the roles of phosphorylation of the nucleocapsid protein of mumps

The roles of phosphorylation of the nucleocapsid protein of mumps virus in 1

regulating viral RNA transcription and replication 2

3

James Zengel, Adrian Pickar, Pei Xu §, Alita Lin¶, and Biao He* 4

5

Department of Infectious Disease, University of Georgia College of Veterinary Medicine, 6

Athens, GA 7

§ Current Address: Microbiology Department, University of Chicago, Chicago, IL 8 ¶ Current Address: Simon Fraser University, Burnaby, BC V5A 1S6 Canada 9 10 *Corresponding author: 11 Department of Infectious Diseases 12 College of Veterinary Medicine 13 University of Georgia 14 501 D.W. Brooks Dr. 15 Athens, GA 30602-7388 16 Tel: 706 542 2855 17 Email: [email protected] 18

19

JVI Accepted Manuscript Posted Online 6 May 2015J. Virol. doi:10.1128/JVI.00686-15Copyright © 2015, American Society for Microbiology. All Rights Reserved.

on February 4, 2018 by guest

http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Abstract 20

Mumps virus (MuV) is a paramyxovirus with a negative sense non-segmented RNA 21

genome. The viral RNA genome is encapsidated by the nucleocapsid protein (NP) to 22

form the ribonucleoprotein (RNP), which serves as a template for transcription and 23

replication. In this study, we investigated the roles of phosphorylation sites of NP in MuV 24

RNA synthesis. Using radioactive labeling, we first demonstrated that NP was 25

phosphorylated in MuV-infected cells. Using both liquid chromatography-mass 26

spectrometry (LC-MS) and in silico modeling, we identified nine putative phosphorylated 27

residues within NP. We mutated these nine residues to alanine. Mutation of the serine 28

residue at position 439 to alanine (S439A) was found to reduce the phosphorylation of 29

NP in transfected cells by over 90%. The effects of these mutations on the MuV mini-30

genome system were examined. S439A was found to have higher activity, four mutants 31

had lower activity and four mutants had similar activity compared to wild-type NP. MuV 32

containing the S439A mutation had reduced phosphorylation of NP by 90% and 33

enhanced viral RNA synthesis and viral protein expression at early time point after 34

infection, indicating that S439 is the major phosphorylation site of NP and its 35

phosphorylation plays an important role in down-regulating viral RNA synthesis. 36

37


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Significance 38

Mumps virus (MuV), a paramyxovirus, is an important human pathogen that is re-39

emerging in human populations. Nucelocapsid protein (NP) of MuV is essential for viral 40

RNA synthesis. We have identified the major phosphorylation site of NP. We have 41

found that phosphorylation of NP plays a critical role in regulating viral RNA synthesis. 42

The work will lead to a better understanding of viral RNA synthesis and possible novel 43

targets for anti-viral drug development. 44

45


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Introduction 46

Mumps virus (MuV) infects humans, causing acute infection with hallmark enlargement 47

of the parotid gland (1). Before widespread vaccination in the late 1960s, mumps was 48

the leading cause of aseptic meningitis and caused deafness in children (2). Although 49

vaccination has greatly reduced the number of infections, large outbreaks have 50

occurred recently in vaccinated populations. The largest recent outbreak in the United 51

States originated at a university in Iowa in 2006, where over 5000 cases were reported, 52

compared to approximately 250 cases per year in the preceding years (3). In 2014, 53

there were over 1100 cases of mumps reported, mainly centered around universities 54

(4). At least 90% of the individual infected received the Measles, Mumps, and Rubella 55

(MMR) vaccine, and the majority of people received two doses (3). New strategies to 56

control these outbreaks are needed. Understanding the roles of each MuV protein in 57

virus replication and pathogenesis will aid development of countermeasures for MuV. 58

59

Mumps virus (MuV) is a member of the family Paramyxoviridae in the genus 60

Rubulavirus (1). It has a negative sense, non-segmented, RNA genome of 15,384 61

nucleotides. The genome is comprised of seven transcriptional units that encode nine 62

viral proteins in the following order: 3’-NP-V/I/P-M-F-SH-HN-L-5’ with RNA synthesis 63

initiating at a single site at the 3’ end. The RNA genome associates with NP to form the 64

helical ribonucleoprotein (RNP), which protects the genome from degradation, and 65

serves as the template for RNA synthesis. The NP also associates with the 66

phosphoprotein (P) and indirectly with the large protein (L), in which P and L forms the 67


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

viral RNA-dependent RNA polymerase (vRdRp) (5). The vRdRp uses NP-encapsidated 68

RNA as a template for both replication of the vRNA genome and production of mRNA 69

(2). The vRdRp transcribes the NP-encapsidated RNA into 5’ capped and 3’ 70

polyadenylated mRNAs in cytoplasm (6). Although the exact details of mRNA 71

production are not known, the process is currently believed to involve termination and 72

reinitiation (stop and start) at each gene junction. The vRdRp also replicates viral RNA 73

genome (7-10). It is thought that vRdRp transcribes vRNA first and replicates vRNA at a 74

later stage after entry into host cells. The regulation of the switch from transcription to 75

replication by vRdRp is not clear. It is thought that phosphorylation state of the P protein 76

plays a critical role. Interestingly, P interacts with NP in RNP as well as free NP (11-14). 77

Mumps NP is also involved in virus budding. It interacts with the matrix (M) protein, 78

which is critical for virus egress (15). 79

80

For all negative-sense non-segmented RNA viruses, their genomes are encapsidated 81

with nucleoprotein to form RNP. It has been shown that phosphorylation of NP plays a 82

role in transcription, replication, and genome stability. In measles virus, phosphorylation 83

of NP has been shown to up-regulate transcriptional activity in a minigenome assay 84

(16). A similar phenotype has also been seen in rabies virus (17) and Nipah virus (18). 85

In measles virus, phosphorylation of NP is involved in genome stability and 86

phosphorylation of NP affects genome stability (19). In Marburg virus, only 87

phosphorylated NP is incorporated into nucleocapsid complexes (20). Similarly in 88

measles virus, phosphorylated NP is preferentially incorporated into the nucleocapsid 89


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

(21). Although it has been shown that NP is phosphorylated in MuV-infected chicken 90

cells, the role of phosphorylation is unclear (22). 91

92

In this study, we used in silico modeling and mass spectrometry to determine 93

phosphorylation sites in the NP of MuV. We studied the function of NP in RNA 94

transcription and replication through the use of a minigenome system (23) and a 95

reverse genetics system (24). 96

97


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Materials and Methods 98

Plasmids and cells 99

All plasmids were constructed using standard molecular cloning techniques. Plasmid 100

sequences were based on the sequence of a mumps virus isolated during an outbreak 101

in Iowa from 2006 (GenBank: JN012242.1). MuV NP, P, and L were previously cloned 102

into the pCAGGS expression vector (24, 25). Firefly-luciferase (pFF-Luc) and a MuV 103

mini-genome plasmid expressing Renilla luciferase flanked by MuV-IA trailer and leader 104

sequences and under a T7 promoter (pT7-MG-RLuc) were also previously produced 105

(23). Mutations were introduced into pCAGGS-NP as previously described for 106

introduction of pCAGGS-P mutations (23). Plasmids encoding the full-length genome of 107

MuV-IA previously used to rescue virus were mutated as necessary. Plasmids and 108

sequences are available upon request. 109

110

HEK293T cells were maintained in Dulbecco’s modified Eagle medium (DMEM) 111

supplemented with 5% fetal bovine serum (FBS) and 1% penicillin-streptomycin (P/S). 112

BSR-T7 cells were maintained in DMEM supplemented with 10% FBS, 1% P/S, 10% 113

tryptose phosphate broth (TPB), and 400 µg/ml G418 to maintain T7 RNA polymerase 114

(RNAP) expression. Vero and HeLa cells were maintained in DMEM with 10% FBS and 115

1% P/S. All cells were cultured at 37°C and 5% CO2. Cells were passaged the day 116

before to achieve about 85-95% confluence for infection and 60-80% confluence for 117

transfection. 118

119


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Minigenome 120

BSR-T7 cells (1 day, 60-80% confluent, 24-well plate) were transfected with pCAGGS-P 121

(80 ng), pCAGGS-L (500 ng), pT7-MG-RLuc (100 ng), pFF-Luc (1 ng), and varying 122

amounts of pCAGGS-NP (wt or mutant at 0, 12.5, 25, 50, or 100 ng) using jetPRIME 123

(Polyplus Transfection, France) following manufacture’s protocol. Empty pCAGGS 124

vector was used to maintain a constant amount of total plasmid transfected per well. 125

After 48 hr, media was removed and 100 µl of passive lysis buffer (Promega, Madison, 126

WI) was added to each well, followed by shaking on an orbital shaker for 15 min. 40 µl 127

of lysate was transferred to a white 96-well plate and a dual luciferase assay (Promega) 128

was performed according to the manufacturer’s protocol. Luminescence was detected 129

using a GloMax 96 Microplate Luminometer (Promega). The ratio of Renilla to firefly 130

luminescence was determined for each well, and the average of 3-6 biological replicates 131

was calculated. The peak activity for each NP plasmid was determined and each 132

experimental data set was normalized to wt NP. The data reported is the combined 133

data for a least 3 experimental replicates. 134

135

Virus Rescue and sequencing 136

BSR-T7 cells (1 day, 60-80% confluent, 6-well plate) were transfected with pCAGGS-137

NP (100 ng), pCAGGS-P (160 ng), pCAGGS-L (2000 ng), and full-length genome (2500 138

ng) using jetPRIME. After 48-72hr, transfected BSR-T7 cells were trypsinized and co-139

cultured with Vero cells at a ratio of 1:5 in a 10-cm dish. When CPE was observed (2-7 140

days), the media, likely containing virus, was collected and a plaque assay was 141


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

performed using Vero cells. Single plaques were isolated 6-7 days later and cultured in 142

fresh Vero cells in 6-well plates to produce passage 1 (P1). After titer determination, P1 143

was passaged again in T75 or T150 flasks at an MOI of 0.01 to produce P2. After 144

72hrs, virus was collected, BSA was added to 1% final concentration, and aliquots were 145

stored at -80°C. Titer was determined by plaque assay. Viral RNA was isolated using 146

QIAamp Viral RNA Mini Kit (Qiagen, Valencia, CA) followed by synthesis of DNA 147

templates using SuperScript III One-Step RT-PCR System with Platinum Taq (Life 148

Technologies, Grand Island, NY) and 5 sets of primers were used to amplify the entire 149

genome. Fragments were sent to Genewiz (South Plainfield, NJ) for sequencing using 150

6-10 primers per fragment. Only viruses matching the full-length plasmid sequence 151

were used for further experiments. Primer sequences are available upon request. 152

153

Immunoprecipitation 154

Cells were lysed with whole cell extraction buffer (WCEB) (50mM Tris-HCl [pH 8], 155

280mM NaCl, 0.5% NP-40, 0.2mM EDTA, 2mM EGTA, and 10% glycerol) 156

supplemented with protease inhibitors (1x protease inhibitor, 0.1mM 157

phenylmethylsulfonyl fluoride OR 1x protease/phosphatase inhibitor cocktail for 158

radioactive labeling experiments). Insoluble material was pelleted at 14000xg for 2 159

minutes and the supernatant was transferred to a new tube. Rec-Protein G-Sepharose 160

4B beads and anti-P or anti-NP mAb was added to each tube and nutated overnight at 161

4°C. The next day, tubes were spun at 600xg for 2 min and supernatant was aspirated. 162

Three washes were performed with 1 ml of WCEB using the same process. The bead 163


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

pellet was resuspended in 50-200 µl of 2x Laemmli Sample Buffer (Bio-Rad, Hercules, 164

CA) + 5% β-Mercaptoethanol followed by heating at 95°C for 5 min. 165

166

Mass spectrometry 167

Vero cells in a 10-cm plate were infected with MuV-IA at an MOI of 0.5. After 24 hr, 168

immunoprecipitation was performed as described above with an anti-MuV-P mAb. After 169

overnight incubation, the sample was spun to pellet the beads and the supernatant was 170

collected. The washes were continued and loading buffer was added as above. This 171

produced the “anti-P” sample. The supernatant collected prior to the first wash was 172

used for a second immunoprecipitation with anti-MuV-NP mAb. This produced the “anti-173

NP” sample. Both samples were resolved on a 10% acrylamide gel by SDS-PAGE. 174

The gel was stained with Coomassie Blue G250 in 10% acetic acid and 45% methanol 175

for 4 hours, followed by destaining with destain buffer (10% acetic acid, 40% methanol, 176

50% water). Bands were excised from the gel and sent to the MS & Proteomics WM 177

Keck Foundation Biotechnology Resource Laboratory (Yale University, New Haven, CT) 178

for further processing and mass spectrometry (MS). Briefly, the protein was digested 179

with trypsin and enriched for phosphoproteins on a TiO2 column (2x). Peptides were 180

separated on a nanoACQUITY (Waters, Milford, MA) (75µm x 250mm eluted at 181

300nl/min, 80 minute run) with MS analysis on an Orbitrap Elite mass spectrometer 182

(Thermo Scientific). Both the fraction enriched by the column and the flow-through were 183

analyzed by LC-MS/MS, and peak lists were combined prior to a Mascot search against 184

the NCBInr database with taxonomy restricted to viruses. Phosphorylated peptides 185


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

were considered significant with a random probability score of less than 5%. For 186

peptides with more than one possible phosphorylation site, the Mascot Delta Score and 187

PhosphoRS score were used to determine which site was phosphorylated. 188

189

Radioactive labeling for phosphorylation analysis. 190

In order to examine phosphorylation of NP expressed from transfected plasmid, 1 µg of 191

pCAGGS-NP (wt or mutant) was transfected into HEK293T cells in a 6-well plate using 192

JetPrime in duplicate. After 24 hr, cells were starved in 1 ml DMEM lacking methionine 193

and cysteine for 30 min followed by labeling with about 50 µCi/ml 35S-EasyTag 194

Express35S Protein Labeling Mix (PerkinElmer, Waltham, MA) for 6 hr. Alternatively, 195

the cells were starved with 1 ml DMEM lacking sodium phosphate followed by labeling 196

with about 100 µCi 33P-Orthophosphoric acid (Perkin Elmer) for 6 hr. The cells were 197

then lysed and immunoprecipitation was performed with anti-NP mAb as described 198

above. The samples were resolved on a 10% acrylamide gel by SDS-PAGE and gels 199

were dried. Radioactivity was detected by exposing the gel to a Storage Phosphor 200

Screen BAS-IP MS (Fuji) overnight. The screen was read on a Typhoon FLA 7000 (GE 201

Healthcare Life Sciences, Pittsburgh, PA) and the densitometry analysis was performed 202

using ImageQuant TL software (GE Healthcare). The ratio of 33P/35S was calculated 203

and reported. 204

205

In order to determine NP phosphorylation in infected cells, Vero cells in a 6-well plate 206

were infected with MuV (wt, S439A, S520A, or 542A) at an MOI of 0.1 for 1 hr. Media 207


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

was replaced with DMEM containing 2% FBS and 1% P/S and incubated for 24 hr. 208

After 24 hr, the cells were lysed, labeled, and immunoprecipitation and quantification 209

were performed as above. 210

211

Growth Curves. 212

Vero or HeLa cells in a 10-cm dish were infected with MuV (wt, S439A, S520A, or 213

542A) at an MOI of 0.01 or 5 in 5 ml of DMEM+2% FBS+1% P/S for 1 hr in triplicate. 214

Cells were washed four times with PBS and 10 ml of DMEM+2% FBS+1% P/S was 215

added to the cells. One sample was taken immediately after the DMEM was added and 216

labeled as 0 hpi (hours post infection). For MOI of 5, samples were collected at 0, 6, 217

12, 24, 48, and 72 hpi. For MOI of 0.01, samples were collected at 0, 24, 48, 72, 96, 218

and 120 hpi. All samples were supplemented with 1% BSA after collection and stored 219

at -80°C. Virus titers were determined by plaque assay on Vero cells. Results were 220

confirmed in a second experiment. Significance was determined by two-way ANOVA 221

using the Holm-Sidak method to correct for multiple comparisons. 222

223

Real-time PCR. 224

Vero cells in a 6-well plate were infected with MuV (wt, S439A, S520A, or S542A) at an 225

MOI of 0.1 for 1 hr, washed three times with PBS, and 2 ml of DMEM+2%FBS+1%P/S 226

was added to each well. At 0, 6, 12, and 18 hpi, total RNA was collected using the 227

RNeasy Plus Mini Kit with QIAshredder homogenization (Qiagen) according to the 228


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

manufacturer’s instruction. cDNA was generated using SuperScript III Reverse 229

Transcriptase (Life Technologies) using 5 µl of RNA according to the manufacturer’s 230

directions. Oligo(dT)15 (Promega) were used for mRNA cDNA synthesis and a primer 231

specific for the negative sense genome (TGAACTAGCGAGGCCTATCCCCAAG) was 232

used for genomic cDNA synthesis. 5µl of cDNA was used for real-time PCR using a 233

MuV-F specific, FAM-tagged probe (Life Technologies) and TaqMan Gene Expression 234

Master Mix (Life Technologies) according to the manufacturer’s instructions. Real-time 235

PCR was run on a StepOnePlus Real Time PCR System (Life Technologies). 236

Biological triplicate samples were run for each sample. Ct values were normalized to 237

genomic RNA at 0 hpi. Significance was determined by two-way ANOVA using the 238

Holm-Sidak method to correct for multiple comparisons. 239

240

Protein quantification. 241

Cells were infected at an MOI of 0.1 for 6 hr or MOI of 5 for 24 hr. Cells were washed 242

once with PBS and trypsinized. Cells were collected into a 1.5 ml tube and pelleted (all 243

spins at 600 g), washed twice with DMEM+2% FBS, and fixed and permeabilized using 244

Cytofix/Cytoperm solution (BD Biosciences, San Jose, CA) overnight at 4°C. The mAbs 245

were conjugated using Zenon Alexa 488 (A488) or Allophycocyanin (APC) Mouse IgG1 246

Labeling Kits (Life Technologies) according to the manufactures specifications. Cells 247

were then washed twice with Perm/Wash buffer (BD Biosiences) followed by staining 248

with anti-NP(A488) or anti-P(APC). After staining for 20 min at 4°C, samples were 249

washed twice with Perm/Wash buffer and once with PBS+1%BSA. Cells were then 250


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

resuspended in 500 µl of PBS+1% BSA. Flow cytometry was performed using the 251

LSRII Flow Cytometer (BD) and data was collected and analyzed using FACSDiva 252

(BD). The mean fluorescence intensity was calculated for the stained population. 253

254

Total protein was also measured by infecting cells at an MOI of 5 as above, lysing with 255

2x Laemmli Sample Buffer (Bio-Rad), and heating at 95°C for 5 min. Samples were 256

then resolved on a 10% acrylamide gel by SDS-PAGE and transferred to Amersham 257

Hybond LFP PVDF membranes (GE Healthcare Life Sciences). Immunoblotting was 258

performed by incubating the membranes with anti-NP and anti-P mAb and anti-GAPDH 259

[GT239] (Genetex, Irvine, CA) in 5% milk+PBS+0.1% Tween 20 (PBST) overnight at 260

4°C, followed by three washes with PBST, followed by incubation with Cy3 conjugated 261

goat anti-mouse IgG diluted 1:2500 (Jackson ImmunoResearch,West Grove, PA) in 5% 262

milk+PBST for 1hr at room temperature. After the incubation, the membrane was 263

washed four times with PBST and dried. The blot was visualized on the Typhoon FLA 264

7000 (GE Healthcare Life Sciences) and the densitometry analysis was performed 265

using ImageQuant TL software (GE Healthcare). 266

267


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Results 268

269

MuV NP is phosphorylated. 270

Previously, it was shown that MuV NP was phosphorylated when mumps virus was 271

grown in chicken embryo cells. In order to determine if NP is phosphorylated in 272

mammalian cells, Vero cells were infected with the recombinant mumps virus, 273

rMuV(Iowa/US/06) (referred to as MuV), at an MOI of 0.1 for 24 hr and labeled with 35S-274

Met/Cys or 33P- Orthophosphoric acid. Immunoprecipitation was performed using anti-275

NP mAb (24) and samples were resolved by SDS-PAGE. NP was detected in the 33P 276

labeling, indicating that NP was phosphorylated in infected cells (Figure 1A, left panel). 277

To determine if NP phosphorylation was dependent on other viral proteins, cells were 278

transfected with a plasmid encoding MuV NP, labeled with radioactive reagents and 279

immunoprecipitated as above (Figure 1A, right panel). NP was detected in NP-280

transfected cells labeled with 33P, indicating that NP was phosphorylated without any 281

other viral proteins present. 282

283

Phosphorylation sites in NP were determined by in silico modeling and mass 284

spectrometry. 285

Potential phosphorylation sites within NP were first identified using NetPhos 2.0 286

(http://www.cbs.dtu.dk/services/NetPhos/), a sequence-based prediction (26). Using 287


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

this program, 12 phosphorylation sites were predicted above the cutoff value of 0.5. 288

These sites are summarized in Table 1. 289

290

To identify the phosphorylated resides in MuV NP in infected cells, Vero cells were 291

infected with MuV at an MOI of 0.1 for 48hr. In order to determine if there were 292

differences in the phosphorylation state of NP interacting with P, two sequential 293

immunoprecipitation were performed. Cells were first lysed and immunoprecipitated 294

with a mAb specific for MuV-P, which pulled down all of the P protein in the sample, as 295

well as NP that was associated with P (Figure 1B, Sample 1). The unbound protein 296

from the first immunoprecipitation was then immunoprecipitated again using a mAb 297

specific for MuV-NP, which pulled down all of the non-P associated NP (Figure 1B, 298

Sample 2). These samples were resolved by SDS-PAGE and stained with Coomassie 299

Blue. The labeled NP bands were excised from the gel. The samples were subjected 300

to tryptic digestion, phosphopeptide enrichment, and analyzed by LC-MS/MS. The 301

coverage was between 93-94% for each sample (Figure 1C and 1D), with residues 302

T387 and S439 found to be phosphorylated in both samples, and residues S25 and 303

S542 phosphorylated in only in sample 1. The detected sites along with other sites that 304

were below the defined cutoff for confirmed phosphorylation are summarized in Table 1. 305

306

The S439 residue in MuV NP was found to be the major phosphorylation site in 307

transfected cells. 308

309


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

To assess which serine and threonine residues contributed to NP phosphorylation, we 310

chose to examine seven residues (S25, S94, T183, S298, T387, S439, and S542) 311

based on identification by mass spectrometry and two residues (S67 and S520) based 312

on high in silico prediction scores (0.990 and 0.979). Plasmids encoding NP were made 313

with mutations to convert the serine or threonine residues to alanine in the encoded 314

protein. Effects of the mutations on phosphorylation were determined by transfection of 315

cells with plasmids expressing wt NP or the NP with alanine substitutions in duplicate. 316

After 24 hours, one replicate was labeled with 35S and the other was labeled with 33P. 317

After 6 hours of labeling, the cells were lysed and immunoprecipitation with anti-NP 318

antibody was performed. The samples were resolved by SDS-PAGE (Figure 2A) and 319

the ratio of 33P to 35S was calculated (Figure 2B). NP-S439A had little or no 320

phosphorylation, while there was no significant difference between wt NP and the other 321

mutants. The addition of P and L in the transfection had no effect on the 322

phosphorylation of wt NP during transfection (data not shown). 323

324

The role of NP residues was assessed with a MuV minigenome system. 325

The role of NP in transcription and replication was studied using the MuV minigenome 326

system previously developed in our lab (23). The minigenome system consists of 327

plasmids required for transcription and replication of viral RNA (NP, P, and L), as wells 328

as a plasmid that encodes a viral negative sense minigenome under a T7 promoter. 329

When transfected into T7 RNAP-expressing BSR-T7 cells, the minigenome plasmid 330

produces negative-sense RNA containing the sequence for Renilla luciferase flanked by 331


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

the MuV leader and trailer. The MuV replication machinery (NP, P, and L) replicates 332

this RNA through a positive sense intermediate and produces Renilla luciferase mRNA, 333

which is translated by host machinery. Changes in Renilla luciferase activity are due to 334

changes in the replicative and transcriptional activity of the MuV replication system. The 335

plasmids encoding NP mutants were tested at four concentrations and the peak activity 336

was reported for each (Figure 3A). An example minigenome titration is shown 337

comparing wt NP and the S439A mutant (Figure 3B). Western blots were performed for 338

each minigenome set to examine NP expression levels (Figure 3C). Two mutants and 339

wt NP are shown, but all mutants had similar protein amounts when the same amount of 340

plasmid was transfected, with some slight variation. The same plasmids showed no 341

difference in protein levels when using radioactive labeling. The use of multiple 342

concentrations of plasmid in the minigenome system also controls for any differences in 343

expression. We found that the S439A mutant had a higher level of minigenome activity. 344

Four of the substitutions (S25A, S94A, T183A, S298A) had lower activity and there was 345

no change with the other four substitutions (S67A, T387A, S520A, S542A). 346

347

S439 was the major phosphorylation site in NP in virus. 348

We have constructed plasmids containing full-length MuV genome with alanine 349

substitutions in NP and produced seven plasmids (S25A, S94A, S183A, T387A, S439A, 350

S520A, S542A). The reverse genetics system previously developed in our lab was 351

used to successfully rescue three viruses (rMuV-NP-S439A, S520A, S542A) (24, 25). 352

Complete genome sequences were confirmed as outlined in the methods. At least 353


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

three rescue attempts were made to rescue the other viruses, without success, while 354

wild-type viruses were consistently rescued. To examine the phosphorylation states of 355

NP in these viruses, Vero cells were infected with wt MuV and the three mutant viruses. 356

Radioactive labeling of infected cells and immunoprecipitation of cell lysates were 357

performed, and phosphorylation was determined as in the previous experiment (Figure 358

4A). After calculating the ratio of 33P to 35S (Figure 4B), we found that there was a 359

significant decrease in phosphorylation for MuV-NP-S439A, while there was no change 360

in the other two mutant viruses, indicating that S439 is the major phosphorylation site of 361

NP. This is consistent with the results obtained using transfected NP. 362

363

rMuV(wt), rMuV-NP-S439A, S520A, and S542A had changed growth rates in cell 364

culture. 365

To determine the effect of the NP mutations on virus growth in cell culture, single-cycle 366

and multi-cycle growth curves were performed in Vero and HeLa cells. In a single-cycle 367

growth curve, cells were infected with an MOI of 5 and supernatant was collected at 0, 368

6, 12, 24, 48, and 72 hours post infection (hpi). In a multi-cycle growth curve, cells were 369

infected at an MOI of 0.01 and supernatant was collected every 24 hours until 144 hpi. 370

During single-cycle replication in Vero cells (Figure 5A), there was lower virus titer for 371

rMuV-NP-S439A at 6 hpi when compared to rMuV(wt), but an increased titer at 12, 24, 372

48, and 72 hpi. rMuV-NP-S542A had decreased titers at 12, 24, 48, and 72 hpi and 373

rMuV-NP-S520A had even lower titers at each of those time-points. During multi-cycle 374

replication in Vero cells (Figure 5B), rMuV-NP-S439A had increased titers at 48, 96, and 375


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

120 hpi, while both rMuV-NP-S520A and S542A had reduced titers at 72 and 120 hpi 376

when compared to rMuV(wt). 377

378

In HeLa cells, the growth characteristics of the viruses were similar to those in Vero 379

cells for the single-cycle growth, but there were differences between HeLa and Vero for 380

the multi-cycle growth. There still was a lag in single-cycle growth for MuV-NP-S439A 381

(Figure 5C), but the virus was able to reach a significantly higher titer than rMuV(wt) by 382

48hpi. During multi-cycle growth in HeLa cells (Figure 5D), MuV-NP-S439A had lower 383

titers from 72 to 144 hpi. MuV-NP-S542A has higher titers compared to rMuV(wt) at 48 384

and 96hpi with slightly lower titers at 144hpi. MuV-NP-S520A had decreased titers 385

compared to rMuV(wt) after 72hpi, similar to growth in Vero cells. 386

387

rMuV-NP-S439A had increased protein present at 6 and 24 hours post infection. 388

To determine if there were differences in protein production for these viruses, the 389

amount of protein produced during viral infection was examined by western blotting first 390

(Figure 6A). rMuV-NP-S439A had increased viral protein in cells (Figure 6B). rMuV-391

NP-S542A also had a small increase in viral protein levels by western blot, although the 392

increase was not significant. To determine if this difference was due to protein 393

production on a per cell basis, flow cytometry was used to stain for viral protein 394

expression after infection. In order to determine early protein production, cells were 395

collected 6 hours after infection (MOI of 0.1) and stained with antibodies specific to MuV 396

NP or P. The mean fluorescence intensity was determined for each of the stained 397


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

populations (Figure 6C). rMuV-NP-S439A produced more protein at 6 hpi, as seen by 398

staining for NP, while amounts of P were not detectable at this time. Furthermore, 399

rMuV-NP-S439A had an increase in both the amount of NP and P produced on a per 400

cell basis using high MOI (MOI of 5) infection at 24 hpi (Figure 6D). rMuV-NP-S542A 401

had a trend toward higher protein levels by flow cytometry, but the difference was not 402

significantly different from rMuV (wt) (p=0.12 to 0.4). 403

404

rMuv-NP-S439A had increased genome replication and mRNA production. 405

To understand the difference in protein production and viral titer, the amount of genome 406

RNA and mRNA were measured by quantitative real-time, reverse transcription PCR 407

(qRT-PCR) in infected Vero cells (MOI of 0.1). The cDNA was generated using a 408

genome specific primer to quantify genome RNA and oligo dT to quantify mRNA. The 409

probe used for all samples was specific to MuV F or HN. Data using the MuV F specific 410

probe is reported. It was found that rMuV-NP-S439A had increased genomic RNA 411

production at 6, 12, and 18 hpi, while rMuV-NP-S520A and S542A had decreased 412

genomic RNA production at 12 and 18 hpi when compared to rMuV(wt) (Figure 7A). 413

rMuV-NP-S439A also had increased mRNA production at all timepoints, while rMuV-414

NP-S520A and S542A had decreased levels at 6, 12, and 18 hpi when compared to 415

MuV(wt) (Figure 7B). When comparing the ratio of mRNA to genomic RNA, rMuV-NP-416

S439A had increased relative mRNA levels at 0 and 6 hpi, rMuV-NP-S542A had 417

reduced relative levels at 6 and 12 hpi, and rMuV-NP-S520A had no significant 418

differences when compared to MuV(wt) (Figure 7C). 419


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

420

Mutations in NP affect NP-P interaction during infection but not transfection. 421

To investigate the mechanism of the phosphorylation of NP in regulating viral RNA 422

synthesis, NP and P interaction was examined. Cells were transfected with plasmids 423

encoding NP and P and immunoprecipitation was performed using either anti-NP 424

(Figure 8A) or anti-P (Figure 8B) mAbs. After co-immunoprecipitation of NP and P 425

when using plasmids encoding any of the mutant NPs, no difference was detected. To 426

assess differences in NP and P association in infected cells, Vero cells were infected 427

with MuV-wt, S439A, S520A, and S542A. Co-immunoprecipitation and total protein 428

visualization was performed (Figure 8C). The ratio of NP to P was calculated (Figure 429

8D) and MuV-S439A had decreased amounts of NP co-immunoprecipitated with P 430

during the anti-P pull down. While there was a difference in NP-P interaction during 431

infection, there was no difference in the amount of NP or P in sucrose gradient purified 432

virus from infected cells (data not shown). 433

434


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Discussion 435

436

In this study, we identified and confirmed multiple phosphorylated residues in MuV NP 437

by mass spectrometry and directed mutagenesis. We showed that S439 was the major 438

site of phosphorylation. Mutating this residue to alanine caused an increase in 439

minigenome activity and higher levels of viral RNA and protein expression in rMuV-NP-440

S439A-infected cells than wild type virus-infected cells at early time points after 441

infection. This is in contrast to previous work on Measles, Rabies, and Nipah viruses, 442

which have decreased activity in their respective minigenome systems when NP 443

phosphorylation is reduced (16-18). To the best of our knowledge this is the only case in 444

which decreased phosphorylation of the nucleoprotein of a virus resulted in increased 445

activity, indicating that phosphorylation of NP down-regulate viral RNA synthesis. We 446

hypothesize that phosphorylation can both up- and down-regulate activity and that these 447

differences may depend on the site that is being phosphorylated. 448

449

The mechanism of down-regulation of viral RNA synthesis by S439 of NP is not clear. 450

We assessed the RNA binding of S439A along with all other alanine substitution 451

mutants, but no differences were found compared to any of the mutants and wt NP 452

(data not shown). One interesting difference between wt NP and NP-S439A is their 453

interaction with P. While we were not able to show any differences in interactions 454

between NP and P or NP and M in transfected cells, we found that there was much less 455

NP pulled down in cells infected with rMuV-NP-S439A by an anti-P mAb in co-456


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

immunoprecipitation. This result suggests that phosphorylation at S439 increases NP 457

association with P in infected cells, although phosphorylation at S439 was found in both 458

P-associated NP and free NP (Figure 1b, Table 1). This is rather surprising because 459

the domain of NP interacting with P is located at N-terminal 400 amino acid residues of 460

NP and mutation at residue 439 should not have affected binding with P (13, 14). The 461

difference in expression levels of NP, P and L in transfection and infection may 462

contribute to the difference observed in the NP-P binding. It is possible that a previous 463

un-detected region of NP (C-terminal tail domain) can interact with P, in the presence of 464

other viral protein such as L and M. 465

466

The fact that rMuV-NP-S439A caused a slight lag in virion production even though there 467

was more RNA and protein at that time point when compared to the other viruses 468

suggests that there may be some defect in packaging of RNA for production and 469

release of progeny virus. The lag in virion production may be detrimental to virus 470

growth in vivo, which could explain why this position is highly conserved among all MuV 471

strains (data not shown). The lower titer of rMuV-NP-S439A in HeLa cells, a type I 472

interferon (IFN) producing cell, compared to wt MuV is consistent with this residue being 473

critical for MuV growth in vivo. It is possible that the rMuV-NP-S439A virus was more 474

sensitive to type I IFN during HeLa infection, which is not observed in Vero cells, an IFN 475

defective cell. 476

477


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

While mutations at other amino acid residues did not produce a significant decrease in 478

phosphorylation in transfected cells, they did play critical roles. There was a small 479

decrease in phosphorylation of the S542A mutant. There was also a small, but 480

significant decrease in both genomic RNA and mRNA, although there was a slight 481

increase in protein produced. It is possible that there may be some defect in budding 482

for the rMuV-NP-S542A virus, which might have caused the decrease in RNA and 483

increased protein in the cells. Less protein may be exported in progeny virions. In 484

PIV5, a closely related paramyxovirus, it is known that negatively charged residues in 485

the tail of NP are important for NP-M interaction and virus budding (27). The impact of 486

the mutation at S542 may also be attributed to the transient nature of phosphorylation at 487

this site. This is consistent with the mass spectrometry data that shows S542 was only 488

significantly phosphorylated in the P-associated sample. rMuV-NP-S520A had a lower 489

virus titer when compared to MuV(wt), suggesting that there was some defect in virus 490

growth, although there were only modest decreases in the amount of genomic RNA and 491

mRNA produced. We were also unable to find any phosphorylation at this site by mass 492

spectrometry and saw no decrease in phosphorylation when the residue was 493

substituted for alanine. It is possible that phosphorylation at this residue per se does not 494

have an impact on virus life cycle, but the residue itself is important for the virus life 495

cycle. When amino acid residues at positions S94, T183, or S298 were substituted with 496

alanine, there was a large decrease in minigenome activity. Viruses containing these 497

mutations were not obtained after multiple attempts, likely due to the low level of 498

replicative activity seen in the minigenome system, suggesting that these residues play 499

important roles in the virus life cycle. It is surprising that viruses containing mutations at 500


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

S67 and T387 were not obtained since these mutations did not affect minigenome 501

activity. It is likely that these residues, not necessarily their phosphorylation status, may 502

play a role beyond viral RNA synthesis. Interestingly, mutations at the unstructured C-503

terminus of NP allowed rescue of infectious virus and we were unable to rescue 504

infectious viruses containing mutations at the N-terminal of NP, suggesting that residues 505

in the more structure N-terminus need to be preserved. 506

507

Understanding the roles of phosphorylation of MuV NP will not only contribute to our 508

knowledge on viral RNA synthesis, but also aid design of novel anti-virals and the next 509

generation of vaccines. Since MuV is not known to encode its own kinase to 510

phosphorylate NP, the host kinases responsible for NP phosphorylation may be viable 511

drug targets. While host kinase responsible for phosphorylation of NP’s S439 residue is 512

not likely a good target for antiviral drug development, kinases responsible for 513

phosphorylation of N-terminal of NP may be good targets since mutating these residues 514

resulted in difficulties in obtaining infectious viruses. Identifying of the host kinases 515

responsible for phosphorylating these critical sites of NP may lead to development of 516

small molecule inhibitors of the kinases as anti-MuV drugs, which do not exist at 517

present. Preventing phosphorylation at NP-S439 was able to increase viral replication 518

in Vero cells. This mutation can be incorporated into vaccine viruses enabling faster 519

growth and higher titer viruses, which will reduce the cost of future vaccines. 520


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

ACKNOWLEDGEMENTS 521

522

We appreciate the helpful discussion and technical assistance from all members of Dr. 523

Biao He’s laboratory. This work was supported by grants (R01AI097368 and 524

R01AI106307) from the National Institutes of Health. 525

526


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Figure Legends 527

Figure 1. Analysis of NP phosphorylation by mass spectrometry. (A) 528

Phosphorylation of NP in infected or transfected cells. Vero cells were infected with 529

MuV-IA and HEK293T cells were transfected with NP and P. After 24 hr, proteins were 530

labeled with 35S-met or 33P-Orthophosphoric acid. Cells were lysed and 531

immunoprecipitated with anti-NP mAb. The samples were resolved by SDS-PAGE. (B) 532

Immunoprecipitiation of NP by anti-NP and anti-P. Vero cells were infected by MuV-IA 533

and lysate was immunoprecipitated with an anti-P mAb (sample 1). Unbound protein 534

was immunoprecipiatated with and anti-NP mAb (sample 2). The samples were 535

resolved by SDS-PAGE followed by visualization using Coomassie blue and NP band 536

was excised for analysis by LC-MS/MS. The P1 and P2 bands of MuV P were excised 537

for analysis in another study. (C) Coverage of MS of NP after anti-P IP. (D) Coverage 538

of MS of NP after anti-NP IP. Phosphorylated positions are in bold and positions not 539

covered are struck through. Phosphorylation was considered significant with a random 540

probability score of less than 5%. 541

542

Figure 2. Phosphorylation of NP mutants in transfected cells. (A) Detection of NP 543

mutant phosphorylation. Residue S439 was found to be the major phosphorylation site 544

in NP. HEK293 cells were transfected with plasmids encoding either wt or NP with S/T 545

residues mutated to A followed by 35S-Met/Cys or 33P-Orthophosphoric acid. 546

Immunoprecipitation was performed with an anti-NP mAb and samples were resolved 547

by SDS-PAGE. A representative gel is shown along with data from three separate 548


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

experiments. (B) Summary of quantified NP phosphorylation. The relative density of 549

the phosphorylated versus total NP was calculated for each experiment. All data was 550

normalized to wt NP. (One-way ANOVA with Holm-Sidak multiple comparison test, N=3, 551

*p<0.001) 552

553

Figure 3. Effects of NP mutants on the MuV minigenome system. (A) Peak 554

minigenome activity of the NP mutants. A MuV minigenome assay was performed 555

using plasmids encoding NP with possible phosphorylation sites mutated to alanine. 556

The amount of NP plasmid was varied (12.5, 25, 50, 100ng/well). The ratio of Renilla 557

luciferase to firefly luciferase activity was normalized to wt for each sample and the 558

peak titer is reported. Mutating position S439 was found to significantly increase 559

minigenome activity. (n=3, ANOVA with Dunnett’s multiple comparison test, *p<0.01, 560

**p<0.001) (B) Representative activity curves for the minigenome assay. The 561

minigenome activity for wt and S439A NP are shown at each concentration tested. (C) 562

The expression of NP was assessed by western blot. All mutant proteins were shown 563

to be expressed at similar levels, as seen by blotting for NP using an NP specific mAb. 564

565

Figure 4. Phosphorylation of NP mutants in infected cells. (A) Detection of 566

phosphorylation of NP mutants. Vero cells were infected with MuV (wt) or mutant 567

viruses. Radioactive labeling was performed and lysates were immunoprecipitation with 568

an anti-NP mAb. Samples were resolved by SDS-PAGE. A representative gel is 569

shown. (B) Summary of NP phosphorylation in infected cells. MuV-NP-S439A was 570


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

found the have significantly reduced phosphorylation in infected cells. (N=3, student t-571

test, *p<0.01) 572

573

Figure 5. Growth kinetics of MuV mutants. In each experiment, cells were infected 574

with MuV(wt), S439A, S520A, or S542A. Media was collected at various time points. 575

The titer of virus in the media was determined by plaque assay using Vero cells (A) 576

Vero cells infected at an MOI of 5. (B) Vero cells infected at an MOI of 0.01. (C) HeLa 577

cells infected at an MOI of 5. (D) HeLa cells infected at an MOI of 0.01. (For all growth 578

curves: n=3, ANOVA with Dunnett’s multiple comparison test, *p<0.05) 579

580

Figure 6. Protein production in infected Vero cells. In each experiment, cells were 581

infected with MuV wt, S439A, S520A, or S542A. (A) Total protein production in Vero 582

cells infected at an MOI of 5 after 24 hours. Samples were resolved by SDS-PAGE and 583

NP was quantified by western blot. (B) Summary of total protein production in Vero 584

cells infected at an MOI of 5. Average density was calculated over multiple experiments 585

and 439A was found to have increased protein production. (C) Protein production in 586

Vero cells infected at an MOI of 0.1 after 6 hours. Cells were collected and stained 587

using anti-NP (A488) and anti-P (APC) for flow cytometry. The mean fluorescence 588

intensity (MFI) was calculated for the stained population. (D) Protein production in Vero 589

cells infected at an MOI of 5 after 24 hours. Cells were treated as in (C). (One-way 590

ANOVA with Holm-Sidak multiple comparison test, n=3, *p<0.05) 591

592


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Figure 7. Genomic RNA and mRNA levels in infected Vero cells. Vero cells were 593

infected at an MOI of 0.1 with MuV(wt), S439A, S520A, or S542A. Total RNA was 594

extracted from biological replicates (n=3). Real-time PCR was performed on each 595

samples using a using a MuV-F specific FAM-tagged probe. (A) Levels of genomic 596

RNA. Genome replication was calculated after normalization to genomic RNA levels at 597

0 hpi. (B) Levels of viral mRNA. mRNA production was calculated after normalization 598

to genomic RNA levels at 0 hpi. (C) Quantification of relative levels of mRNA to 599

genomic RNA. The ratio of mRNA to genomic RNA was calculated at each timepoint. 600

(Multiple T-tests with Holm-Sidak multiple comparison test, n=3, *p<0.05) 601

602

Figure 8. Interaction between MuV NP and P. (A) Interaction between NP and P in 603

transfected cells. HEK293T cells were transfected with wt and mutant NPs and P. 604

Proteins were labeled with 35S-Met/Cys and co-immunoprecipitation was performed 605

using antibodies specific to NP. No difference was detected in the amount of NP or P 606

pulled down. (B) Interaction between NP and P in transfected cells. Using the same 607

samples as (A), co-immunoprecipitation was performed using antibodies specific to P. 608

No difference was detected in the amount of NP or P pulled down. (C) Interaction 609

between NP and P in infected cells. Vero cells were infected with MuV (wt), S439A, 610

S520A, S542A, or mock infected. Total protein was labeled with 35S-Met/Cys and co-611

immunoprecipitation was performed using antibodies specific to NP or P. (D) The mean 612

of the NP to P ratio for the anti-P immunoprecipitation is graphed with the SEM shown. 613

There was less NP co-immunoprecipitated with P, during infection with rMuV-NP-614

S439A. (n=3, student t-test, *p<0.05) 615


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

616

Table 1. Phosphorylation of MuV NP by in silico prediction and mass 617

spectrometry. Phosphorylation site prediction was performed using the NetPhos 2.0 618

Server (http://www.cbs.dtu.dk/services/NetPhos/). Values >0.5 were considered to likely 619

be phosphorylated and are highlighted. Phosphorylation sites found by mass 620

spectrometry (as described in figure 1) are shown in the two right columns. The random 621

probability score for each site is listed, with a score of <0.05 considered likely to be 622

phosphorylated and are highlighted. 623

624


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

References 625

1. Carbone KM, Wolinsky JS. 2001. Mumps Virus, p. 1381-1400. In Knipe DM, 626 Howley PM (ed.), Field's Virology, 4 ed, vol. 1. Lippincott Williams and Wilkins, 627 Philadelphia. 628

2. Fields BN, Knipe DM, Howley PM, Griffin DE. 2007. Fields virology. Wolters 629 Kluwer Health/Lippincott Williams & Wilkins, Philadelphia [etc.]. 630

3. Marin M, Quinlisk P, Shimabukuro T, Sawhney C, Brown C, Lebaron CW. 631 2008. Mumps vaccination coverage and vaccine effectiveness in a large 632 outbreak among college students--Iowa, 2006. Vaccine 26:3601-3607. 633

4. National Center for Immunization and Respiratory Diseases DoVD 2015, 634 posting date. Mumps Cases and Outbreaks. [Online.] 635

5. Takeuchi K, Hishiyama M, Yamada A, Sugiura A. 1988. Molecular cloning and 636 sequence analysis of the mumps virus gene encoding the P protein: mumps virus 637 P gene is monocistronic. J. Gen. Virol. 69:2043-2049. 638

6. Emerson SU, Yu Y-H. 1975. Both NS and L proteins are required for in vitro 639 RNA synthesis by vesicular stomatitis virus. J. Virol. 15:1348-1356. 640

7. Abraham G, Banerjee AK. 1976. Sequential transcription of the genes of 641 vesicular stomatitis virus. Proc. Natl. Acad. Sci. USA 73:1504-1508. 642

8. Ball LA, White CN. 1976. Order of transcripton of genes of vesicular stomatitis 643 virus. Proc. Natl. Acad. Sci. USA 73:442-446. 644

9. Emerson SU. 1982. Reconstitution studies detect a single polymerase entry site 645 on the vesicular stomatitis virus genome. Cell 31:635-642. 646

10. Iverson LE, Rose JK. 1982. Sequential synthesis of 5'-proximal vesicular 647 stomatitis virus mRNA sequences. J. Virol. 44:356-365. 648

11. Cox R, Pickar A, Qiu S, Tsao J, Rodenburg C, Dokland T, Elson A, He B, 649 Luo M. 2014. Structural studies on the authentic mumps virus nucleocapsid 650 showing uncoiling by the phosphoprotein. Proc Natl Acad Sci U S A 111:15208-651 15213. 652

12. Cox R, Green TJ, Purushotham S, Deivanayagam C, Bedwell GJ, Prevelige 653 PE, Luo M. 2013. Structural and functional characterization of the mumps virus 654 phosphoprotein. J Virol 87:7558-7568. 655

13. Kingston RL, Gay LS, Baase WS, Matthews BW. 2008. Structure of the 656 nucleocapsid-binding domain from the mumps virus polymerase; an example of 657 protein folding induced by crystallization. J Mol Biol 379:719-731. 658

14. Kingston RL, Baase WA, Gay LS. 2004. Characterization of nucleocapsid 659 binding by the measles virus and mumps virus phosphoproteins. J Virol 78:8630-660 8640. 661

15. Li M, Schmitt PT, Li Z, McCrory TS, He B, Schmitt AP. 2009. Mumps virus 662 matrix, fusion, and nucleocapsid proteins cooperate for efficient production of 663 virus-like particles. J Virol 83:7261-7272. 664

16. Hagiwara K, Sato H, Inoue Y, Watanabe A, Yoneda M, Ikeda F, Fujita K, 665 Fukuda H, Takamura C, Kozuka-Hata H, Oyama M, Sugano S, Ohmi S, Kai 666 C. 2008. Phosphorylation of measles virus nucleoprotein upregulates the 667 transcriptional activity of minigenomic RNA. PROTEOMICS 8:1871-1879. 668


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

17. Yang J, Koprowski H, Dietzschold B, Fu ZF. 1999. Phosphorylation of Rabies 669 Virus Nucleoprotein Regulates Viral RNA Transcription and Replication by 670 Modulating Leader RNA Encapsidation. Journal of virology 73:1661-1664. 671

18. Huang M, Sato H, Hagiwara K, Watanabe A, Sugai A, Ikeda F, Kozuka-Hata 672 H, Oyama M, Yoneda M, Kai C. 2011. Determination of a phosphorylation site in 673 Nipah virus nucleoprotein and its involvement in virus transcription. Journal of 674 General Virology 92:2133-2141. 675

19. Sugai A, Sato H, Yoneda M, Kai C. 2013. Phosphorylation of Measles Virus 676 Nucleoprotein Affects Viral Growth by Changing Gene Expression and Genomic 677 RNA Stability. Journal of virology 87:11684-11692. 678

20. Becker S, Huppertz S, Klenk H-D, Feldmann H. 1994. The nucleoprotein of 679 Marburg virus is phosphorylated. Journal of General Virology 75:809-818. 680

21. Gombart AF, Hirano A, Wong TC. 1995. Nucleoprotein phosphorylated on both 681 serine and threonine is preferentially assembled into the nucleocapsids of 682 measles virus. Virus Research 37:63-73. 683

22. Naruse H, Nagai Y, Yoshida T, Hamaguchi M, Matsumoto T, Isomura S, 684 Suzuki S. 1981. The polypeptides of mumps virus and their synthesis in infected 685 chick embryo cells. Virology 112:119-130. 686

23. Pickar A, Xu P, Elson A, Li Z, Zengel J, He B. 2014. Roles of Serine and 687 Threonine Residues of Mumps Virus P Protein in Viral Transcription and 688 Replication. Journal of virology 88:4414-4422. 689

24. Xu P, Li Z, Sun D, Lin Y, Wu J, Rota PA, He B. 2011. Rescue of Wild-type 690 Mumps Virus from a Strain Associated with Recent Outbreaks Helps to Define 691 the Role of the SH ORF in the Pathogenesis of Mumps Virus. Virology 417:126-692 136. 693

25. Xu P, Luthra P, Li Z, Fuentes S, D'Andrea JA, Wu J, Rubin S, Rota PA, He B. 694 2012. The V protein of mumps virus plays a critical role in pathogenesis. Journal 695 of virology 86:1768-1776. 696

26. Blom N, Gammeltoft S, Brunak S. 1999. Sequence and structure-based 697 prediction of eukaryotic protein phosphorylation sites1. Journal of Molecular 698 Biology 294:1351-1362. 699

27. Schmitt PT, Ray G, Schmitt AP. 2010. The C-Terminal End of Parainfluenza 700 Virus 5 NP Protein Is Important for Virus-Like Particle Production and M-NP 701 Protein Interaction. Journal of virology 84:12810-12823. 702

703


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

Table 1 Summary of phosphorylation site prediction in MuV NP

Amino Acid NetPhos

(in silico prediction) LC-MS/MS Phosphorylation Anti-P IP Anti-NP IP

T12 0.689 N/A N/A S25 0.071 0.0024 29 T30 0.950 N/A N/A T42 0.891 N/A N/A S67 0.990 N/A N/A S94 0.996 0.28 0.29

T183 0.091 N/A 8.4 S191 0.749 N/A N/A S226 0.510 N/A N/A S298 0.042 N/A 0.059 T368 0.816 N/A N/A T387 0.565 0.0004 0.0032 T395 0.500 N/A 150 S439 0.992 0.0074 0.00036 S520 0.979 N/A N/A

S542 0.028 0.00015 3.4


http://jvi.asm.org/

Dow

nloaded from

http://jvi.asm.org/

the roles of phosphorylation of the nucleocapsid protein of mumps

Documents