can be written in the form for some values of, where is a non-negative

integer, are lucky primes. B. Gap

The following are observed properties based on numerical evidences made by the researchers:

A. Frequency of the Lucky Prime Gaps 1. The lower the value of the gap, the more frequent it might occur on the set of lucky primes.

Furthermore, the higher the value of the gap, the less frequent it might occur on the said set. The exception to this is the lucky prime gap 4 which only occurs once.

149

B. Density Density and Counting Function of Lucky Primes. The average spacing of lucky primes can be found

using , and the lucky prime-counting function is approximately Observations Regarding Density:

1. The probability of getting a lucky prime from the list of prime numbers in the form of 6a + 1, gets smaller and smaller as the sample size gets larger. Thus, the existence of lucky primes gets rarer and rarer as the sample size gets larger.

2. The probability of randomly choosing a lucky prime from the list of all prime numbers is drastically lower than the probability of randomly choosing a lucky prime from the list of primes of the form 6a + 1.

C. Addition of Lucky Primes. The sum of two lucky primes is always even.

1.1. The sum of any two lucky primes with the exception of 3, will always yield an even number x = 2 (mod 6). 1.2. The sum of the first lucky prime 3, and any other lucky prime will yield an even number, x = 4 (mod 6).

D. Multiplication of Lucky Primes. The product of two lucky primes is always an odd number.

1.1. The product of any two lucky primes (with the exception of 3), will always yield an odd number, x = 1 (mod 6). 1.2. The product of the first lucky prime 3, and any other lucky prime will yield an odd number, x = 3 (mod 6).

Generating a New Cryptovariable Creating a cryptovariable, or a key in common term, is the most important part in cryptography.

Presented below is the algorithm in finding the key pair necessary for the RSA Cryptosystem to function. Algorithm in Finding the RSA Public/Private Key Pair

The key-pair used for the RSA cryptosystem cited from Kaliski (n.d.) can be generated by the following steps:

1. Generate a pair of large, random primes p and q. 2. Compute the modulus n such that n = p * q. 3. Select an odd public exponent between 3 and n – 1 that is relatively prime to p – 1 and q – 1. 4. Compute the private exponent d from e and p and q. 5. Output n, e as the public key and n, d as the private key. Lucky Primes as a Substitute Cryptovariable Generating a pair of large, random primes is the basis of the public and private key that makes the

RSA cryptosystem work. Using this line of thought, the researchers have tried to implement a rather specific type of prime number – that is, the lucky primes – as a substitute to normal primes in the generation of the key pair as a new cryptovariable.

However, the researchers have not yet found an optimal and efficient way of finding randomly large “true” lucky primes. As such, using the results of this research, they have discovered a way to generate “pseudo” lucky primes instead.

Application of Lucky Primes in the RSA Cryptosystem With the use of properties and observations about lucky primes, the researchers were able to develop

a computer application using the Python programming language. Two specific programs were created. The first one is the Lucky Prime Generator that generates lucky primes up to a certain limit and, the RSA Cryptosystem that produces a set of public and private keys using pseudo lucky primes in order to perform the encryption and decryption of messages.

150

Conclusions

This research offered the following

conclusions: 1. Lucky primes can be generated using a

linear sieve algorithm that involves the set of lucky numbers. This algorithm was created based on an existing study on finding prime numbers. The researchers made sure that using the algorithm, the primes that are being sieved are indeed lucky primes.

2. The behaviors of lucky primes were extensively analyzed. Formulated propositions about these numbers were stated and then subsequently proven. Such propositions were outlined as to form, gap, density, frequency of lucky prime gaps, and other observable properties. A new set of equations were also presented using numerical evidences as the major basis.

3. Amalgamating the results of the study, the researchers have successfully developed a computer application that

can generate a list of lucky primes up to a given limit. This computer application was created using the Python programming language.

4. The usage of lucky primes as a viable cryptovariable substitute in the Rivest, Shamir, and Adleman (RSA) cryptosystem is, as of the moment, still in its developmental stage. Due to the time-contraints and lack of enough bases to randomly generate “true” lucky primes as a key substitute in the developed RSA Cryptosystem program, the researchers were only able to produce what seem to be “pseudo” lucky primes. Using these pseudo-lucky primes in the encryption and decryption process still bore positive and fruitful outcomes. Having a more efficient and optimal way of randomly generating “true” lucky primes requires more high-end computers and more extensive researches about the topic.

5. Recommendations

Based on the extensive study of lucky

primes, the following are recommended: 1. A research can be conducted to develop a

“luckiness test” that will classify if a number is lucky or unlucky without it undergoing the full sieving process. Furthermore, it is also encouraged to establish other properties of lucky primes such that it will be easier to find them without the need of a sieve.

2. The discovery of other noticeable properties and behaviors between lucky primes and prime numbers in the following areas of concern can also be studied. a. Twin Primes and Twin Lucky Primes b. Goldbach Conjecture and Lucky Prime

Goldbach Conjecture c. Prime Number Theorem d. Infinitude of Lucky Primes

3. The different equations regarding the density of lucky primes can be improved by

increasing the limit size of the numerical evidences to be used. It is therefore recommended that future researchers will further develop an equation in finding the mean density of lucky primes using either numerical evidences and/or other mathematical approaches.

4.Studies on composite lucky numbers can also be made analogous to the procedures done in this research. 5.The development of a computer application that can find the lucky prime in a list

of generated lucky prime numbers can be done using high-end computers with an appropriate computer programming language.

6. The development of a program which will generate random “true” lucky primes

and use it instead of “pseudo” lucky primes that will help in the further advancement of lucky primes as viable substitute in the key making process of the RSA cryptosystem can be carried out by other researchers.

7. Future researchers may use a different number base other than the base 10

(decimal numbers) in the conversion of letters to numbers using the American Standard Code for Information Interchange (ASCII) in the RSA cryptosystem computer program.

8. The study of lucky numbers and lucky primes may be applied in other ways like

real life models that relate in the arts and other fields. Finding such applications could be of great contribution in the area of mathematical research.

151

Literature Cited ASCII. (2016) In Merrian-Webster Dictionary Mobile Application (version 3.1.2) Anderson, J.T. & Stanley Ogilvy, C. (1966). Excursions in Number Theory (p. 101). New

York City. Dover Publications, Inc. Ashbacher, C. (1996). Collection of Problems on Smarandache Notions (pp. 51-54).

USA. Erhus University Press. Baker, G. (2013). Solving Recurrence Relations. Retrieved July 4, 2015 from

https://www.cs.sfu.ca/~ggbaker/zju/math/recurrence.html. Bali, N.P. (2010) Golden Algebra (1st ed.) (p. 205). New Delhi. Laxmi Publications Pvt.

Ltd. Cazelais, G. n.d. Numerical Examples of RSA. Retrieved November 15, 2015 from

http://pages.pacificcoast.net/~cazelais/222/rsa-example.pdf Clapham, C., & Nicholson, J. (2009). The Concise Oxford Dictionary of Mathematics

(4th ed.). Oxford University Press. Decryption. (n.d.). Retrieved March 22, 2015, from

https://ssd.eff.org/en/glossary/decrypt Density. (n.d.). Retrieved March 18, 2016, from https://oeis.org/wiki/Density

Encryption. (n.d.). Retrieved March 22, 2015, from https://ssd.eff.org /en/ glossary/encryption Friberg, J. (2004). Methods and traditions of Babylonian mathematics. Plimpton 322,

Pythagorean triples, and the Babylonian triangle parameter equations. Historia Mathematica,Volume 8 (Issue Number 3), 277-318. Retrieved March 15, 2015, from http://www.sciencedirect.com/science/article/pii/0315086081900690

General Python FAQ. (n.d.). Retrieved March 15, 2015, from https://docs.python.org/3/faq/general.html#what-is-python

Gries, D. et. al., (1978). A Linear Sieve Algorithm for Finding Prime Numbers. Retrieved September 30, 2015 from http://www.cs.utexas.edu /users/misra/ scanned Pdf.dir/linearSieve.pdf

Halterman, R. L. (2011). Learning to Program with Python. Retrieved January 14, 2016 from https://www.cs.uky.edu/~keen/115/Haltermanpythonbook.pdf

Havil, J. (2009). Gamma: Exploring Euler's Constant (p. 171). Princeton University Press.

Hawkins, D. (1958). The random sieve. Retrieved September 9, 2015 from http://diyhpl.us/~bryan/papers2/paperbot/The%20Random%20Sieve.pdf. 72

Joseph, G. (1991). The Crest of the Peacock: Non-European Roots of Mathematics (3rd ed., pp. 140-148). Princeton University Press.

Kessler, G. (2015). An Overview of Cryptography. Handbook on Local Area Networks. Retrieved March 22, 2015, from http://www.garykessler.net/library/crypto.html

Mathematics. (2009) In Microsoft Encarta (version 2.1) [software]. Redmond, WA: Microsoft Corporation.

Neff, J. (n.d.) Prime Gaps. Retrieved on November 5, 2015 from http://wstein.org/edu/2010/414/projects/neff.pdf

Rosen, K. H. (1986) Elementary Number Theory. USA. Addison-Wesley Publishing Company.

Sabbir, Rafiul. (2013, April 28). Sieve of Eratosthenes: The Python way. Retrieved January 18, 2016 from https://iamrafiul.wordpress.com/2013/04/28/sieve-of- eratosthenes-in-python/

https://www.cs.sfu.ca/~ggbaker/zju/math/recurrence.html

http://pages.pacificcoast.net/~cazelais/222/rsa-example.pdf

https://ssd.eff.org/en/glossary/decrypt

https://oeis.org/wiki/Density

http://www.sciencedirect.com/science/article/pii/0315086081900690

https://docs.python.org/3/faq/general.html#what-is-python

https://www.cs.uky.edu/~keen/115/Haltermanpythonbook.pdf

http://www.garykessler.net/library/crypto.html

https://iamrafiul.wordpress.com/2013/04/28/sieve-of-%20eratosthenes-in-python/

152

Impact Assessment of the Mathematics Training Series

Joshua A. Caburian , Mary Rose l. Maglaya, Almar Bryan M. Regacho, John Marvin D. Serran and Eduard M. Albay

Abstract This study assessed the impact of the Mathematics Training Series conducted by the Mathematics and Allied Disciplines Department. It determined the profile of the respondents in terms of age; sex; level of education being taught and academic rank; their pretest and posttest scores; their performance evaluation by their immediate supervisors before and after the training; the extent of utilization of the knowledge, skills, and technology gained from the training; and the immediate and long-term benefits gained from the training. It also determined whether there exists a difference between the means of pretest and posttest scores of the respondents and their performance evaluation by their immediate supervisors before and after the training. This study employed the descriptive research method using questionnaire as the main data-gathering instrument. Results of the analyses revealed that the knowledge, skills, and technology learned from the training are often used by the respondents. Moreover, they became more productive and efficient and have earned the respect of their supervisors. Further, there is a significant difference between the means of the respondents’ pretest and posttest scores and their performance evaluation by their immediate supervisors before and after the training. Thus, the Mathematics Training Series is effective in enhancing the respondents’ skills and knowledge, and their job performance. Keywords: extent of utilization, immediate benefits, impact assessment, long- term benefit, mathematics training series Introduction

Situation Analysis Extension is one of the three major

functions of higher education institutions in the country. In line with the present administration’s thrust to mobilize knowledge and technology towards enhancing productivity, generating employment and reducing poverty, higher education institutions have been actively conducting research and extension programs/projects, including transfer and/or application of technology/knowledge that contribute to the attainment of the country’s development goals (DMMMSU Extension Manual, 2014).

The Don Mariano Marcos Memorial State University (DMMMSU) is grounded in its commitment to fulfill its functions as to instruction, research, and extension, and to continue recognizing the vital role of extension service and community involvement in the life of the university. With its primary purpose of becoming an instrumental and a vital partner in achieving total development of the communities, the university - through its University Extension Office (UEO), together with its implementing units - is determined to strengthen its relationship with the community through mutual cooperation and support of well-defined, meaningful and

responsive community extension programs and services (DMMMSU Extension Manual, 2014).

The UEO is tasked to develop a university-wide program that entails the conduct of community-extension related activity which involves all the academic departments and units. Moreover, it serves as the University’s planning, coordinating, supervising, monitoring and evaluation office of extension activities. With these goals in mind, the “Professor in the Barangay” program was conceptualized in 2002 as the university’s primary extension delivery system. The Professor in the Barangay program aims to determine the socio-economic impact of the university in the service area. Specifically, the program shall: (a) develop extension delivery program; (b) establish the benchmark data on the socio-economic status of a Barangay; (c) prepare the Barangay/clientele’s Integrated Development Plan; (d) strengthen linkages with GO’s, NGO’s, and people’s organization; and (e) monitor and evaluate projects.

The DMMMSU - South La Union Campus (SLUC) upholds the university’s commitment to effectively implement its extension programs and community services. The vision of the DMMMSU-SLUC Extension Office is anchored on and aligned with the extension goals of the UEO.

153

The College of Arts and Sciences (CAS), one of the competent colleges of SLUC, also takes lead in developing empowered and self-reliant communities where people are able to transform themselves from passive objects of development into molders of their own development. Part of manifestations of its commitment to the development of the community is the implementation of a framework of action based on the SLUC Extension Framework that provides technical, educational, social, and health services to outside agencies and communities which foster a culture of service among its administrators, faculty, alumni and other stakeholders (Mathematics and Allied Disciplines Department Narrative Report, 2014).

The college’s commitment in becoming a potential tool to improve the lives of the community is reflected in its objectives: (a) provides students with a general knowledge of the behavioral, mathematical, and natural sciences for greater awareness and responsiveness to the demands of environment, (b) instill the desire to discover and preserve the national heritage and identity, and broaden the scope of knowledge through research, (c) development an analytical mind capable of evaluating and making sound judgment, and integrating scientific knowledge, (d) participate in the government’s efforts to uplift community through its research and extension activities.

The Mathematics and Allied Disciplines Department offers the degree, Bachelor of Science in Mathematics. The BS Mathematics program gears towards providing students with the most advanced level of instruction and professional skills to become competent and effective problem solvers of the society.

The different extension programs and projects of the MADD were framed based on the mandates of the university, national and regional development thrusts, current realities and available technologies. Moreover, they were also based on the needs and opportunities of the communities/clienteles. Given these premises, the department to its target clienteles is expected to enhance or improve the knowledge, skills, and attitudes.

Since 2008, MADD, being one of the service arms of the college, focused its extension programs on the following: (a) educational leadership, teacher support and professional development, (b) special inclusive, adult and education program, (c) institutional development and capability building, (d) entrepreneurial and livelihood skills development, and environmental protection, conversation, and management. These extension programs were implemented through the following strategies and approaches: (a) continuing education, (b) publication and communication (c) Field Operation Service.

The Educational Leadership, Teacher Support and Professional Development Program of DMMMSU-SLUC provides support for the

development of the language, scientific, numerical, and technological literacy of students and communities.

The program endeavors to fulfill the following objectives: (1) provide school and reading skills of school-age children who have difficulties in reading and writing, (2) equip teachers and professionals with updated knowledge and skills in the areas of science, mathematics, and computer technology to become more efficient as delivery agents of education; and (3) upgrade the language, scientific, numerical, and computer literacy levels of students in the adopted schools/communities and make these functional towards gaining better achievement in schools.

The program covers three aspects of educational development: (1) coaching/mentoring, (2) developing specialists, and (3) extending expertise.

One of the extension activities under the Educational Leadership, Teacher Support and Professional Development Program which was initiated by the MADD was the Mathematics Training Series which was implemented in January 2014 to May 2014. This said training series was attended by 140 elementary and secondary mathematics teachers in Agoo. 100 percent of the faculty members of the department were tapped as trainers /lecturers during the entire training series. The Mathematics Training Series was conceptualized with the primary aim of enhancing the competencies of mathematics teachers in the elementary and secondary levels through various innovative modes of delivering mathematics instruction. The following are the themes of the five series of the training: Series 1- Strengthening Mathematical Competence through Learning and Teaching (January 24-26, 2014); Series 2- Optimizing Mathematics Learning through Technology (April 10-12, 2014); Series 3- Assessment Methodologies in the Mathematics Classroom (April 23-25, 2014); Series 4- Mathematics Performance Management and Analysis (May 7-9, 2014); and Series 5 Giving Meaning to Numbers (May 21-23, 2014).

The topics of the Mathematics Training Series were based on the results of the needs assessment conducted to 101 teachers in the Municipality of Agoo. Results of the assessment reveal that the following are the top priority needs: (1) Developing Learning and Learning Other Instructional Materials (57.43%); (2) Implementing Effective Classroom Management Techniques (56.44%); (3) Implementing Literacy Strategies (48.51%); (4) Understanding and Managing Student Behavior (43.56%); (5) Implementing Effective Instructional Strategies and Engaging Students (37.62%); (6) Communicating Effectively with Parents, Students, Colleagues and Stakeholders (36.63%); (7) Utilizing Instructional Technology, Strategies, Innovations (35.64%); (8) Applying Differential

154

Instruction (33.66%); (9) Planning/Reflecting of the Effectiveness of Lessons (33.66%); and (10) Addressing Reading and the Other Learning Problems of Students (32.67%); (Mathematics and Allied Disciplines Department Narrative Report, 2014).

Because evaluation is an integral part of the procedure involved in assessing of the

effectiveness or impact of every extension program, this study was conceptualized. The researchers determined the impact of the Mathematics Training Series to the performance of the public and private elementary, secondary and tertiary mathematics teachers who attended the training.


Impact assessment is a process of evaluating the effect of an implemented project or development. Assessing the impact of extension activities implemented by every higher education institution in the country is a relevant stage of the monitoring and evaluation process. In this undertaking, it indicates the effectiveness and relevance of the extension programs implemented to the people who served as beneficiaries of the programs. Impact assessment may range from assessing knowledge increase, skills and attitudes resulting in higher productivity by the beneficiaries, utilization of technology, and other indicators of the effectiveness of the extension programs implemented.

The researchers assessed the impact of the Mathematics Training Series implemented by the Mathematics and Allied Disciplines Department (MADD) to the elementary and secondary mathematics teachers in Agoo, La Union who attended the said training. This study determined the performance of the respondents in the pretest and posttest, the performance evaluation of the respondents by their immediate supervisor before and after the training, the extent of utilization of the knowledge/skills/technology that the respondents gained from the training and the immediate and long term benefits gained from the training.

Statement of the Problem This research focused on the impact assessment of the mathematics training series. Specifically, this study sought answers to the following questions:

1. What is the profile of the respondents in terms of: a. sex/ b. age/ c. level of education being taught (Elementary, Secondary, or Tertiary), and d. academic rank?

2. What are the pretest and posttest scores of the respondents? 3. What is the performance evaluation of the respondents by their immediate supervisor before and after the training? 4. What is the extent of utilization of the knowledge/skills and technology gained from the training? 5. What are the immediate benefits gained from the training? 6. What are the long term benefits gained from the training? 7. Is there a significant difference between the means of the pretest and posttest scores of the respondents? 8. Is there a significant difference between the performance evaluation of the respondents by their immediate supervisor before and after the training?

Methodology

Research Design The researchers used the descriptive

research method. This method of research was primarily utilized to gather information about the existing present conditions, although it also considered past events and influences as they relate to current conditions (Palisoc, 2014).

Descriptive method was used to gather appropriate information to determine the impact of the extension program, particularly the Mathematics Training Series, conducted by the Mathematics and Allied Disciplines Department.

Sources of Data

The researchers gathered data from the teachers from the different private and public elementary and secondary schools in Agoo, La Union and from those who participated in the five series of the mathematics training series. Instrumentation and Data Collection

The researchers used questionnaire-checklist in gathering the needed data, particularly the profile of the respondents in terms

155

of age, sex, level of education being taught, and position/rank. Moreover, the questionnaire must also gathered from the respondents based on the data on the immediate and long- term benefits of the Mathematics Training Series and the extent of utilization of the knowledge, skills and technology gained from the training.

The pretest and posttest scores of the respondents were taken from the records of the Mathematics and Allied Disciplines Department.

A separate questionnaire was administered to the immediate supervisors of the respondents to determine the performance evaluation of the latter before and after the training.

Analysis of Data The profile of the respondents in terms of

sex/gender, age, and position/rank were analyzed using frequency counts and percentages.

The weighted mean was utilized to determine the extent of utilization of the knowledge, skills and technology gained from the training.

Frequency counts and percentages were used in analyzing the immediate and long-term benefits from the mathematics training series.

Paired T-test determined whether there is a significant difference between the performance evaluation of the respondents before and after the training; and the respondents’ pretest and posttest scores.

FINDINGS

1. The respondents composed of 70.83 percent female and 29.17 percent male. There are 44.17 percent under age 41 and above. In terms of the level of being taught, 75.83 percent are teaching in elementary level while 24.17 percent are secondary teachers. Moreover, 56.67 percent are Teacher 1 and 16.67 percent are supervisors.

2. The respondents obtained higher score in all the posttest of the Mathematics Training Series as reflected by the mean differences of their pretest and posttest scores ranging from 1.09 to 3.43.

3. The respondents’ performance was enhanced based on the evaluation of their supervisors from 3.4 described as “meet expectations” before the Mathematics Training Series to 3.8 described as “exceeds expectations” after the said training.

4. The Mathematics Training Series was often used with a rating 3.68 in terms of the extend

utilization of the knowledge, skills, and technology learned from the training.

5. The top three immediate benefits gained by the respondents from the Mathematics Training Series are: they gained knowledge and skills; the knowledge and skills are applicable to their work; and they became more productive and efficient.

6. As to long-term benefits, there are 24.66 percent and 20 percent of the respondents who agreed that the Mathematics Training Series helped them earn the respect of their supervisors and they were given important responsibility at work.

7. There is a significant difference between the means of the pretest and posttest scores of the respondents.

8. There is a significant difference between the performance evaluation of the respondents by their supervisors before and after the Mathematics Training Series

. Conclusions

Based on the findings of the study, the researchers concluded the following:

1. Majority of the respondents are female belonging to the middle age, elementary level teachers and holding Teacher 1 position.

2. The Mathematics Training Series helped the respondents improve their mathematical knowledge and skills.

3. The Mathematics Training Series aided the respondents to improve their competencies in terms of administration, knowledge of work and responsiveness.

4. The knowledge, skills, and technology learned from the Mathematics Training Series are useful to the respondents.

5. The Mathematics Training Series are beneficial to the respondents in terms of gaining relevant knowledge and skills, and in developing confidence and efficiency at work.

6. The Mathematics Training Series helped the respondents in attaining the respect of their supervisors and in gaining important functions on responsibility at work.

7. The Mathematics Training Series is effective in enhancing the mathematical knowledge and skills of the respondents.

8. The Mathematics Training Series is effective in enhancing the job performance of the respondents.

156

Recommendations Based on the findings and conclusions, the researchers offer the following recommendations:

1. Mathematics teachers of all age levels are encouraged to attend trainings, seminars, workshops and others that are related to their field.

2. Mathematics teachers may constantly aim at improving their knowledge and skills by attending seminars, trainings, and workshops in mathematics.

3. Mathematics teachers may constantly aim for the development of their competency in terms of leadership and responsiveness. Organizers of training, seminars, workshops, and conferences in mathematics are also encouraged to conduct an analysis of the needs of the target audience to ensure that the training sessions are relevant in enhancing the knowledge and job performance of the audience.

4. In the conduct of training, seminars, and conferences in mathematics, the need and interest of the target group audience may be considered.

5. The Mathematics and Allied Disciplines Department and other Mathematics Organizations are also encouraged to continuously organize and conduct relevant training, seminars, and workshops in mathematics.

6. The Mathematics and Allied Disciplines Department and other Mathematics Organizations are encouraged to organize more training and seminars that target the improvement of mathematics teachers’ competencies and overall job performance.

7. The Mathematics and Allied Disciplines Department may extend the Mathematics Training Series to other groups of Mathematics Teachers in the province and in the region.

Literature Cited Aquino E. Q, (2015). Mathematics Competency of the pupils in Palina Elementary

School Pugo, La Union: Basis for Extension Activities. Castro, RD, (2012). Coping Strategies in Mathematics Learning. Don Mariano Marcos

Memorial State University Extension Manual, 2014. Lange, M.S. (2011). Developmental Research. Retrieved on July 21, 2014 from: http://www.krollontrack.com/publications.

Cvetkoska, Violeta, (2011), Data Envelopment Analysis Approach and its Application I Information and Communication Technologies. Faculty of Economic. University Ss Cyril and Methodius, Skopje, Skopje, R., Macedonia.

Madriaga A., et. al, (2014). Graduate Tracer study of the Bachelor of Science in Mathematics of the Don Mariano Marcos Memorial State University-SLUC (DMMMSU SLUC) Year 1982-2014.

Paneda C., et.al, (2015). Work Performance of the Bachelor of Science Mathematics Graduates. DMMMMSU-SLUC, Agoo, La Union.

Roxas, R, et al, (2009). Online Corpora of Philippine Languages. Retrieved from http://scholar.google.com.ph/scholar. On August 7, 2014.

http://www.krollontrack.com/publications

157

BS BIOLOGY

158

Development of Computer Aided Instructional (CAI) Material on Selected Topics in Inferential Statistics

Joana Lyn A. Soriano, Jea Thalia A.Doctolero, Ivy Grace V. Rodriguez, Alvin S. Viduya, and Sunshine P. Briones

Abstract

This research entitled “Development of Computer Aided Instructional (CAI) Material on Selected Topics in Inferential Statistics”, made use of the Development-Evaluation research design to construct a material in the subject Inferential Statistics. The process in the development of the material involved the following: 1) preliminary preparation, 2) construction phase 3) validation, and 4) revision. The validation involved the expertise of ten instructors-five (face validators) and five (content validators).The study showed that the CAI material is valid in terms of content as shown by the following: there was clear presentation of objectives; the mathematical concepts included are suited to the ability of the target learners; the concepts were exemplified and illustrated properly; and they are suited to the mathematical abilities of the target learners. The CAI material is also valid in terms of its physical appearance (face validity). Findings justify the overall validity of the CAI material, and merits recommendation as an additional instructional material to be instituted for the target subject, Inferential Statistics. Nevertheless, the material may also be subjected to more intensive and comprehensive series of validation to further establish its effectiveness. Keywords: Computer Aided Instructional Material, content validity, face validity, Inferential Statistics

159

Decomposition Performance of Black Soldier Fly (Hermetia illucens) Larvae in Two Levels of Kitchen Waste (Cooked and Uncooked)

Kassandra F., Aquino, Sheila Mae B. Capoquian, Jessica R. Erfe, Geraldine M. Mapalo, and Glennadi R. Rualo

Abstract

Food waste is a growing area of concern with much cost in our community in terms of collection, disposal, spread of diseases from vectors, and release of greenhouse gases. Black soldier fly (Hermetia illucens) larvae was used to test its survival rate and decomposition performance as well as growth rate in two levels of kitchen waste (cooked and uncooked).

Result shows that 100g chicken feed with 15g yeast with 40 black soldier fly larvae is the best combination (amount of food and number of larvae) among treatments obtaining the highest percentage survival of 85.00 percent. Decomposition of the two levels of kitchen waste (cooked and uncooked) with black soldier fly larvae is well efficient and faster (at 5.17 and 7.32 rate of decomposition in cooked and uncooked kitchen waste respectively) than natural decomposition process. The kind of food affects the growth of the larvae. The highest length increment was obtained in the larvae fed with uncooked kitchen waste. Keywords: decomposition, food waste, Hermetia illucens larvae

Introduction Situation Analysis Kitchen waste is defined as left-over organic matter from restaurants, hotels, and households. Tons of kitchen wastes are produced daily by highly populated areas. Food waste is a growing area of concern with many costs to our community in terms of waste collection, disposal, spread of diseases from vectors and release of greenhouse gases.

The current practice of disposing biodegradable food waste at landfills is not sustainable and is environmentally undesirable as it depletes the limited landfill space, creates odor nuisance, attracts disease-vector insects like housefly, mosquito etc. that can cause cholera and dengue. Biodegradable wastes generate leachate and landfill gases such as methane- a greenhouse gas 25 times more potent than carbon dioxide that is particularly damaging to the environment (Greener, 2014). Composting kitchen wastes is an imperative activity. Kitchens generate a lot of waste. By composting it, we can contribute towards cleaner environment and also it’s beneficial to plants and garden at home (Harrison, 2015).

In this study, the researchers used black soldier fly specifically its larvae in the decomposition of kitchen wastes since some

studies regarding on organic waste decomposition were conducted using black soldier fly larvae.

Black Soldier Fly (Hermetia illucens) belongs to the order Diptera from the Class Insecta in the Animal Kingdom and is widespread in tropical and warmer temperate regions between about 45°N and 40°S (McCallan, 1974; Üstüner et al., 2003). These flies mostly breed on compost, manure and outdoor toilets. They can also be seen in bright, sunlit areas, resting on nearby structures or on vegetation and in flowers like daisy and of carrot families (Hawkinson, 2005)

The egg of this fly is about 1 mm long, elongated-oval shape that is usually pale yellow or cream colored when newly laid but it darkens with time. Each egg mass most contains about 500 eggs. Its larva is a plump, slightly flattened, with a tiny, yellowish to black head. Its skin is tough and leathery, creamy white in color and about 1.8 mm long when newly hatched, the larva develops through six instars, the last of which is reddish-brown. And the mature larva is about 18 mm long and 6 mm wide, although some individuals could grow as long as 27 mm. The pupa develops within the darkened skin of the last larval instar (puparium). The pupa is about one-third the length of the puparium.

160

Fig. 3. Life Cycle of Black soldier fly

Its adult is dusky-winged. Non-biting fly

is 15 to 20 mm long. Primarily black, the female's abdomen is reddish at the apex and has two translucent spots on the second abdominal segment. The male’s abdomen is somewhat bronze in color.

Black soldier fly larvae are scavengers and feed on different decaying organic material, such as rotting fruits and vegetables, animal manure and human excreta. The last larval stage, the so-called prepupa, migrates from the feed source in search of a dry and protected pupation site. Pupation occurs within the larval skin and the adult emerges after about 14 days. The adults are rather lethargic and poor flyers. Females mate two days after emerging and oviposit into dry cracks and crevices adjacent to a feed source. Due to the relatively long period between oviposition and eclosion (3–4 days), eggs are never laid directly onto the moist rotting material.

During its adult stage, H. illucens does not feed and relies solely on its body fat reserve. Consequently, the fly does not come into contact with any degrading or fresh organic material including foodstuffs, and can therefore not be regarded as unsanitary or a vector of diseases (Leclercq, 1997; Schremmer, 1986). Once hatched, larvae start to feed on the waste, thus, achieving a dry mass volume waste reduction of ~55 percent (Myers et al., 2008; Newton et al., 1995; Sheppard, 1983).

Due to high larval densities and the voracious appetite of the larvae, fresh material is processed extremely fast and bacteria growth suppressed or restrained, thereby reducing production of bad odour to a minimum. Previous work has also shown that black soldier flies are effective in reducing the mass as well as nutrient and moisture content of various kinds of organic waste.


This study was conducted to determine the survival rate and decomposition performance of the black soldier fly larvae in two types of kitchen waste - cooked and uncooked.

Specifically, this study sought to determine the following: a. Survival rate of Black soldier fly from larva to pupa in artificial diet. b. Decomposition rate of the kitchen waste (cooked and uncooked) with and without black soldier

fly larvae. c. Significant difference of decomposition rate in cooked and uncooked kitchen waste.

Time and Place of the Study

The study was conducted in different places - (a) outside the left wing of Don Mariano Marcos Memorial State University, South La Union Campus Library, (b) San Antonio, Agoo, La Union,

(c) Asan Sur, Sison, Pangasinan and (d) Nilombot, Mapandan, Pangasinan for close monitoring purposes.

Larva (14 days)

Eggs (1-4 days) Pupa (14 days)

Adult (5-8 days)

161

Methodology

Research Design Completely Randomized Design (CRD) was used as experimental design of the study. This study is made up two-phases namely: 1) Rearing of Black soldier fly and 2) Experiment proper which is composed of two experiments: a) Survival rate and b) Decomposition rate. In this phase, the following treatments were replicated three (3) times.

For Survival Rate experiment: T1 - 100g chicken feed with 15g yeast + 40 BSF larvae T2 - 100g chicken feed with 15g yeast + 50 BSF larvae T3 - 100g chicken feed with 15g yeast + 60 BSF larvae T4 - 200g chicken feed with 15g yeast + 40 BSF larvae T5 - 200g chicken feed with 15g yeast + 50 BSF larvae T6 - 200g chicken feed with 15g yeast + 60 BSF larvae T7 - 300g chicken feed with 15g yeast + 40 BSF larvae T8 - 300g chicken feed with 15g yeast + 50 BSF larvae T9 - 300g chicken feed with 15g yeast + 60 BSF larvae

For Decomposition Rate experiment: T0 - 75g of kitchen waste only T1 - 10 larvae with 1st to 2nd instar + 75g kitchen waste T2 - 10 larvae with 3rd to 4th instar + 75g kitchen waste T3 - 10 larvae with 5th to 6th instar + 75g kitchen waste

Procedures

1. First Phase: Rearing of Black soldier fly

Black soldier fly larvae and pupae collection

The larvae and pupae were collected from the Municipal Sanitary Landfill of Agoo, La Union under the permission of the MSL staff and employer.

Culturing The larvae collected from the dumpsite

were placed on the first cage. They were fed with mixture of vegetable peel brought from the market, chicken feed, yeast and saw dust. A lamp style water cup was also placed inside as their source of water. The pupae collected were placed into a dry container and placed inside the second cage. On the separate container, wetted chicken feed with yeast and carton strips were also placed inside. The chicken feed served as an attractant for the adult black soldier fly to lay their eggs into the carton strips.

Egg Monitoring and Collection The carton strips that were placed near

the wetted chicken feed were checked regularly by the researchers in search for eggs. The eggs collected from the carton strips were placed into another container containing wetted chicken feed with 15 grams of yeast and were used in the second phase of the experiment.

2. Second Phase Survival Rate

The cultured black soldier fly from the first phase of this study produced a number of one thousand seven hundred forty-five (1745) larvae. The larvae were collected and divided into 40, 50 and 60. Each division of larvae were placed in a microwavable plastic container covered with

organza on top that contains 100g, 200g, and 300g wetted chicken feed and 15g of yeast. In total, there were nine (9) treatments, replicated three times. The larvae were monitored regularly until they become pupa. The number of pupae that emerged was compared to the initial number of larvae.

Decomposition Rate In this experiment, the larvae obtained from the first phase of the study were sorted in terms of their length. They were measured using a caliper. There were three sets of larvae that was sorted in different sizes. The first set of larvae measured an average length of 8.843 ± 0.832 mm, the second set measured an average length of 12.142 ± 2.372 mm and the third set measured an average length of 14.838 ± 0.885 mm. Ten (10) larvae from each different sets were placed in round microwavable plastic containers covered with organza containing 75 grams of two types of kitchen waste, cooked and uncooked weighed right after. There were eight (8) treatments replicated three (3) times. Decomposition rate monitoring was done after every three (3) days. There were three (5) times monitoring, a total of nine (15) days. Data Gathered The following data were gathered during the course of the study: Survival rate = [number of pupa that emerged/number of larva] x 100 Decomposition = (Initial Mass – Final Mass)/initial mass Where: Initial mass = weight of the food in grams before the experiment Final Mass = undecomposed food in grams during measuring day Daily Decomposition Rate = % Mass Loss/ Length of incubation (in days) Data Analysis To determine the significant difference between the means of the nine (9) treatments. Data gathered from the first experiment (survival rate) were subjected to One Way Analysis of Variance (ANOVA) at 5 percent level of significance Tukey HSD was used for further analysis. Data gathered from the second experiment which is decomposition rate were subjected to One-way Repeated Measures ANOVA with Wilks’ Lambda Test at 5 percent level of significance to determine the significant difference between time points among the eight (8) treatments. Pairwise comparison was used as Post hoc test for further analysis.

162


A. Percentage Survival Percentage survival of Black soldier fly (Hermetia illucens) larvae in different treatments is presented in Table 1. Based on the results of the

study, treatment 1 obtained the highest mean survival rate while treatment 9 obtained the least mean survival rate.

Table 1. Percentage Survival of Black soldier fly Larvae in the Different Treatments

Treatments Number of Pupa

Yield (mean)

Percentage Survival (mean)

T1 = 100g Chicken feed + 40 BSF larvae

34.00

85.00 a

T2 = 100g Chicken feed + 50 BSF larvae 26.67 51.33 b T3 = 100g Chicken feed + 60 BSF larvae 43.00 71.56 b T4 = 200g Chicken feed + 40 BSF larvae 22.33 55.83 b T5 = 200g Chicken feed + 50 BSF larvae 29.33 58.67 b T6 = 200g Chicken feed + 60 BSF larvae 27.67 46.00 b T7 = 300g Chicken feed + 40 BSF larvae 13.00 32.50 b T8 = 300g Chicken feed + 50 BSF larvae 14.33 28.67 b

T9 = 300g Chicken feed + 60 BSF larvae 8.33 13.90 c

Means with different letters is significant at the 0.05 level Result indicates that 100g of chicken feed and 40 black soldier fly larvae (Treatment 1) is the best combination among treatments obtaining the highest percentage survival. Based from the result, the higher the amount of food, the lower the percentage survival obtained. Factors such as lack or excess of feed, which is related to the larval feeding rate and overcrowding, related to larval density, haven’t been studied extensively (Parra Paz et al., 2009). However, optimum conditions include a narrow range of temperature and humidity as well as a range of suitable levels of texture, viscosity, and moisture content of the diet. Temperature should be maintained between 29 and 31˚C, though wider ranges maybe feasible. Relative humidity should fall between 50 and 70%. Higher relative humidity makes the diet too wet, and more generally the diet should have enough structure, otherwise the larvae may have a difficult time crawling on it, consuming it and getting

inadequate oxygen supply (Barry, 2004). In addition, such conditions hinder larval access to the food source, thus, reducing yield (Diener et al., 2011). During the experiment, the researchers have found out that black soldier fly can’t tolerate dry and too much wet environment. The same findings found by Bullock et al. (2013) that it is especially important to keep the larvae feeding medium at a proper moisture level—not so dry that it cements the larvae into the feed, and not so wet that they cannot breathe through the pores in their exoskeleton. Furthermore, the larvae can operate 6 to 8 inches below the surface.

Though, black soldier fly can tolerate a widely varied diet (Bullock et al. 2013). BSF larvae are known for their ability to feed on a wide variety of organic waste, including: vegetables, fruits, meat, and manure (Dione et al. 2014).

B. Decomposition Rate B.1. Cooked kitchen waste Based from the result, decomposition rate of the kitchen waste at different day interval is significantly different. In T0, decomposition rate in all day interval is significantly different. As the day increases, the decomposition rate is also increases. In T1, 3rd day is significantly different from 9th, 12th, and 15th day but comparable to 6th day. This reveals that the decomposition rate in 3rd day and 6th day is faster than the longer days spent in decomposition. In T2, 3rd day is significantly

different from 12th and 15th but comparable to 6th and 9th day interval. Meanwhile, 6th, 9th and 12th have comparable decomposition rate. Morever, 9th,12th and 15th day interval were also found to be of comparable decomposition rate. In T3, however, Tukey test found an insignificant difference for decomposition rate in different day intervals. Decomposition rate was not affected at different interval days.

163

Table 2. Decomposition Rate of Cooked kitchen waste in each treatment at different day interval

Treatment Decomposition Rate

Mean 3rd 6th 9th 12th 15th

T0 = 75g waste (without larvae)

-3.42 a -1.67 b -1.10 c -0.74 d -0.15 e -1.42 a

T1 = 75g waste + 10 larvae (1st to 2nd instar)

6.03 a 5.16 ab 4.72 b 4.50 b 4.31 b 4.94 b

T2 = 75g waste + 10 larvae (3rd to 4th instar)

6.03 a 5.16 ab 6.51abc 5.50 bc 4.86 c 5.17 b

T3 = 75g waste + 10 larvae (5th to 6th instar)

5.07 a 4.61 a 4.91 a 4.36 a 4.23 a 4.64 b

Means with different letters are significant at 0.05 levels. Table 2 also shows that, T2 (75g waste + 10 larvae of 3rd to 4th instar) obtained the highest mean decomposition rate of 5.17 while T0 (without larvae) obtained the least (-1.42). The mean decomposition rate of each treatment were subjected to One-way Analysis of Variance (ANOVA) and Tukey HSD as post hoc test (Appendix A). The result shows that T0 is significantly different from all other treatments.

Furthermore, T0 obtained a negative mean rate of decomposition (-1.42) that indicates that cooked kitchen waste was not significantly reduced through or by natural process as compared to the other treatments. Regardless of the larval stage, decomposition of the cooked kitchen waste of the three treatments with black soldier fly larvae was significantly reduced. However, T2 obtained the highest decomposition rate.

B.2. Uncooked kitchen waste Table 3. Decomposition Rate of uncooked kitchen waste in each treatment at different day interval

Means with different letter is significant at 0.05 levels.

The data on the decomposition rate of

uncooked kitchen waste in different treatments at different day interval is presented in Table 3. Based from the result, Treatment 3 obtained the highest decomposition rate of 7.32 while Treatment 1 and Treatment 2 obtained a similar decomposition rate of 5.98. T0 (without larvae) obtained a negative decomposition rate of -1.50. The result indicates that the different treatments, that is, using different instar level at the same amount of

kitchen waste with 10 larvae was significantly different. The comparable decomposition rate of treatments with larvae at different levels is faster than the treatment without the BSF larvae. Considering the number of days’ interval, T0, at 3rd, 6th, and 15th day are significantly different from 9th and 12th which are comparable to each other. T1 and T3 at different day interval had insignificant decomposition rate. Meanwhile, in T2 the 3rd and 9th day intervals are significantly different from

Treatment Decomposition Rate

Mean 3rd 6th 9th 12th 15th

T0 = 75g waste (without larvae)

-3.33 d -1.58 c -0.98 b -1.02 b -0.57 a -1.50 a

T1 = 75g waste + 10 larvae (1st to 2nd instar)

6.49 a 5.49 a 6.76 a 6.48 a 4.70 a 5.98 b

T2 = 75g waste + 10 larvae (3rd to 4th instar)

6.47 ab 5.28 cd 7.30 a 6.25 bc 4.59 d 5.98 b

T3 = 75g waste + 10 larvae (5th to 6th instar)

8.27 a 6.20 a 8.45 a 8.49 a 5.21 a 7.32 b

164

6th, 12th and 15th day interval but comparable with one another. Decomposition rate increases as the number of day also increases.

Similar to the result obtained in cooked kitchen waste, T0 (uncooked kitchen waste only) obtained a negative decomposition rate of -1.50 which indicates that there was no waste weight reduction. Generally, decomposition rate in both

cooked and uncooked kitchen waste with black soldier fly larvae is well efficient as compare to the decomposition rate of kitchen waste alone. Black soldier fly are voracious feeders of organic material and may thus be used in simple engineered systems to reduce organic waste in low- and middle-income countries (Diener et al. 2011).

C. Decomposition rate in Cooked and Uncooked kitchen waste Table 4. Mean Decomposition rate in cooked and uncooked kitchen waste

Decomposition Rate Treatment

T0 T1 T2 T3

Cooked kitchen waste -1.42 a 4.94 a 5.17 a 4.64 a

Uncooked kitchen waste -1.50 a 5.98 b 5.98 a 7.32 b

Means with different letters is significant at 0.05 levels.

Mean decomposition rate of the two levels of kitchen waste (cooked and uncooked) in different treatments is presented in Table 4. Using T-test, decomposition rate of cooked and uncooked kitchen waste in different treatments were analyzed. In T0 and T2, there were no significant difference found in the decomposition rate of both cooked and uncooked kitchen waste. In T1, decomposition rate of cooked and uncooked kitchen waste is significantly different from each other. The decomposition rate of uncooked kitchen waste was faster than in the cooked kitchen waste. In T3, decomposition rate in cooked and uncooked kitchen waste is significantly different. Decomposition rate was higher in the uncooked kitchen waste.

Generally, decomposition rate is higher in the uncooked kitchen waste (7.32) as compare to

the cooked kitchen waste (-1.42). The result indicates that black soldier fly larvae were instrumental in the faster decomposition. They preferred to consume the uncooked kitchen waste than the cooked one. This may probably be due to a lower moisture content of uncooked kitchen waste. Bullock et al. (2013) stated that it is especially important to keep the larvae feeding medium at a proper moisture level—not so dry that it cements the larvae into the feed, and not so wet that they cannot breathe through the pores in their exoskeleton. The higher the relative humidity, the more the feed becomes wet and so the larvae cannot consume well the feed (Barry, 2004). Based from the researchers’ observation during the experiment, moisture content of the cooked kitchen waste is higher than in the uncooked kitchen waste.

Conclusions Based on the results obtained in the study, the following conclusions are drawn: 1. For the survival rate experiment, treatment 1 (100g chicken feed with 15g yeast + 40 black soldier fly larvae) is the best combination (amount of food and number of larvae) among treatments obtaining the highest percentage survival of 85.00 %. Based from the result obtained, as the amount of food and the number of larvae increases, percentage survival decreases. Therefore, food density is one of the factors that affects the survival of the larvae. 2. Decomposition rate of kitchen waste (cooked and uncooked) without black soldier fly larvae did not significantly reduced after 15 days of weighing as compared to that containing black

soldier fly larvae. Having known as voracious feeders on organic matter, the black soldier fly larvae significantly contribute to the decomposition process of the kitchen waste given a period of time (15 days). Comparably, decomposition of the two levels of kitchen waste (cooked and uncooked) with black soldier fly larvae is well efficient and faster (at 5.17 and 7.32 rate of decomposition in cooked and uncooked kitchen waste respectively) than natural decomposition process. 3. Decomposition rate is faster in uncooked kitchen waste than in cooked with the help of the black soldier fly larvae. The larvae preferably consumed the uncooked kitchen waste.

165

Recommendations Based on the conclusions derived from the study, the following recommendations were offered: 1. A combination of 100g feed and 40 black soldier fly larvae is recommended in obtaining a higher survival rate of the larvae. 2. Black soldier fly larvae should be used for efficient, faster decomposition of kitchen waste. 3. Black soldier fly preferably consumed the uncooked kitchen waste. Uncooked kitchen waste should be chosen and introduce to the larvae as the diet.

4. In relation to the third recommendation, since black soldier fly larvae preferably consumed the uncooked kitchen waste, growth rate (length) of the larvae is higher in uncooked than in cooked kitchen waste. Black soldier fly larvae should be feed with uncooked kitchen waste to make them grow better. 5. For further studies, other organic waste aside from kitchen waste should also be used to further test the ability of the black soldier fly larvae to decompose organic wastes.

Literature Cited Banks, I.J., et al. (2014). Growth rates of black soldier fly larvae fed on fresh human faeces and their implication

for improving sanitation. Tropical Medicine and International Health. Volume 19 no. 1 pp 14–22 January 2014.

Barry, T. (2004). Evaluation of the Economic, Social, and Biological Feasibility of Bioconverting Food Waste with the Black Soldier Fly (Hermetia illucens). University of North Texas.

Bio-Conversion of Putrescent Waste. (2008). ESR International, LLC. Retrieved May 18, 2015, from http://www.esrint.com/pages/bioconversion.html Bullock N, Chapin E, Elder B, Evans A, Givens M, Jeffay N, Pierce B, Robinson W 2013 :The Black Soldier Fly How-to-Guide. ENST 698-EnvironmentalCapstone.UNC Institute for the Environment. pp. 12. Burtle, G., et al. (January, 2016). Mass Production of Black Soldier Fly Prepupae for Aquaculture Diets. Tifton, Georgia, University of Georgia Commonwealth of Australia. (2014). Retrieved May 21, 2015, from http://yourenergysav ings.gov.au/waste/reducing-recycling/kitchen-food-waste Dang, N.H. (2010). Decomposition of Organic Wastes and Fecal Sludge by Black Soldier Fly Larvae. Diss.

(MEng Environ. Eng. Manag.) – Asian Inst. Technol. pp. 1–75. al. (2011). Black Soldier Fly for Organic Waste Treatment – Prospects and Constraints. Retrieved May 23, 2015, from http://www.eawag.ch/forschung/sande c/publikationen/swm/dl/Diener_2011.pdf

De Haas, E. M., C. Wagner, A. A. Koelmans, M.H.S. Kraak, andW.Admiraal. 2006. Habitat selection by chironomid larvae: fast growth requires fast food. J. Anim. Econ. 75: 148-155. Decomposition. Retrieved on Januray 31, 2016 from http://decompositionnotes.weebly. com/plant-decomposition.html Diener et. al. (2011). Biological Treatment of Municipal Organic Waste using Black Soldier Fly Fly Larvae Retrieved on the 21st of May 2015 Diener, S., et al. (2009). Conversion of organic material by black soldier fly larvae: establishing optimal feed rates. Waste management & research (electronic resource), Vol. 27/6 pp. 603-610 Diener, S. (2010). Valorisation of Organic Solid Waste using the Black Soldier Fly (Hermetia illucens), in Low and Middle-Income Countries. Swiss Federal Institute of Aquatic Science and Technology. Dübendorf, Zurich, Switzerland Dione, P.C, et al. (2014). Development of a food waste composting system using Black soldier Fly Larvae. 3rd Annual R&D Student Competition – Greenovate NYS Dry Mass. Retrieved Januray 31, 2016 from http://www.biology-online.org/dictio nary/Dry_Mass Gabler, F. (2014). Using Black Soldier Fly for waste recycling and effective Salmonella spp. Reduction. Sveriges lantbruksuniversitet, Swedish University of Agricultural Sciences, Department of Energy and Technology Giberson, D. J., and D. M. Rosenberg. 1992. Effects of temperature, food quantity, and nymphal rearing density on life-history traits of a northern population of Hexagenia (Ephemeroptera: Ephemeridae). J. North Am. Benthol. Soc. 11: 181- 193. Greener Garbage Collection. (2014). Retrieved January 25, 2016 from http://www.saanic h.ca/services/garbage/greenergarbagecollection.html Hawkinson, C. (2005). Black Soldier Fly. Retrieved on the 18th of May 2015 from http://aggie-horticulture.tamu.edu/galveston/beneficials/beneficial51_black_soldie r_fly.htm

http://www.esrint.com/pages/bioconversion.html

http://www.eawag.ch/forsch

166

Holmes, L. (2010). Role of Abiotic Factors on the Development and Life History of the Black Soldier Fly, Hermetia illucens (L.) (Diptera: Stratiomyidae, Windsor, Ontario, Canada. Houde, E. D. Comparative Growth, Mortality, and Energetics of Marine Fish Larvae: Temperature and Implied Latitudinal Effects. Retrieved May 21, 2015, from http://pisaster.genetics.uga.edu/sandbox/groups/evolution3000/wiki/11ecf/attachments/c4b61/houde.pdf Kitchen Waste Composting Kitchen Waste Composting/Conserving Valuable Resources. Retrieved on the

18th of May 2015 from http://www.benefits-of-recycling.com/kitchenwastecomposting/Kitchen waste. Retrieved May 21, 2015, from http://microbewiki.kenyon.edu/index.php/Kitchen_waste

Kuers, K., Simmons, J. Litter Decomposition Study. Retrieved May 21, 2015, from static.sewanee.edu/Forestry_Geology/.../LitterDecompStudy_word.doc Leclercq, M. (1997). Á propos de Hermetia illucens (Linnaeus, 1758) ("soldier fly") (DipteraStratiomyidae: Hermetiinae). Bulletin et Annales de la Societe Royale Belge d'Entomologie ,133, 275-282 Marsh, L, et al. (2004). Suitability of aquaculture effluent solids mixed with cardboard as a feedstock for vermicomposting. Bioresource Technology Volume 96, Issue 4, March 2005, Pages 413–418 McCallan, E. (1974). Hermetia illucens (L.) (Dipt., Stratiomyidae), a cosmopolitan American species long established in Australia and New Zealand. The entomologist’s monthly magazine, 109,232-234 Myers, H.M, et al. (2008). Development of Black Soldier Fly (Diptera: Stratiomyidae) Larvae Fed Dairy Manure. Environ. Entomol. Vol. 37(1) pp. 11-15 Newton L, Sheppard C, Watson DW, Burtle G, Dove, R. (June 2005). Using the black soldier fly, Hermetia illucens, as a value-added tool for the management of swine manure. Waste Management Programs. North Carolina State University. Risse, M., & Faucette, B. (2012). Compost utilization for erosion control. Retrieved on January 25, 2016 from http://extension.uga.edu/publications/detail.cfm? Number=B1200 Symton Black Soldier Fly Solutions. 2013. Retrieved May 29, 2015, from http://www. symtonbsf.com/blog/how-to-identify-male-and-female-of-bsf Tomberlin, J.K., Sheppard DC. 2001. Lekking behavior of the black soldier fly (Diptera: Stratiomyidae). Florida Entomologist 84: 729-730 Tomberlin, J.K., Sheppard DC, Joyce JA. 2002. Selected life history traits of black soldier flies (Diptera: Stratiomyidae) reared on three artificial diets. Annals of the Entomological Society of America 95: 379-386 Üstüner, T., Hasbenli, A., Rozkosny, R. (2003). The first record of Hermetia illucens (Linnaeus, 1758)(Diptera, Stratiomyidae) from the Near East. Studia dipterologica , 10, 181-185 Z, J., et al. (2010). An Artificial Light Source Influences Mating and Oviposition of Black Soldier Flies, Hermetia illucens

http://www.benefits-of-recyc/

http://www.sciencedirect.com/science/journal/09608524

http://www.sciencedirect.com/science/journal/09608524/96/4

http://extension.uga.edu/publications/detail.cfm

167

Occurrence of White Spot Syndrome Virus (WSSV) in Wild Penaeus vannamei

(Pacific Whiteleg Shrimp) of Agoo and Aringay, La Union, Philippines Verified

Through Gross Clinical Assessment & Molecular Analysis

Tumapang, Marc Levi M., Bautista, Marjorie M., Salazar, Christian Geen E., & Bautista, Levylee G.

Abstract

White Spot Syndrome Virus (WSSV) is a determined disease especially to Penaeus vannamei, or the

Pacific Whiteleg Shrimp (PWS). The study aimed to determine the occurrence of WSSV in PWS of Agoo &

Aringay, La Union. PWS were collected for five consecutive days and were examined for gross clinical signs

of the disease. One sample from each catch was subjected to molecular analysis to verify the presence of

WSSV. A relatively “moderate” (29.74) and “low” (20.57) rate of incidence were observed for Agoo & Aringay

respectively. Nested PCR revealed that all samples tested positive for WSSV, in which six exhibited

“moderate” infection, and the remaining four exhibited “light” infection. Maximum Composite Likelihood

Tree (MCLT) reveals that the samples and the strains retrieved from NCBI database are closely associated

with each other. The result of this study may serve as a warning to the fisher folks of the aforementioned sites

& may serve as a basis for future WSSV studies.

Keywords: white spot syndrome virus (WSSV), Penaeus vannamei, nested PCR

INTRODUCTION

Shrimp industry in Asia has long been

dominated by the Black/Giant Tiger Prawn

(Penaeus monodon [Fabricius, 1798]; locally

known as “sugpo”). However, it was slumped in

the 1990s because of severe disease occurrences

which eventually led to significant losses among

producers (Sulit et al., 2005). This series of events

paved way to the introduction of two non-native

shrimp species – the Pacific White Shrimp (PWS;

Penaeus vannamei) [Boone, 1931]) and the Pacific

Blue Shrimp (P. stylirostris [Stimpson, 1874])

(Sulit et al., 2005). P. vannamei, however, was

considered for culture because it is easier to grow,

its survival rate is higher, it requires less protein in

their diet (thus lower feed cost), and most

importantly it is commercially available (Sulit et

al., 2005). P. vannamei was introduced in the

Philippines thru the Department of Agriculture –

Bureau of Fisheries and Aquatic Resources (DA-

BFAR) and Agrifisheries World, Inc. when the

agencies agreed to undertake a research and

verification studies regarding the use of Specific

Pathogen Free (SPF) and Specific Pathogen

Resistant (SPR) P. vannamei for hatchery and

grow-out purposes at BFAR–NIFTDC in August of

2004 (Sulit et al., 2005).

Despite the staggering production rates of

P. vannamei in the market, there has also been

astounding, periodic losses due to the outbreak of

diseases. Shrimp industry in Asia has declared

annual loss that has been reported to reach at

about 4 billion USD, as a result of pandemic

diseases which originates from viral infection and

majority of it is said to be caused by the white spot

syndrome virus (WSSV) (Flegel, 2009). In the

Philippines, first report of WSSV detection was

gathered from Bataan, Batangas, Bulacan,

Camarines Norte, Mindoro Oriental, Quezon,

Cebu, Negros Occidental, Agusan del Norte,

Sarangani, and Zamboanga del Sur (de la Peña,

Magbanua, Natividad, Migo, Alfafara, Miranda, et

al., 2007). The Philippines’ shrimp industry was

affected with WSSV infection much later than the

rest of Asia, and since 1999 to early 2002, there

were only few cases with WSSV infection

documented for mass mortalities. However, for

the last quarter of 2002 up to the present, all major

shrimp producing regions in the Philippines have

reported massive mortalities much frequently

168

causing a mortality that ranges from 80% - 95% for

intensive culture system and 30% - 70% for

extensive culture system (de la Peña, 2004).

WSSV, also known as baculoviral

hypodermal and hematopoietic necrosis virus, is a

rod-shaped double-stranded DNA virus belonging

to the family Nimaviridae (Mayo, 2002, as cited in

Cavalli et al., 2013). Shrimps with the disease

exhibit loose cuticles with white spots (0.5–2.0

mm in diameter) that are usually obvious on the

carapace, pinkish to reddish-brown discoloration

of the body due to circular expansion of the

chromatophores, and emaciation (thinning)

(FAO, 2015; Cavalli et al., 2013). Shrimps infected

with WSSV exhibit reduced food consumption,

lethargy, lose cuticles, high mortality within three

to five days of the onset of clinical signs, and white

spots under their exoskeleton, hence the name

white spot syndrome (Dhar, Roux, & Klimpel,

2001; FAO, 2015). These lethal implications of

WSSV greatly affect the mortality of the PWS,

thus, increasing the risks in food security and

eventually leading to declining human food

production especially to shrimp fructification.

Viruses adapt quickly to altering

conditions and also have a relatively high

mutation rate (Manrubia, 2005). With these

characteristics at hand, their resiliency to the

changing environment of their host turns out to

be very flexible and flaccid. This study aims to

determine the occurrence of WSSV virus in PWS

of San Julian Norte, Agoo and Dulao, Aringay,

both located in La Union, Philippines, through

gross clinical assessment and molecular analysis.

Viral DNA analysis may provide important

insights in the molecular evolution and

population structure and dynamics of WSSV in

the country. Furthermore, analysis of viral DNA

may help in making inferences about levels of

variation and population structure in these

viruses.

METHODOLOGY

Shrimp catch were inspected for five

consecutive catch during the month of July. Only

L. vannamei species were counted and included in

the evaluation of gross signs exhibited by WSSV,

including the presence of white spots (0.5 to 2mm)

on the inside surface of the carapace, appendages,

and cuticle over the abdominal segments and

reddish discoloration.

From the PWS collected in each

barangays, one sample for every catch exhibiting

clinical gross signs of WSSV infection was

subjected to molecular analysis. One presumably

non-infected shrimp from every catch, i.e., not

exhibiting clinical gross signs, was also subjected

to molecular analysis to serve as the negative

control. DNA samples were isolated from the gills

using QIAGEN kit as per manufacturer’s

instructions. PCR reaction mix was prepared for

DNA samples. Primers used in the first step and

nested PCR are described in Table 1. All amplified

DNA of WSSV positive and negative P. vannamei

samples were submitted to NIMBB at UP Diliman

for gene sequencing.

Table 1. Primers used in the study

Primer Name

Primer Amplicon Size (bp)

Reference

WSSV First Step PCR reaction

IQ2000™ First PCR Reaction

F: --- R: ---

--- ---

WSSV Nested PCR Reaction

IQ2000™ Nested PCR Premix

F: AATGGTCCCGTCCTCATCTCA R: GCTGCCTTGCCGGAAATT

333, 630, 848

Tsai et., 2011

Data Analysis

The rate of incidence (RI) of “WSSV-

infected” shrimps were computed by dividing the

total number of WSSV positive samples (WSSV+)

with the total number of shrimps (TPWS),

multiplied to 100 to get the percentage. The

measured percentage RI of WSSV were

transformed into qualitative variables (refer to

Table 2).

169

Table 2. WSSV rate of incidence (RI) category.

RI Value RI Category 81 – 100 Extreme

61 – 80 Very High

41 – 60 High

21 – 40 Moderate

<20 Low

The chromatogram of the DNA sequences

obtained from PGC-DSCF were observed in

MEGA7. Clear, ambiguous DNA sequences of the

samples were subjected in Basic Local Alignment

Search Tool (BLAST) specifically BLASTn for

nucleotide sequence queries. This is to determine

whether the samples are truly WSSV strains

and/or related to WSSV. After strains are

confirmed as WSSV, nucleotide sequences were

aligned using ClustalW in MEGA v.7 (MEGA7). A

Maximum Likelihood Tree was then constructed

using the aligned plasmid nucleotide sequences

returned by ClustalW. A test of phylogeny

(reliability) was done by Bootstrap method using

500 number of bootstrap replications.

DNA sequences of WSSV obtained in this

study were compared amongst each other and to

pre-existing isolates from FASTA database by

utilizing the Maximum Likelihood technique in

view of the Tamura-Nei model. Starting tree(s) for

the heuristic inquiry were acquired naturally by

applying Neighbor-Join and BioNJ calculations to

a network of pairwise separations assessed

utilizing the Maximum Composite Likelihood

(MCL) methodology, and after that selecting the

topology with unrivalled log probability esteem.

The examination included 12 nucleotide

successions. Codon positions included were

1st+2nd+3rd+Noncoding. All positions containing

holes and missing information were wiped out and

there were 121 positions in the last dataset.

RESULTS AND DISCUSSION

Rate of Incidence of White Spot Syndrome (WSS) in P. vannamei

A total of 2014 P. vannamei were collected

in San Julian Norte, Agoo, La Union. Out of these,

29.74% (n = 599) showed positive gross signs of

WSSV infection. On the other hand, out of the 846

P. vannamei collected in Dulao, Aringay, La Union,

20.57% (n = 174) of which have shown positive

gross signs of WSSV infection (Table 3).

Calculated Rate of Incidence (RI) were translated

into one of five categories. The present

investigation revealed that the rate of incidence of

WSSV in Agoo is “moderate” (29.74%), whereas

Aringay has a “low” rate of incidence (20.57%).

Table 3. RI of WSSV in the collection areas.

Collection Site Date of

Collection TPWS WSSV- WSSV+

San Julian Norte, Agoo

July 23 361 327 34

July 24 253 201 52

July 25 1107 701 406

July 27 87 67 20

July 28 206 119 87

Total 2014 1415 599

Dulao, Aringay July 27 158 106 52 July 28 216 199 17

July 29 173 161 12

July 30 116 44 72

July 31 183 162 21

Total 846 672 174

Note: TPWS - Total no. of Pacific White Shrimps (PWS) caught WSSV- - White Spot Syndrome non-infected PWS WSSV+ - White Spot Syndrome infected PWS

Stress caused by various environmental

factors play very important role in the natural

occurrence of WSSV (Fegan & Clifford, 2001;

Rodriguez et al., 2003 – as cited in Rahman,

Corteel, Wille, Alday-Sanz, Pensaert, Sorgeloos, et

al., 2007). Rahman et al., (2007) observed that

170

increasing water temperature (27 – 33⁰C) can have

two opposite side effects in WSSV infected

shrimps depending on the stages of infection.

They mentioned that at higher temperature, viral

replication and disease/mortality is shut off in the

acute stage of infection, i.e., before clinical signs

are observed. On the other hand, in the more sub-

acute, chronic stage of the infection, i.e., when

clinical signs are present, disease/mortality in

WSSV infected shrimps quickly progresses,

making it more detrimental. Therefore, with high

temperature, the L. vannamei can either suppress

or heighten the infection caused by the virus.

Observed temperature in Agoo was documented

at 30.6⁰C, while Aringay has an average

temperature of 31.6⁰C on its respective collection

date (Accuweather, 2015). “Moderate” and “low”

WSSV RI for Agoo and Aringay, respectively, may

have accorded with the first scenario suggested by

Rahman and his colleagues (2007) wherein

considering the difference of the temperature of

Agoo and Aringay, Agoo has a lower temperature.

This then proves that WSSV viral replication

according to Rahman et al., (2007) that the higher

the temperature the replication is shut off or

prevented, basing from our data that Aringay has

a higher temperature than in Agoo. This then

clarifies the fact that the difference of RI in Agoo

and Aringay are slightly different. Tendencia et al.,

(2010a) also mentioned that an important WSSV

risk factor is of this disease is the temperature.

Vidal et al., (2001) also discovered that warm-

water conditions (32ºC) where the water condition

of Aringay is closer, provides a feasible way to

avoid mortalities of L. vannamei from WSSV. Also

severity of infection can also be caused by the

environmental factors, e.g. temperature, which

increases susceptibility of the host as well as the

viral replication process (Zwart et al., 2010). Viral

replication of WSSV infected shrimps in the acute

stage may have been switched off, therefore

making WSSV infected shrimps in this stage less

prone to the disease and clinical manifestation is

repressed as well. Furthermore, high temperature

inhibits the virus’s expression of VP28 protein, an

envelope protein that plays a key role in the initial

steps of systemic WSSV infection in shrimps (van

Hulten et al., 2001), therefore decreasing the

probability of WSSV infection in shrimps.

Tendencia and Verreth (2010b) mentioned that

exposure to low water temperature could lead to

WSSV infection (Tendencia et al., 2010b), as

observed in the study, i.e., Agoo with lower water

temperature has a higher rate of incidence of

WSSV infection. This is attributed to the increase

in viral replication and the decrease in the

immune response of shrimp (Vidal et al., 2001;

Reyes et al., 2007), making them more susceptible

to the infection. Shrimps that grow during warmer

season are less likely to experience WSSV

infection (Corsin et al. 2005). This justifies the

findings of the current study, i.e. the low incidence

of WSSV in wild PWS collected in both sites.

Shrimps are exothermic animals, making their body more susceptible to change contingent on environmental conditions. Significant evidence suggest that at warmer temperatures, shrimps are protected from WSSV infection (Lin, Hung, Leu, Wang, Kou, & Lo, 2011), such that temperatures of 32-33ºC can significantly reduce their mortality (Vidal et al., 2001 as cited in Lin et al., 2011). Lin and his colleagues (2011) observed that proteins NAD-dependent aldehyde dehydrogenase (ALDH) and heat shock protein 70 (HSP70) upregulated at 32ºC. They also observed that specific silencing of ALDH and HSP70 by double stranded ribonucleic acid (dsRNA) led to severe WSSV infection in most of the WSSV challenged shrimps 48 hours post-infection (hpi). They elaborated that the ability of ALDH to mediate the hyperthermic protection of shrimps from WSSV infection is due to its ability to oxidize toxic aldehyde to the less harmful carboxylic acid, thus this detoxification process indirectly help the host to counter attack WSSV. HSP70, on the other hand, is believed to interact with the WSSV structural protein VP28 so as to prevent viral infection and to chaperone/transport ALDH from the cytoplasm to the mitochondrial matrix. This may then also be a possible explanation to the “moderate” and “low” occurrence of WSSV in PWS of Agoo and Aringay, respectively.

Salinity changes have been correlated

with increased susceptibility of PWS to WSSV (Yu

& Guan, 2003; Peinado-Guevara & Lopez-Meyer,

2006). Tendencia et al., (2010) and Peinado-

Guevara and Lopez-Meyer (2006) also mentioned

that salinity fluctuations of sea water by heavy

rains, or frequent storms contributes to increased

viral loads in shrimp and the possibility of a higher

prevalence of the WSSV. Thus, it can be said that

increased precipitation caused by rainfall

decreases the salinity level of the sea water.

Tendencia et al., (2010) also suggested that WSSV

outbreak can be triggered during low salinity

levels associated with decreasing water

temperature. Correlatively, while precipitation

may indicate change in salinity, it might also

indirectly affect the susceptibility of PWS to

WSSV. Data shown in Accuweather states that

Agoo had a precipitation level of 0 mm, 24 mm, 15

mm, 46 mm, and 0 mm on the dates of collection.

While in Aringay, it was recorded on the same

website to have a precipitation of 46 mm, 0 mm,

24 mm, 0 mm, and 0 mm respectively on the dates

of collection. Looking at these quantities, the

171

precipitation level is obviously fluctuating in an

indistinctive manner, which also suggest that

salinity did also change from day to day.

Additionally, the data proposes that Agoo had a

higher average precipitation (17 mm as compared

to Aringay which is 14 mm), thus decreasing the

salinity on higher value, and therefore increasing

the sensitivity of PWS to WSSV. This might be one

of the reasons why Aringay has a lower RI of WSSV

in PWS than in Agoo. According also to the study

of Chakrabarty et al., (2013) where they have

investigated the prevalence of WSSV in three

different seasons, the pre-monsoon, monsoon,

and the post-monsoon seasons in India, WSSV

prevalence is lowest during post-monsoon season,

whereas the highest prevalence is recorded to be

during the monsoon season. This may be because

of the fluctuation of salinity that they have

accounted. Relating this to our study, the dates of

our collection of PWS is considered as pre-

monsoon season, where there were some or nearly

frequent rainfall incidents that indicates monsoon

season is approaching. Meaning, there wasn’t

much precipitation that occurred yet, but may

have caused the salinity to decrease. Fresh water

input occurs at the sea surface due to precipitation

and river inflow, thus reducing salinity (Talley,

2002). This suffice the fact that salinity is reduced

in higher precipitation as related to the study of

Chakrabarty et al. (2013). On the other hand,

during the post-monsoon season, they observed

that a relatively low WSSV prevalence exist,

perhaps due to the fact that the sea water volume

may not have been disturbed and possibly

decreased in volume by evaporation, thus

maintaining its salinity content or increasing its

salinity, respectively.

Sequence Analysis of WSSV DNAs by PCR First Step PCR PCR products were labelled according to the first two letters of the place where they are acquired. Ag1, Ag2, Ag3, Ag4, and Ag5 are samples from Brgy. San Julian Norte Agoo, while Ar1, Ar2, Ar3, Ar4, and Ar5 are the samples from Brgy. Dulao, Aringay. Figure 1 shows that the bands from each line are roughly separated. This is normal since the researchers did two-step PCR. The first and last lines are the negative control i.e., P. vannamei that

do not manifest the clinical gross sign of WSSV for both areas. The deviance of these bands in disparity to the others clearly shows the difference between a positive WSSV and the negative control. The second line, labelled as (+) shows the positive standard provided in the detection kit. It is evidently noticeable that Ag1-5 and Ar1-5 are positive as revealed by the first step PCR.

Fig. 1. First step PCR Electrophoresis. (-) indicates the negative control for Agoo (left) and Aringay,

respectively. Ag1-Ag5 are the samples taken from San Julian Norte, Agoo, while Ar1-Ar5 are from Dulao,

Aringay.

Nested PCR First step PCR is just a presumptive assessment. To assure the presence of WSSV and determine the number of base pairs, Nested PCR was

performed. Nested PCR is a modification of PCR which intends to reduce non-specific binding in products due to the amplification of unexpected

172

primer binding sites. This is but, a more extensive amplification reaction than the first step PCR. In this study, this was done by the addition of the IQ2000™ WSSV Detection Kit’s Nested PCR premix to the amplified PCR product from the first reaction.

Figure 2.A and 2.B show the result of the Nested PCR performed from the Agoo and Aringay samples, respectively. Lane one shows the Molecular weight mark which indicates the probable sizes of the bands. Lane 2 illustrates the WSSV Detection kit negative (-) standard and the last lane displays the negative control from the samples. Figure 2.C serves as a reference for the typical diagnostic result generated by the WSSV

detection kit used in this study. The amplicons reflected on the agarose gel evidently shows the similarity of the Ag1-5 samples. All of these samples indicate a positive WSSV having at least a band in 333 bp indicator which signposts a moderate to severe infection of WSSV. Ag1, Ag2, and Ag3 has a vague band near the 630bp line which signals a moderate septicity to WSSV infection. On the other hand, Ag4 and Ag5 has only one band at 333bp indicator. This signifies a light defilement of WSSV in the sample. The result of this gel electrophoresis shows that 100% of the samples caught in Agoo, La Union expressed WSSV infections.

Fig. 2. Nested PCR Electrophoresis for Agoo (A) and Aringay (B) samples. Typical diagnostic results generated

by IQ2000TM WSSV Detection and Prevention System (C) where lanes 1, 2, 3, and 4 indicate a severe,

moderate, light, and very light infection, respectively. Lanes 5 and 6 as negative control, lanes 7, 8 and 9

indicating a 2000, 200, and 20 copies per reaction of WSSV+ standard respectively and lane M showing the

molecular weight marker 848 bp, 630 bp, 333 bp.

The results from the gel electrophoresis of the samples caught in Aringay, La Union, shows a partly synonymous bands to the Agoo, La Union samples. Ar2, Ar3, and Ar5 presents a moderate infection of WSSV considering the vague bands on the 630bp line. While the band on Ar4 shows a light infection of WSSV. Ar1 also shows a light infection showing unclear bands on the 630bp line. Pursuant to the goals of the study, the bands

of the gel electrophoresis came out to be as expected.

All of the samples in both areas are proven

positive but there is a low severity, probably due

to the high temperature which slowed down the

replication of WSSV in the shrimps and decreased

its virulence. This is because it is said to be that at

high temperatures, immune system of the shrimp

173

is unchanged unlike in low temperature, and their

immune response degrades. It is also very evident

that the bands on the 333bp line, like the earlier

samples, are very similar in terms of form. This

shows the quality of the PCR product and a

manifestation that there were no contaminations

within the sample.

PCR Purification

The bands to which the samples extended are noticeably almost identical to each other. Ar3 seems to deviate in terms of band size but, nonetheless, the concentration is sufficient. After purification, primers and other content of the first and nested PCR premix are removed from the PCR product.

Figure 3.A shows the photographic data

before PCR product purification of Agoo and

Aringay samples in gel electrophoresis. And Figure

3.B shows the after output, which is the Purified

PCR product obtained from the PGC-DSCF.

Apparently, the bands are roughly separated again

and did not mark an accurate form. This is

expected since the PCR products are newly

purified which means that the only content of this

is the amplified PCR product. Furthermore, the

amplicons shown have high concentration and is

ready for DNA sequencing.

Fig. 3. Electrophoresis of PCR Product before (A) and after PCR purification (B).

DNA Sequencing

Only six samples were roughly sequenced,

namely Ag2, Ag3, Ag4 and Ar1, Ar2, Ar3. The other

four samples Ag1, Ag5, Ar4, and Ar5 were not

sequenced at all. Most probably, the factor that

affected the process was the inappropriate cycle

sequencing conditions used by the facilitating

institution. This greatly affects the quality of the

sequence since the optimum cycle conditions

must be met accordingly. Another might be that

the primers used were not matched accordingly to

the template. This could be the lesser feasible

cause since the amplicons and bands revealed in

the series of gel electrophoresis are high in

concentration and non-deviant to each other in

terms of base pairs. Allegedly, the unsequenced

samples have NNN’s in their sheet.

Basic Local Alignment Sequencing Tool (BLAST) Results

The acquired sequences from the samples

were analyzed using BLAST specifically BLASTn or

the nucleotide query for BLAST. Sequences were

queried to confirm the relativity of the sequenced

samples to pre-existing strains of WSSV from

FASTA database. Quantities resulted from this

analysis include Max score, Total Score, E – value

(EV), and other less significant data. Each of the

sequenced samples presented a close relativity

with WSSV from different countries in Asia. As

observed in the appended figures, the EV of the

BLAST results of the sequenced samples are

considerably low. By the definition of E- value, it

is the parameter that describes the number of hits

one can “expect” to see by chance when searching

a data base of a particular size as explained in

National Technology of Biotechnology

Information (NCBI). The lower the EV, the more

likely the samples are connected. Interestingly,

Ar2 of the sequenced samples deviated

exponentially amongst the group. Boot strap (BS)

values in the Maximum Composite Likelihood

Tree also suggest that Ar2 sample is, by far, less

related to the other sequenced samples since it

174

presented the lowest BS Value compared to the

other. Nevertheless, scoring an 8 in EV is still a

likeable happening in this case because short

sequences are being compared (at most 250 - long

sequences), therefore, reducing the error hits. In

addition, Ar1 has an EV of 2x10-4 or 0.0002 error.

Given the fact that EVs closer to zero indicates a

more reliable sequence, it is indicative that this

sample is indeed accurate. In the same manner,

Ag2 presents a reliable sequence having a four-

decimal EV of 0.0007 or 7x10-4. Other E – values

are very diminutive as it didn’t even reached the

value of “1”. With this, we could say that the

samples are truly WSSV strains.

The sequences of the samples fore-stated

earlier were imported to MEGA7. Sequences were

aligned using ClustalW. Two alignments were

made and this preference was used in both

process. The first was done by the alignment of the

sequenced samples Ag2, Ag3, Ag4 and Ar1, Ar2,

Ar3. The second was done by the alignment of the

samples with pre-existing WSSV strains from

NCBI databases. These isolates were based from

the primer used in the past analyses with respect

to the sequence 5’- AAT GGT CCC GTC CTC ATC

TCA – 3’ forward and 5’ – GCT GCC TTG CCG GAA

ATT – 3’ reverse. Six pre-existing gene sequences

of WSSV were downloaded from FASTA database

and were aligned with the samples collected in

this study.

Figure 4 shows the Maximum-likelihood

Tree of the sequenced samples. The numbers

appearing on the nodes of the terminal branches

are Bootstrap values (BS Values). These BS values

indicate the reliability of the relationships

between the samples given. Quantities exceeding

a BS value of ≥70 are considered to be reliable, ≥50

as overestimation of accuracy, and ≥95 indicates

that the clade is real (Hillis & Bull, 1993). The tree

shows that Ag3 and Ar1 has a BS value of 80 in their

internal node which means that the clade is

nevertheless acceptable. The tree also suggests

that Ag4 is also closely related to Ag3 and Ar1

having the same BS value. On the other hand, Ag2

and Ar2 has a BS value of 64, to which can be a

result of orthology which forms a speciation of the

different samples, which is, a little less reliable

than of the earlier values yet acceptable as far as

the standards are concerned.

Fig. 4. Maximum Likelihood (ML) Tree of the Samples as revealed by MEGA7.

The relationship between the samples and

from other isolates downloaded in FASTA database is shown in Figure 5. The isolates were WSSV strains K-LV1 gene, EG3 gene, CN02 gene, Collagen-like protein gene complete cds, CN01 gene, and ORF2311 gene partial cds. As you can see in the main branch of the internode, we have a BS value of 100 which shows that our samples are closely related to the WSSV genes downloaded from NCBI. Interestingly, Ag2 and WSSV strain K-LVL1 has a high BS value of 84, which means that these two are sharply related considering that they have already diverged from the main branch.

The K-LV1 gene of WSSV is an isolate of

South Korea (WSSV-KR). Virus strain CN01, CNO2

and ORF2311 are isolates from Xiamen, China.

WSSV collagen-like protein gene is from Taiwan

while WSSV strain EG3 is from the Mediterranean

and Gulf of Suez, Egypt. K-LV1 gene is homologous

to Ag2 of the sample considering the seas of

collection is within China Sea- South Korea lies on

East China Sea while Western Luzon lies on the

South China Sea, thus, the probability of shrimp

migration is eminent since the distance between

the mentioned seas is not that vast which in result,

shows a similarity in the observed gene sequences

(Altschul, Madden, Schäffer, J. Zhang, Z. Zhang,

Miller, & Lipman 1997).

175

Fig. 5. ML Tree of the Samples with Pre Existing Isolates.

Korean shrimp industry has been affected

by WSSV outbreak in the year 2004 and caused a

major factor that is responsible for approximately

67% mortality rate (MOMAF, 2004). According to

Seok et al., practices to eliminate the disease have

been involved to assist farmers in screening

shrimp brood stocks for WSSV, and yet such

practices have not been applied in most of Korean

farmers. In fact, many farmers do not use

exclusion fences to contain WSSV-infected

organisms, including shrimps and crabs

(Withyachumnarkul et al., 1996). During

monsoon seasons, strong sea water currents drive

different organisms in the sea causing them to

wander in places and force them to aggregate thus

causing a mix in population diversity, and

therefore increases the chance of horizontal

transmission of WSSV into shrimps

(Withyachumnarnkul et al., 2003). Both South

Korea and Philippines are located on the Northern

Hemisphere and the distance between the two is

roughly 1411 miles, therefore it is possible for

shrimp to migrate, especially during typhoon and

strong monsoons. This may possibly explain the

similarity in the DNA of the Ag2 sample obtained

in Agoo and the K-LV1 gene of South Korea

obtained from the FASTA database. Another

possible reason of close similarity of DNA between

the samples of this study and those obtained in the

FASTA database is due to careless importation.

CONCLUSIONS

Based on the results of the study, the following conclusions were drawn: 1. The low rate of incidence and the light to

moderate severity of WSSV infection observed in L. vannamei samples collected in Agoo and Aringay, La Union may probably be accounted to the high water temperature since it causes the upregulation of NAD-dependent aldehyde dehydrogenase (ALDH) which mediates in the hyperthermic protection of shrimps from WSSV infection and heat shock protein 70 (HSP70) which adversely intercepts the viral replication and inhibits the expression of VP28 protein.

2. As exemplified through molecular analysis, the samples from both sampling stations are closely related to each other. Also, WSSV Strain K-LV1 gene is firmly affiliated to Ag2 as confirmed over a Maximum Composite Likelihood Tree (MCLT). Migration of L. vannamei to nearby coastal areas may account for the observed close relationship between the Agoo and Aringay samples and K-LV1 gene and Ag2. Exportation, seemingly, can also be considered as a factor since the Philippines had resumed its exportation of PWS to different parts of U.S.A and Asia, especially Korea and China.

RECOMMENDATIONS

Based on the conclusions of the study, the following recommendations are suggested: 1. As categorized as low – mild rate of incidence

of WSSV in both areas of study, the condition

is seemingly not alarming. However, persistent occurrence of WSSV and ignoring the causes of WSSV to PWS stated on this study might increase WSSV incidence,

176

therefore proposing possible loss in the shrimp industry. In this regard, it is hereby recommended that before the vectors of this virus increase, shrimp farmers and hatchery owners should be freed from ignorance in this matter. This will be made possible with the help of private or public Fishery-related agencies, and of course, with the endorsed help from Local Government Units.

2. Measurement of abiotic factors including seawater temperature, pH, salinity, etc. may also be evaluated to be able to truly confirm their effects to WSSV and PWS.

3. A wider range of sampling areas and a greater amount of samples may be covered in order to

understand the phylogenetic relationships among variants of the virus. Furthermore, more PWS samples should be subjected to molecular analysis for a more accurate verification of WSSV. Different primers associated with WSSV may also be tried in molecular analysis to widen the bounds of diversity in the results. Histopathological analysis should also be performed to further assess the severity of WSSV in the shrimp tissue because it is cheaper compared to molecular analysis. Additionally, other software imparting phylogenetic analysis such as PHYLIP, PAUP*, Crux, and others can be used to create a rigorous MCL Tree.

LITERATURES CITED

1. Accuweather. (2015). Retrieved on January 2016 from http://www.accuweather.com/en/ph/aringay/263754/july-weather/263754?monyr=7/1/2015

2. Accuweather. (2015). Retrieved on January 2016 from http://www.accuweather.com/en/ph/agoo/263758/july- weather/263758?monyr=7/1/2015

3. Altschul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller, W., & Lipman, D.J. (1997). “Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Research. 25:3389-3402. Retrieved on Januray 23, 2016. From http://www.ncbi.nlm.nih.gov/pubmed/9254694

4. Animal and Plant Health Inspection Service (APHIS). (1999). Outbreak of Shrimp Viral Disease in Central America: Situation Report. Retrieved on January 23, 2016. from https://www.aphis.usda.gov/animal_health/animal_dis_spec/.../wssv.pdf

5. Chakrabarty, U., Mallik, A., Mondal, D., Dutta, S., Mandal, N. (2014). Assessment of WSSV Prevalence and Distribution of Disease-resistant Shrimp among the Wild population of Penaeus monodon along the West Coast of India. Retrieved on January 27, 2016 from www.ncbi.nlm.nih.gov/pubmed/24681359

6. de la Peña, L.D., Lavilla-Pitogo, C.R., Villar, C.B.R., Paner, M.G., Sombito, C.D., & Capulos, G.C. (2007). Prevalence of white spot syndrome virus (WSSV) in wild shrimp Penaeus monodon in the Philippines. Retrieved on January 27, 2016 from http://www.ncbi.nlm.nih.gov/pubmed/18062468

7. de la Peña, L.D. (2004). Transboundary Shrimp Viral Diseases with Emphasis on White Spot Syndrome Virus (WSSV) and Taura Syndrome Virus (TSV). Retrieved on January 23, 2016 from https://repository.seafdec.org.ph/handle/10862/1683

8. Lan, J., Pratanpipat, P., Nash, G., Wongwisansri, S., Wongteerasupaya, B., Withyachumnarkul, B., Thammasart, S., & Lohawattanakul, C. (1996). Carrier and Susceptible Host of the Systemic Ectodermal and Mesodermal Baculovirus, the causative agent of White-spot Disease in Penaeid Shrimp, pp 213-214. In: World Aquaculture ’96 Book of Abstracts, The 1996 Annual Meeting of the World Aquaculture Society, January 29-February 2, 1996, Queen Sirikit National Convention Center, Bangkok. Retrieved from January 25, 2016 from pubs.iclarm.net/Naga/Naga24-3&4/pdf/aquabyte%203.pdf

9. Lightner, D.V. (1996). Viral Diseases, pp. 1-72. In Mcvey, A. (ed.), A Handbook of Shrimp Pathology and Diagnostic Procedures for Disease of Cultured Penaeid Shrimp. World Aquaculture Society, Baton Rouge, LA, U.S.A. Retrieved on January 28, 2016 from www.oirsa.org/aplicaciones/.../CAMARONPATOLOGIA.pdf

10. Lo, C.F., Ho, C.H., Peng, C.H., Hsu, H.C., Chiu, Y.L., Chang, C.F., Liu, K.F., Si, M.S., Wang, C.H., and Kou, G.H. (1996). White Spot Syndrome (WSSV) detected in cultured and captured shrimp, crabs, and other arthropods. Dis. Aquat. Organs. 27: 212-225. Retrieved on January 28, 2016 from https://www.researchgate.net/publication/250221338_White_spot_syndrome_baculovirus_WSBV_detected_in_cultured_and_captured_shrimp_crab_and_orthropods

11. Magbanua, F.O., Natividad, K.T., Migo, V.P., Alfafara, C.G., de la Peña, F.O., Miranda, R.O., Albaladejo, J.D., Nadala, E.C. Jr, Loh, P.C., & Mahilum-Tapay, L. (2000). White spot syndrome virus (WSSV) in cultured Penaeus monodon in the Philippines. Retrieved on February 10, 2016 from http://www.ncbi.nlm.nih.gov/pubmed/10986648

12. Mallik, A., Chakrabarty, U., Dutta, S., Mondal, D., & Mandal, N. (2013). Study on the Distribution of Disease-Resistant Shrimp Identified by DNA Markers in Respect to WSSV Infection in Different Seasons Along the Entire East Coast of India Aiming to Prevent White Spot Disease in Penaeus monodon. Retrieved on January 23, 2016 from http://www.ncbi.nlm.nih.gov/pubmed/24735185

13. Maningas, B.B., Nicolarosa, A.D.D., Maralit, B.A., Caipang, M.A., Santos, M.D., & Calpe, A. (2014). Utilization of Loop-mediated Isothermal Amplification (LAMP) Technology for Detecting White Spot

177

Syndrome Virus (WSSV) and Vibrio spp. in Litopenaeus vannamei in Selected Sites in the Philippines. Retrieved on February 10, 2016 from http://philsciletters.org/2014/PSL%202014-vol07-no02-p309-316%20Maningas.pdf

14. Maralit, B., Caipang, C., Santos, M., & Maningas, M.B. (2011). PCR detection of white spot syndrome virus (WSSV) from farmed Pacific white shrimp (Litopenaeus vannamei) in selected sites of the Philippines. Retrieved on January 23, 2016 from http://www.bioflux.com.ro/aacl

15. Moser, J.R., Galván Álvarez, D.A., Mendoza Cano, F., Encinas Garcia, T., Coronado Molina, D.E., Portillo Clark, G, Marques, M.R.F., Magallón Barajas, F.J., & López, J.H. (2011). Water Temperature Influences Viral Load and Detection of White Spot Syndrome Virus (WSSV) in Litopenaeus vannamei and Wild Crustaceans. Retrieved on January 28, 2016 from http://www.academia.edu/11556631/Water_temperature_influences_viral_load_and_detection_of_White_Spot_Syndrome_Virus_WSSV_in_Litopenaeus_vannamei_and_wild_crustaceans

16. Reddy, A., Jeyasekaran, G., Shakila, R. (2013). Morphogenesis, Pathogenesis, Detection and Transmission Risks of White Spot Syndrome Virus in Shrimps. Retrieved on February 10, 2016 from http://astonjournals.com/faj

17. Seok, S.H., Baek, M.W., Lee, H.Y., Kim D.J., Chun, M.S., Kim, J.S., Chang, S.O., Park, J.H. (2006). Retrieved on January 23, 2016 from eanimal.snu.ac.kr/Aboutus/paper/papers/JMB2007shrimp.pdf

18. Tendencia, E.A., Bosma, R.H., & Verreth, J.A.J. (2010). White Spot Syndrome Virus (WSSV) Risk Factors Associated with Shrimp Farming Practices in Polyculture and Monoculture Farms in the Philippines. Retrieved on February 15, 2016 from http://www.elsevier.com/locate/aqua-online

19. Tendencia, E.A. & Verreth, J.A.J. (2010). Temperature Fluctuation, Low Salinity, Water Microflora: Risk Factors for WSSV Outbreaks in Penaeus monodon. Retrieved on January 23, 2016 from http://cmsadmin.atp.co.il/Content_siamb/editor/63.2011.548,%207%20pages.pdf

http://philsciletters.org/2014/PSL%202014-vol07-no02-p309-316%20Maningas.pdf

http://philsciletters.org/2014/PSL%202014-vol07-no02-p309-316%20Maningas.pdf

http://www.elsevier.com/locate/aqua-online

178

Antiteratogenic Property of Ginger (Zingiber officinale) Rhizome Extract in Mice

Ma. Winde Carl P. Leonen, Shulamite S. Abrogar, Shulamit T. Aspiras, Mark Anthony C. Capiz, Felomina Rose

E. Dacanay, and Elizabeth I. Olarte Abstract

Plant products are being explored to discover possible sources of bioactive compounds that would inhibit the occurrence of developmental abnormalities.

Zingiber officinale rhizome extract was investigated for its antiteratogenic property by assessing the reproductive performance of mice given different concentrations from day 1 to 15 in terms of implantation and gestation indices, % dead implants, % fetus with morphological abnormalities, and % fetus with skeletal abnormalities. The gross morphology and skeletal organogenesis were also examined.

The phytochemicals detected in Zingiber officinale were phytosterols, saponins, diterpenes, triterpenes, flavonoids and alkaloids. Results showed that 25, 50, 100 and 150 mg/kg extract varied significantly in terms of the parameters measured. Evidently, the 50 mg/ kg rhizome extract significantly counteracted the effect of retinoic acid (RA); whereas, 25, 100, and 150 mg/kg slightly inhibited the teratogenic effect of RA suggesting that Z. officinale rhizome extract could be a potential medicine in the fight against teratogenesis.

Keywords: antiteratogenic property, developmental abnormalities, Zingiber officinale

Introduction

Today, unpredictable factors can affect the birth of every organism. Life gently depends on the mother, on what she does during the span of pregnancy. Congenital malformations are anatomical or structural abnormalities present at birth but sometimes they remained undiagnosed until later in life. These are caused by genetic factors (chromosomal abnormalities as well as single gene defects); some are caused by environmental factors like drugs, toxin, infectious etiologies, and mechanical forces; or can be multifactorial etiologies (a combination of environmental and genetic factors (Chung, 2010).

Statistics show that a small percent of congenital malformations are caused by environmental factors as compared to the genetic factors, but then, small things come also with great effects. In line with this, researches are conducted to search for possible sources of compounds which are able to inhibit the effects of these environmental factors.

Teratology is the study of abnormal development in embryos and the causes of congenital malformations or birth defects (Chung, 2010). Abnormalities may become visible on the surface of the body or internal to the viscera. A teratogen is an agent that can give rise to congenital malformation. Teratogenic agents

cause around 7% of congenital malformations resulting to mental retardation during both embryonic and fetal periods. Teratogens can cause teratogenic effects because they have the ability to cross the placenta. During periods of rapid differentiation, embryo is most susceptible to teratogenic agents. It is the most critical period in the development of an embryo or in the growth of a particular organ because it is the time of most rapid cell division.

It would be promising if a plant can exhibit treatments of diverse diseases. Today, with higher and deeper knowledge in science and advanced technology, researches about these natural medicines are being conducted. Plants are being tapped as a source of natural medicines.

Medicinal herbs are the rich sources of synthetic and herbal drugs before and even today. They contain phytochemicals that are cure for various diseases. Ginger is a hot herb today and lots of studies have shown that it is a useful medicinal source. Ginger (Zingiber officinale) originates in Southeast Asia and now is cultured in West Indies, Africa, and other tropical regions. Ginger is a perennial herb that grows up to 1.5 meter, with asymmetric flowers but does not grow in the wild. The underground stem or the rhizome, the horizontal stem from which the roots

179

grow, is the main portion of ginger that is consumed. (Singletary, 2010).

Many reviews have been devoted to specific aspects of ginger’s actions. Active ingredients of ginger can be potential candidates in the prevention and treatment of diseases via modulation and biological activities. The active compounds serve as agent for anticancer, antiplatelet, anti-ulcerogenic, antimotion and antinauseant, anti-viral, anti-hyperlipidemic, anti-diabetic, anti-emetic, antimicrobial and antitumor via modulation of genetic pathways such as: activation of tumour suppressor genes, modulation of apoptosis and inhibition of VEGF. It was also shown to play a vital role in anti-inflammatory process. Likewise, it has shown antioxidant activity by preventing the damage of macromolecules caused by free radicals and other oxidative stresses. It regulated blood glucose and

lipid levels, inhibited nausea due to chemotheraphy, hyperemesis gravidarum, motion sickness/seasickness and played a role in chemo-protective and neuroprotective effects. It was also effective in osteoarthritis. Its gastroprotective, hepato-protective and hypotensive effects were also evident. It exerted abortive and prophylactic effects in migraine headache without any side effects and alleviated rheumatoid arthritis/ osteoarthritis/ joint and muscle pain. Ginger and its constituents play a significant role in hepato-protection (Singletary, 2010; Rahmani et al., 2014) On the other hand, the antiteratogenic property of ginger remained unexplored. Since ginger is generally considered a safe herbal medicine (Weidner and Sigwart, 2000), this study was conceptualized to find out if it has antiteratogenic effect after it was already proven to be non-teratogenic.


The study aimed to evaluate the antiteratogenic property of Zingiber officinale methanol rhizome extract.

Specifically, it sought to: 1. determine the secondary metabolites present in ginger; 2. compare the reproductive performance of mice treated with the different concentrations of

Zingiber officinale rhizome extract in terms of: a) gestation index; b) % dead implants; c) % fetus with morphological abnormalities; d) % fetus with skeletal abnormalities;

3. assess the gross morphology in terms of the development of the head, eyes, ears, and appendages including the forelimbs, hind limbs, and digits; skin texture and coloration, and;

4. examine the extent of skeletal organogenesis of the treated as compared to their untreated mouse counterparts.

Methodology Research Design

The study utilized the experimental method that focused on the use of standard laboratory

operations involved in bulk extraction and the determination of the antiteratogenic property of Zingiber officinale rhizome extract in mice. The study used six treatments which are the following:

T1 - 0.2 ml distilled water (negative control) T2 – 4 g of retin A = 2mg RA per 20g mouse (positive control) T3 – 25 mg Zingiber officinale rhizome extract T4 – 50 mg Zingiber officinale rhizome extract T5 – 100 mg Zingiber officinale rhizome extract T6 - 150 mg Zingiber officinale rhizome extract

T3, T4, T5, and T6 were dissolved in 0.2 ml distilled water per 20 g body weight of mouse. All treatments were done in triplicates.

Materials and Procedures Plant Material Mature rhizomes of Zingiber officinale Rosc. (ginger) were collected from their natural habitat at a

distributor’s plantation in Urdaneta, Pangasinan. The rhizomes of the ginger were perfectly mature for better and effective extraction. Test Organism

ICR bred strain was used as test organism. They were about six to eight weeks old weighing 25-30 g. The reproductively mature females were used for mating. They were purchased from Petville pet shop, San Fernando City, La Union. Procedures

180

For two weeks, the mice were acclimated to laboratory condition in order for them to adjust to the new environment in which they were brought in, allowing them to be maintained in their normal condition. They were fed with Pigrolac grower pellet and Hagibis conditioner and water in ad libitum. Cages were provided as their house. Daily monitoring was done to check if the mice are getting along well in their new environment. Preparation of the bulk extract

Rhizomes of Zingiber officinale Rosc. (ginger) were removed from the soil, washed with clean water and air-dried to a weight of about 1 kg. They were cut into miniature pieces and homogenized using a blender. The homogenized sample was soaked in approximately 1L of methanol and then filtered. At a maximum temperature of 45°C, the filtrate was concentrated in vacuo using a rotary evaporator that gave the methanol extract a viscous, semisolid form. The extract was set aside for the succeeding antiteratogenicity assay.

Phytochemical Screening Two hundred fifty grams (250 g) of air/dried ground samples were submitted to the Science

Laboratory, Saint Louis University, Baguio City for qualitative testing of plants’ secondary metabolites like phytosterols, alkaloids, flavonoids, saponins, tannins, and phenolic compounds.

The model organism The mice that were selected at their reproductively mature state were mated. The ratio was two (2)

female mice to one (1) male mouse. The event of mating was monitored by the presence of vaginal plug in females which was designated as the first day of pregnancy. The pregnant mice were housed in separate cages. The other non-pregnant mice were allowed to remain in their cages until they got pregnant. The female mice were weighed every week for monitoring its increasing weight indicating that they are already pregnant.

Application of the teratogen Retin A, a well-known teratogen was the positive control used, and distilled water served as the

negative control. The pregnant mice were treated with Retin A during the first day of pregnancy with a gram of Retin A containing 500 microliter of all-trans retinoic acid. Four (4) g of Retin A is equivalent to 2mg Retinoic Acid per 20g mouse. These 4 grams Retin A were divided equally corresponding to the 15 days of application that gave an amount of 0.267 grams of Retin A administered per day on the shaved portion at the lower lumbar portion of the female mouse back.

Application of the plant extracts Different doses of methanol extract were orally administered for 15 days. The different treatment

concentrations used were: 25, 50, 100, and 150 mg per 0.2 ml for treatments 3, 4, 5, and 6 respectively. Dissection of pregnant mice At 16 days per coitum (dpc), the pregnant female mice were sacrificed through cervical dislocation

and dissected ventrally to expose the uterine horns. Live implants were assessed based on their skin color, manifestation of movement upon removal from the uterine horns, and their sensitivity to touch. The implantation index, gestation index, percent dead implants were also determined. After which, the placenta containing the embryos were separated from the uterine wall. The fetuses were then fixed overnight in fresh buffered paraformaldehyde (PFA) for the morphological and histochemical analyses.

Morphological examination Under the digital microscope, embryos were observed as to the following morphological change:

from lobular head to an elongated head with snout, delayed appearance or absence of otic and optic vesicles, delayed development or absence of forelimbs, hindlimbs and digits, excessive wrinkling of the fast growing skin, bulging of visceral and umbilical areas characteristics of the early stages, growth of the tail and changes in skin texture and color.

Histochemical analysis of skeletogenesis After overnight fixation in 4% paraformaldehyde, the embryos were fixed in 90% ethanol for 10 days.

Alizarin Red S staining method by Bowtell (1998) was adopted with modifications (see Appendix A). Alizarin red S has a greater affinity for Ca+2 resulting to a pink color so it is evident in the bones of the embryos.

Data Gathered

1. Secondary metabolites detected through phytochemical screening 2. Total number of implantations (live and dead implants) 3. Number of live implants 4. Number of fetuses with morphological abnormalities (MA) 5. Number of fetuses with skeletal abnormalities (SA) 6. Various morphological changes manifested by the mice in the different treatments 7. Various degrees of skeletal abnormalities Data Analysis

The reproductive performance of the mice treated with the different concentrations of ginger was evaluated using the following parameters with their corresponding formula.

181

Gestation Index = No. of live implantations x 100

Total no. of implantations % Dead implants = 100 – Gestation Index % Fetuses with Morphological abnormalities (MA)

= No. of fetuses with morphological abnormalities x 100 Total no. of fetus

% Fetuses with skeletal abnormalities (SA) = No. of fetuses with skeletal abnormalities x100 Total no. of fetus

The data were analyzed using the One-Way Analysis of variance (ANOVA) using the IBM SPSS Statistics 20. First, the data on antiteratogenicity analysis were expressed as mean ± SD. The data that were declared significant were analyzed using the Duncan’s Test to determine if there are real differences among treatments. A probability value of <0.05 was declared significant.

Results and Discussion Phytochemical Analysis

The phytochemical screening of Zingiber

officinale revealed the presence of secondary metabolites such as phytosterols, saponins, diterpenes, triterpenes, flavonoids and alkaloids. The screening also showed the presence of other

components like carbohydrates and reducing sugars. It is believed that these active components detected are responsible for the antiteratogenicity of the Zingiber officinale rhizome extract in female mice.

Gestation Index

The gestation index for each treatment group describes the survival of the implants after exposure to the treatments. It is the proportion of live implants to the total number of implantations for the treatment groups.

Table 1 depicts the % gestation indices of the various treatments. It is shown that T4 at 50 mg/ 20g BW registered the highest mean %

gestation index among the treatments which is 94.97% compared to the other treatments. T6 on the other hand, registered the lowest % gestation index of 67.86%.

Univariate Analysis of Variance (ANOVA) shows that there was a significant difference among the various treatments.

Table 1. % Gestation Indices of Mice Exposed to the Different Treatments.

Treatments Mean

(% Gestation Index)

T1 - 0.2 ml distilled water (negative control) 100a T2 – 4g of retin A = 2mg RA (positive control) 0c T3 – 25 mg of Zingiber officinale rhizome extract (ZORE) 94.71a T4 – 50 mg of Zingiber officinale rhizome extract 94.97a T5 – 100 mg of Zingiber officinale rhizome extract 71.53b T6 - 150 mg of Zingiber officinale rhizome extract 67.86b

*Any means followed by the same letter/s are not c.v. = 19.69 % significantly different from each other

Duncan’s test further declared that T3 and T4 were significantly different from T5 and T6 but were not significantly different from each other. Both T3 and T4 are comparable to T1, the negative control. T5 and T6 were not significantly different from each other but were significantly different from T1 (the negative control) and T2 (positive control). Evidently, a lower concentration of the rhizome extract caused a higher gestation index as compared to higher doses (100 and 150 mg).

However, the higher doses of 100 and 150 mg of rhizome extract varied significantly from T2 (the positive control). This result reveals that higher doses of 100 and 150 mg rhizome extract gave lower gestation indices (GI) as compared to low doses of 50 and 25 mg rhizome extract. Expectedly, T2, the positive control, did not produce any live implant.

Ratnasooriya et al. (2009) forwarded that Black Tea (Camellia sinensis L.) contained

182

alkaloids and flavonoids that when administered to pregnant mice produce no risk and a high rate on the gestation index in its fetuses.

% Dead Implants

The dead implants in this study include dead fetuses characterized by a morphology that is underdeveloped for a 16 dpc fetus.

Table 2 depicts that among the treatments with the rhizome extract, T4 with 5.03% had the lowest % dead implants while T6 got the highest % dead implants.

Univariate analysis of variance on the mean % dead implants showed that the various treatments varied significantly from each other.

Duncan’s test further revealed that T3 and T4

varied significantly from T5 and T6 but were comparable to each other. T5 and T6 also gave insignificantly different mean % dead implants. Moreover, T3, T4, T5 and T6 varied significantly from T2 (the positive control). These observations suggest that higher doses of 100 and 150 mg rhizome extract induce higher % dead implants than a low dose of 25 and 50 mg ZORE.

Table 2. Mean % Dead Implants in Mice Exposed to the Different Treatments.

Treatments Mean

(% Dead Implants)

T1 - 0.2 ml distilled water (negative control) 0c T2 – 4 g of retin A = 2 mg RA (positive control) 100a T3 – 25 mg of ZORE 5.29c T4 – 50 mg of ZORE 5.03c T5 – 100 mg of ZORE 28.80b T6 - 150 mg of ZORE 32.14b

*Any means followed by the same letter/s are c.v. = 49 % not significantly different from each other Percent Fetus with Morphological Abnormalities

The percent morphological abnormality gauges the potential of a treatment to revert or inhibit morphological abnormalities.

Table 3 depicts that among the treatments, T4, 50 mg ZORE, gave the lowest mean morphological abnormalities. This implies that T4 was able to revert the occurrence of morphological abnormalities.

Univariate analysis of variance on the mean % fetuses with morphological abnormalities showed that the various treatments varied significantly from each other. Duncan’s test further revealed that T4 had significantly lower mean % fetus compared to T5 and T6. Moreover, T4 had significantly lower mean % fetus with abnormalities than T2, the positive control.

Table 3. Mean % Fetuses with Morphological Abnormalities

Treatments Mean

( % Fetus with Morphological Abnormalities )

T1 - 0.2 ml distilled water (negative control) 10.65c T2 – 4 g of Retin A = 2 mg RA (positive control) 96.11a T3 – 25 mg of ZORE 42.78b T4 – 50 mg of ZORE 20.65c T5 – 100 mg of ZORE 43.11b T6 - 150 mg of ZORE 45.66b

*Any means followed by the same letter/s are c.v. = 29.27 % not significantly different from each other

T3, T5 and T6 gave comparable results with each other. T3, T5 and T6 also varied significantly from T2. This observation suggests that higher doses of 100 and 150 mg slightly counteracted the occurrence of morphological abnormalities but a

dose of 50 mg ZORE significantly lessened the occurrence of morphological abnormalities. A low dose of 25 mg ZORE did not vary significantly from T5 and T6.

183

Morphological development of fetuses at 16 dpc exposed to the different treatments

Normal fetuses from untreated pregnant dams In T1 consisting of the mice which were

given distilled water, fetuses exhibited normal development at 16dpc. The fetuses showed translucent pink skin coloration due to the presence of normal blood vessels and organs like optic vesicles. Otic vesicles are visible. During the dissection, the fetuses started to breathe a few

seconds after they were removed from the uterine horns, indicating healthy and live fetuses. The head was somewhat elongated at the snout. The eyes and ears were prominent. Their extremities were well-developed, and the digits were clearly separated from each other. The body was slender compared to the c-shaped body at 10-11 dpc.

Early death and morphological abnormalities from Retin A-treated mice In T2 which are the Retin A-treated mice,

the presence of a remarkable number of dead implants was the most noticeable change observed. Upon removal from their placenta, the skins were pale and wrinkled, completely different from the untreated litters. There was no manifestation of movement or breathing signs.

From a lobular head, they became elongated with snout. Exposure of brain was evident because they were not enclosed by the skull. Bulging of the umbilical and areas which are characteristics of early stages were also

observed. Some of them gave a wrinkled state of skin showing the early death of the fetus within the womb of the dams that may occur within 10-16 dpc. Delayed appearance of otic and optic vesicles was also seen and as a result, the area of the eye bulged.

The limbs were shorter and the body sizes were small but all throughout the study, no litter showed absence of any part of forelimbs, hind limbs and digits. In addition, some known malformations were also evident like the growth retardation, exencephaly and exophthalmos.

Fetuses from pregnant dams treated with the different concentrations of Z. officinale

rhizome extract. The fetuses of mice from 25 mg (T3) and 50 mg (T4) Z. officinale rhizome extract treatments (see Appendix E) somewhat showed normal gross morphology similar to untreated litters. Evidently, the external structures that are present at 16 dpc were prominent including the presence of elongated head and the snout, eyes, ears which were partly covered by the skin. Most of the fetuses had slender body that is typical of 16d old fetuses. They have well-developed blood vessels that gave a pinkish coloration at exposure. Most of the fetuses also had well-developed skull that protect their brain. For the litters treated with 100 mg (T5) and 150 mg/ 20g of ZORE (T6) (see Appendix E), they resembled the Retin A-treated litters because some of malformations observed in the fetuses of the Retin A-treated mice were also seen in the mice treated with 100 and 150 mg ZORE.

The morphological data of fetuses from Retin A-treated mice reveal high presence of abnormalities. However, it was observed that with ZORE administration, the morphological data greatly improved. It means that the number of abnormalities decreased. The highest decrease of abnormalities was observed from treatment with 50 mg ZORE. This suggests that the antiteratogenic property of ginger was best at a dose of 50 mg ZORE.

Zingiber officinale was reported to have active ingredients indicating that they can be

potential candidate in the search for anti-tumour, anti-cancer, antioxidant agents (Singletary, 2010; and Rahmani 2014). Supporting this result, the Cassia alata leaves were found to have antitumor, antioxidant and antiteratogenic properties in a study of Olarte (2006). Its antiteratogenic effect was observed at 100 mg kg-1 bw but at the highest dose of 200 mg kg-1 bw, the teratogen was no longer counteracted. C. alata was also found to have phytosterols and flavonoids similar to Z. officinale which implies that the antiteratogenic activity of Z. officinale may be attributed to the presence of these two secondary metabolites.

In the study of Weidner and Sigwart (2001), the reproductive performance of mice was not affected by the ginger treatment. Examination of fetuses for external, visceral, and skeletal changes showed neither embryotoxic nor teratogenic effects of the ginger preparation. Based on these results, it was concluded that when administered to pregnant rats during the period of organogenesis, it caused neither maternal nor developmental toxicity at daily doses of up to 1000 mg/ kg body weight (Weidner and Sigwart, 2001). Moreover, Rahmani et al. (2014) showed that the doses of 2.5 g/kg body weight were tolerated without any mortality. But, when the dose was increased to 3-3.5 g/kg body weight, there was already 10-30% mortality.

184

Percent Skeletal Abnormalities The % skeletal abnormalities measures

the potential of a treatment to counteract skeletal abnormalities.

Univariate analysis of variance on the mean % fetuses with skeletal abnormalities demonstrated a statistical significance among the various treatments. Duncan’s Test further revealed that T4 varied significantly from T3, T5,

and T6 but T3, T5, and T6 did not vary significantly among each other. Moreover, T3, T5 and T6 varied significantly from T1 and T2. Evidently, all the Retin-A treated mice showed varying degrees of skeletal abnormalities. However, the mice treated with dH2O showed the lowest % fetuses with skeletal abnormalities.

Table 4. Mean Percent Fetuses with Skeletal Abnormalities

Treatments Mean

( % Fetus with Skeletal Abnormalities )

T1 - 0.2 ml distilled water (negative control)

7.40 d

T2 – 4 g of retin A = 2mg RA per 20g mouse (positive control) 100.00 a T3 – 25 mg of Zingiber officinale rhizome extract 59.92 b T4 – 50 mg of Zingiber officinale rhizome extract 37.24 c T5 – 100 mg of Zingiber officinale rhizome extract 58.58 b T6 - 150 mg of Zingiber officinale rhizome extract 60.29 b

*Any means followed by the same letter/s are not c.v. = 17.21% significantly different from each other Histochemical Analysis of the Skeleton using Alizarin Red S Staining

Fetuses from treated mice were subjected

to Alizarin-Red- staining that gave the skull, limbs, ribs and vertebra a red/purple coloration. The potassium hydroxide made the muscles a little transparent that revealed the bones. Apparently the tail skeleton did not uptake the stain.

Skeletal Development in the Fetuses

of Untreated Mice The control embryos (T1) showed normal

morphology with an estimated number of vertebrae as follows: 7 cervical, 13 thoracic, and 5 or 6 sacral vertebrae.

Skeletal Abnormalities on Retin A- treated Fetuses.

Retin A-treated fetuses showed several skeletal abnormalities which are likely observed under the digital microscope. The mice skeleton showed delayed osteogenesis as demonstrated by partially ossified bones. The bony structure derived from mesenchyme like the skull bones (frontal, nasal. temporal) were affected. Others showed partially unossified radius, ulna, tibia, humerus, fibula, and femur. Most of the fetuses showed partially unossified vertebrae, ribs and scapula.

Fetuses from Pregnant Dams Treated with the Different Concentrations of Z. officinale Rhizome Extract.

The fetuses of the mice from 50 mg extract (T4) showed similar skeletal development like the untreated litters. Although some fetuses from the mice treated with 25, 100 and 150 mg ZORE had normal litters, a considerable number of fetuses showed some skeletal abnormalities. Evidently, from the tally of skeletal abnormalities ranging from partially unossified skull, vertebrae, scapula, ribs and limb bones, the decrease in number of skeletal abnormalities was observed in T4. Apparently however, all treatments containing the extract have significantly higher % skeletal abnormalities than T1 but significantly lower than T2.

Nian (2006) demonstrated that saponins isolated from rhizome of Anemarrhena asphodeloides improved bone mineral density resulting to increased bone formation. The presence of saponins in Z. officinale may also account for the improvement in the development of the bones of the fetuses treated with 50 mg ZORE.


1. Phytochemical screening of Zingiber officinale revealed the presence of secondary metabolites such as

phytosterols alkaloids, saponins, diterpenes, triterpenes, and flavonoids. It is believed that these active components detected are responsible for the

185

antiteratogenicity of the Zingiber officinale rhizome extract in female mice.

2. The reproductive performance of mice showed the following results: a)The gestation index was affected by the treatment such that a dose of 50 mg ZORE had the highest % live implants while 150 mg ZORE has the lowest; b) Percent dead implant was greater at a dose of 150 mg ZORE while the lowest percentage was that of 50 mg ZORE; c) Morphological abnormalities were most likely seen at 150 mg ZORE whereas at a dose of 50 mg ZORE, few fetuses were seen to have abnormalities; d) % skeletal abnormalities were mostly seen at a dose of 150 mg ZORE. The lowest percentage of skeletal abnormalities was observed at a dose of 50 mg ZORE.

3. The untreated mice exhibited normal development at 16dpc. In retin A-treated

mice, varying degrees of abnormalities were observed namely: a change from

lobular head to elongated with snout, bulging of the umbilical and visceral areas,

wrinkled state of skin, delayed appearance of otic and optic vesicles, shorter

limbs, small body sizes, incomplete formation of the skull resulting to the

exposure of the brain, growth retardation, exencephaly and exophthalmos but all

throughout the study, no litter showed the absence of any part of the forelimbs,

hind limbs and digits. 4. A dose of 50 mg ZORE closely resembled a normal morphology characteristic of the fetuses born to the untreated mice having a well- developed skeletal system.

Recommendations Based on the findings and conclusions of the study, the following are recommended:

1. A concentration of 50 mg Zingiber officinale rhizome extract is highly recommended as the best dose because it registered the highest percent inhibition suggesting that it has the highest ability to counteract teratogenic agents.

2. The rhizome of Zingiber officinale was the only part of the plant used in the study; hence, the researchers recommend considering the antiteratogenic property of parts other than the rhizome.

3. The fetuses are recommended to undergo double staining method using the alcian

blue and alizarin red-S stain to exactly reveal which part of the skeleton are not completely ossified and remained in the cartilaginous stage.

4. Further studies using larger test animals like rabbits, guinea pigs and the like, may be done in order to have better evaluation of the potential of the plant as a standard procedure in screening for possible drugs for human consumption. If proven effective with higher animals, clinical trials involving human subjects may follow.

Literature Cited Ali, B.H., Blunden, G., Tanira, M.O., Nemmar, A. (2007). Some

phytochemical, pharmacological and toxicological properties of ginger (Zingiber officinale Roscoe): A review of recent research. Food and Chemical Toxicology, 46, 409–420.

Amin, A. and Hamza, A. (2006). Effects of roselle and ginger on cisplatin induced reproductive toxicity in rats. Asian J. Androl. 8, 607–612.

Chung, W. M.D. (2010). Teratogens and their effects. Jagetia G, Baliga M, Venkatesh P and Ulloor J. (2003). Influence of ginger

rhizome (Zingiber officinale Rosc.) on survival, glutathione and lipid peroxidation in mice after whole-body exposure to gamma radiation. Radiat. Res. 160, 584–592.

Kim J, Kim Y, Na K, Surh Y and Kim T. (2007). [6]-Gingerol prevents UVB- induced ROS production and COX-2 expression in vitro and in vivo. Free Radic. Res. 41, 603–614. Lopez, J., (2006). The effect of Glinus oppositifolius (L) A. DC. (papait) plant srude

extract on the gestation of mice. Don Mariano Marcos Memorial State University, South La Union Campus, Agoo, La Union.

Nian, H., Qin, L.P., Chen, W.S., Zhang, Q.Y., Zheng, H.C., and Wang, Y. (2006). Protective effect of steroidal saponins from rhizome of Anemarrhena asphodeloides on ovariectomy-induced bone loss in rats,. Acta Pharmalogica Sinica. June: 27(6), 728-34.

Olarte,E.I., (2006). In vitro and in vivo biological activities of compounds from Cassia alata L. leaves. Ph.D. Dissertation, University of the Philippines, Diliman, Quezon City.

Rahmani, A.H., Al shabrmi, F.M., Aly, S.M. (2014). Active ingredients of ginger

186

as potential candidates in the prevention and treatment of diseases via modulation of biological activities. Int J Physiol Pathophysiol Pharmacology, 6(2), 125-136.

Ratnasooriya, W. D. and Fernando, T. S. P. (2009), Effects of Sri Lankan Black Tea (Camellia sinensis L.) on Pregnancy of Rats. Basic & Clinical Pharmacology & Toxicology, 105: 361–365. doi: 10.1111/j.1742-7843.2008.00345.x

Siddaraju M and Dharmesh S. (2007). Inhibition of gastric H (+), K(+)- ATPase and Helicobacter pylori growth by phenolic antioxidants of Zingiber officinale. Mol. Nutr. Food Res. 51, 324–332.

Singletary, K. (2010). Ginger An Overview of Health Benefits. Weidner MS, Sigwart K. (2001) Investigation of the teratogenic potential of a

zingiber officinale extract in the rat. Reprod Toxicol. 15(1):75-80. Yemitan O and Izegbu M. (2006). Protective effects of Zingiber officinale

(Zingiberaceae) against carbon tetrachloride and acetaminophen induced hepatotoxicity in rats. Phytother. Res. 20, 997–1002.

http://www.ncbi.nlm.nih.gov/pubmed/?term=Weidner%20MS%5BAuthor%5D&cauthor=true&cauthor_uid=11137381

http://www.ncbi.nlm.nih.gov/pubmed/?term=Sigwart%20K%5BAuthor%5D&cauthor=true&cauthor_uid=11137381

http://www.ncbi.nlm.nih.gov/pubmed/11137381

187

Biodiversity of Mangroves in Selected Areas of the Second District of La Union, La Union, Philippines

Emil Ernest A. Llobrera, Chasteen Kyla C. Cabilatazan, Dina T. Cariño, Mary Grace V. Garcia, Alona M. Mabalot, and Prescilita M. Villanueva

Abstract Mangroves are integral in the role of sustaining aquatic resources. They are unique organisms with

numerous functions that benefit the entire biosphere; still and all, man’s knowledge is not sufficient to

prevent the losses mangroves have entailed and are currently having. This study aimed to identify the

biodiversity of mangroves in the selected areas of the Second District of La Union using natural observation,

literature review and Line Intercept Transect methods. Twenty three (23) mangrove species were identified

during the course of the study. The Simpson Index of Diversity recorded that Barangay Raois, Sto. Tomas, La

Union is the most diverse mangrove community because of its highest value of 0.94606 compared to the

other barangays. The Shannon Diversity Index of 2.839 was from Pudoc, Bauang, La Union while the

Equitablity Index value of 0.9870 was recorded from Narvacan, Sto. Tomas.

Keywords: biodiversity, mangroves, Second District of La Union