INFECTION AND IMMUNITY,0019-9567/98/$04.0010

Aug. 1998, p. 3492–3500 Vol. 66, No. 8

Copyright © 1998, American Society for Microbiology. All Rights Reserved.

Two-Dimensional Electrophoresis for Analysis of Mycobacteriumtuberculosis Culture Filtrate and Purification and

Characterization of Six Novel ProteinsKARIN WELDINGH,1 IDA ROSENKRANDS,1 SUSANNE JACOBSEN,2 PETER BIRK RASMUSSEN,1

MARTIN J. ELHAY,1 AND PETER ANDERSEN1*

Department of TB Immunology, Statens Serum Institut, Copenhagen,1 and Department of Biochemistry and Nutrition,Technical University of Denmark, Lyngby,2 Denmark

Received 26 January 1998/Returned for modification 24 March 1998/Accepted 5 May 1998

Culture filtrate from Mycobacterium tuberculosis contains molecules which promote high levels of protectiveimmunity in animal models of subunit vaccination against tuberculosis. We have used two-dimensionalelectrophoresis for analysis and purification of six novel M. tuberculosis culture filtrate proteins (CFPs):CFP17, CFP20, CFP21, CFP22, CFP25, and CFP28. The proteins were tested for recognition by M. tuberculosis-reactive memory cells from different strains of inbred mice and for their capacity to induce a skin test responsein M. tuberculosis-infected guinea pigs. CFP17, CFP20, CFP21 and CFP25 induced both a high gammainterferon release and a strong delayed-type hypersensitivity response, and CFP21 was broadly recognized bydifferent strains of inbred mice. N-terminal sequences were obtained for the six proteins, and the correspond-ing genes were identified in the Sanger M. tuberculosis genome database. In parallel we established a two-dimensional electrophoresis reference map of short-term culture filtrate components and mapped novelproteins as well as already-known CFP.

For a number of years, efforts to develop a subunit vaccineagainst tuberculosis (TB) have focused on proteins releasedfrom growing mycobacteria into the extracellular medium (3,31). These released proteins are generally believed to be re-sponsible for the high efficacy of live vaccine, Mycobacteriumbovis BCG, and recognition of these molecules may lead toearly immunological detection of the infected macrophagesand control of the disease. Subunit vaccines based on mixturesof culture filtrate proteins (CFPs) from Mycobacterium tuber-culosis have, in a number of studies, resulted in protectiveimmunity in animal models of TB (1, 25, 32, 39), and themolecules are recognized strongly during M. tuberculosis infec-tion in various animal models (22, 31), as well as in early stagesof pulmonary TB in humans (11).

Culture filtrate is therefore an attractive source of candidateantigens for a new vaccine and diagnostic reagents. Short-termculture filtrate (ST-CF) from M. tuberculosis is composed ofnumerous components, and so far only a minority of these havebeen isolated and characterized. In total, approximately 15proteins have been purified from culture filtrate; most of themwere initially identified by use of murine monoclonal antibod-ies (MAbs) (13, 15, 19, 30). In general, these proteins havebeen isolated among the abundant culture filtrate componentswhich are accessible for conventional purification (24, 30, 42).Studies of T-cell recognition and direct analysis of the poten-tial of these molecules in experimental vaccines have so farpointed to only a few culture filtrate antigens, notably Ag85and ESAT-6, as candidate antigens for a novel TB vaccine (2,24). Attempts to screen human cellular responses to separatedCFPs, on the other hand, have demonstrated that there are stillnumerous uncharacterized antigens of various molecularmasses to be identified (11).

In this study, we have focused on purifying new immunolog-ically active proteins from ST-CF by preparative two-dimen-sional electrophoresis (2-DE). Eleven proteins were purifiedfrom ST-CF, and six of these (CFP17, CFP20, CFP21, CFP22,CFP25, and CFP28) were previously uncharacterized proteins.An analytical 2-DE reference system for CFPs was established,in which previously characterized culture filtrate antigens aswell as the newly purified proteins were mapped. The genesencoding the novel proteins were identified, and the biologicalactivities of the proteins were evaluated in animal models ofTB.

MATERIALS AND METHODS

Bacteria and preparation of ST-CF. ST-CF was produced as described previ-ously (3). Briefly, M. tuberculosis H37Rv (8 3 106 CFU/ml) was grown in mod-ified Sauton medium on an orbital shaker for 7 days. The culture supernatantswere sterile filtered and concentrated on a YM3 membrane (Amicon, Danvers,Mass.).

Purification of native proteins from ST-CF. ST-CF was precipitated withammonium sulfate at 80% saturation. The precipitated proteins were removedby centrifugation and after being washed were resuspended in buffer containing8 M urea, 0.5% (wt/vol) CHAPS {3-[(3-cholamidopropyl)-dimethyl ammonio]-1-propanesulfonate}, and 5% (vol/vol) glycerol. Protein (250 mg) was separatedon a Rotofor Isoelectric Cell (Bio-Rad, Richmond, Calif.) in a pH gradient with3% Biolyt 3/5 and 1% Biolyt 4/6 (Bio-Rad). Fractions 9 to 15 were pooled andrefractionated on the Rotofor in the same buffer. The fractions obtained wereanalyzed by silver-stained sodium dodecyl sulfate-polyacrylamide gel electro-phoresis phosphate-buffered saline (SDS-PAGE), and fractions with similarband patterns were pooled, buffer exchanged to (PBS), and concentrated to 1 to3 ml on a Centriprep concentrator (Amicon) with a 3-kDa-cutoff membrane. Anequal volume of sample buffer (63 mM Tris-HCl [pH 6.8], 10% glycerol, 2%SDS) was added, and the protein solution was boiled for 5 min before furtherseparation on a Prep-Cell column (Bio-Rad) in a matrix of 16% polyacrylamideat 200 V overnight. Fractions containing pure proteins were collected. Samplesused for testing of in vivo or in vitro biological activity were washed three timeswith PBS on a Centricon concentrator (Amicon). The fractions were stabilizedwith 0.5% fetal calf serum (Gibco Life Technology, Inchinnan, Scotland), andSDS was removed by passing the sample twice through an Extracti-Gel D column(Pierce, Rockford, Ill.).

Cloning, expression, and purification of rCFP22 and rCFP25. All primersused for cloning and sequencing were synthesized with an ABI-391 DNA syn-thesizer (Applied Biosystems).

By using the cfp22 and cfp25 gene sequences found in the Sanger database, the

* Corresponding author. Mailing address: Department of TB Im-munology, Statens Serum Institut, Artillerivej 5, DK-2300 CopenhagenS, Denmark. Phone: 45 32 68 34 62. Fax: 45 32 68 30 35. E-mail: tbimm@ssi.dk.

3492

on April 25, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

following PCR primers were synthesized: cfp22 forward, ACAGATCTGTAATGGCAGACTGTGAT; cfp22 reverse, TTTTCCATGGTCAGGAGATGGTGATCGA; cfp25 forward, ACAGATCTGCGCATGCGGATCCGTGT; and cfp25reverse, TTTTCCATGGTCATCCGGCGTGATCGAG. Both forward primerscreate BglII sites, and both reverse primers create NcoI sites DNA fragmentswere obtained by PCR amplification of M. tuberculosis H37Rv chromosomalDNA with these primers and were purified on agarose gels and cloned into thepT7Blue T vector (Novagen, Abingdon, United Kingdom). Plasmid DNA wassubcloned into the expression vector pMCT6 (18) in frame with eight histidinesat the N termini of the expressed proteins, and the resulting clones were se-quenced.

Expression and metal affinity purification of recombinant CFP22 (rCFP22)and rCFP25 on a TALON column (Clontech Laboratories, Palo Alto, Calif.)were done essentially as described by the manufacturers.

The recombinant protein preparations were pooled and dialyzed against 3 Murea in 10 mM Tris-HCl, pH 8.5. The dialyzed protein was further purified by fastprotein liquid chromatography (Pharmacia, Uppsala, Sweden) with a 1-mlMono-Q column and eluted with a linear 0 to 1 M gradient of NaCl. Fractionswere analyzed by SDS-PAGE and dialyzed against 25 mM HEPES buffer, pH8.5.

The lipopolysaccharide (LPS) contents in the rCFP22 and rCFP25 prepara-tions were determined by the Limulus amoebocyte lysate clot test (7).

SDS-PAGE, Western blot analysis, and 2-DE. Analytical SDS-PAGE wasdone with 10 to 20% gradient gels (16 by 16 by 0.075 cm) as described byLaemmli (26) under reducing conditions unless otherwise indicated. For calibra-tion, low-molecular-weight standard mixtures (Bio-Rad) were run in parallelwith the samples. The gels were either silver stained (10) or transferred tonitrocellulose (Schleicher and Schuell, Dassel, Germany) as previously described(44). For immunoblot analysis, the nitrocellulose membranes were incubatedwith mouse MAbs followed by alkaline phosphatase-labeled rabbit antimouseantibodies (D314; DAKO, Glostrup, Denmark). A panel of MAbs definingknown CFPs was used: Hyb 76-8 (ESAT-6), Hyb 76-1 (GroES), K12 (MPT63),HBT2 (CFP20), L24.b3 (MPT64), HYT6 (19-kDa lipoprotein), HYT27 (Ag85complex), HBT12 (PstS), HBT10 (Ald), I10 (MPT32), and HAT3 (DnaK). Theantibodies K12 and I10 were kindly provided by M. Gennaro and G. Marchal,respectively.

2-DE in polyacrylamide gels was carried out as described by Hochstrasser et al.(23), except that in the first dimension, Nonidet P-40 was replaced by Tween 80.The first-dimension isoelectric focusing tube gels (14 by 0.15 cm) containedBiolyt 4/6 and Biolyt 5/7 (2:3) (Bio-Rad). After the first-dimension electrophore-sis, samples were separated on 10 to 20% gradient gels. The pI scale wascalibrated by measuring the pH of 0.5-cm pieces of focusing gel soaked in 1 mlof degassed Milli Q water.

Identification of the positions of individual proteins in 2-DE analysis of ST-CFwas achieved by two methods: (i) comparative computer analysis (Phoretix In-ternational, Newcastle, United Kingdom) of the 2-DE spot pattern of ST-CFwith and without addition of the purified protein and (ii) immunoblotting withMAbs defining known CFPs as described above.

N-terminal sequencing. For N-terminal sequencing, the protein fractions werewashed with Milli Q water on a Centricon concentrator (Amicon) with a cutoffat 3 kDa, and 10 to 50 pmol was applied to a polyvinylidene difluoride membranein a ProSpin concentrator (Applied Biosystems). The membrane was washedthree times with 20% methanol and subjected to N-terminal sequence analysis byautomated Edman degradation with a Procise 494 sequencer (Applied Biosys-tems) as described by the manufacturer. The SWISSPROT database wassearched with FASTA algorithms (33).

Animals and experimental infections. Female C57BL/10 mice and congenicB10.BR mice (haplotype H-2k), and B10.HTG mice (haplotype H-2g) were pur-chased from Harlan Olac Ltd. (Bicester, United Kingdom).

Memory-immune mice were generated as previously described (12). Briefly,mice received a primary infection with 5 3 104 CFU of M. tuberculosis H37Rv viathe lateral tail vein, after which they were treated with isoniazid (Merck, Rahway,N.J.) and rifabutin (Farmatalia Carlo Erba, Milan, Italy) in their drinking waterfor 2 months to clear the infection. The mice were rested for a period of 4 to 6months before challenge with 106 CFU of bacteria intravenously, and the animalswere sacrificed on day 4 postinfection.

Female outbred Ssc:AL strain guinea pigs were bred at Statens Serum Institut(Copenhagen, Denmark) and were infected via an ear vein with M. tuberculosisH37Rv in 0.2 ml of PBS containing 5 3 104 CFU.

Lymphocyte cultures. Spleen lymphocytes were isolated from memory-im-mune mice during the recall of protective immunity as previously described (12).Briefly, cells were pooled from three mice and cultured in microtiter wells (2 3105 cells/200 ml) in RPMI 1640 medium supplemented with b-mercaptoethanol,penicillin-streptomycin, glutamine, and fetal calf serum. Recombinant mouseinterleukin-2 (2.5 U/ml; Genzyme, Cambridge, Mass.) was added to all cultures.ST-CF, purified native proteins, and recombinantly produced proteins were allbuffer exchanged into PBS and tested in various concentrations (0.5 to 8 mg/ml)in cultures (results not shown). On the basis of these results, we chose to use thepurified proteins at 2 mg/ml and ST-CF at 5 mg/ml throughout the study. Super-natants were harvested after 48 h of incubation, and gamma interferon (IFN-g)levels were quantified by enzyme-linked immunosorbent assay as described pre-viously (12). Experimental values are given as means of duplicate or triplicate

cultures 6 standard errors. Toxicity tests were performed for all protein prepa-rations as follows. Twofold dilutions of the antigens (8 to 0.5 mg/ml) were testedfor toxicity in coculture with a suboptimal concentration of concanavalin A (0.32mg/ml). The proliferative responses were compared to those of cell culturesstimulated with concanavalin A alone, and no suppression of the response wasobserved at any of the antigen concentrations used.

Skin testing. Four weeks after infection of the guinea pigs, skin testing wasperformed with proteins diluted to 1 mg/ml in 0.1 ml of PBS and injectedintradermally in the shaved flanks. Tuberculin purified protein derivative (PPD)RT23 (10 tuberculin units; Statens Serum Institut) was used as a positive control.Reaction diameters were measured at 24 h after injection, and reaction diame-ters of less than 3 mm were considered negative.

RESULTS

Purification of M. tuberculosis CFPs by preparative 2-DE.Single CFPs were purified by using a strategy based on pre-parative 2-DE with isoelectric focusing as the first step fol-lowed by separation according to size in SDS-PAGE. Pilotexperiments demonstrated that CFPs focused within a narrowpI range (pI 4 to 7), with a large number of molecules with pIsof around 5.5. Isoelectric focusing of ST-CF was done with aRotofor Cell, and the pH range of 3.5 to 6.5 was chosen. Theproteins were separated into 20 fractions; the majority of theprotein bands were in fractions within the pH range of 5 to 5.8,whereas the peripheral fractions had a lower protein contentbut also a markedly different band composition (Fig. 1A).Fractions with similar band patterns were combined into threepools as follows. Fractions 6 to 8 were sampled as pool 1, andfractions 16 to 20 were sampled as pool 3. The remainingfractions, 9 to 15, were pooled and refractionated on the Roto-for Cell. The resulting fractions in the pH range of 5.0 to 5.7were collected and samples as pool 2. By this method threepools with markedly different band composition were obtainedand used for further fractionation (Fig. 1B).

The proteins in each pool were separated according to sizeby preparative SDS-PAGE on a Prep-Cell column. A poly-acrylamide concentration of 16% was chosen, as it gives opti-mal resolution of molecules below 35 kDa, a region previouslydemonstrated to contain highly stimulatory molecules in ani-mal models as well as in human donors (2, 5, 11, 36). Thefractions obtained were analyzed by SDS-PAGE, and 10 frac-tions chosen for further investigation, as they contained onlyone protein band (Fig. 2). These 10 single purified CFPs, withmolecular masses of 8 to 30 kDa, were tested by Western blotanalysis with a panel of MAbs defining previously character-ized CFPs (results not shown). Five of the proteins were iden-tified as already-known proteins: ESAT-6, GroES, MPT63,MPT64, and MPT59 (Fig. 2, lanes 2, 3, 4, 9, and 11, respec-tively). The remaining five proteins appeared to be novel pro-teins and were designated CFP17 (Fig. 2, lane 5), CFP20 (lane6), CFP21 (lane 7), CFP22 (lane 8), and CFP28 (lane 10).GroES, CFP17, and CFP20 were obtained from pool 1;MPT63, CFP21, MPT64, and CFP28 were obtained from pool2; and ESAT-6, CFP22, and MPT59 were obtained from pool3.

CFP20 was recognized by MAbs HBT2 and HBT11. Anantigen recognized by these MAbs has previously been isolatedby affinity chromatography, but the protein has not been char-acterized (27, 48). None of the other novel proteins wererecognized by any of the MAbs available.

2-DE of CFPs. Mycobacterial proteins are being identified atan increasing rate, and analytical tools are needed to performa systematic evaluation of newly purified proteins and to dis-tinguish them from the already-characterized proteins. Wehave utilized the analytical power of 2-DE to establish a 2-DEmap of ST-CF components in which the positions of previouslycharacterized CFPs as well as those of the panel of novel CFPs

VOL. 66, 1998 SIX NOVEL M. TUBERCULOSIS ANTIGENS 3493

on April 25, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

were mapped. This was achieved by visual inspection as well ascomputer-assisted evaluation of parallel 2-DE gels with puri-fied antigens, ST-CF, or purified antigens added to ST-CF. Thepositions of the previously characterized proteins were alsoconfirmed by Western blotting with specific MAbs. The anal-ysis confirmed that CFP17, CFP20, CFP21, CFP22, and CFP28all mapped as previously uncharacterized proteins with molec-ular masses of 17 to 28 kDa (Fig. 3). Of the five proteins,CFP17, CFP20, CFP21, and CFP28 all focused at the expectedmolecular mass as a cluster of spots within a narrow pI range,indicating the presence of only one protein in the preparation.All of the proteins focused as more than one spot, which may

be due to microheterogeneity caused by posttranslational mod-ification, e.g., deamidation or oxidation of side chains, as pre-viously observed for both mycobacterial and nonmycobacterialproteins (9, 17, 43). Interestingly, 2-DE analysis of the CFP22preparation revealed that a protein of slightly higher molecularmass was copurified and seen as a spot at 25 kDa and at aslightly lower pI (Fig. 3). The protein of 25 kDa was seen onlywhen a reducing agent was introduced in the SDS-PAGE anal-ysis, which explained the copurification of the two moleculesduring the nonreducing separation on the Prep-Cell column.The preparation was accordingly designated CFP22/25. All ofthis information was integrated into a 2-DE reference map ofST-CF components (Fig. 4).

N-terminal sequence analysis and identification of the genesencoding the novel proteins. The five protein preparationswere transferred to polyvinylidene difluoride membranes,which were subjected to N-terminal sequencing. CFP17,CFP20, CFP21, and CFP28 all gave one main sequence, whichis highly indicative of a pure protein preparation. Fifteenamino acids were determined for each of the proteins (Table1). For the CFP22/25 preparation, N-terminal sequencing ofthe two individual bands separated by reducing SDS-PAGEconfirmed the existence of two protein species with differentN-terminal sequences.

Each of the six N-terminal sequences obtained was used fora homology search of the Sanger M. tuberculosis database withthe Blast program. For CFP17, CFP20, CFP21, CFP22, andCFP25 the N-terminal amino acid sequence was found to beidentical to the deduced amino acid sequence for an openreading frame identified in the Sanger database, whereas nosimilarity for CFP28 was found in the database (Table 1). Thefive open reading frames identified in the Sanger databasewere examined and found to code for mature proteins rangingfrom 132 to 187 amino acids (Fig. 5). The first amino acididentified in the mature CFP17, CFP20, CFP21, CFP22, andCFP25 were residues 31, 2, 33, 8, and 33 in the deduced

FIG. 1. Fractionation of CFPs from M. tuberculosis by preparative isoelectric focusing. (A) ST-CF was fractionated on a Rotofor Cell, and each fraction wasanalyzed by SDS-PAGE and silver staining. The fraction number is indicated below each lane, and the pHs of selected fractions are indicated at the top. (B) Thefractions were pooled into three major pools. All fractions were analyzed by silver staining after SDS-PAGE, and the protein profiles were compared to that of ST-CF.Sizes of molecular mass (MW) markers (in kilodaltons) are indicated at the left.

FIG. 2. Purified CFPs obtained by preparative size separation. Lane 1, pro-tein profile of ST-CF; lanes 2 to 11, migrations of the individual purified proteins.The proteins were separated by nonreducing SDS-PAGE, which was followed bysilver staining. Sizes of molecular mass (MW) markers (in kilodaltons) areindicated at the left.

3494 WELDINGH ET AL. INFECT. IMMUN.

on April 25, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

sequences, respectively. The stretch of deduced amino acidsupstream of the N-terminal sequences of the mature CFP17,CFP21, and CFP25 suggested the presence of a putative leadersequence cleaved after secretion. However, only the sequencesof CFP21 and CFP25 had the typical characteristics of a signalpeptide (approximately 20 to 40 amino acids with a stretch oflargely hydrophobic residues) (46).

The theoretical molecular weight and pI were calculatedfrom the sequences, and in each case the theoretical molecularweight and pI were somewhat less than those observed (Table1). This slight difference may arise from the presence of urea inthe first dimension of the 2-DE, as previously described (30).

The identified sequences were used for homology searchesin the EMBL database with the TFASTA algorithm (33). Noneof the identified proteins were identical to previously describedproteins from M. tuberculosis, whereas homology to proteinsfrom other bacteria was found for four of the proteins (Table1).

CFP22 showed 90% identity in a 182-amino-acid overlap toa peptidyl-prolyl isomerase from Mycobacterium leprae and is

most likely the M. tuberculosis homolog of this protein. CFP20exhibited identity to a number of outer cell wall proteins andenzymes from other bacteria. CFP21 and CFP25 are homolo-gous proteins (43% in a 217-amino-acid overlap), and both arehomologous to a cutinase from fungi (29). In addition, theanalysis of the open reading frame for CFP21 revealed that thisprotein was encoded within the translated region RD2, whichis not present in some strains of M. bovis BCG (28).

Cloning and expression of rCFP22 and rCFP25. CFP22 andCFP25 were purified together, and the biological activities ofthe individual antigens therefore could not be evaluated. AsCFP25 is present in only trace amounts in ST-CF, purificationand evaluation of this single protein from culture filtrate wasconsidered impractical. Therefore, the genes encoding CFP22and CFP25 were cloned, and the proteins were expressed asrecombinant proteins. cfp22- and cfp25-containing DNA frag-ments were amplified from M. tuberculosis H37Rv chromo-somal DNA by PCR with cfp22- and cfp25-specific primers andcloned into the Escherichia coli expression vector pMCT6 inframe with eight N-terminal histidine codons.

FIG. 3. 2-DE analysis of the novel CFPs. The CFP17, CFP20, CFP21, CFP22/25, and CFP28 preparations were separated by 2-DE, which was followed by silverstaining. The migrations of the purified CFPs are compared to the spot pattern of the complex mixture ST-CF. The CFP22 preparation is seen to contain anothermolecule of 25 kDa. This preparation was accordingly designated CFP22/25. MW, molecular masses in kilodaltons.

VOL. 66, 1998 SIX NOVEL M. TUBERCULOSIS ANTIGENS 3495

on April 25, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

Recombinant, histidine-tagged rCFP22 and rCFP25 wereexpressed in E. coli XL1Blue cells and purified by metal affinitychromatography followed by anion-exchange (Mono-Q) chro-matography, concentration, and dialysis against a suitablebuffer. The resulting clones were sequenced and found to be100% in agreement with the cfp22 and cfp25 sequences ob-tained from the Sanger database.

Before the proteins were used in immunological tests, thepreparations were analyzed for contamination with LPS. Inboth cases, LPS was present in amounts that are not suspectedto interfere with either T-cell or skin test experiments (,1.0 ngof LPS/mg of rCFP22 and ,25 ng of LPS/mg of rCFP25).

Immunological activities of the CFPs. The immunologicalactivities of the six CFPs were investigated in mice and guineapigs infected with M. tuberculosis. Mice of three congenicstrains on the B10 background representing the H-2b, H-2k,and H-2g-haplotypes were rendered memory immune by pri-mary M. tuberculosis infection followed by chemotherapy, aspreviously described (2). Recognition of the purified proteinsby memory effector cell lymphocytes isolated at day 4 of re-challenge was investigated. All molecules were recognized inthe C57BL/10 strain, and CFP17 and CFP21 were the mostpotent inducers of IFN-g release, giving rise to 40 to 60% of

the response to total ST-CF (Tables 2 and 3). In the B10.BRmice, CFP20 and CFP21 induced the highest IFN-g release,although at a level somewhat lower than that in the C57BL/10mice (Table 2). For B10.HTG mice the amount of IFN-greleased in response to CFP17, CFP20, and CFP22/25 wasnegligible; however, CFP21 also induced a marked IFN-g re-lease in this strain, almost at the level of ST-CF (Table 2). NoIFN-g release was detected when the antigens were tested inspleen cell cultures isolated from naive mice (results notshown).

The response to the rCFP22 and rCFP25 was compared tothat to the native antigen preparations isolated from culturefiltrate. The recognition of these antigens in the mouse modeland the ability to induce a DTH response in guinea pigs in-fected with M. tuberculosis were evaluated (Table 3).

In these experiments rCFP25 was demonstrated to be re-sponsible for the activity of the mixed preparation, whilerCFP22 induced neither IFN-g release nor a significant DTHreaction. The ranking of the antigens’ immunological activitiesin the C57BL/10 strain was in agreement with the results of theother experiment (Table 2), confirming the high reactivity ofCFP17 and CFP21, both of which induced IFN-g release in thismodel at levels above those for the well-known T-cell antigen

FIG. 4. 2-DE pattern of M. tuberculosis CFPs. ST-CF was analyzed by 2-DE in the pH range of 4 to 7. The proteins were separated according to isoelectric pointin the first dimension and then by size in the second dimension. The gel was silver stained. The positions of proteins mapped are indicated; known proteins aredesignated by the most commonly used name, and the novel CFPs identified in this study are marked by boxes. MW, molecular mass.

3496 WELDINGH ET AL. INFECT. IMMUN.

on April 25, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

MPT59 (6.5 6 0.1 ng/ml). In the guinea pig model CFP17 andCFP21 also demonstrated a high activity, but this model inaddition identified CFP20 and CFP25 as potent preparationswhich gave rise to DTH reactions at levels comparable to thosefor PPD (Table 3). CFP28 induced a weak skin test reaction,and no responses to rCFP22 were found. These experimentswere repeated three times with the same overall result, leading

to the same relative ranking of the immunological activities ofthe antigens.

Taken together, these data support the overall conclusionthat CFP17, CFP20, CFP21, and CFP25 are antigens stronglyrecognized in animals infected with M. tuberculosis. CFP21, inparticular, is broadly recognized in animals of different majorhistocompatibility complex class II compositions.

DISCUSSION

The aim of the present study was to identify proteins fromM. tuberculosis with potential for use as a TB vaccine or diag-nostic reagents. ST-CF was used as the source of antigens,since this preparation has been the basis of several successfulstudies of experimental subunit vaccines (reviewed in refer-ence 14) and contains antigens recognized in the early stage ofM. tuberculosis infection in animals as well as in humans (11,36).

ST-CF is a complex mixture composed of a large number ofcomponents present in different concentrations, ranging fromproteins barely detectable in silver-stained gels to componentspresent in abundant quantities. Using classical chromato-graphic methods, Nagai et al. (30) were the first to isolate andcharacterize a number of the major CFPs. More recently, con-ventional purification has resulted in the identification of novelculture filtrate antigens (40, 42, 44), but such studies have alsodemonstrated that in many cases antigens that are alreadyknown are obtained (21, 24). These abundant CFPs were orig-inally identified as the 33 major proteins in ST-CF (3), but asdemonstrated in this study as well as in another very recentreport (43), sensitive 2-DE allows the detection of at least 150different protein species. 2-DE separation followed by directexcision of spots and N-terminal sequence analysis is obviouslyan attractive and rapid method, but again this method has thedisadvantage that only proteins present in high quantities willbe obtained.

In this regard, ESAT-6 and the recently identified T-cellantigen CFP29 are both present only in very small amounts inculture filtrate but are still very potent T-cell antigens (12, 36,40, 44). It is therefore clear that there is no direct correlationbetween the relative representation of an antigen in culturefiltrate and its immunological relevance, as has been suggested

FIG. 5. Deduced amino acid sequences of the CFPs. Full-length sequencesare shown for the proteins CFP17, CFP20, CFP21, CFP22, and CFP25. Theamino acids determined by N-terminal sequencing in this study are in boldface.

TABLE 1. N-terminal sequences and genomic identification of the purified proteins

Protein N-terminal amino acidsequencea

Correspondingcosmid in the

Sanger database

Theoreticalmol wt/pIb Homology to other proteinsc

CFP17 SELDAPAQAGTEXAV MTCY1A11.16c 13,833/4.4 NoneCFP20 AQITLRGNAINTVGE MTCY9F9.32c 16,897/4.2 52% identity in 166-aa overlap to E. coli scavengease

p20 (EC 93212), 52% identity in 166-aa overlap toE. coli thiol peroxidase (EC 33213), 51% identityin 166-aa overlap to Haemophilus influenzae ToxRregulon (HI32759)

CFP21 DPXSDIAVVFARGTH MTCY39.35c 18,657/4.6 33% identity in 193-aa overlap to fungal cutinaseprecursor (P41744)

CFP22 TNSPLATATATLHTN MTCY10H4.08c 18,517/6.8 90% identity in 185-aa overlap to M. leprae peptidyl-propyl cis-trans isomerase (E235739)

CFP25 AXPDAEVVFARGRFE MTCY339.08c 19,665/4.9 43% identity in 217-aa overlap with CFP21, 32%identity in 190-aa overlap with cutinase (P41744)

CFP28 XXQKSLELIXXTAXE NFd NAe NA

a N-terminal sequences of the proteins found in culture filtrate. X, the amino acid could not be determined.b Calculated from the deduced sequence of the mature protein.c Only homologies of .30% identity are shown, except CFP20, for which only homologies of .50% identity are shown. aa, amino acid.d NF, not found.e NA, not applicable.

VOL. 66, 1998 SIX NOVEL M. TUBERCULOSIS ANTIGENS 3497

on April 25, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

elsewhere (21, 24), and this may reflect differences in theprotein expression in vivo and in vitro. We therefore decided toemploy a preparative 2-DE method in which a preseparationof proteins by isoelectric focusing enables the subsequent pu-rification of novel proteins, including molecules present in onlysmall quantities in culture filtrate.

Boesen et al. (11) showed that patients with minimal TB arecharacterized by a strong cellular reactivity to a range of ST-CFproteins, with a recognition of molecules ranging from 5 to 35kDa. This predominant recognition of low-mass CFPs prevailsin different species and has been reported for mice, guineapigs, and cattle infected with M. tuberculosis (12, 22, 36). Wetherefore optimized our size separation to enable maximalseparation of this region. Six proteins not previously describedwere obtained, and four of these proteins, CFP17, CFP20,CFP21, and CFP25, were immunologically very active and in-duced either a high IFN-g release from murine memory effec-tor cells or a pronounced DTH reaction. One of the proteinspurified, CFP20, was recognized by the MAbs HBT2 andHBT11. This antigen has previously been purified by affinitychromatography and was found to induce a strong proliferativeresponse in humans and mice (4, 6, 27, 48), but until now nobiochemical or sequence data on this antigen have been avail-able.

Interestingly, the present study led to the identification ofCFP21, which is encoded in the RD2 region of the genome, aregion reported to be absent from several strains of BCG (28).CFP21 elicited a strong skin test reaction and was broadlyrecognized in genetically different strains of inbred mice. Thevalue of this protein as a diagnostic reagent either alone or incombination with other antigens also absent in BCG, such asMPT64 and ESAT-6, will be the subject of future studies.

The establishment of 2-DE reference maps of mycobacterialproteins from different subcellular locations will greatly com-plement the biochemical and genetic characterization of M.tuberculosis proteins. In the coming years the complete se-quence of the M. tuberculosis genome (35) and the use of 2-DEto characterize the proteome, i.e., the total set of expressedproteins, will change TB research dramatically and allow adirect analysis of genes expressed under different conditionsand of importance for host-parasite interactions. A recent re-port describes the resolution of more than 600 spots in 2-DEanalysis of a whole-cell extract of M. tuberculosis (45), andanother very recent study has addressed this important subjectby mapping a number of CFPs defined by the World HealthOrganization standard panel of MAbs (43). The results ob-

tained in that study are generally in good agreement with the2-DE map presented in this study. In our early culture filtrate,however, we cannot detect the KatG molecule found in abun-dant quantities in the culture filtrate used by Sonnenberg andBelisle (43). This discrepancy could be explained by the differ-ent culture periods used in the two studies (7 versus 14 days),as we can detect this protein in culture filtrates harvested atlate time points (data not shown). The reproducibility of 2-DEmaps established in different laboratories emphasizes the po-tential of this method for future purification and characteriza-tion of mycobacterial proteins in complex mixtures.

In the present study, the proteins CFP22 and CFP25 werecopurified as one band at 22 kDa by preparative SDS-PAGEperformed under nonreducing conditions. Separation of therecombinant CFP25 under reducing and nonreducing condi-tions confirmed that the relative migration of the nonreducedmolecule is faster, reflecting a smaller total hydrophodynamicvolume. Analysis of the deduced sequence for CFP25 revealedthe presence of four cysteines, and we propose, therefore, thatthere are one or two internal disulfide bonds in this molecule.

ST-CF consists of proteins released from the bacterium intothe medium before significant autolysis of the bacterium hastaken place (3). Most proteins destined for translocation acrossthe cytoplasmic membrane, in both gram-negative and gram-positive bacteria, are synthesized as preproteins containing anNH2-terminal signal sequence which is cleaved from the ma-ture protein by specific peptidases (34, 46). However, severalproteins without a signal peptide have been found in ST-CF,e.g., superoxide dismutase, ESAT-6, and CFP29 (40, 44, 49). Inthis study only two of the six molecules identified, CFP21 andCFP25, contain the typical consensus sequence for a signalpeptide (46).

Export of proteins lacking classical signal peptides has beendescribed for several bacterial species (for reviews, see refer-ences 37, 38, and 41), but not much is known about the actualtranslocation of these proteins across the plasma membrane.In E. coli, one signal peptide-independent pathway, the ABCprotein-mediated export mechanism, involves three proteinslocated in the membrane. Both proteins secreted by this path-way, as well as the Yop proteins secreted from yersiniae, con-tain particular sequences involved in secretion but lacking theclassical features of a signal peptide (8, 47). Whether similarmechanisms exists in mycobacteria is yet to be established, but

TABLE 2. Recognition of purified CFPs by memory effector cellsfrom B10 congenic strains of mice

Antigenb

IFN-g release (ng/ml)a in:

C57BL/10 mice(H-2b)

B10.BR mice(H-2k)

B10.HTG mice(H-2g)

Controlc ,0.1 0.3 ,0.1ST-CF 11.68 6 0.3 11.05 6 0.02 4.46 6 0.02CFP17 5.33 6 0.2 0.78 6 0.03 0.48 6 0.02CFP20 3.20 6 0.1 1.73 6 0.09 0.15 6 0.02CFP21 7.34 6 0.1 2.98 6 0.04 3.57 6 0.4CFP22/25 3.38 6 0.3 0.25 6 0.09 0.14 6 0.01CFP28 1.11 6 0.1 0.49 6 0.08 0.60 6 0.07

a IFN-g release was measured in spleen cell cultures isolated from threememory-immune mice 4 days after rechallenge with 106 CFU of M. tuberculosisH37Rv. Results are means 6 standard errors.

b Single proteins were tested at 2 mg/ml, and ST-CF was tested at 5 mg/ml.c Stimulation without antigen.

TABLE 3. Immunological activities of the purified CFPs in M.tuberculosis-infected mice and guinea pigs

Protein IFN-g release (ng/ml)a DTH reaction diam (mm)b

Controlc ,0.10 6 0.0 ,3 6 0.3PPD/ST-CFd 20.96 6 1.1 11.7 6 0.5CFP17 9.25 6 0.1 12.9 6 1.0CFP20 2.39 6 1.8 12.3 6 0.8CFP21 10.73 6 0.04 10.4 6 0.5CFP22/25 5.34 6 0.3 4.2 6 0.2rCFP22 ,0.10 6 0.0 ,3 6 0.2rCFP25 9.87 6 0.1 10.3 6 0.6CFP28 2.82 6 0.2 5.8 6 0.8

a IFN-g release from memory effector cells was measured in spleen cell cul-tures isolated from three memory-immune C57BL/10 mice 4 days after rechal-lenge with 106 CFU of M. tuberculosis. The proteins were used at 2 mg/ml.Results are means 6 standard errors.

b Skin testing was done 4 weeks after infection with 5 3 104 CFU of M.tuberculosis. Values shown are means 6 standard errors; for eight readings. Theproteins were tested at 1 mg/ml.

c Stimulation without antigen.d PPD (10 tuberculin units) was used in the skin test experiment, while ST-CF

(5 mg/ml) was used in the lymphocyte cultures.

3498 WELDINGH ET AL. INFECT. IMMUN.

on April 25, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

a recent report indicated that the signal for secretion in somecases may be encoded internally in mycobacterial proteins(20). It is interesting that both CFP17 and CFP22 are precededby peptides apparently cleaved from the mature protein andthat none of them have the characteristics of typical signalpeptides. These peptides could play a role in protein secretionor, alternatively, may be cleaved off as a result of nonspecificdegradation.

Another possible explanation for the seven amino acids pre-ceding the CFP22 sequence found in ST-CF could be that thestart codon of this open reading frame is GTG (coding for Valin position 7) and not the predicted ATG (coding for Met inposition 1). If this is the case, then the predicted first aminoacid of the mature protein will be Thr (in position 8), inagreement with the N-terminal sequence of the protein presentin ST-CF. Analysis of the DNA sequence upstream from thetwo possible start codons did not clarify this, as no consensusShine-Dalgarno sequence could be identified (data notshown).

There is no doubt that although ST-CF is produced fromvery early cultures, some autolysis will take place, leading torelease of proteins directly from the cytoplasm. CFP22 is 90%identical to an M. leprae peptidyl-prolyl isomerase which func-tions as an intracellular housekeeping enzyme during proteinsynthesis (for a review, see reference 16), and if this proteinserves the same function in M. tuberculosis, the small amountof CFP22 in ST-CF must be a result of autolysis. In this regard,it is noteworthy that CFP22 is not recognized in any of theexperimentally infected animal models used. This finding, to-gether with the strong recognition of the rest of the proteinsisolated, supports our present understanding that extracellularantigens are the main targets recognized in the first phase ofM. tuberculosis infection, leading to early control of disease.

ACKNOWLEDGMENTS

This investigation received financial support from The EuropeanCommunity (project no. TS3*CT94-0313 and BNH-4-CT97-2167) andthe Center for Advanced Food Research.

We are grateful to Charlotte Adamzcky Bak, Annette Hansen, Bir-gitte Smedegaard, and Bente Isbye for excellent technical assistance.

REFERENCES

1. Andersen, P. 1994. Effective vaccination of mice against Mycobacteriumtuberculosis infection with a soluble mixture of secreted mycobacterial pro-teins. Infect. Immun. 62:2536–2544.

2. Andersen, P., A. B. Andersen, A. L. Sorensen, and S. Nagai. 1995. Recall oflong-lived immunity to Mycobacterium tuberculosis infection in mice. J. Im-munol. 154:3359–3372.

3. Andersen, P., D. Askgaard, L. Ljungqvist, J. Bennedsen, and I. Heron. 1991.Proteins released from Mycobacterium tuberculosis during growth. Infect.Immun. 59:1905–1910.

4. Andersen, P., D. Askgaard, L. Ljungqvist, M. W. Bentzon, and I. Heron.1991. T-cell proliferative response to antigens secreted by Mycobacteriumtuberculosis. Infect. Immun. 59:1558–1563.

5. Andersen, P., and I. Heron. 1993. Specificity of a protective memory immuneresponse against Mycobacterium tuberculosis. Infect. Immun. 61:844–851.

6. Andersen, P., L. Ljungqvist, K. Haslov, M. W. Bentzon, and I. Heron. 1991.Proliferative response to seven affinity purified mycobacterial antigens ineight strains of inbred mice. Int. J. Lepr. Mycobact. Dis. 59:58–67.

7. Baek, L. 1983. New, sensitive rocket immunoelectrophoretic assay for mea-surement of the reaction between endotoxin and Limulus amoebocyte lysate.J. Clin. Microbiol. 17:1013–1020.

8. Binet, R., S. Letoffe, J. M. Ghigo, P. Delepelaire, and C. Wandersman. 1997.Protein secretion by Gram-negative bacterial ABC exporters—a review.Gene 192:7–11.

9. Bini, L., M. Sanchez-Campillo, A. Santucci, B. Magi, B. Marzocchi, M.Comanducci, G. Christiansen, S. Birkelund, R. Cevenini, E. Vretou, G.Ratti, and V. Pallini. 1996. Mapping of Chlamydia trachomatis proteins byimmobiline-polyacrylamide two-dimensional electrophoresis: spot identifica-tion by N-terminal sequencing and immunoblotting. Electrophoresis 17:185–190.

10. Blum, H., H. Beier, and H. J. Gross. 1987. Improved silver staining of plant

proteins, RNA and DNA in polyacrylamide gels. Electrophoresis 8:93–99.11. Boesen, H., B. N. Jensen, T. Wilcke, and P. Andersen. 1995. Human T-cell

responses to secreted antigen fractions of Mycobacterium tuberculosis. Infect.Immun. 63:1491–1497.

12. Brandt, L., T. Oettinger, A. Holm, and P. Andersen. 1996. Key epitopes onthe ESAT-6 antigen recognized in mice during the recall of protective im-munity to Mycobacterium tuberculosis. J. Immunol. 157:3527–3533.

13. Dobos, K. M., K. Swiderek, K. H. Khoo, P. J. Brennan, and J. T. Belisle.1995. Evidence for glycosylation sites on the 45-kilodalton glycoprotein ofMycobacterium tuberculosis. Infect. Immun. 63:2846–2853.

14. Elhay, M. J., and P. Andersen. 1997. Immunological requirements for asubunit vaccine against tuberculosis. Immunol. Cell Biol. 74:595–603.

15. Engers, H. D., J. Bennedsen, T. M. Buchanan, S. D. Chaparas, G. Kadival,O. Closs, J. R. David, J. van-Embden, T. Godal, A. S. Mustafa, J. Ivanyi,D. B. Young, S. H. E. Kaufmann, A. G. Khoenko, A. H. J. Kolk, M. Kubin,J. A. Louis, P. Minden, T. M. Shinnick, and L. Trnka. 1986. Results of aWorld Health Organization-sponsored workshop to characterize antigensrecognized by Mycobacterium-specific monoclonal antibodies. Infect. Im-mun. 51:718–720.

16. Hacker, J., and G. Fischer. 1993. Immunophilins: structure-function rela-tionship and possible role in microbial pathogenicity. Mol. Microbiol. 10:445–456.

17. Harboe, M., S. Nagai, M. E. Patarroyo, M. L. Torres, C. Ramirez, and N.Cruz. 1986. Properties of proteins MPB64, MPB70, and MPB80 of Myco-bacterium bovis BCG. Infect. Immun. 52:293–302.

18. Harboe, M., T. Oettinger, H. G. Wiker, I. Rosenkrands, and P. Andersen.1996. Evidence for occurrence of the ESAT-6 protein in Mycobacteriumtuberculosis and virulent Mycobacterium bovis and for its absence in Myco-bacterium bovis BCG. Infect. Immun. 64:16–22.

19. Harth, G., D. L. Clemens, and M. A. Horwitz. 1994. Glutamine synthetase ofMycobacterium tuberculosis: extracellular release and characterization of itsenzymatic activity. Proc. Natl. Acad. Sci. USA 91:9342–9346.

20. Harth, G., and M. A. Horwitz. 1997. Expression and efficient export ofenzymatically active Mycobacterium tuberculosis glutamine synthetase in My-cobacterium smegmatis and evidence that the information for export is con-tained within the protein. J. Biol. Chem. 272:22728–22735.

21. Harth, G., B. Y. Lee, and M. A. Horwitz. 1997. High-level heterologousexpression and secretion in rapidly growing nonpathogenic mycobacteria offour major Mycobacterium tuberculosis extracellular proteins considered tobe leading vaccine candidates and drug targets. Infect. Immun. 65:2321–2328.

22. Haslov, K., A. Andersen, S. Nagai, A. Gottschau, T. Sorensen, and P.Andersen. 1995. Guinea pig cellular immune responses to proteins secretedby Mycobacterium tuberculosis. Infect. Immun. 63:804–810.

23. Hochstrasser, D. F., M. G. Harrington, A. C. Hochstrasser, M. J. Miller, andC. R. Merril. 1988. Methods for increasing the resolution of two-dimensionalprotein electrophoresis. Anal. Biochem. 173:424–435.

24. Horwitz, M. A., B. W. Lee, B. J. Dillon, and G. Harth. 1995. Protectiveimmunity against tuberculosis induced by vaccination with major extracellu-lar proteins of Mycobacterium tuberculosis. Proc. Natl. Acad. Sci. USA 92:1530–1534.

25. Hubbard, R. D., C. M. Flory, and F. M. Collins. 1992. Immunization of micewith mycobacterial culture filtrate proteins. Clin. Exp. Immunol. 87:94–98.

26. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227:680–685.

27. Ljungqvist, L., A. B. Andersen, P. Andersen, K. Haslov, A. Worsaae, J.Bennedsen, and I. Heron. 1990. Affinity purification, biological characteriza-tion and serological evaluation of defined antigens from Mycobacteriumtuberculosis. Trop. Med. Parasitol. 41:333–335.

28. Mahairas, G. G., P. J. Sabo, M. J. Hickey, D. C. Singh, and C. K. Stover.1996. Molecular analysis of genetic differences between Mycobacterium bovisBCG and virulent M. bovis. J. Bacteriol. 178:1274–1282.

29. Martinez, C., P. De-Geus, M. Lauwereys, G. Matthyssens, and C. Cambillau.1992. Fusarium solani cutinase is a lipolytic enzyme with a catalytic serineaccessible to solvent. Nature 356:615–618.

30. Nagai, S., H. G. Wiker, M. Harboe, and M. Kinomoto. 1991. Isolation andpartial characterization of major protein antigens in the culture fluid ofMycobacterium tuberculosis. Infect. Immun. 59:372–382.

31. Orme, I. M., P. Andersen, and W. H. Boom. 1993. T cell response to Myco-bacterium tuberculosis. J. Infect. Dis. 167:1481–1497.

32. Pal, P. G., and M. A. Horwitz. 1992. Immunization with extracellular proteinsof Mycobacterium tuberculosis induces cell-mediated immune responses andsubstantial protective immunity in a guinea pig model of pulmonary tuber-culosis. Infect. Immun. 60:4781–4792.

33. Pearson, W. R., and D. J. Lipman. 1988. Improved tools for biologicalsequence comparison. Proc. Natl. Acad. Sci. USA 85:2444–2448.

34. Perlman, D., and H. O. Halvorson. 1983. A putative signal peptidase recog-nition site and sequence in eukaryotic and prokaryotic signal peptides. J.Mol. Biol. 167:391–409.

35. Philipp, W. J., S. Poulet, K. Eiglmeier, L. Pascopella, V. Balasubramanian,B. Heym, S. Bergh, B. R. Bloom, W. R. Jacobs, and S. T. Cole. 1996. Anintegrated map of the genome of the tubercle bacillus, Mycobacterium tuber-

VOL. 66, 1998 SIX NOVEL M. TUBERCULOSIS ANTIGENS 3499

on April 25, 2018 by guest

http://iai.asm.org/

Dow

nloaded from

culosis H37Rv, and comparison with Mycobacterium leprae. Proc. Natl. Acad.Sci. USA 93:3132–3137.

36. Pollock, J. M., and P. Andersen. 1997. Predominant recognition of theESAT-6 protein in the first phase of interferon with Mycobacterium bovis incattle. Infect. Immun. 65:2587–2592.

37. Pugsley, A. P. 1993. The complete general secretory pathway in gram-neg-ative bacteria. Microbiol. Rev. 57:50–108.

38. Pugsley, A. P., and M. Schwartz. 1985. Export and secretion of proteins bybacteria. FEMS Microbiol. Rev. 32:3–38.

39. Roberts, A. D., M. G. Sonnenberg, D. J. Ordway, S. K. Furney, P. J. Brennan,J. T. Belisle, and I. M. Orme. 1995. Characteristics of protective immunityengendered by vaccination of mice with purified culture filtrate proteinantigens of Mycobacterium tuberculosis. Immunology 85:502–508.

40. Rosenkrands, I., P. B. Rasmussen, M. Carnio, S. Jacobsen, M. Theisen, andP. Andersen. 1998. Identification and characterization of a 29-kilodaltonprotein from Mycobacterium tuberculosis culture filtrate recognized by mousememory effector cells. Infect. Immun. 66:2728–2735.

41. Simonen, M., and I. Palva. 1993. Protein secretion in Bacillus species. Mi-crobiol. Rev. 57:109–137.

42. Sinha, R. K., I. Verma, and G. K. Khuller. 1997. Immunobiological proper-ties of a 30 kDa secretory protein of Mycobacterium tuberculosis H37Ra.Vaccine 15:689–699.

43. Sonnenberg, M. G., and J. T. Belisle. 1997. Definition of Mycobacteriumtuberculosis culture filtrate proteins by two-dimensional polyacrylamide gelelectrophoresis, N-terminal amino acid sequencing, and electrospray massspectrometry. Infect. Immun. 65:4515–4524.

44. Sorensen, A. L., S. Nagai, G. Houen, P. Andersen, and A. B. Andersen. 1995.Purification and characterization of a low-molecular-mass T-cell antigensecreted by Mycobacterium tuberculosis. Infect. Immun. 63:1710–1717.

45. Urquhart, B. L., T. E. Atsalos, D. Roach, D. J. Basseal, B. Bjellqvist, W. L.Britton, and I. Humphrey-Smith. 1997. Proteomic contigs of Mycobacteriumtuberculosis and Mycobacterium bovis (BCG) using novel immobilised pHgradients. Electrophoresis 18:1384–1392.

46. von Heijne, G. 1985. Signal sequences. The limits of variation. J. Mol. Biol.184:99–105.

47. Wattiau, P., S. Woestyn, and G. R. Cornelis. 1996. Customized secretionchaperones in pathogenic bacteria. Mol. Microbiol. 20:255–262.

48. Worsaae, A., L. Ljungqvist, and I. Heron. 1988. Monoclonal antibodiesproduced in BALB.B10 mice define new antigenic determinants in culturefiltrate preparations of Mycobacterium tuberculosis. J. Clin. Microbiol. 26:2608–2614.

49. Young, D. B., S. H. Kaufmann, P. W. Hermans, and J. E. Thole. 1992.Mycobacterial protein antigens: a compilation. Mol. Microbiol. 6:133–145.

Editor: S. H. E. Kaufmann

3500 WELDINGH ET AL. INFECT. IMMUN.

on April 25, 2018 by guest

http://iai.asm.org/

Dow

nloaded from