sw - /de 0hg 9ro 1r 2fwrehu · 2018-01-24 · manal mohsen , wafaa k.zaki , rania ismail , nehal...
TRANSCRIPT
Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015
THE EGYPTIAN JOURNAL OF LABORATORY MEDICINE “DAR EL HEKMA”, 42, Kasr El‐Eini Street, Cairo, Egypt
PUBLISHED BY THE EGYPTIAN SOCIETY OF LABORATORY MEDICINE
(ESLM) Editor in Chief: Ali Ahmed Shams El‐Din Editor: Naguib Zoheir Mostafa e‐mail: [email protected] Assistant Editors: Sahar Kamal
Mervat Mamdooh Khorshied Heba Mahmoud Gouda
ADVISORY BOARD Alphabetical Order
Clinical Chemistry Mohga Zewar
Ahmed Abdel Samie Omran Nabiela Thabet Fatma El Mogui Naila Omran Omar Ali Alroubi Nevine Kassem Omneya Youssef Samir Sahlab Ousama Bakr Seddik Sherif Ahmed Ali Sawsan Housny Sourya Badawy Mona Salem Mouna Sedrak Histopathology Abdullah Khalil
Clinical Microbiology Eleya Ishaak
Amany El Kholy Ragaa Lashin ImmunologySoheir Helal Aida Abd El Azim Abd El Salam Walaa Gad Aisha Abdel Ghaffar Azza Aboul Enein
Hematology Azza Kamel
Azza Ahmed Mohamed Farha El Shennawy Azza Mostafa Mervat El‐Ansary Fadila Sabri Moemena Abdel Wahab Kamel Hala Farawella Mona Rafik Hala Gabr Nawal Afifi Laila Hegazy Safaa El KaraksyLoutfi Abdul Nabui Taghreed Gaafar
NOTES TO THE CONTRIBUTORS
The Egyptian Journal of Laboratory Medicine published by the Egyptian Society of Laboratory Medicine (ESLM) welcomes original papers, review articles, book reviews, abstracts from current literature and technical notes concerning different clinical laboratory procedures. The journal is published three times annually.
Articles to be published should not be published elsewhere, and should be accepted by a referee of the advisory board.
The authors will be responsible for published articles and not the editor.
MANUSCRIPTS:
1. An original manuscript and a photocopy plus one soft copy on a CD in Microsoft words format should be sent to the editor. (Clinical Pathology Dept., Kasr El‐Eini, Faculty of Medicine, Cairo University), Tel: o2‐23654480
2. It is necessary to present the manuscripts type‐written, preferably using word processor write on one side of A4 paper only, double spacing, liberal margins and not more than 24 lines per page.
3. Tables and figures should be: Clear, of very good quality and numbered in Arabic numericals. Photo pictures should be either (black and white or colored).
4. Site of the tables and figures in the articles should be marked in the manuscript. 5. The first page should only include (a) Title of paper (b) Authors (c) Institution in which the
work was carried out (d) Complete address for mailing purposes (e) Mobile Phone and e‐mail. 6. The manuscript should begin with abstract of the work, followed by introduction, material
and methods, results, discussion and the references. The last page is an Arabic summary. 7. Author’s names should be written as follows: First name then family name or first name,
initials then family name. 8. References at the end of the paper should be arranged alphabetically in the following order:
number, name of the author(s) each followed by initials, year in brackets, title of the subject, abbreviation of the journal name, volume number and page.
9. References within the article are referred to using the number of reference between brackets in superscript typing.
10. Authors are requested to condense their papers.
page
IMPLICATION OF TLR-3 AND TLR-9 SINGLE NUCLEOTIDE POLYMORPHISMS ON HCV
INFECTION, RESPONSE TO THERAPY AND FIBROSIS PROGRESSION AMONG EGYPTIAN
PATIENTS
Rania A. Zayed , Dalia Omran , Zinab Zakaria , Sameera Ezzat , Salwa Tawfeek and Hossam El-Sweesy
ROLE OF PLACENTAL PROTEIN 13 AS A BIOMARKER FOR EARLY DETECTION OF PRE-
ECLAMPSIA. METHYLENETETRAHYDROFOLATE REDUCTASE GENE POLYMORPHISM
AND RELATION TO DISEASE RISK, AN EGYPTIAN STUDY
Engy El Khateeb and Sherif Dahab..................................................................................................................
CORD BLOOD COPEPTIN AND CALPROTECTIN AS POTENTIAL BIOMARKERS OF
EARLY-ONSET NEONATAL SEPSIS
Manal Mohsen , Wafaa K.Zaki , Rania Ismail , Nehal El-Raggal and Mohamed A. Abd El-Wahed...........
THE STUDY OF BCR-ABL TRANSCRIPT VARIANTS (B2A2 AND B3A2) RELATION TO
DIFFERENT RISK SCORES
Hisham Abdelaziz , Ahmed Omar , Ali Alshemary and Mohamed Keshk..................................................
CRP AND SERUM AMYLOID A AS MARKERS FOR THE AGGRESSIVENESS OF BREAST
CANCER
Rania Elhelely , Rasha Elzehery , Mohammed AF Hegazy and Ramy Faris................................................
EXPRESSION OF CD69 IN CHRONIC LYMPHOCYTIC LEUKEMIA; RELATION TO
PROGNOSIS AND DISEASE PROGRESSION
Mahira I Elmougy and Ghada M Elgohary......................................................................................................
COMBINED ANALYSIS OF LEVELS OF SERUM B-CELL ACTIVATING FACTOR AND
A PROLIFERATION INDUCING LIGAND IN B-CELL CHRONIC LYMPHOCYTIC
LEUKEMIA; CORRELATION WITH CLINICAL FEATURES AND DISEASE PROGRESSION
Mahira I Elmougy and Ghada M. Elgohary.....................................................................................................
IN VITRO APOPTOTIC EFFECT OF METFORMIN ON HUMAN CERVICAL CANCER CELLS
Dina Sabry ,Sahar H. Ahmed and Mohamed A. S. Al-Ghussein....................................................................
ROLE OF INTERCELLULAR ADHESION MOLECULE-1 (ICAM-1) G241R AND K469E GENE
POLYMORPHISM AND SOLUBLE ICAM-1 SERUM LEVELS IN THE DEVELOPMENT OF
ISCHEMIC STROKE IN EGYPTIAN PATIENTS
Abeer Mohamed Mohy , Ahmed Abd Allah Hassan Ali and Heba Omar....................................................
γ- GLOBIN GENE XMN1 POLYMORPHISM-158 AND ITS CORRELATION TO THE
RESPONSE TO HYDROXYUREA IN βTHALASSEMIA MAJOR PATIENTS IN BENISUEF
GOVERNORATE(EGYPT)
Abdel Meged A. Abdel Meged , Dalia G. Amin , Dalia S. Morgan and Safwat L. Shaker...........................
1
13
21
31
39
47
57
65
73
81
1.
2.
3.
4.
5
6.
7.
8.
9.
10.
CONTENTS
IMPLICATION OF TLR-3 AND TLR-9 SINGLE NUCLEOTIDE
POLYMORPHISMS ON HCV INFECTION, RESPONSE TO THERAPY
AND FIBROSIS PROGRESSION AMONG EGYPTIAN PATIENTSRania A. Zayed*, Dalia Omran**, Zinab Zakaria**, Sameera Ezzat***, Salwa Tawfeek****
and Hossam El-Sweesy*****
ABSTRACT
Toll-like receptors (TLRs) are recognized as fundamental contributors to the immune system function against infections.
We studied the association of genetic variation in TLRs and HCV infection susceptibility, response to therapy and fibrosis
progression. Frequency of TLR-3 (_7 C/A [rs3775296]), TLR-3 (c.1377C/T [rs3775290]) and TLR-9 (1237T/C [rs5743836])
single nucleotide polymorphisms (SNPs) was studied in 100 chronic HCV- positive Egyptian patients and 100 healthy controls.
Frequency of SNP in TLR-3 (_7 C/A), TLR-3 (c.1377C/T) and TLR-9 (1237T/C) were not significantly different between studied
HCV- positive patients and controls with p-value 0.121, 0.112, 0.683 respectively. TLR-3 c.1377 T- allele was associated with
failure of end of treatment response (p= 0.006), failure to achieve SVR (p= 0.006) and was found to be related to advanced
stage of fibrosis (p= 0.003). In conclusion, TLR-3 c.1377 T- allele is associated with impaired response to therapy and fibrosis
progression in HCV infected Egyptian patients. Key words: TLR-3; TLR-9; HCV; Fibrosis; IFN; Egypt
Departments of Clinical and Chemical Pathology*, Faculty of Medicine, Cairo University, **Tropical Medicine,
***National Liver Institute, Menofia University, ****Internal Medicine, National Re search Institute, *****Cairo
Fatemic Hospital, Ministry of Health
Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015 1 - 12
INTRODUCTION
Hepatitis C virus (HCV) infection is a mul-
tifactorial disease representing a major health
problem in Egypt where the prevalence is almost
10-fold higher than that in other countries(17).
The immune system is an essential determinant
of viral infection outcome(57). Interactions be-
tween the viruses, hepatocytes, and the host im-
mune systems may determine viral persistence
and disease progression (9).
Toll-like receptors (TLRs) are fundamental
component of the innate immune system and
key regulators of acquired immunity. In hu-
mans, 10 TLRs proteins (TLR1–10) have been
identified(3), that possess different subcellular
localization depending on the specific patho-
gen-associated molecular patterns (PAMPs) or
damage-associated molecular patterns (DAMPs)
they recognize(25), thus called pattern recognition
receptors. TLR1, 2, 4, 5, 6, and 10 are found on
the extracellular surface of cells, while TLR3, 7,
8, and 9, are nucleic-acid sensors located within
the endoplasmic reticulum and endosomes(43,29).
TLRs 3 and 9 recognize microbial nucleic acid
molecular patterns (20-22, 32), TLR-3identifies viral
RNA(6), while TLR-9 is specific for unmethyl-
ated cytosine–phosphate–guanine (CpG) dinu-
cleotide motifs in pathogen DNA (22).
TLRs have an important role in pathogen
recognition and subsequently immune system
activation (2,22,26). They trigger inflammatory cy-
tokines production through nuclear factor-κB–
dependent or interferon (IFN) regulatory fac-
tor–dependent signaling pathways. Activation of
TLR by pathogen binding stimulates inflamma-
tory cytokines production that triggers induction
of type I IFNs(4,36). Type I IFNs (IFN-α, IFN-β)
have potent antiviral properties as they interfere
with virus replication(34,42,45) and possess immu-
nomodulatory activities(53) by promoting mul-
tiple immune functions. Type I IFNs promote;
CD8+ T cell effector functions, survival and
memory (28,31,38,41), polarization of CD4+ T cells
by Th1(52), NK cell activation (10), differentiation
and maturation of DCs(11,30,48). Thus, Type I IFNs
derive its name from a function to “interfere” in
viral replication(56).
Several data supports the role of SNPs in
TLR genes in modulating the risk of viral and
bacterial infections. SNP may alter promoter
activity affecting gene expression, mRNA con-
formation and stability or protein structure and
function (35).
HCV infection adds great financial burden on
the health sector especially in Egypt, having the
highest prevalence of HCV worldwide. “Know
your epidemic, know your response” concept,
Zayed, R. A. et al.2
necessitates the study of every aspect of the dis-
ease that may help in controlling disease dissem-
ination in the community or disease progression
which compromises the life quality of chronic
HCV-infected patients. The treatment regimen
for HCV-4 is composed of IFN-α2b plus ribavi-
rin for of 48 weeks. As TLRs play a role in type
I IFN production, this implies they having anti-
viral potencies against HCV.
The genetic make-up of the host plays an im-
portant role in susceptibility and response to in-
fections (14,54). In the present work, we studied the
frequencies of TLR-3 (c.1377C/T [rs3775290]),
TLR-3 (_7 C/A [rs3775296]) and TLR-9 (1237T/
C [rs5743836]) SNPs in chronic HCV- positive
Egyptian patients in order to clarify the role of
TLR-3and TLR-9 polymorphism in HCV infec-
tion and response to therapy.
SUBJECTS AND METHODS
Two hundred participants were included
in the study; one hundred naïve chronic HCV-
positive patients and one hundred age and sex
matched normal healthy individuals as control
group. Informed consent was obtained from all
participants before enrollment, the study was
performed in accordance with the Helsinki Dec-
laration, and the protocols were approved by
Faculty of Medicine, Cairo University Ethics
Committee.
HCV infection was diagnosed by anti-HCV
antibodies testing and detection of HCV-RNA
(Applied biosystems). All patients had no coin-
fection with hepatitis B virus and no other causes
of chronic liver disease.
Pretreatment Liver biopsy, Clinical and Lab-
oratory evaluation
Liver biopsy specimens were obtained from
all patients included in the study within 3 months
prior to start of treatment regimen. Histopatho-
logic features of fibrosis and activity were scored
according to the Metavir scoring system(8). Fi-
brosis was staged on a scale of 0–4.
Abdominal ultrasound, echocardiography,
fundus examination and body mass index (BMI)
calculation were done for all patients before start
of therapy and on regular basis every month dur-
ing treatment. Body mass index (BMI) was cal-
culated as weight divided by the square of the
height (kg/m2).
Hematological tests and blood chemistry
were analyzed before therapy and at least once
every month during treatment, laboratory inves-
tigations included complete blood count, blood
glucose level, liver function tests (ALT, AST,
Alkaline phosphatase, total bilirubin, Albumin),
prothrombin time and concentration, alfa-feto-
protein, creatinine, blood glucose and quantita-
tive HCV-RNA by PCR.
Treatment regimen and Evaluation of Treat-
ment outcomes
Although, first and second generations of
protease and polymerase inhibitors are used for
treatment of HCV in West Europe and USA, they
are not readily available in developing countries.
Pegylated interferon (PEG-IFN) combined with
daily oral ribavirin were the only drugs used for
treatment of HCV in Egypt until recently.
In the current study, all patients received
complete course of IFN-α2b (1.5 µg/kg/week)
plus ribavirin (1000-1200 mg/day) therapy for
duration of 48 weeks.
Quantitative HCV-RNA by real-time PCR
was done for all patients after complete course
of treatment for 48 weeks and six month later
to detect sustained virological response (SVR).
SVR was defined as undetectable HCV RNA
in serum 24 weeks after cessation of therapy.
Patients with reappearance of HCV RNA after
complete course of treatment or serum HCV
RNA positivity during therapy were considered
as non-responders (NR)(37).
Polymorphism analysis of TLR-3 c.1377C/T
(rs3775290), TLR-3 _7 C/A (rs3775296) and
TLR-9 1237T/C (rs5743836)
Genomic DNA extraction was done from pe-
ripheral blood samples using Gene JET Whole
Blood Genomic DNA purification Mini kit (Ther-
mo Scientific) according to the manufacturer’s
instructions. Isolated DNA was stored at -20°C
until used for PCR amplification. Polymorphism
analysis was performed by polymerase chain re-
action-restriction fragment length polymorphism
(PCR-RFLP) technique. All PCR reactions were
performed in a total volume of 25 μl contain-
TLRs-SNP and HCV : Response to Therapy 3
ing 150-ng genomic DNA, 2X Taq Green PCR
Master Mix, 25 pM of each forward and reverse
primers (Biosearch technologies). PCR amplifi-
cation was carried out in the DNA thermal cycler
(PTC programmable thermal controller, MJ Re-
search, Watertown, MA). Amplification condi-
tions were initial denaturation at 95°C for 5 min
followed by 35 cycles of; 95°C for 45 s, * for 45
s, and 72°C for 30 s, with final extension for 7
min at 72°C (* 55°C for TLR-3 c.1377C/T and
TLR-9 1237T/C and 59°C for TLR-3 _7 C/A).
The amplified PCR products were visualized by
2% agarose gel electrophoresis under UV light.
Primers sequences used and amplified product
size are shown in table 1.
Digestion of the amplified product by specific
restriction enzyme for each polymorphism was
done as follows; 10 µl of the amplified product
were mixed with 1 µl restriction enzyme (Ther-
mo Scientific) and the mixture was incubated
10 minutes (at 37ºC for MboII and BstNI and at
65ºC for TaqI). The product was analyzed by gel
electrophoresis using 4% agarose gel (Promega).
The separated fragments were stained with ethid-
ium bromide and visualized along with 50 bp
ladder (MBI Fermentas, Vilnius, Lithuania) as
a size marker using transilluminator (Bio-Rad,
USA). Restriction enzyme used and the resulting
bp length are shown in table 1.
Statistical analysis:
Data were analyzed using SPSS (Statistical
Package for Social Science) program for statisti-
cal analysis, (version 20; Inc., Chicago. IL). Chi-
square or fisher exact (when expected counted
in 25% of the cell or more is 5) were used to
compare qualitative variable. Logistic regression
analysis was used to calculate odds ratios (OR)
and 95% confidence intervals (CI) for risk esti-
mation. P value less than 0.05 was considered
significant.
RESULTS
Baseline demographic, clinical and labora-
tory data of the studied patients are shown in
table 2.
The frequency of the studied genetic poly-
morphisms in HCV patients and controls is
presented in table 3. There was no statistically
significant difference noticed in the distribution
of TLR-3 _7 C/A, TLR-3 c.1377C/T and TLR-9
1237T/C genotypes between HCV patients and
controls. Also, combined genotypes analysis of
the studied genetic polymorphisms showed that
co-inheritance of the genetic polymorphism in
the three studied genes didn’t confer increased
risk to HCV infection.
HCV Patients were stratified according to
hepatic fibrosis stage, group with mild fibrosis
(F1) and another group with advanced fibrosis
(F2, F3). Different parameters that may relate to
fibrosis progression were studied. Patients with
advanced hepatic fibrosis have significantly ele-
vated AFP serum levels; 5.82 ± 6.07 ng/ml in ad-
vanced fibrosis versus 3.29 ± 2.39 ng/ml in mild
fibrosis (p = 0.000). Otherwise, there were no sta-
tistically significant differences noticed between
the two patients’ groups regarding age, gender,
baseline laboratory data (data not shown). No
symptomatic significance was found as regards
Table (1): Summary of PCR-PFLP assay
Polymorphism Primer Sequence (5' –3′)Length
(bp)
Restriction
enzyme
Fragments
size (bp)
Refer
ence
TLR-3 c.1377C/T
(rs3775290)
CCAGGCATAAAAAGCAATATG
GGACCAAGGCAAAGGAGTTC 337 TaqI
CC: 274, 63
CT: 337, 274, 63
TT: 337
(13)
TLR-3
_7 C/A (rs3775296)
GCATTTGAAAGCCATCTGCT
AAGTTGGCGGCTGGTAATCT 279 MboII
AA: 257, 17
AC: 279, 257, 17
CC: 279
(13)
TLR-9 1237T/C
(rs5743836)
ATGGGAGCAGAGACATAATGGA
CTGCTTGCAGTTGACTGTGT 135 BstNI
TT: 108, 27
TC:108, 60, 48, 27
CC: 60, 48, 27
(35)
Zayed, R. A. et al.4
the distribution of TLR-3 _7 C/A, TLR-9 1237T/
C across the two patients’ groups, but as regards
TLR-3 c.1377C/T, the T- allele was found to be
associated was advanced stage of fibrosis (p=
0.003), (Table 4).
After complete course of combined interferon
and ribavirin therapy for 48 weeks, 86% of the
patients tested negative for HCV-RNA by real
time PCR while 14% were positive. Ninety three
patients were followed up six months later, 72/
93 (77.4%) achieved SVR where 21/93 (22.6%)
tested positive for HCV-RNA.
TLR-3 c.1377 T/T genotype was associated
with failure to achieve end of treatment response
as well as SVR (p= 0.004 and 0.008 respective-
ly). No association was found between TLR-3
_7 C/A and TLR-9 1237T/C different genotypes
and response to treatment or SVR, (Tables 5, 6).
Age, gender, baseline laboratory data and de-
gree of fibrosis were studied among responders
and patients’ group who failed to achieve SVR,
no statistically significant difference was found
between the two groups (data not shown).
Table 3: The Distribution of TLR-3 _7 C/A, TLR-3 c.1377C/T and TLR-9 1237T/C genotypes in HCV Pa-
tients and ControlsControls
GenotypePatients (100) Control (100)
P value OR (95% CI)Count % Count %
TLR3_ 7C/A
AA 2 2.0% 3 3.0% 1.000 0.748 (.122-4.599)
AC 24 24.0% 14 14.0% 0.076 1.923 (.927-3.989)
CC 74 74.0% 83 83.0% REF
AA+AC 26 26.0% 17 17.0% 0.121 1.715 (.863-3.410)
Allele A 28 14% 20 10% 0.218 1.468 (.796-2.698)
Allele C 172 86% 180 90% REF
TLR3-1377 C/T
TT 6 6.0% 6 6.0% 0.763 0.833 (.254-2.731)
CT 28 28.0% 39 39.0% 0.094 0.598 (.327-1.094)
CC 66 66.0% 55 55.0% REF
TT+CT 34 34.0% 45 45.0% 0.112 0.630 (.356-1.115)
Allele T 40 20% 51 25.5% 0.190 0.730 (.456-1.169)
Allele C 160 80% 149 74.5% REF
TLR-9 1237T/C
CC 3 3.0% 3 6.0% 0.396 0.474 (0.019-2.464)
TC 19 19.0% 10 20.0% 0.813 0.901 (0.381-2.130)
TT 78 78.0% 37 74.0% REF
CC+TC 22 22.0% 13 26.0% 0.683 0.803 (0.365-1.768)
Allele C 25 12.5% 16 16% 0.405 0.750 (.380-1.479)
Allele T 175 87.5% 84 84% REF
OR: Odds ratio, CI: Confidence Interval, p-value <0.05 is considered significant
Table 2: Baseline Clinical and Laboratory Data
of the Patients (n=100)
Age 41.1 ± 9.8 y
BMI 26.72± 3.5
Sex Male Female
65 (65%)35 (35%)
ALT (U/L) 53.74±39.5
AST (U/L) 47.37±32.2
T. Bil (mg/dl) 0.81±0.46
Alkaline phosphatase (u/l) 103.4±62.7
Albumin (gm/dl) 4.2±0.48
Creatinine (mg/dl) 0.99±0.17
Glucose (mg/dl) 97.7±21.0
WBC (109 /L) 6.5±1.8
Hb (gm/dl) 13.6±1.5
Platelets (109 /L) 225±59.5
PC (%) 92.2±9.7
AFP (ng/ml) 4.1±4.2
HCV viral Load (IU/ml x 105) 45.8±32.5
Stage of Fibrosis Stage 1 Stage 2 Stage 3
65 (65%)15(15%)20 (20%)
Data are presented as mean±SD and number (%) BMI, body mass index; ALT, alanine aminotransferase; AST, aspartate transaminase; T. Bil, total bilirubin; WBC, white blood count; Hb, Hemoglobin; PC, prothrombin concentration; AFP, alpha fetoprotein; HCV, hepatitis C virus
TLRs-SNP and HCV : Response to Therapy 5
Table 4: Association of gene polymorphism and degree of liver fibrosis
Genotype
Degree of liver fibrosis
P valueMild fibrosis F1 (n=65)Advanced fibrosis F2, F3
(n=35)
Count % Count %
TLR3_ 7C/A
AA 0 .0% 2 5.7%
0.174AC 17 26.2% 7 20.0%
CC 48 73.8% 26 74.3%
AA+AC 17 26.2% 9 25.7% 0.962
Allele A 17 13% 11 16%0.608
Allele C 113 87% 59 84%
TLR3-1377 C/T
TT 4 6.2% 2 5.7%
< 0.001CT 10 15.4% 18 51.4%
CC 51 78.5% 15 42.9%
TT+CT 14 21.5% 20 57.1% < 0.001
Allele T 18 14% 22 31.4%0.003
Allele C 112 86 % 48 68.6%
TLR-9 1237T/C
CC 1 1.5% 2 5.7%
0.183TC 10 15.4% 9 25.7%
TT 54 83.1% 24 68.6%
CC+TC 11 16.9% 11 31.4% 0.095
Allele C 12 9 % 13 18.6%0.057
Allele T 118 91 % 57 81.4%
Table 5: Association of gene polymorphism and response to treatmentTable 5: Association of Gene Polymorphism and Response to Treatment
Genotype
HCV-RNA at Week 48
(End of treatment)P value OR (95% CI)
Negative (n=86) Positive (n=14)
Count % Count %
TLR3 7C/A
AA 1 1.2% 1 7.1% 0.293 0.175 (0.010-3.003)
AC 22 25.6% 2 14.3% 0.511 1.921 (0.394-9.352)
CC 63 73.3% 11 78.6% REF
AA+AC 23 26.7% 3 21.4% 1.000 1.339 (0.343-5.231)
Allele A 24 14% 4 14.3% 1.000 0.973 (0.310-3.051)
Allele C 148 86% 24 85.7% REF
TLR3-1377 C/T
TT 2 2.3% 4 28.6% 0.004 0.059 (0.009-0.385)
CT 25 29.1% 3 21.4% 1.000 0.989 (.236-4.136)
CC 59 68.6% 7 50.0% REF
TT+CT 27 31.4% 7 50.0% 0.225 0.458 (.146-1.434)
Allele T 29 17% 11 39.3% 0.006 0.313 (0.133-0.738)
Allele C 143 83% 17 60.7% REF
TLR-9 1237T/C
CC 2 2.3% 1 7.1% 0.386 0.328 (.027-3.936)
TC 17 19.8% 2 14.3% 1.000 1.396 (.282-6.898)
TT 67 77.9% 11 78.6% REF
CC+TC 19 22.1% 3 21.4% 1.000 1.040 (.263-4.110)
Allele C 21 12.2% 4 14.3% 0.759 0.834 (0.263-2.643)
Allele T 151 87.8% 24 85.7% REF
Zayed, R. A. et al.6
Genotype
HCV-RNA at Week 72 (SVR)
P value OR (95% CI)Negative
(n=72)
Positive
(n=21)
Count % Count %
TLR3_ 7C/A
AA 1 1.4% 1 4.8% 0.402 0.278 (0.016-4.078)
AC 17 23.6% 5 23.8% 1.000 0.944 (0.299-2.981)
CC 54 75.0% 15 71.4% REF
AA+AC 18 25.0% 6 28.6% 0.742 0.833 (0.281-2.470)
Allele A 19 13.2% 7 16.7% 0.568 0.760 (0.296-0.1954)
Allele C 125 86.8% 35 83.3% REF
TLR3-1377 C/T
TT 1 1.4% 4 19.0% 0.008 0.054 (.005-.530)
CT 20 27.8% 6 28.6% 0.563 0.719 (.234-2.206)
CC 51 70.8% 11 52.4% REF
TT+CT 21 29.2% 10 47.6% 0.114 0.453 (.167-1.226)
Allele T 22 15.3% 14 33.3% 0.009 0.361 (0.164-0.791)
Allele C 122 84.7% 28 66.7% REF
TLR-9 1237T/C
CC 1 1.4% 1 4.8% 0.400 0.276 (.016-4.658)
TC 13 18.1% 4 19.0% 1.000 0.897 (.257-3.129)
TT 58 80.6% 16 76.2% REF
CC+TC 14 19.4% 5 23.8% 0.759 0.772 (.242-2.468)
Allele C 15 10.4% 6 14.3% 0.579 0.698 (0.253-1.928)
Allele T 129 89.5% 36 85.7% REF
OR: Odds ratio, CI: Confidence Interval, p-value <0.05 is considered significant
Table 6: Association of gene polymorphism and sustained virological response (SVR)
Figure (1): Characterization of the TLR3 _7 C/A polymorphism using MboII restriction enzyme. Ethidium
bromide stained 4% agarose gel.
Cases 1,4,7 show Homozygous CC (wild genotype): 1band 279 was detected.
Cases 2, 3, 5 show Heterozygous AC genotype: 3 bands 279, 257, 17 were detected.
Case 6 shows Homozygous AA genotype: 2 bands 257, 17 was detected.
M: PCR marker (50-100-150-200-250-300-350-400 bp-etc)
N.B. The 17 bp band cannot be visualized in the horizontal gel electrophoresis.
TLRs-SNP and HCV : Response to Therapy 7
Figure (2): Characterization of the TLR3 c.1377C/T polymorphism using Taq I restriction enzyme. Ethid-
ium bromide stained 4% agarose gel.
Cases 1,2,4,6,8 show Homozygous CC (wild genotype): 2 band 274 and 63 bp were detected..
Cases 3,7 show Heterozygous CT genotype: 3 bands 337, 274 and 63 were detected.
Case 5 shows Homozygous TT genotype: 1 band 337 was detected.
M: PCR marker (50-100-150-200-250-300-350-400 bp-etc).
Figure (3): Characterization of the TLR-9 (-1237 T/C) Polymorphism using BstNI restriction enzyme.
Ethidium bromide stained 4% agarose gel.
Cases 1,2,3, 5 show Homozygous TT (wild genotype): 2 bands 108 and 27 bp were detected.
Case 6 shows Homozygous CC genotype: 3 bands 60, 48 and 27 bp were detected.
Cases 4,7,8 show Heterozygous TC genotype: 4 bands 108, 60, 48 and 27 bp were detected.
M: PCR marker (50-100-150-200-250-300-350-400 bp-etc).
N.B. The 27 bp band cannot be visualized in the horizontal gel electrophoresis.
Zayed, R. A. et al.8
DISCUSSION
Knowing that, genetic variations in the
TLR-signaling pathway contributed in either
susceptibility or resistance to several infectious
diseases(50,55), we studied the impact of TLR-
3 (c.1377C/T [rs3775290]), TLR-3 (_7 C/A
[rs3775296]) and TLR-9 (1237T/C [rs5743836])
SNPs on HCV infection.
The TLR-9 gene is located on chromosome
3p21.3 and spans approximately 5 kb, TLR-9
gene has a major coding region exon in one of
its two exons(36). TLR-9 has been demonstrat-
ed to bind only to DNA virus, so the binding of
HCV which is single-stranded RNA (ssRNA) to
TLR-9 is assumed unlikely(4). However, studies
demonstrated that TLR-9 mRNA and protein are
down-regulated in peripheral blood mononu clear
cells of HCV-infected patients compared to nor-
mal controls, and are negative ly correlated with
serum viral copies(62). In addition, TLR-9 stimu-
lation showed antiviral effects in HCV-infected
individu als(12), and was found to participate in
the early immune response against HCV infec-
tion of the central ner vous system(23). On the oth-
er hand, some other studies showed that TLR-9
level was present at higher levels in HCV pa-
tients compared to healthy controls(61). Although
data are controversial, it points that TLR-9 plays
a role during HCV infection. In our study, the
presence of TLR-9 1237T/C SNP is not associ-
ated with susceptibility to HCV infection or re-
sponse to antiviral therapy. Similarly, Wei et al(58)
showed no signifi cant association in regards to
TLR9 (rs187084) genotype and allele frequency
between chronic HCV patients and subjects who
sponta neously cleared the virus.
In human, TLR-3-promoter region is
responsible for maintenance of promoter
integrality and promoter specific virus re-
sponsive element(51). In our study, the TLR-3
(_7 C/A) SNP within the promoter region is
not associated with HCV infection, and our
results are comparable to results in other
ethnicities(7,13,40). On the other hand, TLR-3
(c.1377 T/T) SNP was associated with fail-
ure of end of treatment response (p= 0.006)
and failure to achieve SVR (p= 0.006). This
can be attributed to unsuccessful host defense
against viral infections which relies on ear-
ly production of type I IFN and subsequent
activation of a cellular cytotoxic response.
TLR3, TLR7, or TLR8 recognize PAMP
thus allow virus linkages with dendritic cell
and subsequent activation and stimulation of
dendritic cells, TLRs-SNPs result in disrup-
tion of PAMP recognition mechanism(27,49).
In a recent study by Firdaus et al(18) TLR-3
expression was found upregulated in pa-
tients who successfully cleared HCV infec-
tion, further supporting the antiviral role of
TLR-3 in HCV infection.
Previous studies stated the association be-
tween TLR-9 and hepatic failure, where, TLR-
9 signals caused hepatic failure by promoting
TNF-α production(15). However, in our study no
symptomatic significance was found as regards
the distribution of TLR-9 1237T/C, TLR-3 _7
C/A in patients with mild hepatic fibrosis or ad-
vanced fibrosis. However, interestingly enough,
TLR-3 c.1377 (T) - allele was found to be associ-
ated with advanced stage of fibrosis (p= 0.003),
because significant hepatic fibrosis is closely re-
lated to failure of response to PEG- INF/ ribavirin
therapy as well(44,46) and this matches with our re-
sults. Also, in the current study, patients with ad-
vanced hepatic fibrosis had significantly elevat-
ed AFP serum levels. This goes with the results
of Hu et al (24) who found that chronic hepatitis
C patients had elevated serum AFP that was in-
dependently associated with stage III/IV hepatic
fibrosis. Patients with elevated AFP serum levels
are less likely to respond to therapy(1,5,13,19). In our
cohort of patients, non-responders were found to
have elevated serum AFP levels however these
levels did not reach statistical significance.
We assumed that both TLR-3 and TLR-9 sig-
naling mechanisms work in synergy to establish
an antiviral state against HCV infection, so we
analyzed whether combined genetic variants in
TLRs act as a potential indicator for Egyptian
host susceptibility to HCV infection, but co-
inheritance of the genetic polymorphism in the
three studied genes didn’t confer increased risk
to HCV infection.
In conclusion, we aimed to demonstrate as-
sociations between TLR-3and TLR-9 SNPs and;
TLRs-SNP and HCV : Response to Therapy 9
susceptibility, therapy outcome and effect on
fibrosis progression in HCV- infected Egyptian
patients; as in the recent years, TLRs are gaining
increased importance due to their role in influenc-
ing host immunity. It has been suggested to use
TLRs as biomarkers for HCV pathogenesis(18).
Also, TLRs use as agonists in antiviral therapy
has been studied(33). In our study, TLR-3 (c.1377
(T) – allele was found to be associated with fail-
ure of response to therapy and advanced fibrosis
stage, however, as regards TLR-9 1237T/C, TLR-
3 _7 C/A, no signifi cant association was found
and the results are comparable between the pa-
tients and control groups. Our study has certain
points of strength as well as certain limitations;
the most important issue is that most of Egyptian
patients are infected with HCV genotype-4 and
the predominant subtype is HCV-4a(47), thus the
obtained results were not fragmented due to in-
clusion of various HCV- genotypes as the patho-
genesis of infection and IFN responsiveness
vary according to genotype(16,39,59,60). On the other
hand, the study encompassed a limited number
of cases. Further studies with larger samples of
patients are required to further add to the validity
of our results, and also studies including other
members of TLR family identified in humans are
required.
REFERENCES:1. Abdoul H, Mallet V, Pol S et al; (2008): Serum alpha-
fetoprotein predicts treatment outcome in chronic hepa-
titis C patients regardless of HCV genotype. PLoS One
3(6): e2391.
2. Ahmad-Nejad P, Ha¨cker H, Rutz M et al; (2002): Bac-
terial CpG-DNA and lipopolysaccharidesactivate Toll-
like receptors at distinct cellular compartments. Eur J
Immunol 32:1958.
3. Akira S, Takeda K (2004): Toll-like receptor signaling.
Nat Rev Immunol 4:499.
4. Akira S, Uematsu S, Takeuchi O (2006): Pathogen rec-
ognition and innate immunity. Cell 124:783.
5. Akuta N, Suzuki F, Kawamura Y et al; (2007): Predic-
tors of viral kinetics to peginterferon plus ribavirin com-
bination therapy in Japanese patients infected with hep-
atitis C virus genotype 1b. J Med Virol 79(11):1686.
6. Alexopoulou L, Holt AC, Medzhitov R et al; (2001):
Recognition of double-stranded RNA and activation of
N F - K B by Toll-like receptor 3. Nature 413:732.
7. Askar E, Bregadze R, Mertens J et al; (2009): TLR3
gene polymorphisms and liver disease manifestations
in chronic hepatitis C. J Med Virol 81: 1204.
8. Bedossa P, Poynard T (1996): An algorithm for the
grading of activity in chronic hepatitis C. The META-
VIR Cooperative Study Group. Hepatology 24:289.
9. Bertoletti A, Gehring AJ (2006): The immune response
during hepatitis B virus infection. Journal of General
Virology 87(6):1439.
10. Biron C A (2001): Interferons _ and _ as immune regu-
lators—a new look. Immunity 14: 661.
11. Blanco P, Palucka A K, Gill M et al; (2001): Induction
of dendritic cell differentiation by IFN-_ in systemic
lupus erythematosus. Science 294:1540.
12. Broering R, Wu J, Meng Z et al; (2008): Toll-like recep-
tor-stimulated non-parenchymal liver cells can reg ulate
hepatitis C virus replication. J Hepatol 48:914.
13. Cheng PL, Eng HL, Chou MH et al; (2007): Ge-
netic polymorphisms of viral infection-associated
Toll-like receptors in Chinese population. Transl Res
150(5):311.
14. Clementi M, Di Gianantonio E (2006): Genetic suscep-
tibility to infectious diseases. Reprod Toxicol 21:345.
15. Dejager L, Libert C (2008): Tumor necrosis factor alpha
mediates the lethal hepatotoxic effects of poly(I:C) in
d-galactosamine-sensitized mice. Cytokine 42(1):55.
16. Dusheiko GM, Schmilovitz-Weiss H, Brown D et al;
(1994): Hepatitis C virus genotypes: an investigation of
type-specific differences in geographic origin and dis-
ease. Hepatology 19:13.
17. El-Zanaty F, Way A (2009): Egypt Demographic and
Health Survey 2008. Cairo, Egypt Ministry of Health,
El Zanaty and Associates, and Macro International.
(Online at: http://dhsprogram.com/pubs/pdf/FR220/
FR220.pdf).
18. Firdaus R, Biswas A, Saha K et al; (2014): Modula-
tion of TLR 3, 7 and 8 Expressions in HCV Genotype
3 Infected Individuals: Potential Correlations of Patho-
genesis and Spontaneous Clearance. BioMed Research
International 2014:Article ID 491064, 7 pages.
19. Gad HH, Dellgren C, Hamming OJ et al; (2009): Inter-
feron-lambda is functionally an interferon but structur-
ally related to the interleukin-10 family. J Biol Chem
284(31): 20869-75.
20. Heil F, Ahmad-Nejad P, Hemmi H et al; (2003): The
Toll-like receptor 7 (TLR7)-specific stimulus loxorib-
ine uncovers a strong relationship within the TLR7, 8
and 9 subfamily. Eur J Immunol 33:2987-2997.
21. Hemmi H, Kaisho T, Takeuchi O et al; (2002): Small
anti-viral compounds activate immune cells via the
TLR7 MyD88-dependent signaling pathway. Nat Im-
munol 3:196.
22. Hemmi H, Takeuchi O, Kawai T et al; (2000): A
Toll-like receptor recognizes bacterial DNA. Nature
408:740.
Zayed, R. A. et al.10
23. Hu K, Wang GW, Wang ZH (2011): TLR9 mRNA ex-
pression and tumor necrosis factor alpha/interleukin-6
secretion in murine microglia by hepatitis C virus stim-
ulation. Zhonghua Yi Xue Za Zhi 91:1070-4.
24. Hu KQ, Kyulo NL, Lim N et al; (2004): Clinical signif-
icance of elevated alpha-fetoprotein (AFP) in patients
with chronic hepatitis C, but not hepatocellular carci-
noma. Am J Gastroenterol 99(5):860.
25. Isaza-Correa J M, Liang Z, van den Berg A et al;
(2014): Toll-like receptors in the pathogenesis of hu-
man B cell malignancies. Journal of Hematology &
Oncology 7:57.
26. Kaisho T, Akira S (2001): Toll-like receptors and their
signaling mechanism in innate immunity. Acta Odontol
Scand 59:124.
27. Kaisho T, Akira S (2003): Regulation of dendritic cell
function through Toll-like receptors. Curr Mol Med
3:373.
28. Kolumam G A, Thomas S, Thompson L J et al; (2005):
Type I interferons act directly on CD8 T cells to allow
clonal expansion and memory formation in response to
viral infection. J. Exp. Med. 202:637.
29. Krishnegowda G, Hajjar AM, Zhu J et al; (2005): In-
duction of proinflammatory responses in macrophages
by the lycosylphosphatidylinositols of Plasmodium fal-
ciparum: cell signaling receptors, glycosylphosphati-
dylinositol (GPI) structural requirement, and regulation
of GPI activity. J Biol Chem 280:8606 .
30. Le Bon A, Etchart N, Rossmann C et al; (2003): Cross-
priming of CD8_ T cells stimulated by virus-induced
type I interferon. Nat. Immunol. 4,1009.
31. Le Bon A, Tough D F (2002): Links between innate and
adaptive immunity via type I interferon. Curr. Opin.
Immunol. 14:432.
32. Lee J, Chuang TH, Redecke V et al; (2003): Molecu-
lar basis for the immunostimulatory activity of guanine
nucleoside analogs: Activation of Toll-like receptor 7.
Proc Natl Acad Sci USA 100:6646.
33. Lee J, Wu C C, Lee K J et al; (2006): Activation of
anti-hepatitis C virus responses via Toll-like receptor 7.
Proc. Natl. Acad. Sci. USA 103:1828–1833.
34. Lindenmann J, Burke D C, Isaacs A (1957): Studies on
the production, mode of action and properties of inter-
feron. Br. J. Exp. Pathol 38:551.
35. Liu F, Lu W, Qian Q et al; (2012): Frequency of TLR
2, 4, and 9 gene polymorphisms in Chinese population
and their susceptibility to type 2 diabetes and coronary
artery disease. J Biomed Biotechnol 2012:373945.
36. Lu KC, Yang HY, Lin YF et al; (2011): The T-1237C
polymorphism of the Toll-like receptor-9 gene is asso-
ciated with chronic kidney disease in a Han Chinese
population. Tohoku J Exp Med 225(2):109.
37. Mangia A, Ricci GL, Persico M et al; (2005): A ran-
domized controlled trial of pegylated interferon al-
pha-2a (40 KD) or interferon alpha-2a plus ribavirin
and amantadine vs interferon alpha-2a and ribavirin in
treatment-naive patients with chronic hepatitis C. J Vi-
ral Hepat 12(3):292.
38. Marrack P, Kappler J, Mitchell T (1999): Type I interfer-
ons keep activated T cells alive. J. Exp. Med.189:521.
39. McHutchison JG, Gordon SC, Schiff ER et al; (1998):
Interferon alfa-2b alone or in combination with ribavi-
rin as initial treatment for chronic hepatitis C. N Engl J
Med 339:1485.
40. Medhi S, Deka M, Deka P et al; (2011): Promoter region
polymorphism & expression profile of toll like recep-
tor-3 (TLR-3) gene in chronic hepatitis C virus (HCV)
patients from India. Indian J Med Res134:200.
41. Mescher M F, Curtsinger J M, Agarwal , et al; (2006):
Signals required for programming effector and memory
development by CD8_ T cells. Immunol. Rev. 211:81.
42. Nagano Y, Kojima Y (1954): Immunizing property of
vaccinia virus inactivated by ultraviolets rays. C. R. Se-
ances Soc. Biol. Fil.148:1700.
43. O’Neill LA, Bowie AG (2007): The family of five:
TIR-domain-containing adaptors in Toll-like receptor
signalling. Nat Rev Immunol 7:353.
44. Parise ER, de Oliveira AC, Conceição RD et al; (2006):
Response to treatment with interferon-alpha and ribavi-
rin in patients with chronic Hepatitis C virus genotypes
2 and 3 depends on the degree of hepatic fibrosis. Braz
J Infect Dis 10(2):78.
45. Pestka S, Krause C D, Walter M R (2004): Interferons,
interferon like cytokines, and their receptors. Immunol.
Rev. 202:8–32.
46. Poynard T, Munteanu M, Colombo M et al; (2011):
FibroTest is an independent predictor of virologic re-
sponse in chronic hepatitis C patients retreated with
pegylated interferon alfa-2b and ribavirin in the EPIC³
program. J Hepatol 54(2):227-35.
47. Ray SC, Arthur RR, Carella A et al; (2000): Genetic
epidemiology of hepatitis C virus throughout Egypt. J.
Infect. Dis 182:698–707.
48. Santini S M, Di Pucchio T, Lapenta , et al; (2002): The
natural alliance between type I interferon anddendritic
cells and its role in linking innate and adaptive immu-
nity. J. Interferon Cytokine Res 22:1071–1080.
49. Sato A, Iwasaki A (2004): Induction of antiviral immu-
nity requires Toll-like receptor signaling in both stro-
mal and dendritic cell compartments. Proc Natl Acad
Sci USA 101:16274.
50. Schröder NW, Schumann RR (2005): Single nucleotide
polymorphisms of Toll-like receptors and susceptibility
to infectious disease. Lancet Infect Dis 5:156.
51. Tanabe M, Kurita-Taniguchi M, Takeuchi K et al;
(2003): Mechanism of up-regulation of human Toll-like
TLRs-SNP and HCV : Response to Therapy 11receptor receptor 3 Secondary to infection of measles
virus-attenuated strains. Biochem Biophys Res Com-
mun 311 : 39.
52. Trinchieri G (2003): Interleukin-12 and the regulation
of innate resistance and adaptive immunity. Nat. Rev.
Immunol.3:133.
53. Trinchieri G (2010): Type I interferon: friend or foe? J.
Exp. Med. 207:2053.
54. Tuite A, Gros P (2006): The impact of genomics on the
analysis of host resistance to infectious disease. Mi-
crobes Infect 8:1647.
55. Turvey SE, Hawn TR (2006): Towards subtlety: under-
standing the role of Toll-like receptor signaling in sus-
ceptibility to human infections. Clin Immunol 120:1.
56. Uematsu S, Akira S (2007): Toll-like Receptors and
Type I Interferons. The Journal of Biological Chemistry
282(21):15319.
57. Visvanathan K, Lewin SR (2006): Immunopathogen-
esis: role of innate and adaptive immune responses.
Semin Liver Dis 26:104.
58. Wei XS, Wei CD, Tong YQ et al; (2014): Single nucleo-
tide polymorphisms of toll-like receptor 7 and toll-like
receptor 9 in hepatitis C virus infection patients from
central China. Yonsei Med J. 55(2):428.
59. Yoshioka K, Kakumu S, Wakita T et al; (1992): Detec-
tion of hepatitis C virus by polymerase chain reaction
and response to interferon alpha therapy: relationship to
genotypes of hepatitis C virus. Hepatology 16:293
60. Zein NN, Rakela J, Krawitt E et al; (1996): Hepatitis
C virus genotypes in the United States: epidemiology,
pathogenicity, and response to interferon therapy. Ann
Intern Me; 125:634.
61. Zhao P, Ma L, Ji , et al; (2015): The Expression of
TLR-9, CD86, and CD95 Phenotypes in Circulating
B Cells of Patients with Chronic Viral Hepatitis B or
C before and after Antiviral Therapy. Mediators of in-
flammation 2015:Article ID 762709, 11 pages.
62. Zhou J, Huang Y, Tian D et al; (2009): Expression of
Toll-like Receptor 9 in Peripheral Blood Mononuclear
Cells from Patients with Different Hepatitis B and C
Viral Loads. J Huazhong Univ Sci TechnolزMed Sciز
29(3):313.
Zayed, R. A. et al.12
تأثير التعدد الشكلى لجين مستقبالت شبيه التول - 9و3 على االصابة بفيروس الكبد الوبائى-سى، االستجابة للعالج و درجة التليف الكبدى بين المرضى المصريين
رانيا زايد – داليا عمران – زينب زكريا - سميرة عزت – سلوى توفيق – حسام السويسى
االصابة بفيروس الكبد الوبائى-سى يعتبر وباء مستمر فى مصر. عرفت مستقبالت شبيه التول بالقيام بدور مهم فى تحفيز الجهاز المناعى لمقاومة االمراض المعدية. فى هذا البحث قمنا بدراسة تأثير التعدد الشكلى لجين مستقبالت شبيه التول - 9و3 على االصابة بفيروس الكبد الوبائى-سى، االستجابة للعالج و درجة التليف الكبدى بين المرضى المصريين. شمل البحث 100 مريض مصاب بفيروس الكبد الوبائى-سى و 100 شخص من األصحاء و المتطابقين في العمر والجنس كعينة ضابطة. تم دراسة التعدد الشكلى الجينى لكل .([TLR-3 (_7 C / A [rs3775296])، TLR-3 (c.1377C / T [rs3775290]) ، TLR-9 (1237T / C [rs5743836 :مناظهر البحث النتائج التالية: ال يوجد اختالف بين المرضى و العينة الضابطة من االصحاء فى نمط التعدد الشكلى لجين مستقبالت شبيه التول TLR-3 (_7 C/A), TLR-3 (c.1377C/T) and TLR-9 (1237T/C) وجود (TLR-3 c.1377 T ) كان مرتبطا بعدم
االستجابة للعالج وله تأثير على تقدم درجة التليف الكبدى فى المرضى المصريين المصابين بفيروس الكبد الوبائى-سى.
ROLE OF PLACENTAL PROTEIN 13 AS A BIOMARKER FOR EARLY
DETECTION OF PRE-ECLAMPSIA. METHYLENETETRAHYDRO
FOLATE REDUCTASE GENE POLYMORPHISM AND RELATION TO
DISEASE RISK, AN EGYPTIAN STUDYEngy El Khateeb* and Sherif Dahab**
ABSTRACT
Objective: to investigate the value of maternal serum Placental Protein 13 (PP13) measurement and uterine
artery indices (Resistance Index (RI) and Pulsatility Index (PI) ) Doppler during first trimester screening as
the prediction of early pre-eclampsia with genotyping for detection of Methylenetetrahydrofolate reductase gene
(MTHFR) polymorphisms (MTHFR677 C/T). Subjects and Methods: Fifty pregnant females were divided into two
groups, twenty five as a control group and twenty five as high risk group; they were subjected to uterine artery
Doppler, measurement of maternal serum (pp-13) and detection of (MTHFR) gene polymorphisms in first trimes-
ter at 11 to 14 weeks of gestation, all pregnancies were followed until 40 weeks for development of pre-eclampsia.
Results: In the cases that developed pre-eclampsia- in both groups- in comparison with un-affected pregnancies it
was noticed that they had low serum level of (PP-13), detection of (MTHFR) gene polymorphisms and higher (PI
and RI) which were of statistically significant difference. Conclusion: Lower level of maternal serum PP-13 in first
trimester, high prevalence of (MTHFR) gene polymorphisms and abnormal increase in uterine artery indices (PI
and RI) are associated with developing pre-eclampsia several months later in pregnancy so they can be used for
early prediction of pre-eclampsia in first trimester.
Departments of Clinical & Chemical Pathology* and Gynecology & Obstetrics**, Faculty of Medicine,
Cairo University
Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 13 - 20
INTRODUCTION
Preeclampsia (PE) is a pregnancy-specific
disease defined by new-onset hypertension and
proteinuria after 20 weeks of gestation. It is
present in around 5–10% of all pregnant women
worldwide(5) and is associated with an increased
risk of maternal and fetal morbidity and mortali-
ty, and recently it has been associated with an in-
creased risk of later-life death due to cardiovas-
cular disease for both mother and child(2, 10,12).
Several factors have been suggested to be
involved in the etiology of PE, but there is con-
sensus that the first step in the pathogenesis of
this disease is a defective trophoblastic invasion
early in pregnancy(18), which leads to reduced
placental perfusion and hypoxia(13).
Placental protein 13 (PP-13, galectin-13)
was first isolated in 1983(3,25). It is a homodimer
which is linked by disulfide bonds and has spe-
cial hemostatic and immunobiological functions
at the feto-maternal interface or a developmental
role in the placenta(24)
Placental protein 13 (PP-13) is a member of
the galectin family, predominantly expressed
by the placenta, specifically by the syncytiotro-
phoblast in which it is localized on the brush
border membrane at the maternal fetal interface,
recently maternal serum (PP13) concentrations
were found to be significantly reduced during the
first trimester among women who subsequently
developed pre-eclampsia(24).
Intracellular folate hemostasis depends on
the 5,10-methylenetetrahydrofolate reductase
(MTHFR) gene, which is located at position 36
on the short arm of chromosome 1(27).This gene
codes for the enzyme MTHFR, which catalyses
the irreversible conversion of 5,10-MTHFR to
5-metyltetrahydrofolate, a substrate for methyla-
tion of homocysteine to methionine. 5,10-MTH-
FR C677T is located in the catalytic N-termi-
nal domain of the enzyme, while 5,10-MTHFR
A1298C is located in the regulatory domain of
the enzyme(7).
Biochemically, the 5,10-MTHFR C677T
polymorphism is associated with thermolabil-
ity and reduced enzyme activity. The meta-
bolic consequences are folate deficiency and
mild hyperhomocysteinemia, a risk factor for
thrombotic vascular diseases. It has been sug-
El Khateeb, E. & Dahab, S.14
gested that oxidative stress, platelet aggregation,
and endothelial cell dysfunction contribute to
the vasculotoxicity of homocysteine, and 5,10-
MTHFR polymorphisms have been widely in-
vestigated in relation to a spectrum of several
disease outcomes. Specifically, several studies
have identified maternal 5,10-MTHFR C677T
polymorphisms as obstetric genetic risk factors
for spina bifida, placenta-related vasculopathies,
spontaneous fetal loss, preterm delivery (PTD),
low birth weight (LBW), small for gestational
age (SGA), neuro developmental delays, and
other congenital anomalies (21,15)
Doppler ultrasonography is a non-invasive
method for studying the uteroplacental circula-
tion, provides the capability to qualitatively eval-
uate blood flow in small branches of the uterine
arteries, in normal pregnancy, impedance to flow
in the uterine arteries decreases with gestation,
however in cases of impairment of trophoblas-
tic invasion, doppler studies showed increased
impedance to flow in the uterine arteries as they
failed to develop into low resistance vessels (20,4).
The aim of this work was to assess uterine
artery Doppler and maternal serum placental
protein 13(PP-13) indices as early predictors for
pregnancy induced hypertension of occurrence
of pre-eclampsia and detection of MTHFR gene
polymorphisms in those patients.
SUBJECTS AND METHODS.
This prospective observational case-control
study was performed in Obstetrics and Gynecol-
ogy Department Kasr El Aini Maternity Hospi-
tal (Cairo University). It was conducted on 50
pregnant females who were recruited from the
Antenatal Care Clinic in Kasr El Aini Maternity
Hospital.
Fifty pregnant females were divided into two
groups, twenty five as a control group and twen-
ty five as high risk group; they were subjected
to uterine artery Doppler, measurement of ma-
ternal serum (PP-13) and detection of (MTHFR)
gene polymorphisms in first trimester at 11 to
14 weeks of gestation, all pregnancies were fol-
lowed until 40 weeks for development of pre-
eclampsia.
PP13 ELISA Assay:
- Blood samples were collected with all
aseptic precautions from all study subjects, Sam-
ples were centrifuged and serum was separated
and stored at -20 degrees Celsius until analysis.
- The blood samples were cooled and
centrifuged immediately after collection
and the erythrocytes removed. Serum PP-13
level was determined by enzyme linked im-
mune sorbent assay (ELISA) kit (Cusabio,
USA).
- Detection of (MTHFR677 C/T) polymor-
phisms by PCR-RFLP:
- Three ml of blood were withdrawn from
all the subjects included in the study in a sterile
ethelenediaminetetraacetic acid (EDTA) vacu-
tainer. DNA was extracted from the whole blood
using DNA extraction kit. (QIAamp Blood Kit
(Cat. No. 51106; Qiagen Inc., Valencia, CA) ac-
cording to the manufacturer’s instructions.
- The method described by Frosst et
al.1995, was used for detection of the 677 C→
T polymorphism. A length of 198 base pairs on
exon 4 of the MTHFR gene was amplified us-
ing (5’ TGA AGG AGA AGG TGT CTG CGG
GA 3’) as the forward primer and (5’ AGG ACG
GTG CGG TGA GAG TG 3’) as the reverse
primer.
- The C to T polymorphism at codon 677
introduces a restriction site for enzyme Hinf 1.
The PCR was carried out in a total volume of
25 µL containing about 200 ng/ml DNA, 2 µl
of 2.5 mM of each of the dNTP’s, 0.5 µl of 25
mM MgCl 2 , 10 pmol of both primers and 0.5 U
Taq polymerase. PCR cycling conditions were:
an initial denaturation step at 94°C for 5 min-
utes, and 30 cycles of the following: 94°C for
1 minute, 57°C for 1 minute, and 72°C for 15
seconds. This was followed by a 10 minute ex-
tension at 72°C. Restriction digestion with Hinf
1 (Fermentas, INC, USA) was carried out on 2 µl
buffer, 1 µl Hinf 1, and 8 µl of PCR amplicons
incubated at 37°C for 4 to 6 hours. The digested
fragments were separated on 2.5% agarose gel
electrophoresis stained with ethidium bromide.
The electrophoretic pattern was visualized un-
PP-13 MTHFR Gene Polymorphism and Pre-eclampsia 15
der UV light then photographed using a Pola-
roid camera with a red orange filter. Wild type
(677CC) showed a single band at 198 bp. The
presence of the ‘T’ allele introduces a cut among
heterozygous (677 CT) and three bands of 198
bp, 175 bp and 23 bp were seen. The homozy-
gous (677 TT) had two bands of 175 bp and 23
bp. The size of the amplified product was read
with the use of a DNA ladder of different mo-
lecular weights (fermentas, No Limits™ 100 bp
DNA Fragment, catalogue number SM1441).
Ultrasonography assessment:
- The ultrasound equipment used for
both vaginal sonography and colour Doppler
technique was Elegra (Siemen) ,trans-vaginal
6.5 MHZ ultrasound with pulsed and colour
Doppler . the high pass filter was set at 50-
100 HZ and the pulse repetition frequency
ranged between 1000-2000 HZ.
- Each woman underwent a trans-vag-
inal ultrasonography examination including
colour Doppler techniques to assess the fol-
lowing data:
- Gestational age was determined from
the onset of the normal period , measurement
of the crown –rump length(CRL) was done
to confirm the fetal gestational age , fetal viabil-
ity and careful search for any fetal abnormalities
beside to the resistance index (RI) and pulsative
index (PI) in the uterine arteries both side
right and left .
- All the scans were performed by the
same ultrasound machine by senior staff that
has extensive experience in early first trimester
scans.
- Uterine arteries were seen as aliasing
vessels at the level of the cervical-corporeal
junction with the colour Doppler technique ,and
blood velocity waveform were obtained by
placing the Doppler gate over the coloured
areas and activating the pulsed Doppler func-
tion .angel correction was then applied and
the signal updated until at least four consec-
utive flow velocity wave form of good quality
were obtained then the RI and PI of the right
and left arteries was calculated to determine
the vascular resistance. The presence or absence
of an early diastolic notch in the flow profile
of uterine arteries was noted and determined
if unilateral or bilateral was recorded. All cases
were followed until termination of pregnancy to
detect the development of hypertensive disor-
ders of pregnancy by serial clinical examination,
blood pressure measurement and, urinary pro-
teins.
Statistical Analysis
- Data were statistically described in term
of range, mean and standard deviation. Numerical
data were analysed by using unpaired student`s
T test. Non parametric data were analysed using
(Mann Whitney test) (for independent samples).
P value less than 0.05 was considered statisti-
cally significant, Receiver Operator Character-
istic (ROC) analysis was used to determine the
optimum cut-off value for the studied diagnostic
markers.
RESULTS
The current study was carried out on 50 preg-
nant females divided into two groups, twenty
five as a control group and twenty five as high
risk group.
The high risk group age ranged between 23 to
35 years with a mean value of 28.5±3.58. Control
group age ranged between 21 And 39 years with
a mean of 28.4±4.4. The gestational age of high
risk group ranged between 11-13.5 weeks with
a mean of 12.0+ 1.01. Control group gestational
age ranged between 10-14 weeks with a mean
of 11.9 ± 0.79. There were no statistically
significant differences between the 2 groups as
regards age (p value >0.05) or gestational age (p
value >0.05).
Two cases out of the 25 control cases devel-
oped pre eclampsia (PE) while 23 cases didn’t
develop PE.
Four cases out of the 25 high risk group cases
developed PE while 21 cases didn’t develop PE.
As regards the PP13 results of control sub-
jects, in the PE group the PP13 index was (27.5
±3.535) Pg/ml and in the non PE group it was
(231.13±67.1) Pg/ml, by comparing the two
groups P value was < 0.0001 which is of highly
significant difference .
El Khateeb, E. & Dahab, S.16
Table (1): Comparison between Control subjects and high risk subjects regarding Doppler ultrasonography results
Control
Subjects
High Risk
Subjects
PE
( n= 2 )
Range
(mean+SD)
NO –PE
( n=23 )
Range
(mean+SD)
P-value
PE
(n=4 )
Range
(mean+SD)
NO – PE
( n=21 )
Range
(mean+SD)
P-value
Right
mean uterine artery
RI
0.79-0.81
(0.8±0.01)
0.6-0.79
(0.72±0.04)0.0109
0.77-0.79
(0.78± 0.01)
0.62-0.79
(0.72± 0.05)0.0276
Left mean
uterine artery RI
0.85 -0.9
(0.87± 0.03)
0.6-0.88
(0.72± 0.08)0.0163
0.8-0.83
(0.81± 0.01)
0.56-0.81
(0.72±0.07)0.0190
Right mean
uterine artery PI
2.32-2.34
(2.33±0.01)
0.96-2.2
(1.44± 0.3)0.0004
2.2-2.4
(2.3± 0.05)
1.02-1.9
(1.59± 0.34)0.0004
Left mean uterine
artery PI
2.32-2.34
(2.33±0.01)
0.96-1.6
(1.37± 0.17)0.0001 1.62-2.01 (1.83±0.16)
1.2-2.1
(1.52±0.29)0.0514
P value < 0.05 is considered significant
PE: Pre-eclampsia
RI: Resistance Index
PI: Pulsatility Index
Table (2): Genotype and allele frequencies in high risk and control groups for MTHFR 677C→T and
MTHFR 1298 A→C polymorphisms
Genotypes, alleles High risk group
(n=25)
Control group
(n=25)
OR(95%CI) P value
MTHFR677
-CC
-CT
-TT
-C allele
-T allele
15(60%)
5(20%)
5(20%)
35(46.6%)
15(20%)
21(84%)
3(12%)
1(4%)
91(60%)
5(6.6%)
0.154(0.034-0.546)
2.4(1.00-13.5)
6.3(1.15-8.76)
0.002[S]
0.032[S]
0.028[S]
0.024[S]
→0.0001[HS]
PP-13 MTHFR Gene Polymorphism and Pre-eclampsia 17
As regards the PP13 results of high risk group
cases, In the PE group the PP13 index was (25.2
± 4.20) pg./ml in comparison with non-PE group
PP13 level which was (140.4 ± 57.09) pg./ml
with p value < 0.0035 which was of significant
difference .
The results of Doppler assessment regarding
high risk group and control cases were summa-
rized in the tables from table 1.
The P values of comparing the right and
left uterine arteries PI & RI indices in high risk
group and control group were <0.05 with highly
significant differences.
The results of genotype and allele frequen-
cies in high risk and control groups for MTHFR
677C→T and MTHFR 1298 A→C polymor-
phisms are summarized in table 2.
The results showed significant difference be-
tween high risk and control groups in CC, CT
and, TT alleles of MTHFR gene (p values 0.002,
0.032 and 0.028 respectively).
The results showed also significant difference
and highly significant difference between high
risk and control groups in frequencies of C allele
and T allele in MTHFR gene (p values 0.024 and
0.0001 respectively).
DISCUSSION
Pre-eclampsia is a disorder of pregnancy
characterized by high blood pressure and large
amounts of protein in the urine. Though present
in the majority of cases, protein in the urine
need not be present to make the diagnosis of
preeclampsia(16,6).
There are a host of contributing and related
factors that complicate finding a precise mecha-
nism for preeclampsia(22). These include immu-
nologic, hematologic, genetic, and environmen-
tal factors. Central to the effects of preeclampsia
are the resulting presence of uteroplacental hy-
poxia, an imbalance in angiogenic and anti-an-
giogenic proteins, oxidative stress, maternal
endothelial dysfunction, and elevated systemic
inflammation(22,1).
We are concerned in our study with serum
level of PP13 and uterine arteries Doppler evalu-
ation as first trimester marker for predicting
the occurrence of preeclampsia and screening
of genotype and allele frequencies in patients
and control groups for MTHFR 677C→T and
MTHFR 1298 A→C polymorphisms.
In our study we had two groups: control
group (n=25) and high risk group (n=25) in
control group two patients (n=2) developed pre-
eclampsia (8%) and other patients didn’t develop
it; serum PP13 level showed highly statistically
significant difference p<0.0001.
In high risk group comparing serum PP13
level in patients who developed preeclampsia
(n=4), (16%) and patients who didn’t develop it
(n=21) there was highly statistically significant
difference between both of them p<0.003. So it
was observed that serum level of PP13 was low
in patients developed preeclampsia comparing
with other patients who didn’t develop it in both
groups (control group and high risk group)
A prospective observational study was done
by maternal blood testing at 6-10 gestational
weeks demonstrated significantly decreased se-
rum level PP13 in women who developed pre-
eclampsia several months. Later, with sensitivity
80% and P<0.001 and it is possible that if com-
bined with other variables such as BP, maternal
history, and uterine artery Doppler flow velocity
may have prediction in low risk population(19).
Another study showed that PP13 declined
with maternal weight and was lower in in vitro
fertilization. Levels were converted into mul-
tiples of the median (MoMs) accordingly. In
twins, the median was 1.74 MoM (n=76) vs.
1.00 in singletons (n=676, P<0.0001). Among
twins with severe PE (n=10), the median was
1.53 MoM vs. 1.74 in unaffected twins (P=0.10),
and 2.26 (n=6) for mild PE (P=0.30). Among
singletons with severe PE, the median was 0.44
MoM (n=26, P<0.0001), and for mild PE 0.62
(n=17, P<0.001)(23).
In our study, Doppler of uterine arteries were
chosen as they were the most common arter-
ies used to evaluate utero-placental circulation
in pregnancy through analysis of uterine artery
flow velocity wave form for prediction of pre-
eclampsia.
In control group it showed that right and left
El Khateeb, E. & Dahab, S.18
uterine arteries RI were higher in women who
developed pre-eclampsia than those with normal
outcome ( P = 0.0109 and 0.0163 respectively)
which is statistically significant.
As for high risk group also right and left uter-
ine arteries RI were high in women developed
pre-eclampsia in comparison with women who
did not develop it ( P= 0.027 and 0.0190 respec-
tively) which were found to be highly statisti-
cally significant.
In control group there was highly statistically
significant difference between pre-eclampsia
group (who developed pre-eclampsia) and nor-
mal group (who did not develop it) regarding to
right and left uterine arteries PI ( P=0.0004 and
0.0001 respectively).
Examination of 3058 patient, using T.V.S
uterine artery Doppler at 11-14 weeks with
singleton pregnancies was done, this study has
found that presence of pre-eclampsia because
of high prevalence of this finding in normal
pregnancies(45%) with low specificity (55%),
sensitivity (55%)(11) and this finding is consistent
with pervious study which concluded that early
diastolic notch was unlikely to be useful screen-
ing for pregnancy complications(8,9)
In our study early diastolic notch was not re-
corded except in two patient in high risk group
which was statistically insignificant as P value
was <0.05, with specificity 35% and sensitivity
22%, we have no clear explanation for this find-
ing but may be our sample size was limited in
comparing with other studies numbers (11)
More recent studies showed comparable re-
sults, they had larger studies including 1091,
384, 1123 singleton pregnancies for routine pre-
natal ultrasound examination at 11-14 weeks of
gestation, as regarding the prognostic value of
unilateral / bilateral uterine artery notching in
predicting of pre-eclampsia(14).
In our study we revealed that significant asso-
ciations were detected between MTHFR C677T
polymorphism and risk of PE in patients vs. con-
trols for CC (OR = 0.154, 95% CI:0.034-0.546),
CT (OR = 2.4, 95% CI: (1.00-13.5)), and TT ge-
netic model (OR = 6.3, 95% CI: 1.15-8.76).
A recent study revealed that significant asso-
ciations were detected between MTHFR C677T
polymorphism and risk of PE in the overall
population for TT vs. CC (OR = 1.280, 95% CI:
1.074-1.525), recessive model (OR = 1.264, 95%
CI: 1.067-1.303), and dominant genetic model
(OR = 1.174, 95% CI: 1.057-1.303); in Cauca-
sian population for dominant model (OR = 1.136,
95% CI: 1.022-1.263), and in East Asia popula-
tion for TT vs. CC (OR = 2.199, 95% CI: 1.366-
3.924) CT vs. CC (OR = 1.453, 95% CI: 1.001-
2.109), recessive model (OR = 1.742, 95% CI:
1.202-2.525), and dominant model (OR = 1.783,
95% CI: 1.271-2.501). Conversely, no asso-
ciations were detected in Latin America, South
Asia, and Africa populations(26).
Xia et al., 2013 discussed a number of stud-
ies that investigated the association between
the methylenetetrahydrofolate reductase (MTHFR)
C677T polymorphism and the risk of pre-eclamp-
sia (PE) in various populations and have deliv-
ered inconsistent results. Therefore, this meta-
analysis of 36 case-control studies, comprising
4253 PE cases and 4950 controls, were assessed
to evaluate a possible association. The pooled
results showed that the MTHFR C677T poly-
morphism was significantly associated with PE
(P=0.03, odds ratio (OR)=1.25, 95% confidence
interval (CI)=1.02-1.54, for the additive compar-
ison; P=0.04, OR=1.14, 95% CI=1.01-1.29, for
the dominant genetic model). The results of the
subgroup analysis showed that MTHFR 677T
had the effect of increasing the PE risk for the
recessive genetic model (P<0.0001, OR=1.76,
95% CI=1.33-2.33, P(heterogeneity)=0.28), the
additive comparison (P=0.002, OR=2.09, 95%
CI=1.31-3.31, P(heterogeneity)=0.08) and allele
contrasts (P=0.03, OR=1.42, 95% CI=1.04-1.95,
P(heterogeneity)=0.0001) in the Asians, while
no evidence of an association between MTHFR
C677T polymorphisms and PE was observed in
the Caucasians. This meta-analysis suggests that
the MTHFR C677T polymorphism is capable of
causing PE susceptibility in the Asians but not in
the Caucasians(28).
Another study revealed that the frequency
of combined genotypes of MTHFR CT and TT
(CT+TT) and T allele tended to be higher in se-
PP-13 MTHFR Gene Polymorphism and Pre-eclampsia 19
vere preeclamptic women compared to controls.
A significantly higher level of triglycerides was
observed in the presence of combined geno-
types of MTHFR CT and TT in pre eclamptic
women compared to controls with the same
genotype(17).
Finally in our study we confirmed the poten-
tial role of serum Placental Protein 13(PP-13) in
combination with uterine arteries Doppler indices
(PI and RI), as early predictors of pre-eclampsia
in first trimester of pregnancy and that there is an
association between the MTHFR C677T poly-
morphism and susceptibility to preeclampsia
REFERENCES 1.Al-Jameil (2013) : “A Brief Overview of Preeclampsia”.
Journal of Clinical Medicine Research.
2. Bellamy L., Casas J.-P., Hingorani A. D. et al 2007: “Pre-
eclampsia and risk of cardiovascular disease and cancer
in later life: systematic review and meta-analysis,” Brit-
ish Medical Journal,: 335, 7627,. 974.
3. Bohn H, Kraus W, Winckler W et al 1983: Purification
and characterization of two new soluble placental tissue
proteins (PP13 and PP17): Oncodev Biol Med ; 4:343.
4. Dugoff L, Hobbins JC, Malone FD, et al 2004: First-
trimester maternal serum PAPP-A and free-beta sub-
unit human chorionic gonadotropin concentrations
and nuchal translucency are associated with obstetric
complications: a population-based screening study (the
FASTER Trial). Am J Obstet Gynecol ; 191:1446.
5. Duley L., 2009 “The Global Impact of Pre-eclampsia and
Eclampsia,” Seminars in Perinatology: 33, 3, 130.
6. Eiland, Elosha et al. 2012; Nzerue, Chike; Faulkner, Mar-
quetta. “Preeclampsia ”. Journal of Pregnancy 2012: 1.
7. Friso S, Choi SW, Girelli D, et al. 2002: A common mu-
tation in the 5,10-methylenetetrahydrofolate reductase
gene affects genomic DNA methylation through an in-
teraction with folate status. Proc Natl Acad Sci USA.;
99: 5606.
8. Gomez O, Martinez JM, Figueras F, et al. 2005 Uterine
artery Doppler at 11–14 weeks of gestation to screen for
hypertensive disorders and associated complications in
an unselected population. Ultrasound Obstet Gynecol;
26:490.
9. Martin AM, Bindra R, Curcio P, et al. 2001 Screening for
pre-eclampsia and fetal growth restriction by uterine
artery Doppler at 11-14 weeks of gestation. Ultrasound
Obstet Gynecol ; 18:583.
10. McDonald, A. Malinowski S.D., Zhou,S. et al. 2008
“Cardiovascular sequelae of preeclampsia/eclampsia: a
systematic review and meta-analyses,” American Heart
Journal, :. 156. 5, 918.
11. Melchiorre K, Wormald B, Leslie K, et al. 2008 First-
trimester uterine artery Doppler indices in term and
preterm pre-eclampsia. Ultrasound Obstet Gynecol. ;
32:133.
12. Mongraw-Chaffin M. L., Cirillo P. M., and Cohn B. A.,
2010: “Preeclampsia and cardiovascular disease death:
prospective evidence from the child health and devel-
opment studies cohort,” Hypertension, 56, 1,. 166.
13. Pijnenborg R., Vercruysse L., and Brosens I., 2011
“Deep placentation,”Best Practice and Research : 25,
3, 273.
14. Pilalis A, Souka P, Antsaklis P, et al. 2007: Screening
for pre-eclampsia and fetal growth restriction by uter-
ine artery Doppler and PAPP-A at 11–14 weeks’ gesta-
tion. Ultrasound Obstet Gynecol ; 29:135.
15. Pilsner JR, Hu H, Wright RO, et al. 2010: Maternal
MTHFR genotype and haplotype predict deficits in ear-
ly cognitive development in a lead-exposed birth cohort
in Mexico City. Am J Clin Nutr.; 92:226.
16. Pregnancy, developed by the Task Force on Hyperten-
sion in (2013). Hypertension in pregnancy..
17. Rahimi Z, Malek-Khosravi S, Rahimi Z, et al. 2013
Clin Biochem. Jan;46(1-2):143.
18. Rauramo I. and Forss M., 1988 “Effect of exercise on
placental blood flow in pregnancies complicated by hy-
pertension, diabetes or intrahepatic cholestasis,” Acta
Obstetricia et Gynecologica Scandinavica, : 67, 1,. 15.
19. Romero R, Nien JK, Espinoza J, et al 2008: A longitu-
dinal study of angiogenic (placental growth factor) and
anti-angiogenic (soluble endoglin and soluble vascular
endothelial growth factor receptor-1) factors in normal
pregnancy and patients destined to develop preeclamp-
sia and deliver a small for gestational age neonate. J
Matern Fetal Neonatal Med , 21:9.
20. Schutte JM, Schuitemaker NW, van RJ, Steegers EA et
al. 2008: Substandard care in maternal mortality due to
hypertensive disease in pregnancy in the Netherlands
BJOG ; 115:732.
21. Sohda S, Arinami T, Hamada H, et al. 1997 Methylene-
tetrahydrofolate reductase polymorphism and pre-ec-
lampsia. J Med Genet.;34:525.
22. Steegers, Eric AP; von Dadelszen, et al. 2010 “Pre-ec-
lampsia”. The Lancet : 376 (9741): 631.
23. Svirsky R, Meiri H, Herzog A, et al. 2013 Perinat Med.
Sep 1;41(5):561.
24. Than NG, Pick E, Bellyei S, et al. 2004: Functional
analyses of placental protein 13/galectin-13: Eur J Bio-
chem 271:1065.
25. Visegrady B, Than NG, Kilar F, et al. 2001 : Homology
modelling and molecular dynamics studies of human
placental tissue protein 13 (galectin-13) at al (2001) :
Protein Eng ; 14:875.
El Khateeb, E. & Dahab, S.20
26. Wang XM, Wu HY, Qiu et al. 2013 Med Res.
Apr;44(3):159.
27. Weisberg I, Tran P, Christensen B, et al.1998 second
genetic polymorphism in methylenetetrahydrofolate re-
ductase (MTHFR) associated with decreased enzyme
activity. Mol Genet Metab. ;64:169.
28. Xia XP, Chang WW, Cao YX. 2012., Hypertens Res.
Dec;35(12):1129.
دور البروتين المشيمى 13 فى االكتشاف المبكر لتسمم الحمل وعالقة تعدد الشكل الجينى
للمثيلينهيدروفوالت ريدكتيز وعالقته بخطر حدوث المرض (دراسة مصرية)
انجى الخطيب – شريف دهب
الرحمي الشريان مؤشرات وقياس (PP13) األم دم في 13 المشيمي البروتين قيمة لفحص البحث يهدف للتنبؤ الحمل من شهور ثالث أول دوبلرخالل خالل من ((Pulsatility (PI ومؤشر (RI) المقاومة (مؤشر .(MTHFR) (MTHFR677 C / T) تتراهيدروفوالت للميثيلين الجيني التنميط مع الحمل تسمم قبل بما المبكر
قد و ؛ الخطر مجموعة وعشرين وخمسة مراقبة كمجموعة وعشرين خمسة مجموعتين، إلى الحوامل اإلناث تقسيم تم
الثالثة األشهر في (MTHFR) ل الجينية األشكال عن والكشف (13 (بروتين وقياس الرحمي، للشريان الدوبلر عمل تم الحمل. تسمم الكتشاف أسبوعا 40 حتى الحمل حاالت جميع متابعة وتم الحمل، من أسبوعا 14 إلى 11 بين األولىما تم التوصل الى انه في الحاالت التي اصيبت بeclampsia-pre في كل المجموعات بالمقارنة مع الحاالت التي لم تصاب لوحظ أن لديهم انخفاض مستوى (PP-13)، و األشكال الجينيه ل (MTHFR) وارتفاع (PI و RI) و التي كانت بفروق ذات داللة إحصائية.الخالصة: انخفاض مستوىPP-13 في األشهر الثالثة األولى، و ارتفاع معدل انتشاراألشكال الجينيه ل (MTHFR) وزيادة غير طبيعية في مؤشرات الشريان الرحمي (PI وRI) مع حدوث ما قبل تسمم الحمل بعد عدة أشهر في الحمل حتى أنها يمكن أن تستخدم للتنبؤ المبكر
للتسمم الحملي في الثلث األول من الحمل.
CORD BLOOD COPEPTIN AND CALPROTECTIN AS POTENTIAL BIOMARKERS OF EARLY-ONSET NEONATAL SEPSISManal Mohsen*, Wafaa K.Zaki**, Rania Ismail***, Nehal El-Raggal***
and Mohamed A. Abd El-Wahed***
ABSTRACTBackground: The correct diagnosis of neonatal sepsis is a relevant problem because sepsis is one of the most important
causes of neonatal morbidity, mortality, and prolonged hospital stay. Therefore, early diagnosis and treatment of neonates
with suspected infection is crucial to prevent life threatening complications. New infection markers may potentially improve
guidance of therapeutic decisions. Copeptin and Calprotectin are two markers which have been recently demonstrated to be
strongly elevated in samples from adult patients with sepsis. However a few reports are available in neonates and pediatric
patients. Objective: The aim of this study was to investigate the clinical utility of assaying cord blood copeptin and calprotectin
as markers of early-onset neonatal sepsis. Subjects and Methods: This case control study comprised 138 newborn infants with
gestational age of 28-40 weeks and birth weights between 1500 and 4100 grams, delivered between February 2014 and Janu-
ary 2015 at the Maternity Departments of Manshiet El-Bakry and Ain Shams University Hospitals, Cairo, Egypt, They were
transferred to the Neonatal Intensive Care Unit (NICU) of the hospital because of having at least one risk factor for suspicion of
neonatal sepsis. On the basis of clinical observation over their first 5 postnatal days and sepsis work-up results, into 2 groups:
Early onset neonatal sepsis (EOS) group (n=78) and non-septic control group (n=60). For all included population, two cord
blood samples were collected for blood culture , and assay for Copeptin and Calprotectin by competitive and sandwich enzyme
immunoassays (EIA), respectively. Results: Results of both inflammatory markers were significantly higher in septic neonates
than controls [median copeptin concentration in cord blood was 212 (IQR 95 – 537) vs. 82(60 – 125) pg/mL, and median
calprotectin concentration was 4.6(4.0-9.1) vs. 0.93(0.7-2.0) ng/mL for calprotectin, respectively; p<0.001 for both]. Levels
of copeptin and calprotectin did not associate with CRP results, only calprotectin levels associated with culture positivity,
however, both tests significantly correlated with Rodwell’s score indicating that they are good diagnostic tests for early-onset
septicemia. Moreover, copeptin and calprotectin levels were significantly associated with patients’ outcome. Receiver-operat-
ing-characteristic (ROC) curve analysis showed that copeptin cord blood concentrations were strongly associated with EOS:
sensitivity of 73.3%, a specificity of 100%, positive predictive value (PPV) of 100%, negative predictive value (NPV) of 87.5%
and efficacy 81%. ROC curve for calprotectin showed 100%, sensitivity and 97.5%, specificity. PPV is 98%, NPV is 100% and
efficacy is 98.9%. Conclusion: the current study reveals that copeptin and calprotectin may be considered two promising sensi-
tive and specific predictors for EOS. Keywords: neonatal sepsis, neonatal infection, EOS, copeptin, calprotectin.
Departments of Clinical Pathology*, Medical Microbiology and Immunology**, Pediatrics***
Faculty of Medicine , Ain Shams University
Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 21 - 30
INTRODUCTION
Sepsis is one of the most important causes
of neonatal morbidity, mortality, and pro-
longed hospital stay, particularly in preterm,
due to their immature immune response and
exposure to infectious risks in neonatal inten-
sive care units (NICUs) (11,5). In this issue, an
early diagnosis becomes crucial as signs of
sepsis in the newborn are nonspecific(15,19).
Blood culture remains the gold standard test
for diagnosis of neonatal sepsis. However, the
results of blood culture are not available before
24–48 h and there are possible false negative
responses in many instances. For this reason,
a broad spectrum of inflammatory markers has
been proposed for the diagnosis of neonatal sep-
sis (10).
Copeptin is a novel neuroendocrine peptide. It
is 39 amino acids glycopeptides co-synthesized
with arginine vasopressin (AVP) and released
together in stoichiometric pattern from the hypo-
thalamus upon stimulation of AVP release. Due
to difficulties of AVP assay, copeptin largely re-
placed it in clinical assay as surrogate biomarker
because copeptin has easier and more valid mea-
surement methods. In acute stress condition, co-
peptin rises and reflects stress level exactly like
AVP which was largely known as a mediator of
non-specific stress conditions(1).
Calprotectin is antimicrobial, calcium
and zinc binding heterocomplex protein. It
is contained in the cytosol fraction of innate
immunity cells and released immediately
after host-pathogen interaction. For this it
Mohsen, M. , et al.22
has been used as a nonspecific marker for
activation of granulocytes and mononuclear
phagocytes(27,20). In addition to protecting
cells against microorganisms, calprotectin
regulates adhesion of leukocytes to the en-
dothelium and extracellular matrix during
the inflammatory process(28). So calprotectin
has been proposed for the diagnosis of in-
flammatory conditions.
Aim of the Work
The aim of this study was to investigate
the clinical utility of assaying cord blood co-
peptin and calprotectin as markers of early-
onset neonatal sepsis.
SUBJECTS AND METHODS
I. Subjects:
The study series comprised 138 newborn in-
fants with gestational age of 28-40 weeks and
birth weights between 1500 and 4100 grams,
delivered between February 2014 and January
2015 at the Maternity Departments of Manshiet
El-Bakry and Ain Shams University Hospitals,
Cairo, Egypt, They were transferred to the Neo-
natal Intensive Care Unit (NICU) of the hospital
because of having at least one risk factor for sus-
picion of neonatal sepsis (prolonged premature
rupture of membranes > 24 hr, premature onset of
labour, chorioamnionitis or peripartum maternal
fever). EOS cases were defined as neonates who
presented with sepsis within the first 72 hours
of life as defined by the following criteria(25) : i)
at least two clinical signs of sepsis (temperature
instability, irritability or apathy, feeding diffi-
culties, poor capillary refill >2 seconds, apnea,
tachycardia and/or tachypnea); ii) elevated C-
reactive protein >20 mg/L, iii) decision of the
attending physician to treat for at least 7 days
with intravenous antibiotics and iv) recovery of
bacterial pathogens in blood-culture. In infants
with negative blood cultures but clinical diag-
nosis of EOS, all first three criteria mentioned
above were required to be present.
Exclusion criteria:
• Maternal diabetes or pre-eclampsia.
• Chromosomal abnormalities or major
congenital malformations.
• Inborn error of metabolism.
Cord blood samples were withdrawn imme-
diately at birth for determination of:
a. Complete blood counts (CBC) with dif-
ferential smear: usingABX Micros 60 cell coun-
ter (ABX DIAGNOSTICS, Rue du caducée,
ParcEuromédecine, Montpellier Cedex, France)
b. Semiquantitative measurement of serum
C-reactive protein (CRP) concentration, using
latex agglutination test using the AVITEX CRP
commercial kit (Omega Diagnostics Ltd, NOVA
Century Scientific, South Service Road, Burl-
ington, Ontario)
c. Blood culture for isolation of pathogenic
microorganisms.
d. Measurement of copeptin and calprotec-
tin concentrations by enzyme immunoassays us-
ing commercially available copeptin (Human)
EIA Kit (Phoenix Pharmaceuticals, Inc.Beach
Rd., Burlingame, California, USA) and Calpro-
tectin ELISA Kit (MRP 8/14) (Immundiagnostik
AG Stubenwald-Allee, Bensheim, Germany),
respectively.
The neonates were assigned retrospectively,
on the basis of clinical observation over their
first 5 postnatal days and sepsis work-up results,
into 2 groups:
1. Early Onset Neonatal Sepsis group (EOS) (n=78):
Cases diagnosed in the first 72 hours of life
according to the clinical score of Tollner, and
hematological score of Rodwell . They were
31 (39.8%) males and 47 (60.2%) females; 19
(24.4%) were delivered vaginally and 59 (75.6%)
by cesarian section. They had a mean gestational
age of 32.0 ±3.6 weeks, and a mean birth weight
of 2845±766 grams.
2. No infection, (non-septic) Control group (n=60):
Infection was ruled out on both clinical and
laboratory basis. They were 22 (36.7%) males and
38(63.3%) females; 16(26.7%) were delivered
vaginally and 44 (73.3%) by cesarian section.
They had a mean gestational age of 36.55±3.88
weeks, and a mean birth weight of 3217±569
grams. They served as a control group.
Cord Blood Copeptin and Calprotectin in Neonatal Sepsis 23
Procedure of blood sampling:
An informed written consent was taken from
the parents before enrollment of neonates in this
study. Cord blood samples were collected under
complete aseptic conditions immediately after
birth. The collected blood was divided among a
blood culture bottle, an EDTA tube for complete
blood counts, and a plain test tube for serum sepa-
ration. Blood withdrawn into the plain tubes were
allowed to clot for 30 minutes before centrifuga-
tion for 15 minutes at approximately 1000xg. Se-
rum was separated, for immediate assessment of
C-reactive protein and stored at -20oC for the assay
of copeptin and calprotectin. Hemolysed samples
were discarded, repeated freezing and thawing
was avoided.
Procedure of blood culture:
Using a signal blood culture system (oxoid),
the formulation of medium enhances the growth
of aerobic, anaerobic, micro-aerophilic and fungi.
Two sets of blood culture were drawn from each
patient under complete aseptic condition. The
medium were designed to create pressure in se-
lected bottle when organisms are growing caus-
ing displacement of blood /broth mixture into the
chamber as assign of microbial activity. Examina-
tion of blood culture bottle was done every other
day, any bacterial growth was identified by sub-
culture on solid blood agar, Mac-Conkey agar and
Sabouraud,s dextrose agar(SDA) . isolates were
identified on the basis of conventional identifica-
tion methods described in Colle et al (1996) based
on colonial morphology , microscopic examina-
tion of Gram stained films and biological activity
of isolated strain(9).
Principle of Copeptin and Calprotectin en-zyme immunoassays (EIA):
The assay of copeptin is based on a competi-
tive immunoassay technique. In this technique,
the immunoplate is pre-coated with secondary
antibody and the nonspecific binding sites are
blocked. The secondary antibody can bind to the
Fc fragment of the primary antibody (peptide an-
tibody) whose Fab fragment would be competi-
tively bound by both biotinylated peptide and
peptide standard or targeted peptide in samples.
The biotinylated peptide interacts with strepta-
vidin – horseradish peroxidase (SA-HRP) which
catalyzes the substrate solution. The intensity of
the yellow is directly proportional to the amount
of the biotinylated peptide-SA-HRP complex but
inversely proportional to the amount of the pep-
tide in the standard solutions or samples. This is
due to the competitive binding or samples to the
peptide antibody (primary antibody).
The assay of calprotectin utilizes the two-site
“sandwich” technique. Standards, controls and
prediluted (1:50) serum samples are added to the
wells of a microplate coated with a high affinity
monoclonal anti-human calprotectin antibody.
During the first incubation step, Calprotectin in
the samples is bound by the immobilized anti-
body. Then a peroxidase labeled conjugate is
added to each well and the following complex
is formed: capture antibody - human calprotectin
– Peroxidase conjugate. Tetramethyl¬benzidine
(TMB) is used as a peroxidase substrate. Fi-
nally, an acidic stop solution was added to
terminate the reaction. The color changes from
blue to yellow. The intensity of the yellow color
is directly proportional to the calprotectin con-
centration of sample.
Accordingly, standard curves of known
concentration were established from which un-
known concentration of both assayed markers
were determined.
Statistical Analysis:
IBM SPSS statistics (V. 23.0, IBM Corp.,
USA, 2015) was used for data analysis. Data
were expressed as mean and standard deviation
(Mean±SD) for quantitative parametric measures
in addition to Median and interquartile range
(IQR) for quantitative non-parametric measures
and both number and percentage for categorized
data. Comparative statistics was done by Wil-
coxon’s rank sum in case of non-parametric data.
Correlation analysis was performed by Spear-
man’s rank correlation (rs). P values<0.05 were
considered significant, whereas values<0.01
were considered highly significant. Receiver op-
erating characteristic curve (ROC) analysis was
applied to assess the overall diagnostic perfor-
mance of each test.
Mohsen, M. , et al.24
RESULTS
Demographic and clinical characteristics
of the studied groups show no significant dif-
ference between sepsis and control group in
terms of sex distribution and delivery modalities
(p>0.05). Septic neonates, however, were found
to have a significantly lower mean gestational
age (p<0.01) and mean birth weight (p<0.05) as
compared to the control group.
Compared to controls, septic newborns dem-
onstrated significantly lower 1&5 minutes Apgar
scores (p<0.001). In the same group, 93% had
hematological scores ≥3 over the study period.
Most of cases (92.3%) had positive CRP (>6mg/
L). Positive blood cultures for bacteria were
encountered in 30 (38%) cases. Positive blood
cultures demonstrated the presence of Klebsiella
pneumoniae (14%), Coagulase negative Staph.
(8%) Acinetobacter (6%) and E.coli (5%) (Fig-
ure 1).
When we searched for risk factors for ear-
ly-onset neonatal sepsis (EOS) in septic cases,
results showed 34(43.6%) cases were due to
prolonged premature rupture of membranes
(PROM)> 24 hr, 25(32%) due to preterm labor,
16(20.6%) due to chorioamnionitis and 3(3.8%)
due to peripartum maternal fever.
Table 1 shows a highly statistical significant
increase in the level of copeptin and calprotec-
tinin septic than control group.
Table 2 demonstrates comparison between
the levels of copeptin and calprotectin in septic
group according in relation to CRP, blood cul-
ture results and patients’ outcome. Fifty seven
(73.1%) cases improved while 21(26.9%) died.
Gestational age (using Ballard score), birth
weight and mode of delivery did not correlate
with copeptin (rs= 0.195, 0.261 and 0.045, re-
spectively) and calprotectin levels (rs= 0.256,
0.313 and 0.60, respectively); for all p>0.05.
Levels of assayed cord blood copeptin(pg/
mL) and calprotectin(ng/mL) correlated to some
hematological tests in the septic newborns (Ta-
ble 3). However, both markers’ levels showed
significant correlation with Rodwell,s Sepsis
score [median score=5 (3.25-5.3), with co-
peptin: rs=0.471; p=0.021 and with calprotectin
rs=0.704; p=0].
Diagnostic performance test results for deter-
mination of the best cut-off value of copeptin and
calprotectin for prediction of early-onset neona-
tal sepsis are shown in table 4 and figure 2.
Figure 1: Blood culture results of sepsis group.
Table 1: Comparison of cord blood copeptin and calprotectin levels between sepsis and control groups
Variable
Sepsis group
n=78
median (IQR)
Control group
n=60
median (IQR)
Z p significance
Copeptin (pg/mL) 212 (95 – 537) 82 (60 – 125) -3.451 0.001 HS
Calprotectin (ng/mL) 4.6 (4.0-9.1) 0.93 (0.7-2.0) -8.028 0.0 HS
Cord Blood Copeptin and Calprotectin in Neonatal Sepsis 25
Table 2: Comparison between levels of copeptin and calprotectin in septic group according to CRP, blood culture results and
patients’ outcome
CRP Blood culture Patients’ outcome
Negative
n=5
Positive
n=72
Negative
n=48
Positive
n=30
Improved
n=57
Died
n=21
Copeptin
(pg/mL)
Median
(IQR)236(184-462) 294(237-520) 223(97-469) 293(105-510) 228(94-286) 410(328-516)
Z 0.683 1.244 2.952
P 0.337 0.244 0.018
significance NS NS S
Calprotectin
(ng/mL)
Median
(IQR)7.6(4-13.4) 9.4(3.8-15) 5.1(3.4-6.1) 8.0(4.2-15) 4.5(3.2-5.9) 11(7.9-14.3)
Z 0.371 3.409 2.371
P 0.707 0.026 0.046
significance NS S S
Table 3: Correlation of cord blood Copeptin(pg/mL) and Calprotectin(ng/mL) to other laboratory param-
eters in the septic newborns:
Copeptin Calprotectin
Parameter Median (IQR) rs p value Significance rs p value Significance
TLC (x10³/mm³) 13.1(4.6-26.8) 0.437 0.016 S 0.374 0.044 S
Platelet count
(x10³/mm³)99 (54-166) -0.424 0.020 S -0.195 0.819 NS
Granulocytes
(x10³/mm³)6.8 (1.9-17.4) 0.319 0.002 S 0.261 0.051 NS
I/T ratio 0.3 (0.2-0.4) 0.654 <0.001 HS 0.352 0.019S
TLC= total leucocytic count, I/T ratio= ratio of immature to mature granulocytes.
Table 4: Diagnostic performance test results of copeptin and calprotectin for prediction of early-onset neo-
natal sepsis:
Cord blood Copeptin
(pg/mL)
Cord blood
Calprotectin (ng/mL)
Best cut-off value 85 2.25
Sensitivity (%) 73.3 100
Specificity (%) 100 97.5
Positive predictive value (%) 100 98
Negative predictive value (%) 87.5 100
Efficacy (%) 81 98.9
Mohsen, M. , et al.26
DISCUSSION
Prompt diagnosis of sepsis is crucial to es-
tablishing treatment and modifying neonatal
prognosis. Laboratory sepsis markers represent
a helpful tool in the evaluation of a neonate with
a potential infection. Neonatal septicaemia is as-
sociated with hyper-inflammatory host responses
that subtend activation of immune system includ-
ing innate immunity which is fully developed in
the first weeks of life(19,21).
Copeptin concentrations were strongly
elevated in samples from adult patients with
sepsis and high copeptin levels were pre-
dictive of mortality(26,17,23) .Many studies in
adults have shown that copeptin is a valu-
able biomarker of infection in patients with
community-acquired and ventilator-associ-
ated pneumonia(18).
Calprotectin, a major product of innate im-
munity cells, is an antimicrobial that protects
cells against invasive microorganisms and regu-
lates adhesion of leukocytes to the endothelium
and extracellular matrix during the inflammatory
process (27). It has been proposed for the diagnosis
of many inflammatory conditions; however, its
use in the diagnosis of neonatal sepsis remains a
matter of research.
Therefore, we aimed in this study to inves-
tigate the clinical utility of assaying cord blood
copeptin and calprotectin as markers of early-on-
set neonatal sepsis. We performed a case control
study that comprised 138 newborn infants with
gestational age of 28-40 weeks and birth weights
between 1500 and 4100 grams who were trans-
ferred to the NICU because of having a risk fac-
tor of neonatal sepsis. On the basis of clinical
observation over their first 5 postnatal days and
sepsis work-up results, into 2 groups: Early on-
set neonatal sepsis group (EOS) (n=78) and non-
septic control group (n=60).
Our findings revealed no significant differ-
ence between sepsis and control group in terms of
sex distribution and delivery modalities. Chaco
and Sohi (2005) found that the rates of infection
were similar in males and females(6). In Werner
et al., 2012, there was no significant difference
in sepsis between cesarean and vaginal delivery
groups(29). In the current study, Septic neonates,
however, were found to have a significantly low-
er mean gestational age and mean birth weight
AUC
Calprotectin 0.992
Cord Copeptin 0.795
Figure 2: ROC curve analysis showing the diagnostic performance of Cord Copeptin and Calcprotectin
for discriminating patients with sepsis from those without
Cord Blood Copeptin and Calprotectin in Neonatal Sepsis 27
as compared to the controls. This goes in agree-
ment with the study of Abdelmaaboud et al., and
Hornik et al., who observed that very low birth
weight (VLBW) infants are at high risk for both
early- and late-onset neonatal sepsis(2,13)
Compared to controls, septic newborns dem-
onstrated significantly lower 1&5 minutes Apgar
scores. Unfortunately, low Apgar score usually
necessitates more prolonged and aggressive re-
suscitation which is a known risk factor for sep-
sis (12).
Concerning risk factors for EOS in septic
cases, prolonged PROM> 24 hr was found in
34 cases (43.6%) , preterm labour in 25(32%),
chorioamnionitis in 16(20.6%) and peripartum
maternal fever in 3(3.8%).
For all infants included in this work, cord
blood copeptin and calprotectin were assayed
by competitive and sandwich enzyme immuno-
assays (EIA), respectively. Results of both in-
flammatory markers were significantly higher in
septic neonates than controls [212 (95 – 537) vs.
82(60 – 125) pg/mL for copeptin; and 4.6(4.0-
9.1) vs. 0.93(0.7-2.0) ng/mLfor calprotectin,
respectively; p<0.001 for both]. Our results are
in accordance with previous demonstrations as
those of Benzing et al., Morgenthaler et al.and
Abdelmaaboud et al.(3,17,2).
Gestational age (Using Ballard score), birth
weight and mode of delivery did not correlate
with copeptin (rs= 0.195, 0.261 and 0.045, re-
spectively) and calprotectin levels (rs= 0.256,
0.313 and 0.60, respectively); for all p>0.05.
Our data are in contrast with reports from
Schlapbach et al who stated that infants after
vaginal delivery compared to cesarean delivery
had significantly higher copeptin levels, even
when adjusting for gestational age indicating that
the vasopressin system in the neonate is strongly
activated upon perinatal stress(24). However, our
explanation is that most of septic babies, in our
study, were born by cesarian section 59 (75.6%)
as their mothers had had risk factors which ne-
cessitated cesarean section.
In the study by Abdelmaaboud and co-work-
ers, they found significant negative correlations
between calprotectin and both of gestational
ages and weights(2). They attributed their results
to the fact that sepsis is more severe in neonates
with younger ages and lower weights resulting
in higher levels of these inflammatory markers.
However, their reports depended on cases with
late onset sepsis (more than 3 and less than 30
days) rather than ours of EOS.
Most of our patients; 72 (92.3%) had positive
CRP (>6mg/L). Comparison of copeptin and cal-
protectin in neonates with positive and negative
CRP was non-significant. Our findings are in
accordance with those of Schlapbach et al. and
Decembrino et al.(24,10). In fact, the utility of CRP
for the diagnosis of neonatal infection has been
the subject of controversy because of its unsat-
isfactory sensitivity. The CRP concentration in-
creases physiologically in newborns within the
first days after birth. This dynamic behavior may
in part account for the low diagnostic accuracy
of CRP measurements in neonatal infection, par-
ticularly when measured shortly after birth(7,10).
Positive blood cultures for bacteria were en-
countered in 30 (38%) cases. A recent study by
Decembrino et al., showed positive culture in
8/41 neonates (19.51%) with sepsis (10). This is
explained by that the sensitivity of blood culture
for diagnosis of bloodstream infection is still de-
pendent upon the volume of blood used to inocu-
late the culture medium. (4,8). Moreover, low level
of bacteremia is possible in the NICU where in-
fants are often exposed to multiple courses of
empirical antibiotics, including in utero antibiot-
ics.
Forteen percent of positive blood culture
cases were due to Klebsiella pneumoniae (14%),
coagulase negative staph (8%) Acinetobacter
(6%) and E.coli (5%). Our findings are consis-
tent with those of Stoll et al., 2005 and Klinger
et al., 2009, who found that EOS was caused
mainly by gram negative bacteria; while Abdel-
maaboud reported that nosocomial sepsis caused
by coagulase negative staphylococcal (CoNS)
infections continues to be an important cause of
morbidity in NICUs(25,14).
When serum copeptin and calprotectin were
assayed in septic neonates with positive and neg-
ative blood culture results, higher levels of both
markers were obtained in septic neonates with
Mohsen, M. , et al.28
positive blood culture. These high levels were
significant in calprotectin, however, they did not
reach a significant level in copeptin. Our results
were in accordance with those previously ob-
tained by Abdelmaaboud et al. and Decembrino
et al.(2,10).
Of the 78 septic patients, 57(73.1%) in-
fants improved, while 21(26.9%) died. These
results significantly associated with copeptin
and calprotectin initial cord blood values; de-
noting that both are early predictor markers of
survival in neonatal septicemia. Morgenthaler
and colleagues, in their study, had also elevated
copeptin concentrations are elevated in hemor-
rhagic and septic shock and that copeptin was
higher on admission in non-survivors as com-
pared with survivors, suggesting copeptin as a
prognostic marker in sepsis(17). Moreover, re-
ports of Abdelmaaboud and colleagues showed
that patients with positive blood cultures, and/or
those who died within one week after diagnosis
of sepsis had significantly higher levels of cal-
protectin than cases that were negative for blood
cultures or those who survived beyond the first
week after diagnosis of sepsis(2). These findings
may reflect the reliability of serum calprotectin
level as a marker of the severity and outcome of
cases with sepsis.
Correlation analysis of cord blood copeptin
and calprotectin to hematological tests was per-
formed. Copeptin significantly correlated with
total leucocytic count (TLC), granulocytes,
platelet count and I/T ratio, while calprotectin
showed significant correlation with TLC and
I/T ratio. Thrombocytopenia is one of the most
common complications of neonatal sepsis and is
considered one of the hematological parameters
of severity of neonatal sepsis(22,16,2). The signifi-
cant negative correlation of copeptin with plate-
let counts indicate that it may be used as param-
eters of the severity of sepsis.
Rodwell score is a hematologic scoring sys-
tem that uses parameters of complete blood count
to diagnose sepsis; in which score above 3 raises
the possibility of sepsis. Both markers signifi-
cantly correlated with Rodwell’s score indicat-
ing that they are good diagnostic tests for EOS.
Such assumptions are strengthened by studying
the diagnostic performance of the two tests for
prediction of EOS.
Receiver-operating-characteristic (ROC)
curve analysis showed that copeptin cord blood
concentrations at a cut-off of 35pg/mL could dis-
criminate between neonates with and without
septicemia with a sensitivity of 73.3%, a speci-
ficity of 100%, positive predictive value (PPV)
of 100%, negative predictive value (NPV) of
87.5% and efficacy 81%
Regarding the discriminating ability of cal-
protectin between healthy neonates and those
having EOS, even though their blood culture is
negative, our ROC curve at a best cut-off value
of 2.25ng/mL had sensitivity of 100%, specific-
ity of 97.5%, PPV of 98%, NPV of 100% and
efficacy is 98.9%.
Conclusion:
As diagnosis and early treatment of EOS
is crucial to decrease neonatal morbidity and
mortality, our study reveals that copeptin and
calprotectin may be considered two promis-
ing sensitive and specific predictors for early
onset neonatal sepsis.
REFERENCES1. Abdalla, G; Elshafei, A; Abd EL-Motaal, O; et al.
(2014): Copeptin, A novel neuropeptide in acute myo-
cardial infarction. Arab. J. Lab. Med; 40(1): 729.
2. AbdelMaaboud, M. Elmazary, A. M,. Osman, A. M.
(2012): Serum calprotectin as a diagnostic marker of
late onset sepsis in full-term neonates.. Egypt J Pediatr
Allergy Immunol; 10(1):19
3. Benzing J, Wellmann S, Achini F, et al. (2011 ) : Plas-
ma Copeptin in Preterm Infants: A Highly Sensitive
Marker of Fetal and Neonatal Stress.. The Journal of
Clinical Endocrinology & Metabolism (JCEM); 96(6).
4. Bhatti M, Chu A, Hageman JR, et al. (2012): Future
Directions in the Evaluation and Management of Neo-
natal Sepsis. NeoReviews Vol.13 No.2
5. Bizzarro, M. J.; Raskind, C. R.; Baltimore, S. et al.
(2005 ) : Seventy-five years of neonatal sepsis at Yale:
1928–2003, Pediatrics; 116(3): 595.
6. Chacko, B and Sohi I (2005): early Onset Neonatal
Sepsis .Indian Journal of Pediatrics; 72(1):23.
7. Chiesa C.1, Natale F, Pascone R, et al. (2011): Refer-
ence intervals for preterm and term newborns during
the early neonatal period. Clin .Chim .Acta. May 12;
412(11-12).
8. Chu A, Hageman JR, Schreiber MD (2012): Antimicro-
Cord Blood Copeptin and Calprotectin in Neonatal Sepsis 29
bial Therapy and Late Onset Sepsis. Neo Reviews, 13
(2): e94.
9. Colle JG, Fraser AG, Marmion BP et al. (1996): Tests
for the identification of bacteria In: Machie and Mc
Carteny Practical Medical Microbiology, 14th edition;
p. 413-424, Churchill Livingstone.
10. Decembrino L; De Amici , M; Pozzi, M; et al. (2015):
Serum Calprotectin: A Potential Biomarker for Neo-
natal Sepsis. Journal of Immunology Research; 10(8):
e0136250-e0136254.
11. Gerdes, J. S (2004): Diagnosis and management of
bacterial infections in the neonate. Pediatric Clinics of
North America; 51(4): 939.
12. Gomella T.L, Cunningham M.D., Eyal F.G, et al. .
(2009): Neonatal sepsis. In: Lange Clinical Manual of
Neonatology, 6th ed., Lang Medical Books/McGraw-
Hill; 130: 865.
13. Hornik CP, Fort P, Clark RH, et al. (2012 ): Early
and late onset sepsis in very-low-birth-weight infants
from a large group of neonatal intensive care units.
101(11):1121.
14. Klinger G, Levy I, Sirota L, et al. (2009): Epidemiology
and risk factors for early onset sepsis among very-low-
birthweight infants. Am J Obstet Gynecol; 201(1):38.
e1.
15. Klouwenberg P. K and. Bont L. (2008): Neonatal and
infantile immune responses to encapsulated bacteria
and conjugate vaccines, Clinical and Developmental
Immunology; Article ID 628963: 10 pages,
16. Manucha V, Rusia U, Sikka M, et al. ( 2002): Utility of
haematological parameters and C reactive protein in the
detection of neonatal sepsis. J Paediatr Child Health;
38(5):459.
17. Morgenthaler NG, Muller B, Struck J, et al. (2007):
Copeptin, a stable peptide of the arginine vasopressin
precursor, is elevated in hemorrhagic and septic shock.
Shock, 28(2):219.
18. Muller B, Morgenthaler N, Stolz D, et al. (2007): Circu-
lating levels of copeptin, a novel biomarker, in lower re-
spiratory tract infections. Eur J Clin Invest, 37(2):145.
19. Ng, P. C (2004): Diagnostic markers of infection in neo-
nates, Archives of Disease in Childhood; 89(4): F229.
20. Nilsen T, Sunde K, and Larsson A (2015): A new turbi-
dimetric immunoassay for serum calprotectin for fully
automatized clinical analysers. Journal of Inflamma-
tion; 45(12)90.
21. Nupponen, I Turunen R., Nevalainen T.et al. (2002):
Extracellular release of bactericidal/permeability-in-
creasing protein in newborn infants, Pediatric Research,
vol. 51, no. 6, pp. 670.
22. Roberts I, and Murray NA. (2003): Neonatal throm-
bocytopenia causes and management. Arch Dis Child
Fetal Neonatal Ed.; 88(5):F359.
23. Russell JA(2009): Vasopressin and its co-pilot copeptin
in sepsis and septic shock. Crit. Care Med, 37(2):749.
24. Schlapbach L. J., Frey S, Bigler S, et al. (2011): Co-
peptin concentration in cord blood in infants with early-
onset sepsis, chorioamnionitis and perinatal asphyxia.
BMC Pediatrics, 11:38
25. Stoll BJ, Hansen N, Fanaroff AA, , et al. (2002): Chang-
es in pathogens causing early-onset sepsis in very-low-
birth-weight infants. N Engl J Med, 347(4):240.
26. Struck J, Morgenthaler NG, Bergmann A (2005): Co-
peptin, a stable peptide derived from the vasopressin
precursor, is elevated in serum of sepsis patients. Pep-
tides, 26(12):2500.
27. Terrin, G; Passariello, A; Comanguso,F;, et al (2011):
Serum calprotectin: An antimicrobial peptide as a new
marker for the diagnosis of sepsis in very low birth
weight newborns. Clin Devel Immun. 2011, Article Id
291085, 6 Gesdoi: 10. 1155 /2011 / 291085.
28. Vaos ,G; . Kostakis, I .D; Zavras, N. et al. (2013): The
Role of Calprotectin in Pediatric Disease. Bio Med Re-
search International; volume 2013 ID 542363: 8 pages.
29. Werner EF, Savitz DA, Janevic TM, et al. (2012):
Mode of delivery and neonatal outcomes in preterm,
small-for-gestational-age newborns. Obstet Gynecol;
120(3):560.
Mohsen, M. , et al.30
قياس معدل الكوبيبتن و الكالبروتيكتين الموجود في دم الحبل السرى كعوامل حيوية لتشخيص التسمم الدموى المبكر في االطفال حديثي الوالدة
منال محسن- وفاء خليل زكى - رانيا إسماعيل – نهال الرجال – محمد عبد الوهاب
يعتبر التسمم الدموى عند االطفال حديثى الوالدة من المشاكل االساسية التى تتسبب فى ارتفاع معدل المرض و الوفيات عند هؤالء االطفال الى حد كبير.ولذلك فان التشخيص المبكر وتوفير العالج المناسب أمر بالغ األهمية ويعتبر سببا فى إنقاذ حياة هؤالء االطفال . و علي الرغم من ان مزرعة الدم هو اختبار قياسي لتشخيص تسمم الدم في حديثي الوالدة فإن نتيجتها ال تكون متاحة قبل 48-24 ساعة وقد تكون سلبية في كثير من االحيان.,وحيث انه غالبا ما يصاحب التسمم الدموى عند حديثى الوالدةرد فعل التهابي مفرط مع المضيف والتي تقابل بتنشيط الجهاز المناعي. ولذلك تم اقتراح مجموعة واسعة من الدالالت االلتهابية لتشخيص تسمم الدم في حديثي الوالدة. وقد قمنا في دراستنا هذo بقياس اثنين من العوامل الحيوية والتى تم التعرف حديثا و هما الكوبيبتن والكالبروتيكتين بغرض معرفة القيمة التشخيصية لهما كعوامل حيوية لتشخيص حاالت التسمم الدموى المبكر عند االطفال حديثي الوالدة. تم تنفيذ هذo الدراسة في وحدة العناية المركزة لحديثي الوالدة حيث تم تقسيم األطفال إلى مجموعتين:المجموعة االولى :وتشمل يعانون من تسمم دموى مبكر وعددهم 78طفال والمجموعة الثانية:وتشمل اطفال اصحاء ظاهرياوعددهم 60 طفال. وقد أظهرت نتائج البحث وجود إرتفاع ذو داللة إحصائية
فى مستوى الكوبيبتن و الكالبروتيكتين فى مصل األطفال حديثى الوالدة المصابين بالتسمم الدموى المبكرمقارنة باألطفال األصحاء فى المجموعة الضابطة,كما أظهرت الدراسة إرتفاع معدل إكتشاف مستوى الكالبروتيكتين فى حاالت التسمم الدموى المصاحبة لعزل ميكروبات من مزارع الدم ولم يتم تسجيل ذلك مع مستوى الكوبيبتن والذى لم يسجل إرتفاع بشكل ملحوظ مع حاالت المزارع اإليجابية. كذلك أظهرت الدراسة وجود عالقة وطيدة بين إرتفاع مستوى الكوبيبتن و الكالبروتيكتين ومقياس رودويل عند حديثى الوالدة مما يدل على إمكانية إستخدامهما كداللة حيوية أولية لتشخيص التسمم الدموى المبكر لدى هؤالء االطفال.كما أظهرت مستويات الكوبيبتن و الكالبروتيكتين إرتفاع ذو داللة إحصائية مع حاالت التسمم الدموى الشديد الذى قد يؤدى إلى الوفاة. وبقياس الدالئل األحصائية لهذان العامالن الحيويين فأشارت النتائج إلى وجود حساسية وخصوصية عالية فى تشخيص حاالت التسمم الدموى المبكر عند االطفال حديثى الوالدة. ومما سبق نستنتج أن قياس مستوى الكوبيبتن و الكالبروتيكتين يعتبر معيارا حيويا جيدا وحساسا لتشخيص حاالت التسمم الدموى المبكر لدى األطفال حديثى الوالدة خاصة فى الحاالت التى يتعذر تشخيصها بواسطة نتائج مزارع الدم المستخدمة لعزل الميكروب
المسبب للمرض.
THE STUDY OF BCR-ABL TRANSCRIPT VARIANTS (B2A2 AND B3A2)
RELATION TO DIFFERENT RISK SCORES Hisham Abdelaziz*, Ahmed Omar** , Ali Alshemary**and Mohamed Keshk***
ABSTRACT
Background: The exact role of the different transcript variants of BCR-ABL in the pathogenesis of chronic myeloid leu-
kemia (CML) and their impact on prognosis is yet to be definitely enumerated. Aims: In this study, we have tried to correlate
the presenting features, risk scores and treatment response with the BCR-ABL variants detected in our patients. Settings and
Design: A cross-sectional unicentric hospital-based study on 80 patients in Dammam University Hospital, Saudi Arabia, diag-
nosed to have CML by bone marrow cytogenetics and confirmed by reverse transcriptase-polymerase chain reaction (RT-PCR).
Materials and Methods: RT-PCR for BCR-ABL was performed on consecutive patients with CML attending the CML clinic
from January 2010 to December 2010.The medical charts of these patients were analyzed after a follow-up of 18 months in
a retrospective manner. Statistical Analysis: Box plot and histogram were used to see the distribution of variables. t-test was
performed to enumerate the difference between risk scores in two populations of patients carrying two different BCR-ABL
transcript variants. Results: Nearly 56.25% of patients had b3a2 (e14a2) while 41.25% of patients showed b2a2 (e13a2) tran-
scripts. The rest 2.5% (two patients) expressed the rare e19b2 variant. Patients with b2a2 presented with higher Sokal, Hasford
and European Treatment and Outcomes Study score than their b3a2 counterpart. Different parameters such as the platelet
count, leukocyte count, hemoglobin and splenomegaly showed a minor difference between the groups. More patients in the
b2a2 group achieved complete hematologic response at 3 months, but it was not significant. Conclusions: Patients with b2a2
variant CML tend to present with higher risk score, but do not behave in a vastly different manner than their b3a2 counterparts.
Key words: BCR-ABL transcript variants, chronic myeloid leukemia, chronic myeloid leukemia risk scores, imatinib mesylate
Departments of Hematology*, National Cancer Institute, University of Cairo, Egypt, Clinical Hematology**,
University of Dammam, KSA and Molecular Biology***, University of Dammam, KSA.
Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 31 - 37
INTRODUCTION
Philadelphia chromosome i.e., the chromo-
some originating from the reciprocal transloca-
tion between long arms of chromosome 9 and
chromosome 22 t(9;22)(q34;q11), along with
its product BCR-ABL oncogene is perhaps the
most extensively studied oncoprotein. Since its
discovery in 1960(13), its different variants in dif-
ferent types of leukemia has been recorded and
analyzed. In chronic myeloid leukemia (CML)
BCR-ABL fusion oncogene translates chimeric
protein p210, which exerts its oncogenic role
by activating the tyrosine kinase, which does
not block differentiation but leads to the devel-
opment of malignancy by enhancing prolifera-
tion of myeloid cell line(15). In CML, most of the
cases of p210 constitutes principally of two vari-
ants: b3a2 or e14a2 and b2a2 or e13a2(4,11). The
b3a2 variant is produced by the fusion of exon
14 of BCR gene with exon 2 of ABL gene while
the other variant, i.e., b2a2 is produced by fusion
of exon 13 of BCR and exon 2 of ABL(18). These
transcripts variants are produced as the result of
alternate splicing. Many studies had been per-
formed to find interrelation between the particu-
lar variant of p210 BCR-ABL and the etiology,
pathogenesis, prognosis of the disease. What our
study constitutes is the endeavor to find the in-
terrelation between these two principal transcript
variants of p210 and its association with differ-
ent aspects of the disease such as white blood
cell (WBC) count, platelet count, organomegaly,
prognostic markers of the CML (Sokal score(19),
Hasford/ Euro score(8), European Treatment and
Outcomes Study (EUTOS) score(7)) along with
the response to the modern day mainstay thera-
py of CML through Imatinib mesylate. Reverse
transcriptase polymerase chain reaction (RT-
PCR) chosen as the method of choice to deter-
mine the transcript variant of BCR-ABL, is one
of the most sensitive methods for this purpose.
MATERIALS AND METHODS
The study was approved by the ethics com-
mittee of the Dammam University Hospital.
Abdelaziz H., et al.32
Patients
A total of 80 consecutive patients who were
diagnosed to be suffering from CML in our clin-
ic over the period of January 2010 to December
2010 were selected for the study and followed up
for18 months.
Sample collection
Blood samples were collected from 80 pa-
tients from the Out-Patient Clinic (3 ml for each
patient), in a proper aseptic manner, into prop-
erly labeled ethylene diaminetetraacetic acid
vacuum tubes. Processing of the collected blood,
i.e., beginning of ribonucleic acid (RNA) isola-
tion from the collected blood sample, was started
immediately, thus evading any chance of mes-
senger RNA degradation. Proper consent from
each patient was taken at the time of sample col-
lection.
RNA isolation
Total RNA was isolated from a blood sample
by using the QIAGEN RNA isolation kit (Qia-
gen, Germany) by following the protocol pro-
vided by the manufacturer. RNA quantity was
determined by spectrophotometry.
Complementary DNA (cDNA) synthesis
RNA was reverse transcribed into cDNA
for using as template in PCR reaction. RT reac-
tion was performed by using Transcriptor First
Strand cDNA Synthesis Kit, Roche applied sci-
ence, USA.
Six microliter of RNA (~2.4 µg RNA) was
added to 14 µL of mix containing 2 µL of 10x RT
reaction buffer (40 mM Tris-HCL, 100 mM KCl,
20 mM DTT), 10 mM dNTP, 10 mM oligo-dT,
20 units of RNase inhibitor and 40 units of Re-
verse Transcriptase. Next the mix was incubated
in 42°C for 45 min, 99°C for 3 min and finally
held at 4°C for 20 min. Manufacturer provided
RNA is used as a positive control.
PCR amplification
The primers of standardized PCR protocol of
BIOMED1(Europe against Cancer)(21) were used
to amplify the cDNA (Except the shifted primer
ABL-a3-E3’). The sequences of the primers are
given as follows:
• BCR-b1-A 3086 (22): GAAGT-
GTTTCAGAAGCTTCTCC
• ABL-a3-B 458 (21): GTTTGGGCTTCA-
CACCATTCC
• BCR-b2-C 3126 (21): CAGATGCTGAC-
CAACTCGTGT
• ABL-a3-D 441 (23): TTCCCCATTGT-
GATTATAGCCTA.
The cDNA product of the former reaction
was amplified with PCR reaction in two rounds
(nested PCR), 150 mM primers, 1 U/ml Taq Poly-
merase, 10 mM dNTP mix and ×10 PCR buffer
with 25 mM MgCl2 was used in each round.
Initial denaturation was performed at 95°C for
3 min followed by 35 cycles of denaturation at
94°C for 20 s; annealing at 55°C for 15 s; exten-
sion at 72°C for 15 s with a total 35 cycles using
thermocycler. Final extension was performed at
72°C for 5 min. After performing the PCR reac-
tion, the products were checked through agarose
gel electrophoresis in 2% of agarose gel medi-
um.
RESULTS
The b3a2 transcript variant was recognized as
417 base pair long product and b2a2 was recog-
nized as 342 base pair long product when primers
A and B were used [Figure 1] and as 360 and 285
bp products when primers C and D were used.
The baseline characteristics of patients are
shown in table 1. Amongst 80 patients (includ-
ing 24 females) 45 (56.25%) of patients showed
the presence of b3a2 and 33 (41.25%) of patients
showed the presence of b2a2 transcript variant.
The rest 2.5% (numerically, 2 cases) showed the
expression of rare e19b2 variety, recognized as
a 243 base pair long product in agarose gel elec-
trophoresis. However, there was no case of b3a2
and b2a2 co-expression in any patient. Bone
marrow cytogenetics did not reveal any abnor-
mality other than the presence of Philadelphia
chromosome in any patient.
Qualitative nested PCR were performed on
the patients at the end of the follow-up period as
it was done at the beginning of the study. All the
patients, including two patients who underwent
complete molecular response, did show qualita-
BCR-ABL Variants Relation to Different Scores 33
tive nested PCR value as positive at the end of
the follow-up period (which is a common occur-
rence).
Hence the first round PCR (at the time of di-
agnosis) and the second round PCR (at the end
of follow-up) did not discriminate the patient
population. From the database of history of the
patients, we had calculated the Sokal score, Has-
ford score and EUTOS score of all patients at
the time of diagnosis and correlated them with
the respective transcript variants of the patients
is given in figure 2.
From figure 2, it is apparent that, according
the Sokal, Hasford and EUTOS score, the pa-
tients with b2a2 transcript variants are present-
ing with higher scores than the patients having
b3a2 variants. Hence we have performed t-test to
test if the risk scores are significantly higher in
patients with b2a2 variants and it was found that
the P < 0.05 in both Sokal and EUTOS score, but
not in Hasford score (P = 0.03 in case of Sokal
score, 0.027 in EUTOS score and 0.24 in Has-
ford score).
We analyzed the correlation between different
transcript variants and the progression of disease
among the patients. We tabulated the transcript
variants of the patients against
their stage of the disease i.e., if they stayed
in chronic phase (CP) all along or progressed to
accelerated phase or blast crisis in tables 2. We
have also tabulated the Platelet count, organo-
megaly and other hematological features against
the transcript variants in table 3, as there are
earlier reports on the correlation between these
two in the form of higher platelet count found in
b3a2 variety.(14,22,9,3) However, we found higher
platelet counts in patients with b2a2 variety of
BCR-ABL than in b3a2.
We also studied and tabulated our patients’
response to the first generation tyrosine kinase
inhibitor Imatinib mesylate and any possible re-
lation with the transcript variants of the patients
in table 4. For this purpose, we had only con-
sidered the data of the patients who presented to
us in the CP of the disease (1st CP of CMLCP)
and are currently being treated by Imatinib me-
sylate (at the standard dose of 400 mg/day) for at
least a period of 6 months. In our population, we
found 30 such cases of b3a2 and 23 such cases of
b2a2. For assessment of the Imatinib response,
we had to depend mostly on the hematological
response as most of the patients could not afford
the recommended bone marrow cytogenetics or
quantitative. RT-PCR (qRT-PCR). Cytogenetic
response (partial, major or complete) and molec-
ular response was assessed for BCRABL in a few
cases where the patient could afford the test.
�������!�$���������� �������������������������������������������������������������������������������� %�� -���������� %���-������������ %��� �
1"�������������������!5�.�������������������������������������������5.����������������������7������������������������6�
1"�������������������!.�.�������������������������������������������.5����������������������2������������������������2� ���/� ����������������������5� 0�/� �������%���5��0�/������������%���5�( �/�(�����������
������ ������������ �������������
����
� ����� �������/&� �������� ��������2�
����
����
����� �������A6/ ���������/''�
������
�������� ����������� �����������
���� ���������� �������
����� ������� �����������
Table 1: Baseline characteristics of patients
WBC – White blood cell
Table 2: Disease stage
CML – Chronic myeloid leukemia; CP – Chronic phase; AP – Accelerated phase; BC – Blast crisis
Parameters
at diagnosis b3a2 b2a2
Median Interquartile Range Median Interquartile Range
Platelet count (103/µl) 206 310 297 326
Hemoglobin (g/dl) 10 2.8 10 2.96
WBC count (103/µl) 37.7 98.3 45 107.98
Splenomegaly (cm) 3.5 6 4 7
Hepatomegaly (cm) 2 3 2 3
Abdelaziz H., et al.34
Table 3: Clinical features of patients with transcript variants
������2!����������������"���� �������������������������������������������������������������������������������������������������������������������������������
������"��������������������#�������������/&��������������������������������������������������������������������������������������������5'�������������������������������������.5�
+�"��� �������������
������*�����5������OO���������������������������������������������������������������.'������������������������������������/7�
�����#���������*�����������������������������������������������������/'��������������������������������������6� � ���������������
�������N���������/�524 ����������������������������������������������������������������5���������������������������������������.�
�����������������53�324 ��������������������������������������������������������������5���������������������������������������.�
�����������������33�724 ���������������������������������������������������������������.��������������������������������������/�
�������������������������������������������������������������������������������������������6��������������������������������������.�
�����1�������� ������������������������������������������������������������������������/&������������������������������������/3�
%����������������
������������������������������������������������������������������������������������������/���������������������������������������/�
�������N������������������������������������������������������������������������������������5���������������������������������������/�
�������� ������� �������������������������������������������������������������������.3�������������������������������������./�.( � /� .����� ������ ����5� !�� /� !������� �������5� 66 �,� / ��%����� ������������ ���������� ������
Table 4: Response to treatment
IM – Imatinib mesylate; **CHR –Complete hematological remission i.e., resolution of splenomegaly (if
previously present), restoration of normal blood counts and loss of marrow hypercellularity (Platelet
<450×109/L; WBC <10×109/L; No immature granulocyte and basophil <5%)(1)
��������� �
�"������
������� �������� ��������� ��%�����
Figure 1: Reverse transcriptase-polymerase chain reaction of
BCR- ABL transcript variants in 2% agarose gel. Lane 1:
100bp ladder, Lane 2: Positive control of b3a2 (417bp);
Lane 3: Positive control of b2a2 (342 bp); Lane 4 and 5:
Patient sample showing b3a2 variant; Lane 6: Patient
sample showing b2a2 variant; Lane 7: Negative control
Characteristic b2a2 b3a2Age 42 32Gender M MHemogram on diagnosis
Tot .Leukocyte count (X103/µl) 112.66 263.6Platelet (X103/µl) 740 210Neutrophil % 38 40Eosinophil % 3 5Basophil % 18 5Blast % 0 7
Organomegaly on diagnosisLiver (cm) 3 4Spleen (cm) 15 7
Hemogram on test dayTotal Leukocytic count (X103/µl) 4.1 6.35platelets (X103/µl) 741 100Neutrophil % 32 44Eosinophil % 12 1Basophil % 32 0Blast % 0 0
Organomegaly on test dayLiver (cm) 4 0Spleen (cm) 13 0
Sokal score 1.17 (int.) 1.22 (high)Hasford score 577.3 (high) 111.3 (int.)EUTOS score 81 (low) 63 (low)
BCR-ABL Variants Relation to Different Scores 35
DISCUSSION
In our study, the frequency of b3a2 and b2a2
was found to be 56.25% and 41.25% respec-
tively which is quite closer to the data derived
in the similar studies performed in the Caucasian
population(22). No co-expression of these two
variants was found in any of the patients. In other
countries, the distribution was also similar to our
findings(6,10). In all the aforementioned studies,
the ratio was roughly calculated to be b3a2:b2a2
= 3:2. However, the role of BCR-ABL transcripts
variants in the prognosis had always been a con-
troversial issue. Although some authors reported
no such role on the part of the transcript vari-
ants, others found data referring to the transcript
variants to have prognostic values(5,16,20). In the
Middle East population, this is perhaps the first
study on the transcript variants and their possible
role on the presenting relative risks (measured
by Sokal, Hasford and EUTOS score) and Ima-
tinib response. Our study does not reveal a sig-
nificant difference of treatment response in the
two patient populations. The patients with b2a2
variants of our population seem to be presenting
with higher relative risk (according to Sokal and
EUTOS score).
In the study by Martínez-Mancilla et al., a
higher leukocyte count in b2a2 patients was
reported(12). The presenting features of the pa-
�Figure 2: Distribution of patients of both the transcript variants b3a2 and b2a2 are shown as in (a) Sokal
score, (b) Hasford score and (c) European Treatment and Outcomes Study score described risk cat-
egories.B2a2 shows higher risk scores than b3a2 variety.
c
b
a
Abdelaziz H., et al.36
tients of these two sub-populations are not stark-
ly different either. Although some of the studies
failed to show any correlation between platelet
count and BCR-ABL transcript variants(17), oth-
ers recognized higher platelet count in patients
carrying b3a2(14,22,9,3). However almost all the
reported studies correlating these two, related
higher platelet count in the b3a2 variety our
study had revealed otherwise [Table 4]. The oth-
er presenting features as Total WBC count, He-
moglobin, hepatomegaly and splenomegaly are
within moderate range of discrimination show-
ing the b2a2 population presenting with relative
organomegaly and slightly lower hemoglobin as
well as lower WBC count.
Due to the issue of affordability of our patients,
the world-wide recommended follow-up proto-
col through qRT-PCR to analyze transcript load
of BCR-ABL every 3 months interval(2,1)could
not be performed. Rather the common practice
is to follow-up patients through checking for
hematological remission. In addition in case of
Imatinib failure, switching over to second gen-
eration tyrosine kinase inhibitor is impossible
for the same reason of affordability.
Conclusion
According to the criterion of achieving and
maintenance of hematological remission, b2a2
patients seem to respond well to the Imatinib
therapy. Patients with b2a2 variant CML tend
to present with higher risk score, but do not be-
have in a vastly different manner than their b3a2
counterparts. Still keeping the small sample size
in mind, it is better to say that further investiga-
tion is required to conclude this aspect as well as
to investigate the association between transcript
variants and treatment response in terms of cyto-
genetic and molecular response.
REFERENCES1. Baccarani M, et al. 2006 Evolving concepts in the man-
agement of chronic myeloid leukemia: Recommenda-
tions from an expert panel on behalf of the European
LeukemiaNet. Blood ;108:1809.
2. Baccarani M, Cortes J, et al. 2009 Chronic myeloid leu-
kemia: An update of concepts and management recom-
mendations of European LeukemiaNet. J Clin Oncol ;
27:6041.
3. Balatzenko G, Vundinti BR, Margarita G. 2011 Correla-
tion between the type of bcr-abl transcripts and blood
cell counts in chronic myeloid leukemia-A possible in-
fluence of mdr1 gene expression. Hematol Rep ;3:e3.
4. Ben-Neriah Y, Daley GQ, Mes-Masson AM, 1986 Witte
ON, Baltimore D. The chronic myelogenous leukemia-
specific P210 protein is the product of bcr/abl hybrid
gene. Science ; 233:212.
5. de Lemos JA, de Oliveira CM, Scerni AC, et al. 2005
Differential molecular response of the transcripts B2A2
and B3A2 to imatinib mesylate in chronic myeloid leu-
kemia. Genet Mol Res; 4:803.
6. Goh HG, Hwang JY, Kim SH, et al. 2006 Comprehensive
analysis of BCR-ABL transcript types in Korean CML
patients using a newly developed multiplex RTPCR.
Transl Res ;148:249.
7. Hasford J, Baccarani M, Hoffmann V, et al. 2011 Pre-
dicting complete cytogenetic response and subsequent
progression-free survival in 2060 patients with CML
on imatinib treatment: The EUTOS score. Blood ;
118:686.
8. Hasford J, Pfirrmann M, Hehlmann R, et al. 1998 A new
prognostic score for survival of patients with chronic
myeloid leukemia treated with interferon Alfa. Writing
Committee for the Collaborative CML Prognostic Fac-
tors Project Group. J Natl Cancer Inst ;90:850.
9. Inokuchi K, Inoue T, Tojo A, et al. 1991 A possible cor-
relation between the type of bcr-abl hybrid messenger
RNA and platelet count in Philadelphia-positive chron-
ic myelogenous leukemia. Blood ;78:3125.
10. Iqbal Z, Manzoor F, Iqbal M, et al. 2011 Frequency of
BCR-ABL Fusion Oncogene Splice Variants Associ-
ated with Chronic Myeloid Leukemia (CML). J Cancer
Ther ; 2:176.
11. Lucas CM, Harris RJ, Giannoudis A, et al. 2009 Chron-
ic myeloid leukemia patients with the e13a2 BCR-ABL
fusion transcript have inferior responses to imatinib
compared to patients with the e14a2 transcript. Haema-
tologica ; 94:1362.
12. Martínez-Mancilla M, Gutiérrez M, de la Rosa GZ,
et al. 2002 Younger age and shorter chronic phase in
b2a2-positive chronic myeloid leukemia adults with
high white blood cell count at diagnosis. Haematolog-
ica ; 87:666.
13. Nowell PC. 1962 The minute chromosome (Phl) in
chronic granulocytic leukemia. Blut ;8:65.
14. Perego RA, Costantini M, Cornacchini G, et al. 2000
The possible influences of B2A2 and B3A2 BCR/ABL
protein structure on thrombopoiesis in chronic myeloid
leukaemia. Eur J Cancer ;36:1395.
15. Ren R. 2005 Mechanisms of BCR-ABL in the patho-
genesis of chronic myelogenous leukaemia. Nat Rev
Cancer ; 5:172.
16. Rosas-Cabral A, Martínez-Mancilla M, Ayala-Sánchez
M, et al. 2003 Analysis of Bcr-abl type transcript and its
BCR-ABL Variants Relation to Different Scores 37
relationship with platelet count in Mexican patients with
chronic myeloid leukemia. Gac Med Mex ;139:553.
17. Shepherd P, Suffolk R, Halsey J, 1995 Analysis of mo-
lecular breakpoint and m-RNA transcripts in a prospec-
tive randomized trial of interferon in chronic myeloid
leukaemia: No correlation with clinical features, cyto-
genetic response, duration of chronic phase, or survival.
Br J Haematol ;89:546.
18. Shtivelman E, Lifshitz B, Gale RP, 1985 Fused tran-
script of abl and bcr genes in chronic myelogenous leu-
kaemia. Nature ; 315:550.
19. Sokal JE, Cox EB, Baccarani M, et al. 1984 Prognostic
discrimination in “good-risk” chronic granulocytic leu-
kemia. Blood ;63:789.
20. Udomsakdi-Auewarakul C, U-Pratya Y, Boonmoh S,
2000 Detection of molecular variants of BCRABL
gene in bone marrow and blood of patients with chronic
myeloid leukemia by reverse-transcriptase polymerase
chain reaction (RT-PCR). J Med Assoc Thai ;83:928.
21. van Dongen JJ, Macintyre EA, Gabert JA, et al. 1999
Standardized RT-PCR analysis of fusion gene tran-
scripts from chromosome aberrations in acute leuke-
mia for detection of minimal residual disease. Report
of the BIOMED-1 Concerted Action: Investigation of
minimal residual disease in acute leukemia. Leukemia;
13:1901.
22. Verschraegen CF, Kantarjian HM, Hirsch-Ginsberg C,
et al. 1995 The breakpoint cluster region site in patients
with Philadelphia chromosome-positive chronic my-
elogenous leukemia. Clinical, laboratory, and prognos-
tic correlations. Cancer ;76:992.
دراسة عالقه بدائل ال بوجودعوامل الخطور
هشام عبد العزيز - أحمد عمر - على الشميرى - محمد كشك
الخلفيه العلميه: الدور الدقيق للبدائل المختلفه ل BCR-ABL فى التسبب فى سرطان الدم الميلودى المزمن (CML) و تأثيرها على ناتج تطور الحاله المرضيه ال يزال يحتاج الى الكثير من الدراسات. األهداف: فى هد الدراسه, حاولنا دراسة وجود عالقه بين االعراض المرضيه و وجود عوامل الخطور و االستجابه للعالج مع بدائل ال BCR-ABL . المواد والطرق: قمنا بدراسه ذات مقطع عرضى فى مركز االورام التابع لمستشفى واحد فى الفتر من يناير 2010 الى ديسمبر 2010 ,على 80 مريض من المترددين على عيادة امراض الدم بمستشفى جامعة الدمام بالمملكه العربيه السعوديه و مصابون
بمرض سرطان الدم الميلودى المزمن. و قد تم التشخيص لجميع المرضى حسب الطرق و المعايير العالميه و ذلك عن طريق دراسة تحليل النخاع العظمى و تحليل العوامل الوراثيه و قد تم التأكد من التشخيص عن طريق تفاعل البلمر العكسى. تم تحليل نتائج المعدالت الطبيه المختلفه و متابعة هؤالء المرضى لمدة 18 شهرا بأثر رجعى. التحليل االحصائى: تم استعمال طريقة ال Box Plot و الرسم البيانى لمعرفة كيفية توزيع العوامل المختلفه. و أيضا تم استعمال ال T-test لدراسة الفرق بين تاثير عوامل الخطورة المختلفه فى مجموعتين من المرضى يحمل كل منهم بديل مختلف لل BCR-ABL. النتائج: ما b2a2 في حين أن ٪41.2 من المرضى أظهرت وجود بديل (b3a2 (e14a2 يقرب من 56.2 ٪ من المرضى يحملوا البديل b2a2 نادرة الحدوث. المرضى الذين يحملون بديل e19b2 الباقي ٪2.5 (اثنين من المرضى) أعربت البديل .((e13a2
أظهروا نسبه أعلى مع تدريج سوكال و تدريج هاسفورد والعالج األوروبي لنظير ممن يحملوا بديل b3a2. وأظهرت معايير المجموعتين. بين بسيط اختالف الطحال وتضخم الدم خضاب البيض، الكريات عدد الدموية، الصفائح عدد مثل مختلفة حقق المزيد من المرضى في المجموعة b2a2 استجابة دموية كاملة في 3 أشهر، ولكنه لم يكن كبيرا أو محقق احصائيا. االستنتاجات: المرضى الذين يحملون البديل b2a2 لل BCR-ABL فى مرضى سرطان الدم الميلودى المزمن تميل إلى
.b3a2 اظهار معدالت أعلى لوجود عوامل الخطور ، ولكن ال تتصرف بطريقة مختلفة إلى حد كبير من نظرائهم
BCR-ABL (b2a2 and b3a2)
CRP AND SERUM AMYLOID A AS MARKERS FOR THE AGGRESSIVENESS OF BREAST CANCER
Rania Elhelely* , Rasha Elzehery* , Mohammed AF Hegazy** and Ramy Faris**
ABSTRACT
Introduction: Chronic inflammation is included in the development and progression of breast cancer. Serum C - reactive
protein (CRP) and serum amyloid A (SAA) are measures of low-grade chronic inflammation. Aim: the present study investi-
gated the possibility to use CRP and SAA as predictors for the aggressiveness of breast cancer. Subjects and methods: serum
CRP and SAA levels were measured in 181 female patients (24-78 years old) with breast cancer and 60 healthy age- matched
control females (33-67years old) using Enzyme-linked Immunosorbent Assay (ELISA) kit. Results: serum CRP levels were
higher in malignant and benign breast lesions than control group but with no statistical significant difference among diseased
groups (P < 0.001). SAA levels were statistically higher in malignant breast lesions than benign and control group (P< 0.001),
but there was no statistical significant difference in its levels between FA and control group (P= 0.57). CRP levels showed no
statistical significant difference between benign breast tumor and stage I cancer breast (P= 0.97). SAA and CRP concentrations
were correlated positively with tumor stages [(r=0.861, P< 0.001) and (r=0.680, P< 0.001)] respectively and with each other
(r=0.628, P< 0.001). Conclusion: SAA can be used as a predictor marker than CRP for malignant breast lesions. Key Words:
Breast Cancer, Serum Amyloid A, C - reactive protein.
Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015 39 - 46
INTRODUCTION
The International Agency for Research on
Cancer (GLOBOCAN 2012) found that breast
cancer (BC) is the world’s most common can-
cer among women, and the most likely cause
of death among them (12). BC is reported as the
most frequent cancer among women in 140 of
184 countries worldwide including China the
world’s most populous country (5). After 1990
the mortality rate of BC has decreased, due to
widespread BC screening and the general use of
anticancer agents (33). The 5-year survival rates
have improved to 98% for early stage and 39%
for late stage BC (28). Thus, early detection is vi-
tal to improve the prognosis of cancer patients
and this requires non-invasive and specific bio-
markers; among them, blood markers may offer
a good surrogate selection.
Chronic inflammation is a key contributor
to cancer development and progression. Cancer
survivors with chronic inflammation may have
an elevated risk of recurrence as a result of the
effects of inflammatory processes on cell growth
or the presence of cancer cells that induce in-
flammation (8).
Clinical and experimental data suggest that
chronic inflammation promotes mammary tu-
mor development through mechanisms involv-
ing chronic activation of humoral immunity and
infiltration of Th2 cells and polarized innate in-
flammatory cells (10) .
Moreover; inflammation associated oxidative
damage could initiate carcinogenesis by causing
inactivating mutations in tumor-suppressor genes
or post-translational modifications in proteins
involved in DNA repair or apoptotic control. In
addition; inflammatory cytokine signaling via
intracellular enzymes and transcription factors
may inhibit apoptosis and promote the growth
and proliferation of cancer cells. Moreover; acti-
vation of inflammatory pathways might enhance
tumor progression by promoting cell motility,
vascular permeability and angiogenesis(8,10,16).
Acute-phase proteins (APPs) generally have
a nonspecific rapid response to such processes as
inflammation/infections, tissue damage, surgery,
myocardial infarction or the presence of tumors.
The relationship between the APPs and cancer
has been well documented in the literature with
numerous investigations reporting an altered
levels of various APPs with different types of
cancers and evidence that many APPs are actu-
ally produced directly by tumor tissue (34).
It has been suggested that APPs were not like-
ly to be specific for any type of cancer and would
be expected to be elevated in all malignancies
Departments of Clinical Pathology* and Surgical Oncology**, Faculty of Medicine, Mansoura University-
Egypt
Elhelely,R. , et al.40
and in inflammatory diseases. Moreover; APPs
were thought unlikely to be tumor-derived and
thus to represent cancer epiphenomena rather
than direct tumor-derived proteins. Proteomics
studies, which profiled the serum proteins of pa-
tients with cancer and those of normal individu-
als, proved that the altered expression of APPs
was different for various types, subtypes, and
even stages of cancer (23).
It is likely that panels of biomarkers in the fu-
ture will be comprised of biomarkers that reflect
tumor-specific proteins together with proteins
from the tumor microenvironment (25).
Serum amyloid A (SAA) is a 12-kD acute-
phase protein which can be induced up to 1000-
fold (22). HDL is the main carrier of SAA in
human(4).
C-reactive protein (CRP) and serum amyloid
A (SAA) are nonspecific, acute-phase, hepatic
proteins secreted in response to cytokines in-
cluding interleukin-1, interleukin-6 and tumor
necrosis factor-α(3).
Previous epidemiologic studies have report-
ed that elevated CRP levels may be associated
with poor prognosis of several types of solid
cancers(1), as endometrial(30), cervical (27), colorec-
tal, pancreatic, hepatocellular, esophageal, renal
cell, bladder, prostate, ovarian, and non-small-
cell lung cancer(24,29).
Up-regulation of SAA was found in a wide
range of malignancies as lung, pancreatic, pros-
tate, colon and gastric cancer(11,19,18,9,7). Previous-
ly; it was considered that the elevation of SAA
in the serum of cancer patients is of liver origin
rather than from tumor cells. However, other re-
searches indicated that some tumor cells (such
as endometrial and colon cancer cells) also syn-
thesize and secrete SAA(7,6). SAA is an inflam-
matory modulator that is involved in cholesterol
metabolism and transport and is important in
cancer progression (21).
The aim of the present study was to deter-
mine whether circulating markers of inflamma-
tion (CRP and SAA) could be used as predictors
for the aggressiveness of breast cancer.
MATERIALS AND METHODS
Materials:
This study was conducted on 181 female
patients (24-78 years old) diagnosed as cancer
breast admitted at Mansoura Oncology Center.
60 healthy age- matched females (33-67) were
taken as a control group. Subjects with a history
of any cancer and those with associated diseases
that might raise serum CRP or SAA (such as in-
fectious diseases, autoimmune conditions, asth-
ma, and osteoarthritis) were excluded.
All studied patients were subjected to full his-
tory taking and thorough clinical examination.
Fine needle aspiration biopsy from breast lesion
was taken for histopathological examination.
Sampling: 5 ml venous blood was obtained
from breast cancer patients and the healthy con-
trols. Serum samples were frozen and maintained
at -80˚C until the assay was conducted. All 120
breast cancer patients and healthy volunteers
signed informed consent forms for sample col-
lection. The study was conducted in accordance
with the guidelines of the Helsinki Declaration.
Methodology: The following investigations
were done to both patients and controls:
*Serum SAA concentrations were determined
using Enzyme-linked immunosorbent assay
(ELISA) kit supplied by Assay pro (3400 Harry
S Truman Blvd St. Charles, MO 63301, USA).
* Serum CRP concentrations were deter-
mined using commercially available ELISA kit
supplied by Abcam (1 Kendall Square, Suite
B2304 Cambridge, MA 02139-1517 USA).
Statistical Analysis: All statistical analyses
were performed using the Statistical Package for
Social Sciences (SPSS) version 17.0 software.
Data were first tested by Kolmogorov-Smimov
test for distribution of data. Description was done
in the form of median and IQR for numerical non-
parametric data, and number and percentage for
categorical data. Kurskal Wallis test was used for
comparison of the studied groups in all variables
followed by comparisons using the Mann Whit-
ney U test. Spearman’s rank correlation was also
used to check the correlation between CRP and
SAA concentrations and stages of breast cancer.
CRP and Amyloid A in Breast Cancer 41
For all tests, p<0.05 was considered to indicate a
statistically significant difference.
RESULTS
According to histopathological examination
of fine needle aspiration biopsy obtained from
different breast lesions included in our study;
we found 44 patients with invasive ductal car-
cinoma (IDC), 43 patients with invasive lobular
carcinoma (ILC), 42 patients with Ductal carci-
noma in situ (DCIS), 32 patients with Mucinous
adenocarcinoma (MC) and 20 patients with Fi-
broadenoma (FA).
Our study found that median CRP levels were
9, 8.3, 7.8, 8.55 and 6.45pg/ml in patients with
IDC, ILC, DCIS, MC and FA respectively vs
3.4 pg/ml in control group (P< 0.001) (Table 1).
When Mann-Whitney test was performed; serum
CRP levels were higher in malignant and benign
breast lesions than control group but with no
statistical significant difference among diseased
groups (Figure 1).
As regards SAA; it was found that its levels
were statistically higher in malignant breast le-
sions than benign and control group. Median
SAA levels were (50, 27, 17.3, 6.95 μg/ml in pa-
tients with IDC, ILC, DCIS and MC vs FA (2.15
μg/ml) and control group (1.9 μg/ml) (P< 0.001)
(Table 1). By Mann-Whitney test; there was a
statistical significant difference among malig-
nant groups and between malignant and both be-
nign and control groups (P ≤ 0.002). In contrast;
there was no statistical significant difference in
SAA levels between FA and control group (P=
0.57). Moreover; SAA levels were directly pro-
portional with aggressiveness of cancer breast
(Figure 1).
According to different stages of cancer
breast; our study included 22 patients in stage
I, 52 patients in stage II, 58 patients in stage
III and 29 patients in stage IV. The results of
the statistical assessment showed the median
serum CRP and SAA concentrations were 6.3
pg/ml and 11μg/ml in stage I, 8.4 pg/ml and
19.7 μg/ml in stage II, 11.2 pg/ml and 31 μg/
ml in stage III and 13 pg/ml and 63.1 μg/ml in
stage IV respectively (P< 0.001) when com-
pared to control group) (Table 2 & Figure 2).
Using Mann-Whitney test; a statistical signif-
icant difference in CRP levels between FA and
control group (P = 0.002) was found, while there
was no statistical significant difference in SAA
between the two groups (P= 0.57). On the other
hand; there were statistical significant differenc-
es as regards SAA levels between benign breast
tumor and cancer breast (P< 0.001). As regards
CRP, there was no statistical significant differ-
ence between benign breast tumor and stage I
cancer breast (P= 0.97), while there were statis-
tical significant differences among higher stages
of cancer breast (P< 0.006).
Moreover; SAA and CRP concentrations
were correlated positively with tumor stages
[(r=0.861, P<0.001) and (r=0.680, P< 0.001)]
respectively (Figure 3&4). CRP levels were cor-
related positively with SAA levels (r=0.628, P<
0.001).
Table (1): Serum levels of SAA and CRP among the studied groups as regard histological type:
Parameter IDC
(n = 44)
ILC
(n = 43)
DC IS
(n = 42)
MC
(n =32 )
FA
(n = 20)
Control
(n = 60) P
SAA (μg/ml)
(median &
Range)
50
( 13 –77)
27
(12-59)
17.3
(8.6-31)
6.95
(3.9-10.5)
2.15
(1.2-3.6)
1.9
(0.9-3.6) < 0.001
CRP (pg/ml)
(median &
Range)
9
(3.1-15.3)
8.3
(4.5-18.2)
7.8
(3.2-14.5)
8.55
(4.5-12)
6.45
(2.4-11)
3.4
(1.1-6.5) < 0.001
Elhelely,R. , et al.42
Table (2): Serum levels of SAA and CRP among different stages of cancer breast:
Parameter IDC
(n = 44)
ILC
(n = 43)
DC IS
(n = 42)
MC
(n =32 )
FA
(n = 20)
Control
(n = 60)
P
SAA (μg/ml)
(median &
Range)
50
( 13 –77)
27
(12-59)
17.3
(8.6-31)
6.95
(3.9-10.5)
2.15
(1.2-3.6)
1.9
(0.9-3.6) < 0.001
CRP (pg/ml)
(median &
Range)
9
(3.1-15.3)
8.3
(4.5-18.2)
7.8
(3.2-14.5)
8.55
(4.5-12)
6.45
(2.4-11)
3.4
(1.1-6.5) < 0.001
Figure (2): Serum levels of CRP and SAA among
different stages of cancer breast.
Figure (3): Concentrations of SAA in controls,
benign breast disease (FA) and breast
cancer patients at various stages of the
disease.
Figure (4): Concentrations of CRP in controls,
benign breast disease (FA) and breast
cancer patients at various stages of the
disease.
Figure (1): Serum levels of CRP and SAA among
different histological types of cancer
breast.
CRP and Amyloid A in Breast Cancer 43
DISCUSSION
Although there have been significant advanc-
es in imaging technology, many breast lesions re-
main indeterminate following conventional eval-
uation. Genomic and proteomic high-throughput
approaches may help in identifying new blood
biomarkers, which provide a convenient, rela-
tively noninvasive approach for diagnosis and
monitoring patients.
Besides the potential of SAA as a cancer
biomarker, the role of SAA in the progression
of neoplastic diseases is of current interest. An
acute immune response may cause an increased
risk of peripheral metastases(17). SAA protein
stimulates the production of various cytokines
by macrophages and can play an important
role in acute immune response, stimulating
tumor metastasis indirectly. It stimulates ma-
trix metalloproteinase- 9 (MMP-9) production
by macrophages(20). These metalloproteinases
(MMPs) are a family of extracellular matrix
degrading proteases that are zinc-dependent
and associated with invasion and metastasis
during tumor progression(31).
In the present study; patients with breast
tumors were classified according to both histo-
pathological examination and clinical staging.
CRP and SAA levels were measured at time of
diagnosis of breast tumor.
According to histopathological classification;
serum CRP levels were higher in malignant and
benign breast lesions than control group but with
no statistical significant difference among dis-
eased groups. These results are not in agreement
with Allin et al(2) who reported that elevated CRP
levels were indeed associated with larger tumor
size, presence of distant metastases, and lower
tumor grade.
Two hypotheses have been proposed to ex-
plain the relationship between CRP level and
cancer. First; it has been suggested that elevated
CRP levels are a result of an underlying cancer.
Second; chronic inflammation and elevated CRP
might have a causal role in carcinogenesis(15).
SAA levels showed statistical significant differ-
ence among malignant groups and between ma-
lignant and both benign and control groups. In
contrast; there was no statistical significant dif-
ference in SAA levels between FA and control
group. Moreover; SAA level was directly pro-
portional with aggressiveness of cancer breast.
Sura et al demonstrated a highly significant in-
crease of SAA concentration in benign and ma-
lignant breast tumors compared to control group
(p<0.001)(32). Chronic inflammation may pro-
mote carcinogenesis through complex processes
such as polarization of M2 tumor-associated
macrophages via cytokines and the subsequent
production of tumor growth factors or promotion
of angiogenesis(10).
Solid tumours typically trigger inflammatory
responses that result in the formation of a pro-
tumourigenic and pro-angiogenic microenviron-
ment around the tumour. Immune and inflamma-
tory cells in the tumour microenvironment inter-
act with malignant cells in a complicated fash-
ion, resulting in stimulation of tumour growth,
invasion, and metastasis(14).
Our study investigated both CRP and SAA
levels in different stages of cancer breast. There
was a statistical significant difference in CRP
levels between FA and control group, while there
was no statistical significant difference between
FA and stage I cancer breast, but statistical sig-
nificant differences appeared in higher stages of
cancer breast.
As regards SAA; there was no statistical
significant difference between FA and control
group, but there were statistical significant dif-
ferences between FA and stage I cancer breast
and the difference increased in higher stages.
These results are nearly similar to a recent study
done by Zhang et al(35) who found no difference
in SAA concentrations among the controls, be-
nign breast lesion and stage I breast cancer pa-
tients, but there was a gradual increase of SAA
concentrations in increasing stages of breast can-
cer patients.
Spearman’s correlation showed that SAA and
CRP concentrations were correlated positively
with tumor stages and with each other.
Other studies have demonstrated that higher
concentrations of SAA were associated with
increasing concentrations of CRP, and that el-
Elhelely,R. , et al.44
evated SAA and CRP were associated with re-
duced disease-free survival and reduced overall
survival in breast cancer patients, regardless of
adjustment for age, tumor stage, race and body
mass index(26,13) .
So, inflammation is closely linked to tumor
progression since inflammation in the tumor
microenvironment stimulates tumor growth,
invasion, and metastasis, inflammation seems
to favors invasion and metastasis more than to
mount an effective host anti-tumour response.(14)
So, inflammatory status may be an important
prognostic factor for breast cancer. Addition-
ally, reduction of the inflammatory reaction by
improving diet quality may benefit breast cancer
survivors(26,13).
Conclusion:
Our results indicated that inflammation plays
a key role in pathogenesis and aggressiveness of
breast cancer. SAA can be used as a predictor
marker than CRP for malignant breast lesions.
Conflict of interests:
The authors have declared no conflict of in-
terest.
Acknowledgments:
We would like to express our sincere grati-
tude to the patients for their co-operation with
us.
REFERENCES 1. Allin KH, Bojesen SE, Nordestgaard BG et al. 2009.
Baseline C-reactive protein is associated with incident
cancer and survival in patients with cancer. J Clin On-
col ; 27:2217.
2. Allin KH, Nordestgaard BG, Flyger H, et al. 2011 Ele-
vated pre-treatment levels of plasma C-reactive protein
are associated with poor prognosis after breast cancer: a
cohort study. Breast Cancer Research ; 13:R55.
3. Arnold PI. 1990 Properties of four acute phase proteins:
C-reactive protein, serum amyloid A protein, alpha
1-acid glycoprotein, and fibrinogen. Semin Arthritis
Rheum.; 20:129.
4. Cabana VG, Feng N, Reardon CA, et al 2004. Influence
of apoA-I and apoE on the formation of serum amyloid
A-containing lipoproteins in vivo and in vitro. J Lipid
Res ; 45: 317.
5. Chen W, Zheng R, Zhang S, et al. 2014 Annual report on
status of cancer in China. Chin J Cancer Res ; 26:48.
6. Cocco E, Bellone S, El-Sahwi K, et al. 2009; Serum
amyloid A (SAA): a novel biomarker for uterine serous
papillary cancer. Br J Cancer 101: 335.
7. Cocco E, Bellone S, El-Sahwi K, et al. 2010 Serum amy-
loid A: a novel biomarker for endometrial cancer. Can-
cer ; 116: 843.
8. Coussens LM, Werb Z .2002 Inflammation and cancer.
Nature ; 420:860.
9. Dai S, Wang X, Liu L, et al .2007 Discovery and iden-
tification of Serum Amyloid A protein elevated in lung
cancer serum. Sci China C Life Sci ;50: 305.
10. De Nardo DG, Coussens LM 2007. Inflammation and
breast cancer: Balancing immune response—Crosstalk
between adaptive and innate immune cells during breast
cancer progression. Breast Cancer Res.; 9:212.
11. Diamandis EP. Identification of serum amyloid a protein
as a potentially useful biomarker for nasopharyngeal
carcinoma. Clin Cancer Res 2004; 5293.
12. Ferlay J, Soerjomataram I, Dikshit R, et al .2015 Cancer
incidence and mortality worldwide: sources, methods
and major patterns in GLOBOCAN 2012 Int J Cancer
; 1;136(5):359.
13. George SM, Neuhouser ML, Mayne ST, et al. 2010;
Postdiagnosis diet quality is inversely related to a bio-
marker of inflammation among breast cancer survivors.
Cancer Epidemiol Biomarkers Prev 19: 2220.
14. Grivennikov SI, Greten FR, Karin M. 2010 Immunity,
inflammation, and cancer. Cell ; 140:883.
15. Heikkila K, Ebrahim S, Lawlor DA. A 2007 systematic
review of the association between circulating concen-
trations of C reactive protein and cancer. J Epidemiol
Community Health ; 61:824.
16. Heikkilä K, Harris R, Lowe G, et al 2009. Associations
of circulating C-reactive protein and interleukin-6 with
cancer risk: findings from two prospective cohorts and
a meta-analysis. Cancer Causes Control; 20 (1):15.
17. Hobson J, Gummadidala P, Silverstrim B, et al.2013
Acute inflammation induced by the biopsy of mouse
mammary tumors promotes the development of metas-
tasis. Breast Cancer Res Treat ; 139: 391.
18. Koomen JM, Shih LN, Coombes KR, et al. 2005 Plas-
ma protein profiling for diagnosis of pancreatic cancer
reveals the presence of host response proteins. Clin
Cancer Res ; 11: 1110.
19. Le L, Chi K, Tyldesley S, et al.2005 Identification of
serum amyloid A as a biomarker to distinguish prostate
cancer patients with bone lesions. Clin Chem ;51: 695.
20. Lee H Y, Kim M K, Park K S, et al. 2005 Serum amy-
loid A stimulates matrix-metalloproteinase-9 upregula-
tion via formyl peptide receptor like-1 mediated signal-
ing in human monocytic cells. Biochem Biophys Res
Commun; 330: 989.
CRP and Amyloid A in Breast Cancer 45
21. Li Y, Cai L, Wang H, et al.2011 Pleiotropic regulation of
macrophage polarization and tumorigenesis by formyl
peptide receptor-2. Oncogene ; 36: 3887.
22. Malle E, Steinmetz A, Raynes JG.1993 Serum amyloid
A (SAA): an acute phase protein and apolipoprotein.
Atherosclerosis ; 102: 131.
23. Miyake H, Muramaki M, Furukawa J, et al.2010 Serum
level of clusterin and its density in men with prostate
cancer as novel biomarkers reflecting disease exten-
sion. Urology ; 75:45.
24. O’Dowd C, McRae LA, McMillan DC, et al. 2010 El-
evated preoperative C-reactive protein predicts poor
cancer specific survival in patients undergoing resec-
tion for non-small cell lung cancer. J Thorac Oncol ;
5:988.
25. Paul D, Colin C, Kim H, et al. 2012 Analysis of acute-
phase proteins, AHSG, C3, CLI, HP and SAA, reveals
distinctive expression patterns associated with breast,
colorectal and lung cancer. Int J Cancer ; 131: 911.
26. Pierce BL, Ballard-Barbash R, Bernstein L, et al .2009
Elevated biomarkers of inflammation are associated
with reduced survival among breast cancer patients. J
Clin Oncol ; 27: 3437.
27. Polterauer S, Grimm C, Tempfer C, et al. 2007 C-reac-
tive protein is a prognostic parameter in patients with
cervical cancer. Gynecol Oncol; 107:114.
28. Redondo M, Rivas-Ruiz F, Guzman-Soler MC, et al.
2008 Monitoring indicators of health care quality by
means of a hospital register of tumours. J Eval Clin
Pract ; 14: 1026.
29. Roxburgh CS, McMillan DC.2010 Role of systemic in-
flammatory response in predicting survival in patients
with primary operable cancer. Future Oncol; 6:149.
30. Schmid M, Schneitter A, Hinterberger S. 2007 Asso-
ciation of elevated C-reactive protein levels with an
impaired prognosis in patients with surgically treated
endometrial cancer. Obstet Gynecol.; 110:1231.
31. Sung H J, Ahn J M, Yoon Y H, et al.2011 Identification
and validation of SAA as a potential lung cancer bio-
marker and its involvement in metastatic pathogenesis
of lung cancer J roteome Res ; 10: 1383.
32. Sura A, Shahla, Aqeel Sh.2014 Inflammatory mark-
ers and risk of breast tumor. J. Chem Pharm Res ;
6(8):357
33. Veronesi U, Boyle P, Goldhirsch A, et al.2005 Breast
cancer. Lancet ; 365: 1727-41.
34. Wood SL, Rogers M, Cairns DA, et al. 2010 Associa-
tion of serum amyloid A protein and peptide fragments
with prognosis in renal cancer. Br J Cancer ; 103:101.
35. Zhang G, Sunx , Lv H, et al. 2012 Serum amyloid A: A
new potential serum marker correlated with the stage of
breast cancer. ONCOLOGY LETTERS; 3: 940.
Elhelely,R. , et al.46
استخدام بروتين ال سي ر بي و بروتين االميلويد A كعالمات لتقدم سرطان الثديرانيا الهاللي - رشا الزهيري - محمد عبد الفتاح حجازي - و رامي فارس
االلتهاب المزمن يعد من االسباب المؤدية لحدوث وتقدم سرطان الثدي. البروتين التفاعلي (CRP) وبروتين األميلويد في الدم (SAA)يمكن استخدامهما كمقياس لدرجة االلتهاب المزمن. تهدف هذI الدراسة الى إمكانية استخدام CRP وSAA كمقياس
لدرجة تقدم سرطان الثدي. تم فى هذI الدراسة قياس مستوى CRP و SAA في الدم في 181 مريضة (78-24 سنة) مصابة بسرطان الثدي و 60 من اإلناث الطبيعيه كمجموعة ضابطة (67-33سنة) باستخدام طريقة االياليزا (ELISA) النتائج :
كانت مستويات CRP أعلى في المرضى الذى لديهم سرطان الثدي وكذلك المرضى اصحاب االورام الحميدة فى الثدى من المجموعة الضابطة ولكن مع عدم وجود فروق ذات داللة إحصائية بين المجموعات المصابة (P <0.001) وكانت مستويات P) أعلى إحصائيا في المرضى اصحاب سرطان الثدي من المرضى اصحاب االورام الحميدة والمجموعة الضابطة SAA
0.001>)، ولكن لم يكن هناك فروق ذات داللة إحصائية في مستوياته بين المرضى اصحاب االورام الحميدة والمجموعة
الضابطة (P = 0.57). أظهرت مستويات بروتين سي التفاعلي CRP)) انه ال يوجد فرق احصائي كبير بين المرضى ذوى االورام الحميدة فى الثدىوى و المرضى ذوى سرطان الثدى مرحلة اولى I (P = 0.97). كما اثبتت الدراسة ان هناك عالقة ايجابية طردية احصائيا بين تراكيزات SAA و CRP مع مراحل الورم المختلفة [(ص = P <0.001 ،0.861) و (ص = P <0.001 ،0.680)] على التوالي ومع بعضها البعض (ص = P <0.001 ،0.628). الخالصة: يمكن استخدام كال من
. CRP اكثر من SAA كمؤشرلدرجة تقدم سرطان الثدى خاصة CRP و SAA
EXPRESSION OF CD69 IN CHRONIC LYMPHOCYTIC LEUKEMIA; RELATION TO PROGNOSIS AND DISEASE PROGRESSION
Mahira I Elmougy* and Ghada M Elgohary**
ABSTRACT
Background: Chronic lymphocytic leukemia (CLL) is a disease characterized by extensive clinical heterogeneity despite a
common diagnostic immunophenotype. CD69 is an integral membrane protein that is expressed in CLL as an early activation
marker. Aim of the work: to evaluate the expression of CD69 in CLL and correlate it with clinical and cytogenetic prognos-
tic markers. Subjects and Methods: the present work was carried on 55 patients diagnosed as CLL in Ain Shams University
Hospitals, 20 hematological matched age and sex normal subjects served as control group. Expression of CD69 was detected
by flow cytometric immunophenotyping. Results: Regarding CD69 expression, there was a significant difference in expression
between patients and control group. 40 patients (73%) out of 55 had positive CD69 expression (≥30%) while 15 patients (27%)
had negative CD69 expression (<30%). Comparative study between positive versus negative expression groups of patients
revealed a significant difference in expression as regarding hemoglobin level, LDH level, CD38 expression, β2 microglobulin
level, advanced disease stage as well as immunoglobulin heavy chain gene mutation. CD69 was significantly associated with
splenomegaly, advanced disease stage, absence of immunoglobulin heavy chain gene mutation as well as increased β2 micro-
globulin level, high CD38 expression and low hemoglobin level. Patients with positive CD69 expression had a significantly
shorter progression free survival than those with negative CD69 expression. Conclusion: CD69 could be considered as a novel
independent prognostic marker which is significantly correlated with poor clinical and biological factors in B-CLL as well as
disease progression. In addition, antiCD69 could be a suitable target for immunotherapeutic intervention.
Departments of Clinical Pathology*, and Clinical Hematology **, Ain Shams University Hospital
Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 47 - 55
INTRODUCTION
B-cell chronic lymphocytic leukemia (B-
CLL) is a neoplasm of mature-appearing mono-
clonal B-lymphocytes, it is an incurable disease
characterized by extensive clinical heterogenec-
ity despite a common diagnostic immunophe-
notype (Small mature B cells display CD19+,
CD20+, CD5+, CD23 markers)(32).
Whether defects in the apoptotic pathway
are frequently encountered in a variety of can-
cers, B-CLL represents a paradigm of the tumors
that arise as a consequence of alterations in the
processes leading to programmed cell death(14).
Indeed, B-CLL cells display multiple intrinsic
defects in their apoptotic machinery and dysreg-
ulated production of survival signals from their
microenvironment(4).
The clinical course of patients with B-CLL is
quite variable(33) and the two major clinical stag-
ing systems are unable to prospectively discrimi-
nate an indolent or aggressive course within the
low and intermediate risk categories(1,25). For this
reason, several biological parameters have been
added to the staging systems to differentiate
prognostic subsets (8,9,12,17,22,27).
CD69, also known as activation inducer
molecule (AIM), early activation antigen (EA-
1), is a type II integral membrane protein with
an extracellular C-type lectin domain. CD69 is
not detectable on normal peripheral blood lym-
phocytes, but cell surface expression is upregu-
lated in response to a wide variety of stimuli(20).
CD69 is constitutively expressed on monocytes,
platelets, Langerhans cells and a small percent-
age of resident lymphocytes in the thymus. In
addition CD69 expression is induced very early
upon activation of T and B lymphocytes, NK
cells, macrophages, neutrophils(23). Activation-
induced CD69 expression precedes the expres-
sion of other cell activation markers, such as
CD25(26). Therefore CD69 represents the first
cell surface glycoprotein detected after lympho-
cytes activation. Therefore, the aim of this study
is to investigate the potential merit of detection
of CD69 expression by flowcytometry in B-CLL
as an early activation marker and to correlate it
with other biological and cytogenetic parameters
as well as its independent prognostic value on
disease progression.
El- Mougy, M. & El Gohary,G.M.48
SUBJECTS AND METHODS
Subjects:
The present study was conducted on 55 newly
diagnosed B-CLL patients; who attended to Ain
Shams University Hospitals, during the period
from February 2012 till February 2013. Patients
were 36 males and 19 females with a male to
female ratio of 1.9: 1. Their ages ranged from 53
- 71 years, with a mean of 62±12.73 years. In ad-
dition, twenty hematologically matched age and
sex normal subjects were included as a control
group which included 14 males and 6 females
with a male to female ratio 2.3:1, their ages
ranged from 52-69, with a mean of 60.5±12.02
years. A written consent was obtained from each
patients and control before participation in the
study. Patients were followed up for 30 months.
Methods:
All the patients were subjected to the follow-
ing:
I- Full history and thorough clinical examina-
tion, laying stress on lymphadenopathy, spleno-
megaly and hepatomegaly, Rai staging according
to disease burden and the degree of bone marrow
involvement. II- Abdominal ultrasonography for
spleen, liver and lymph node enlargement.
II- Laboratory investigations: 1- Complete
blood count (CBC) with examination of periph-
eral blood (PB) smears stained with Leishman
stain for lymphocyte count and morphology
(done for both patients and control). 2- Bone
marrow (BM) examination with morphological
examination of Leishman stained smears laying
stress on BM lymphocytes %, 3- immunopheno-
typing (IPT) of bone marrow or whole peripheral
blood using Coulter EPICS-XL flow cytometer,
USA. The following panel of monoclonal anti-
bodies was used: (CD20, CD79b, FMC7, s.IgM,
CD5/CD19, CD10, CD103, CD123, CD23 and
CD38) as well as κ and λ light chains labeled
with either fluorescin isothiocyanate (FITC) or
phycoerythrin (PE). Samples were considered
positive for a marker if ≥ 20% of cells expressed
that marker; except for CD38 positivity which
was considered ≥ 30%, 4- IgVH mutation anal-
ysis by real time polymerase chain reaction 5-
measurement of CD69 expression by flow cy-
tometry using Coulter EPICS-XL, USA (done
for both patients and control).
Sampling:
Two ml peripheral blood were collected
on ethylene diamine tetraacetic “EDTA” (1-2
mg/ml) as an anticoagulant,for complete blood
count (CBC) and Leishman stained smears. One
mL bone marrow or peripheral blood (collected
on EDTA) was used for immunophenotyping
and detection of CD69 expression. For chemical
analysis clotted samples were obtained.
Methods
Surface marker analysis was done on
lysed whole peripheral blood or bone marrow
samples using the following monoclonal antibod-
ies: CD20, CD79b, FMC7, s.IgM, CD5/CD19,
CD10, CD103, CD123, CD23 and CD38) and
Kappa/Lambda light chains as well as CD69.
They were fluorescein isothiocynate (FITC) or
phycoerythrin (PE) labeled supplied by coulter
electronics. Negative isotypic control for deter-
mining the non-specific binding of the MoAbs.
Interpretation:
Positivity threshold for CD69 was defined
as expression of ≥ 30 % of lymphocytes for the
marker(7).
Statistical Analysis:
The processing of data was computed using
SPSS (version 15) IBM compatible PC. Data
were described in the form of number, percentage,
range and median. Student-t test was used to com-
pare two groups regarding quantitative variables.
Receiver operating characteristic (ROC) curve
was used to determine the best cut-off value. Pro-
gression-free survival (PFS) was calculated from
the date of diagnosis to the date of progression(15).
PFS curves were calculated by the Kaplan-Meier
method and comparison between groups was per-
formed by the Log rank test. P values of ≤ 0.05
and ≤ 0.01 were considered significant and highly
significant respectively, in all analyses.
RESULTS
The clinical and laboratory characteristics of
patients are listed in table (1)
Expression of CD69:
Expression Of CD69 in CLL; Relation To Prognosis 49
CD69 was expressed in all B-CLL patients
with a percentage of expression ranged from 4
– 86% with a mean of 44.5±17.5%, in the control
group CD69% expression ranged from 1% - 3%
with a mean of 2.0±1.0% revealing a highly sig-
nificant difference between patients and control
groups (P < 0.001).
A cut off value at 30% was established to
allow the most significant separation and dif-
ferentiation between B-CLL cases with positive
and negative expression. According to this cut
off value, 40 cases (73%) were ≥ 30% for CD69
expression and 15 cases (27%) were < 30% for
CD69 expression.
Comparative study between patients with
positive versus negative CD69 expression:
(Table 2)
A significant difference was detected between
both groups (positive versus negative expression
groups) regarding hemoglobin level (P< 0.001),
LDH level (P= 0.001), CD38% expression (P=
0.022), β2M (P= 0.002), advanced disease stage
(P< 0.001), level as well as IgVH mutation (P<
0.001) while no significant difference could be
detected between both groups regarding other
clinical and laboratory parameters.
Correlation between CD69 expression and
laboratory data among patients (Table 3)
A highly significant positive correlation was
detected between CD69 expression and each of
β2 microglobulin (P=0.013) and CD38 expres-
sion (P= 0.033).
On the other hand, a significantly inverse
correlation was detected between CD69 and Hb
level (p= 0.004).
Relation between CD69 expression and
clinical data as well as Rai stage and IgVH
mutation among patients (Table 4)
A significant relation was detected between
CD69 expression and each of splenomegaly, ad-
vanced Rai stage and absence of IgVH mutation
(P= < 0.001, < 0.001, < 0.001, respectively).
Relation between CD69 expression and
disease progression
Kaplan Meier survival analysis revealed that
patients with positive CD69 expression had a
significantly shorter progression free survival
(PFS) than those with negative CD69 expression
(Log rank 38.860; P< 0.001) (Figure 1).
Combination analysis of CD69 expression
with tumor burden markers (β2M and Rai stage)
revealed that cases with high tumor burden
(β2M > 2 mg/dl, Rai stage III-IV) and negative
CD69 expression had significantly longer PFS
compared to those with high tumor burden and
positive CD69 expression (Log rank 16.728, P<
0.001) (Figure 2).
Table (1): Clinical and laboratory characteristics of studied group of patients
Number of patients 55
Age (years) (53-71), median 60
Males, n(%) 36(65%)
Splenomegaly, n(%) 32(58%)
Lymphadenopathy, n(%) 20(36%)
Hemoglobin (g/dl) 11.095±1.76
Total leucocytic count TLC(x109/L) 90.65±25.5
Platelet count (x109/L) 196.7±56.55
Absolute peripheral blood lymphocyte count (x109/L) 55.975±20.375
Β2-microglobulin (β2M) (mg/dl) 3.725±2.15
Lactate dehydrogenase (LDH) (Iu/L) 401.95±253.15
CD38% 50.05±24.75
IGVH mutation 17(31%)
Rai stage (III-IV) 33(60%)
El- Mougy, M. & El Gohary,G.M.50
Table (2): Comparison between patients with positive versus negative CD69 expression regarding clinical
and laboratory data
ParameterNegative CD69
n = 15
Positive CD69
N = 40
Independent t-test
t p-value
Hemoglobin (g/dl)
Mean±SD12.72±2.60 9.47±0.92 6.917 <0.001
TLC (x109/L)
Mean±SD83.80±20.5 97.5±30.5 1.604 0.115
Platelet count (x109/L)
Mean±SD192.6±54.6 200.8±58.5 0.471 0.639
Peripheral bl. Lymphocyte count (x109/L)
Mean±SD57.56±21.15 54.39±19.6 0.523 0.603
LDH (Iu/L)
Mean±SD271.9±256.3 532±250 3.413 0.001
CD 23%
Mean±SD72.5±16.4 69.3±19.5 0.564 0.575
CD38%
Mean±SD41.6±27.2 58.5±22.3 2.356 0.022
β2M (mg/dl)
Mean±SD2.3 ± 1.1 5.15 ± 3.2 3.359 0.002
Rai stage
I
II
III
IV
12 (80.0%)
2 (13.33%)
1 (6.67%)
0 (0.0%)
0 (0.0%)
8 (20.0%)
20 (50.0%)
12 (30.0%)
42.132 < 0.001
IgVH mutation
Present
Absent
12 (80.0%)
3 (20.0%)
5 (12.5%)
35 (87.5%)23.275 < 0.001
Table (3): Correlation between CD69 expression and laboratory data among patients
ParameterCD69 expression
R P value
TLC (x109/L) 0.054 0.609
Hemoglobin (g/dl) -0.559 0.004
Platelet count (x109/L) 0.244 0.316
Peripheral bl. Lymph (x109/L) 0.211 0.311
β2M (mg/dl) 0.491 0.013
CD23 0.391 0.53
CD38 0.428 0.033
Table (4): Relation between CD69 expression and clinical data as well as Rai stage and IgVH mutation
among patients
Variable No.% of CD69(Mean±SD)
T-test P-value
Splenomegaly
27.810 <0.001Negative 23 18±5.4
Positive 32 69±7.5
Lymphadenopathy
1.624 0.110Negative 35 42±6.9
Positive 20 45±6
Rai stage
21.669 <0.001I, II 22 22±4.3
III, IV 33 65±8.6
IgVH mutation
26.854 <0.001Negative 38 69±6.6
Positive 17 18±6.3
Expression Of CD69 in CLL; Relation To Prognosis 51
Median SE Log rank P-value
Negative CD69 24.0 0.938.860 < 0.001
Positive CD69 10.0 0.3
Fig. (1): Kaplan Meier survival curve showing PFS of CD69 (positive and negative expression)
Median SE Log rank P-value
Negative CD69 18.00 1.8916.728 < 0.001
Positive CD69 9.00 0.38
Fig. (2): Kaplan Meier survival curve showing PFS of CD69 (positive and negative expression) in combina-
tion with tumor burden markers (β2M and Rai stage)
El- Mougy, M. & El Gohary,G.M.52
DISCUSSION
In the present work, regarding CD69 expres-
sion, the threshold of positivity was set at 30%
to identify patients with positive and negative
CD69 expression. Mean CD69% was signifi-
cantly higher in B-CLL patients compared to the
control group. This comes in accordance with a
study done by. Del Poeta et al.(7) who stated that
the optimal cut off for CD69 expression yielding
the best separation of CLL patients into 2 sub-
sets with significantly different prognosis was
fixed at 30% of positive cells (3,7,12,19). The same
comes in accordance with Gattei et al.(12). Krober
et al.(19) and Bomben et al. (3).
In our study 40(73%) patients out of 55 pa-
tients had CD69% expression ≥ 30% and were
identified to have a positive expression, while 15
(27%) patients had < 30% CD69 expression and
were identified as negative expression group.
Similarly, Smilveska et al.(30) showed that
64.3% of their CLL cases were CD69 positive.
In this work, comparative study between
patients with negative versus positive CD69
expression revealed a significant difference de-
tected among them regarding hemoglobin level,
LDH level, CD38 expression, β2M level, IgVH
mutation as well as advanced disease stage. As
patients with positive CD69 expression were as-
sociated with a lower hemoglobin, higher LDH,
β2M levels, CD38 expression, absence of IgVH
mutation as well as advanced disease stage com-
pared to those with negative CD69 expression.
While no significant difference could be detected
regarding other parameters.
Damle et al.(5) and Smilevska et al.(30) stated
in their studies that advanced disease stage is
significantly associated with positive CD69 ex-
pression.
In our study, a highly significant association
was detected between CD69 expression and sple-
nomegaly. This comes in accordance with Del
Poeta et al. (7) who found that CD69 expression is
significantly associated with spelnomegaly.
Also, significant association was detected be-
tween CD69 expression and each of CD38 ex-
pression and unmutated IGVH, this was similarly
detected by Del Poeta et al. (7) who reported that
CD69 expression was significantly related with
CD38, CD49d, ZAP-70 and unmutated IgVH.
In our work, the significant association be-
tween positive CD69 expression and many of
the poor clinical and biological standard prog-
nostic factors as splenomegaly, high CD38 ex-
pression increased β2M level, advanced disease
stage, low Hb level as well as unmutated IgVH
strongly suggests its beneficial utility as an in-
dependent poor prognostic factor in B-CLL. In
agreement with our work, Grund et al.(13) showed
in their study that negative CD69 expression was
associated with mutated IgVH. The concordance
between CD69 positivity and mutation status
was 96%, since it is well known that patients
with unmutated IgVH genes have a worst prog-
nosis and decreased survival compared to those
with mutated IgVH genes.
Herishanu et al. (16) and Walsby et al.(31) stated
that CD69 has been found to be stronger predictor
of CLL prognosis. In our study, patients with pos-
itive CD69 expression had a significantly shorter
PFS than those with negative CD69 expression,
this was in agreement with Del Poeta et al.(7)
who demonstrated that CD69 expression was an
independent risk factor for PFS and OS in their
large series of CLL patients. CD69 was found to
be upregulated on cells in the tissue microenivo-
ronment, both in bone marrow (BM) and lymph
nodes (LN). Interestingly, stronger upregulation
of CD69 was also found in LN-resident com-
pared with BM-resident CLL cells and LN-de-
rived cells showed an increase in BCR signature
genes compared with those from the BM and the
P.B(16). Moreover, because CD69 is involved in
retaining lymphocytes at the site of stimulation (18,28,29), the levels of this molecule on circulating
B-CLL cells might be less than those in the solid
tissue (BM and LN) and, therefore, might indi-
cate that B-CLL cells expressing CD69 are recent
emigrants from such sites. Tumor proliferation,
quantified by the expression of E2F and c-MYC
target genes and verified with Ki67 staining by
flow cytometry was highest in the LN and was
correlated with clinical disease progression (6).
Thus CD69 appear to offer an easy to perform
and reliable marker both of progression and poor
Expression Of CD69 in CLL; Relation To Prognosis 53
outcome in CLL. In the present work, combined
analysis of CD69 expression with tumor burden
markers (β2M and Rai stage) revealed that cases
with high tumor burden (β2M > 2 mg/dl, Rai
stage III-IV) and negative CD69 expression had
significantly longer PFS compared to those with
high tumor burden and positive CD69 expres-
sion (Log rank 16.728, P< 0.001). This comes in
agreement with Del Poeta et al.(7) who had done
a multivariate analysis of PFS and OS, in which
entered Rai stages, ZAP-70 beta-2 microglobu-
lin, CD38 and CD69 resulted to be independent
prognostic factors.
Interestingly, Gattei et al.(12) made a combined
analysis of CD69 with CD38 or CD49d or ZAP
-70 where they demonstrated that CD69 expres-
sion had true additive properties, allowing us
to identify CLL subsets (CD69-CD38-;CD69-
CD49d-, CD69-ZAP-70; CD69-M IgVH) pre-
senting a very good outcome with regard to PFS
and OS. Conversely, double positive (CD69+
CD38+, CD69+ CD49d+, CD69+ ZAP- 70+
subsets) and CD69 positive UM IgVH patients
showed the worst outcome. Moreover, CD69
was also necessary to correctly prognosticate the
active/progressive disease status than CD38 and
ZAP-70. Furthermore, they stated that CD69 is
easily analyzed with flow cytometry and well
suited for routine analysis.
Significant progress is being made in aug-
menting specific immune effector functions in
experimental tumor therapy, particularly using
monoclonal antibodies (mAbs)(24).
Mechanisms of NK-cell cytotoxicity activation
by costimulatory molecules have been described
and new studies reveal novel roles for regulatory
molecules on NK cells. Similarly, mAb CD69
promotes NK cytolytic activity in the presence or
absence of the tumor microenvironment. Conse-
quently, in vivo treatment with anti-CD69 mAbs,
in either preventative or therapeutic settings, is
efficient in promoting NK-cell-dependent tumor
elimination. Importantly, this occurs in the face of
significant levels of TGF-β made by the tumors
themselves (21).
Furthermore, CD69 targeting by a non-de-
pleting anti-CD69 antibody similarly increases
anti-tumor responses by enhancing NK cell ac-
tivity, and treatment of NK cells with this anti-
body results in increased cytotoxic activity and
IFN-γ production, CD69 thus regulates anti-tu-
mor immune responses by modulating the ex-
pression of various cytokines, including TGF-β
and IFN-γ (11).
In conclusion, CD69 is significantly correlat-
ed with poor clinical and biological factors in B-
CLL as well as disease progression which could
be considered as a novel independent prognostic
marker determined by flowcytometry. This sup-
ports its utility in routine laboratory assessment
and, possibly, in a prognostic scoring system for
B-CLL. Moreover, anti-CD69 could be a suit-
able target for immunotherapeutic intervention.
REFERENCES1. Binet, J. L., Auquier, A., Dighiero, G., et al. (1981). A
new prognostic classification of chronic lymphocytic
leukemia derived from a multivariate survival analysis.
Cancer 48, 198.
2. Binet, J. L., Lepoprier, M., Dighiero, G., et al. (1977).
A clinical staging system for chronic lymphocytic leu-
kemia: prognostic significance. Cancer 40, 855.
3. Bomben, R., Dal Bo, M., Zucchetto, A., et al. (2005).
Mutational status of IgV(H) genes in B-cell chronic
lymphocytic leukemia and prognosis: percent muta-
tions or antigen-driven selection? Leukemia 19, 1490.
4. Burger, J. A. (2011). Nurture versus nature: the micro-
environment in chronic lymphocytic leukemia. Hema-
tology Am Soc Hematol Educ Program, 96-103.
5. Damle, R. N., Ghiotto, F., Valetto, A., et al. (2002). B-
cell chronic lymphocytic leukemia cells express a sur-
face membrane phenotype of activated, antigen-experi-
enced B lymphocytes. Blood 99, 4087.
6. Damle, R. N., Temburni, S., Calissano, C., et al. (2007).
CD38 expression labels an activated subset within
chronic lymphocytic leukemia clones enriched in pro-
liferating B cells. Blood 110, 3352.
7. Del Poeta G, D. P. M., Zucchetto A, Buccisano F, et al.
(2010). CD69 and CD79B overexpression identity poor
risk chronic lymphocytic leukemia. (Haematologica,)
95(suppl 2):317.
8. Del Poeta, G., Maurillo, L., Venditti, A., et al. (2001).
Clinical significance of CD38 expression in chronic
lymphocytic leukemia. Blood 98, 2633.
9. Dohner, H., Stilgenbauer, S., Benner, A., et al. (2000).
Genomic aberrations and survival in chronic lympho-
cytic leukemia. N Engl J Med 343, 1910.
10. Dohner, H., and Stilgenbauer, S. (2002). V(H) mutation
status, CD38 expression level, genomic aberrations,
and survival in chronic lymphocytic leukemia. Blood
100, 1410.
El- Mougy, M. & El Gohary,G.M.54
11. Esplugues, E., Vega-Ramos, J., Cartoixa, D., et al.
(2005). Induction of tumor NK-cell immunity by anti-
CD69 antibody therapy. Blood 105, 4399.
12. Gattei, V., Bulian, P., Del Principe, M. I., et al. (2008).
Relevance of CD49d protein expression as overall sur-
vival and progressive disease prognosticator in chronic
lymphocytic leukemia. Blood 111, 865.
13. Grund Sofia, B. O., Margareta Jernas, Stefan Jacobsson
et al (2010). CD69 is a good surrogate marker for IgVH
gene mutation status in Swedish chronic lymphocytic
leukemia (CLL) patients. Acta Haematologica Polonica
41, 57.
14. Haiat, S., Billard, C., Quiney, C., et al. (2006). Role
of BAFF and APRIL in human B-cell chronic lympho-
cytic leukaemia. Immunology 118, 281.
15. Hallek, M., Cheson, B. D., Catovsky, D., et al. (2008).
Guidelines for the diagnosis and treatment of chronic
lymphocytic leukemia: a report from the International
Workshop on Chronic Lymphocytic Leukemia updat-
ing the National Cancer Institute-Working Group 1996
guidelines. Blood 111, 5446.
16. Herishanu, Y., Perez-Galan, P., Liu, D., et al. (2011).
The lymph node microenvironment promotes B-cell
receptor signaling, NF-kappaB activation, and tumor
proliferation in chronic lymphocytic leukemia. Blood
117, 563.
17. Keating MJ, L. S., Kantarjian H, Freireich EJ, et al.
(1995). The serum β2-microglobulin level is more
powerful than stage in predicting response and survival
in chronic lymphocytic leukemia. Paper presented at:
Blood.,86 Abstract 606
18. Kishimoto, T. K., Jutila, M. A., and Butcher, E. C.
(1990). Identification of a human peripheral lymph
node homing receptor: a rapidly down-regulated adhe-
sion molecule. Proc Natl Acad Sci U S A 87, 2244.
19. Krober A, Seller T, Benner A, et al. (2002): V(H) muta-
tion status, CD38 expression level, genomic aberrations,
and survival in chronic lymphocytic leukemia. Blood,
100(4):1410.
20. Lauzurica, P., Sancho, D., Torres, M., et al. (2000). Phe-
notypic and functional characteristics of hematopoietic
cell lineages in CD69-deficient mice. Blood 95, 2312.
21. Lee, K. M., McNerney, M. E., Stepp, S. E., et al. (2004).
2B4 acts as a non-major histocompatibility complex
binding inhibitory receptor on mouse natural killer
cells. J Exp Med 199, 1245.
22. Montserrat, E., Sanchez-Bisono, J., Vinolas, N., et al.
(1986). Lymphocyte doubling time in chronic lympho-
cytic leukaemia: analysis of its prognostic significance.
Br J Haematol 62, 567.
23. Murata, K., Inami, M., Hasegawa, A., et al. (2003).
CD69-null mice protected from arthritis induced with
anti-type II collagen antibodies. Int Immunol 15, 987.
24. Ostrand-Rosenberg, S. (2004). Animal models of tumor
immunity, immunotherapy and cancer vaccines. Curr
Opin Immunol 16, 143.
25. Rai, K. (1987). A critical analysis of staging in CLL.
Chronic Lymphocytic Leukemia, Vol vol 59., (New
York, NY: Liss: UCLA Symposium and Cellular Biol-
ogy New Series).
26. Reddy, M., Eirikis, E., Davis, C., et al. (2004). Compar-
ative analysis of lymphocyte activation marker expres-
sion and cytokine secretion profile in stimulated human
peripheral blood mononuclear cell cultures: an in vitro
model to monitor cellular immune function. J Immunol
Methods 293, 127.
27. Sarfati, M., Chevret, S., Chastang, C., et al. (1996).
Prognostic importance of serum soluble CD23 level in
chronic lymphocytic leukemia. Blood 88, 4259.
28. Shiow, L. R., Rosen, D. B., Brdickova, N., et al..
(2006). CD69 acts downstream of interferon-alpha/beta
to inhibit S1P1 and lymphocyte egress from lymphoid
organs. Nature 440, 540.
29. Simms, P. E., and Ellis, T. M. (1996). Utility of flow
cytometric detection of CD69 expression as a rapid
method for determining poly- and oligoclonal lympho-
cyte activation. Clin Diagn Lab Immunol 3, 301.
30. Smilevska, T., Stamatopoulos, K., Samara, M., et al.
(2006). Transferrin receptor-1 and 2 expression in
chronic lymphocytic leukemia. Leuk Res 30, 183.
31. Walsby, E., Buggins, A., Devereux, S., et al. (2013).
Development and characterization of a physiologically
relevant model of lymphocyte migration in chronic
lymphocytic leukemia. Blood 123, 3607.
32. Wang, L., Lawrence, M. S., Wan, Y., et al. (2011).
SF3B1 and other novel cancer genes in chronic lym-
phocytic leukemia. N Engl J Med 365, 2497.
33. Zwiebel, J. A., and Cheson, B. D. (1998). Chronic
lymphocytic leukemia: staging and prognostic factors.
Semin Oncol 25, 42.
Expression Of CD69 in CLL; Relation To Prognosis 55
ظهور بروتين فى سرطان الدم الليمفاوى المزمن وعالقته بالتنبو بمسار و تقدم المرض مهير@ الموجى - غاد@ الجوهرى
يعتبر سرطان الدم اليمفاوى المزمن احد االمراض التى تتميز بمجموعه متجانسه من الخصائص االكلينيكيه على الرغم من اشتراكها جميعا فى نمط ظاهرى مناعى واحد عند التشخيص ويعد CD69 احد البروتينات الغشائيه المتكامله ويظهر فى حاالت سرطان الدم اليمغاوى المزمن بمثابه عالمه تنشيط مبكرT الهدف من الدراسه : تم اجراء الدراسه بهدف تقيم ظهور الخلويه والوراثيه االكلينيكيه التنبؤ بعالمات ذلك وربط CLL المزمن الليمفاوي الدم سرطان جاالت بروتين CD69في الحاالت وطرق البحث : تم اجراء الدراسه الحاليه علي 55 مريض ممن اكد التشخيص اصابتهم بسرطان الدم الليمفاوي والنوع العمر في المتوافقين االصحاء االشخاص من اخرين 20 الي ,باالضافه شمس عين جامعه بمستشفيات المزمن
كمجموعه ضابطه . وتم الكشف عن ظهور بروتينCD69 بواسطه النمط الظاهري للتدفق الخلوي المناعي .النتائج :كشفت الدراسه عن ظهور بروتين CD69 في جميع مرضي سرطان الدم الليمفاوي المزمن , وكان هناك اختالف كبير في درجه الظهور بين المرضي والمجموعه الضابطه . حيث كانت نسبه الظهور بروتين CD69 مرتفعه (≤ من 30% CD69>) لدي 40 مريضا من بين 55 مريضا (%73) في حين اظهر 15 مريضا (%27 ) انخفاض في نسبه ظهور%30) . وكشفت المقارنه بين مجموعتي الظهور المنخفض والمرتفع اختالفا كبيرا في مستوي الظهور فيما يتعلق بمستوي
الهيموجلبين ومستوي انزيم نازعه الهيدروجين(LDH ) وبروتين CD38 ومستوي الميكروجلوبولين β2ومرحله تقدم CD69 بروتين بين موجبا ارتباطا الدراسه واظهرت . السلسله ثقيل المناعي للجلوبولين الجينيه Tالطفر وكذلك المرض وبين تضخم الطحال , ومستويβ2 الميكروجلوبولين وظهور بروتين CD38 فضال عن المرحله المتقدمه للمرض ,في حين كان هناك ارتباط عكسي مع مستوي الهيموجلوبين وكذلك التحور او الطفرT الجينيه للجلوبولين المناعي ثقيل السلسله .واظهرت الدراسه قصر فترT البقاء علي قيد الحياT مع عدم تقدم المرض لدي المرضي الذين يعانون من ارتفاع ظهور بروتين
عن غيرهم . الخالصه :يمكن اعتبار بروتين CD69 عالمه تنبؤيه مستقله جديدT والتي ترتبط بشكل كبير مع العوامل االكلينيكيه والبيولوجيه السيئه في حاالت سرطان الدم الليمفاوي بي B-CLL)) فضال عن تطور المرض وباالضافه الي
ذلك , يمكن ان اعتبار مضادات بروتين CD69هدقا مناسبا للتدخل بالعالج المناعي
COMBINED ANALYSIS OF LEVELS OF SERUM B-CELL ACTIVATING FACTOR AND A PROLIFERATION INDUCING LIGAND IN B-CELL
CHRONIC LYMPHOCYTIC LEUKEMIA; CORRELATION WITH CLINICAL FEATURES AND DISEASE PROGRESSION
Mahira I Elmougy* and Ghada M. Elgohary**
ABSTRACT Background: B-cell activating factor (BAFF) and a proliferation inducing ligand (APRIL) are involved in normal B-cell
survival and differentiation. Aim of the work: to evaluate the role of BAFF and APRIL in B-CLL and their prognostic relevance.
Subjects and Methods: 50 patients diagnosed as CLL and 30 age and sex-matched healthy controls were enrolled into this study
for assessment of serum BAFF and APRIL levels by enzyme linked Immunosorbent assay (ELISA). Results: In CLL-patients,
median serum BAFF level was significantly lower than in healthy controls, whereas serum APRIL was significantly higher than
in healthy controls. BAFF was significantly correlated to platelet count, CD5 expression, peripheral blood lymphocyte count
and bone marrow infiltration. Moreover BAFF level was significantly lower in patients with stage C Binet staging system than
those in group B and group A. APRIL serum level was significantly correlated with CD38 expression as well as advanced clini-
cal stage. Combined analysis of BAFF and APRIL serum levels emerged as an independent predictor of disease progression.
Conclusion: Our results suggest that the combined analysis of serum BAFF and APRIL seems to be a reliable predictor of B-
CLL, and highlights its importance in identifying patients at a higher risk of progression.
Departments of Clinical Pathology* and Clinical Hematology**, Internal Medicine, Ain shams University
Hospital
Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 57 - 64
INTRODUCTION
Chronic lymphocytic leukemia (CLL) is
characterized by the progressive accumulation
of monoclonal B-cells with a distinctive im-
munophenotype (i.e. CD5+ CD19+, CD20 dim,
CD23+, sm Ig dim) in peripheral blood, bone
marrow, and the lymphoid tissues(14). This accu-
mulation is mainly due to a defective regulation
of programmed cell death(5). CLL cells express
high levels of antiapoptotic proteins such as Bcl-
2 and Bcl-xL(28). However, CLL cells undergo
spontaneous apoptosis in vitro, which reflects
the requirement of external factors (i.e. micro-
environment signals for survival of the CLL
clone(6).
Currently, most patients with CLL are diag-
nosed in early, stable phases of their disease, but
all of them eventually progress. Factors that pre-
dict disease progression not only are clinically
useful but also pinpoint biological mechanisms
that underlie the disease process and which may
be amenable to therapeutic intervention.
BAFF (B cell activating factor of the TNF fam-
ily) /BlyS (B lymphocyte stimulator) and APRIL
(a proliferation-inducing ligand) belong to the
TNF ligand superfamily and share several biolog-
ical characteristics and functions (2,18). Both BAFF
and APRIL bind with high affinity two members
of TNF-receptor superfamily), BCMA (B-cell
maturation antigen) and TACI (Transmembrane
activator and calcium modulator and cyclophilin
ligand interactor), BAFF, but not APRIL, inter-
acts with the third receptors named BAFF recep-
tor (BAFF-R/BR3)(30). BAFF, APRIL and their
receptors are crucial for the survival of normal B
lymphocytes. Both factors play an important role
in the control of their maturation and differentia-
tion into Ig-secreting cells. Defects in the synthe-
sis of these molecules or expression of their re-
ceptors have been associated with various B cell
malignancies (18,30). BAFF and APRIL were found
to protect B-CLL cells from spontaneous and
drug-induced apoptosis and to enhance cell sur-
vival (16). These findings suggest that BAFF and
APRIL may be involved in the pathogenesis of
B-cell chronic lymphocytic leukemia (B-CLL).
The aim of our study was to investigate the
role of BAFF and APRIL in the pathogenesis and
prognosis of B-CLL by assessment of correlation
between their expression and clinical and labora-
tory parameters.
Elmougy, M. I & Elgohary G.M.58
Moreover, we have been interested to study
the relationship between BAFF, APRIL and some
prognostic factors as CD38 expression which is
a known poor prognostic factor in B-CLL(7).
SUBJECTS AND METHODS
Fifty patients with B-CLL attending the clini-
cal hematology and oncology unit, Ain Shams
University Hospital, from August 2011 to Febru-
ary 2013, and 30 age- and sex matched healthy
controls were enrolled into this study. Patients
included 32 males and 18 females, with a male to
female ratio of 1.8:1. Their median age at diagno-
sis was 71 years (range 55-86 years). The control
group included 18 males and 12 females (ratio,
1.5:1) with a median age of 65 years (range 51-
79 years). A written consent was obtained from
each patient and control before participation in
the study. All patients were subjected to :
i) Full history and physical examination.
ii) Complete blood count.
iii) Laboratory investigations including blood
urea nitrogen and uric acid.
iv) Pelvi-abdominal ultrasound.
v) Immunophenotyping using flowcytom-
etry.
vi) Bone marrow aspiration and examina-
tion.
vii) Measurement of circulating BAFF and
APRIL serum levels using quantitative ELISA
technique.
§ Patients were followed up for 24 months
The staging of B-CLL was based according
to the Binet staging system.
Methods
Sample collection: Peripheral blood and
BM samples were collected on ethylene diamine
tetra-acetic acid (EDTA) (1.2 mg/ml) for mor-
phological and immunophenotypic determina-
tion. For chemical analyses and assessment of
serum BAFF and APRIL levels, clotted samples
were obtained. Serum was isolated and stored at
-20°C till subsequent use in ELISA for BAFF
and APRIL.
BAFF and APRIL serum concentrations by
enzyme linked immunosorbent assay (ELISA):
Serum samples from B-CLL patients and
healthy controls were analyzed by ELISA kit
for human BAFF and APRIL using commercial
ELISA kits: Quanticine human BAFF immuno-
assay (R&D systems) and human APRIL ELISA
(Bender MED systems). According to manufac-
turer’s instructions. Human BAFF or APRIL
specific-specific polyclonal antibodies were pre-
coated onto 96-well plates. The human specific
detection monoclonal antibodies were biotinyl-
ated. The test samples and biotinylated detection
antibodies were added to the wells subsequently
and then followed by washing with PBS or TBS
buffer, Avidin-Biotin-Peroxidase complex was
added and unbound conjugates were washed
away with PBS or TBS buffer and substrate was
added. The colour developed is proportioned to
the amount BAFF or APRIL bound. The reaction
is stopped and the intensity of the yellow color
is measured Spectrophotometrically at a wave
length of 450 nm. The concentration of BAFF
or APRIL in the samples was then determined
Table (1): Binet clinical stage system (15)
Stage Clinical features Overall survival years
ALymphocytosis in peripheral blood and bone marrow and < 3 lymphoid regions involved. No anemia, no thrombocytopenia
12
B
Lymphocytosis in peripheral blood and bone marrow and > 3 lymphoid regions involved. With or without splenomegaly and/or hepatomegalyNo anemia, no thrombocytopenia
7
CLymphocytosis with anemia (hemoglobin level < 11 g/dL in male and < 10 g/dL in female) or thrombocytopenia (platelet count < 100 x 109/L)
2-4
BAFF and APRIL in CLL; Correlation with Disease Progression 59
by comparing the optical density of the samples
to the standard curve. Results are reported in ng/
ml.
Statistical analysis
The processing of data was computed using
SPSS (version 15) IBM compatible PC. Data
were described in the form of number, percent-
age, range and median. Student-t test was used
to compare two groups. Receiver operating char-
acteristic (ROC) curve was used to determine
the best cut-off value. Progression-free survival
(PFS) was calculated from the date of diagnosis
to the date of progression (1). PFS curves were
calculated by the Kaplan-Meier method and
comparison between groups was performed by
the Log rank test. P values of ≤ 0.05 and ≤ 0.01
were considered significant and highly signifi-
cant respectively, in all analyses.
RESULTS
The clinical characteristics of patients with
CLL are listed in table (2).
BAFF and APRIL serum levels (Table 3)
In patients with CLL, the median serum
BAFF level was 1.12 ng/ml (range 0.10-2.16),
significantly lower than in healthy controls [2.95
ng/ml (range 2.5-3.91); P=0.012]. Whereas se-
rum APRIL was significantly higher than in
healthy controls [11.4 ng/ml (4.8-18.5) versus.
6.54 ng/mL (2.1-10.8); P= 0.042]. The receiver
operating characteristics (ROC) curve identi-
fied a cut-off value equal to 2.15 ng/ml and 4.5
ng/mL to categorize patients with low and high
BAFF and APRIL levels, respectively.
Correlation between BAFF and laboratory data among patients (Table 4)
Table (2): Clinical characteristics of studied group of patients with CLL
Number of patients 50Age (years) 71(55-86)Males, n(%) 32(64%)Hepatomegaly, n(%) 39(78%)Splenomegaly, n(%) 41(82%)Lymphadenopathy, n(%) 12(24%)Hemoglobin (g/dL) 10.21±1.4TLC (x109/L) 77.48±80.21Absolute lymphocytic count (x109/L) 41.32±23.51Platelet count (x109/L) 115.31±60.28Binet stage
A
B
C
22(44%)
13(26%)
15(30%)BUN (mg/dl) 15.50±8.21Uric acid (mg/dL) 6.97±0.71
Table (3): BAFF and APRIL serum levels in patients and control groups.
Parameter Patients group Control group P value
BAFF (ng/ml)
0.012Median 1.12 2.95
Range 0.10-2.16 2.5-3.91
APRIL (ng/ml)
0.042Median 11.4 6.54
Range 4.8-18.5 2.1-10.8
Table (4): Correlation between BAFF level and laboratory data among patients
PatientsBAFF
r P valueHemoglobin (g/dl) 0.088 0.600
Total leucocytic count (x109/L) -0.126 0.430Peripheral blood lymphocyte count -0.419 0.009*
Platelet count (x109/L) 0.905 0.035*BM infiltration (%) -0.450 0.021*
CD5% 0.443 0.005*CD23% -0.187 0.370FMC7% -0.340 0.096CD79% 0.280 0.175
BUN (mg/dl) 0.442 0.457Uric acid (mg/dl) .494 0.398
Elmougy, M. I & Elgohary G.M.60
Table (5): Correlation between APRIL level and laboratory data among patients
PatientsAPRIL
r P value
Hemoglobin (g/dl) -0.025 0.0903
Total leucocytic count (x109/L) 0.118 0.366
Peripheral Blood lymphocyte count 0.185 0.366
Platelet count (x109/L) -0.097 0.637
BM infiltration (%) 0.202 0.322
CD5% -0.204 0.319
CD23% 0.154 0.804
FMC7% 0.136 0.508
CD79% -0.208 0.737
CD38% 0.996 <0.001*
Binet staging system (advanced stage) 0.421 0.004*
Fig. (1): Progression-free survival analy-
sis of combined BAFF and APRIL
serum levels.
There was a significant positive correla-
tion between BAFF values and each of platelet
count and CD5 expression (P=0.012 and 0.001
respectively). While there was a significant in-
verse correlation between BAFF values and each
of peripheral blood lymphocyte count and BM
infiltration (p=0.022 and 0.03 respectively). On
the other hand, there was no significant corre-
lation between BAFF and other parameters as
total leucocyte count, hemoglobin level, CD23,
FMC7, CD79, BUN and uric acid.
According to Binet staging system, B-CLL
patients were subdivided into three subgroups
(A,B,C) BAFF level was highly significantly
lower in group C than group B and A as median
was 0.078 in group C, 0.83 in group B and 2.1 in
group A (P=0.005). This reveals that BAFF level
decreased with advanced stages of CLL.
Correlation between APRIL level and lab-oratory data among patients (Table 5)
High serum levels of APRIL were signifi-
cantly correlated with a high CD38 expression
as well as advanced clinical stage (Binet stag-
ing system) (P=0.03, 0.01 respectively). While,
no significant correlation was detected between
APRIL level and other parameters.
The risk of progression was assessed by
combing BAFF and APRIL serum levels, three
different groups were identified: a low risk group
(high BAFF and low APRIL), a high risk group
(low BAFF and high APRIL), and an intermedi-
ate risk group (not fitting the two former catego-
ries).
Survival analysis (Figure 1) revealed that
high risk group patients had a significantly
shorter PFS [median 5.5 months, 95% CI 4.99-
6.01] compared to those of low and intermediate
risk groups [median 17.15, 10.5 months, 95% CI
14.31-19.99 and 8.22-12.78] respectively (Log
rank 65.11; P < 0.001).
BAFF and APRIL in CLL; Correlation with Disease Progression 61
DISCUSSION
Despite homogenicity of B-CLL at the cel-
lular level, it is clinically heterogenous; some
patients survive for a long time without therapy,
while others progress towards more advanced
stages and die despite aggressive treatment (8).
Several reliable prognostic markers were
found to be capable of predicting the progression
and outcome of the disease from its early stages
including age, sex, lymphocyte morphology,
lymphocyte doubling time, serum factors, im-
munophenotyping and cytogenetic finding (21).
In recent years molecular and cellular mark-
ers have helped to predict the prognosis of CLL
patients. A combined panel of FISH probes are
available now and can identify genomic aberra-
tion in approximately 80% of CLL cases using
a 4-probe panel for the detection of deletion of
13q14, 17p13, 11q22-23 and trisomy 12 (31).
Recent years have witnessed increasing inter-
est in BAFF and APRIL as B-cell survival fac-
tors implicated in the pathogenesis of several B-
cell malignancies (10). In CLL, the biological rel-
evance of both molecules has been demonstrated
in vitro studies, which show that the addition of
exogenous BAFF and APRIL protects neoplastic
CLL cells from apoptosis (9,23). Furthermore, ab-
normal BAFF and APRIL serum levels are found
in CLL and other B=cell malignancies (10,27). Not
surprisingly, there is considerable interest in
finding effective ways to target this system as a
new treatment modality in B=cell lymphoprolif-
erative disorders(4,12).
In our study 64% of cases were males and
36% were females, this come in accordance with
data shown by Okaly et al.(25) who found that
males have higher incidence of CLL compared
with females.
The age range at presentation in our study
was 55-86 years, in contrast to Siegl et al. (29) who
found that the higher incidence of CLL was seen
in age range 75-84 years. This variation could
have been due to the smaller number of cases
that were studied or due to the ethnic differences
in epidemiology.
We compared the level of BAFF and APRIL
in patient’s and control’s groups by quantitative
ELISA kits and we found significantly lower
and higher levels of BAFF and APRIL respec-
tively in the sera of B-CLL patients compared to
healthy controls.
This was in accordance with recent obser-
vations of Planelles et al.(26), Haiat et al. (13) and
Kern et al.(16) showing a decrease in circulating
BAFF levels in B-CLL patients in comparison
with healthy subjects. Which could be related
to the absorption of BAFF by CLL cells (20). An-
other study showed elevated BAFF levels only
in patients with familial B-CLL (24).
On the other hand, plasma APRIL levels in B
CLL patients were significantly higher as com-
pared with healthy subjects. Our results were
similar to those of Planelles et al.(26) showing an
increase in circulating APRIL protein concentra-
tion compared with healthy subjects.
BAFF and APRIL are produced in excess
in patients with various B-lymphoid malignan-
cies, either by the leukemic cells themselves or
by cells in their micro environmental or both (17).
BA variety of tumoral B cells from Non-Hod-
jkin’s lymphoma (NHL) were found to express
receptors for BAFF. Comparable levels were de-
tected in B lymphocytes from normal individu-
als and from patients with diffuse large cell lym-
phoma (DLCL), mantle cell lymphoma (MCL)
and marginal zone lymphoma, whereas those
from B-CLL and follicular lymphoma displayed
somewhat lower expression (3).
Regarding BAFF, there was a significant pos-
itive correlation between BAFF values and each
of platelet count and CD5 expression. Bojarska
et al. (1) found a positive correlation between
percentage of CD5 positive B lymphocytes and
BAFF concentration.
In addition there was a significant inverse cor-
relation between BAFF values and each of pe-
ripheral blood lymphocyte count, bone marrow
infiltration and advanced disease stage, which
was in accordance with Ferrer et al. (11).
It was found that among patients with follicu-
lar lymphoma, those with circulating neoplastic
B-cells had lower serum BAFF compared to
those without detectable neoplastic cells in the
peripheral blood. This suggests that serum BAFF
may be a marker of tumor burden (13).
Elmougy, M. I & Elgohary G.M.62
Regarding serum APRIL levels, there was a
significant correlation with high CD38 expression
as well as advanced clinical stage. This is in agree-
ment with Ferrer et al.(11) who found that APRIL
serum levels were significantly increased in those
cases with high CD38 expression. This may reflect
the dependence on CD38 of the cross-talk between
CLL cells and stromal or nurse-like cells which
are an important source of BAFF and APRIL (22).
Previous studies have suggested that either BAFF
or APRIL serum levels correlate with disease pro-
gression and survival (1,19).
The risk of progression was assessed by com-
bining BAFF and APRIL serum levels, three dif-
ferent risk groups were identified. In our study,
survival analysis revealed that high risk group
patients had a significantly shorter PFS compared
to those of low and intermediate risk groups. This
comes in accordance with a study done by Fer-
rer et al.(11) who demonstrated that the combined
analysis of BAFF and APRIL may provide more
accurate predictive information by separating pa-
tients into three risk groups. Thus subjects show-
ing low BAFF and high APRIL serum levels had
the highest risk of disease progression whereas
those with high BAFF and low APRIL had a very
low progression risk.
In conclusion, this study demonstrated that
BAFF could be a valid marker of leukemic tu-
mor burden and disease progression. Additionally
APRIL strongly correlates with poor prognostic
factors as high CD38 expression. From the clini-
cal stand point, the new and most relevant finding
of our study is that the combined analysis of serum
BAFF and APRIL seems to be a better predictor
of progression. However it should be validated in
further studies including larger series of patients.
REFERENCES1. Bojarska-Junak, A., Hus, I., Chocholska, S., et al.
(2009). BAFF and APRIL expression in B-cell chronic
lymphocytic leukemia: correlation with biological and
clinical features. Leuk Res 33, 1319.
2. Bossen, C., and Schneider, P. (2006). BAFF, APRIL
and their receptors: structure, function and signaling.
Semin Immunol 18, 263.
3. Briones, J., Timmerman, J. M., Hilbert, D. M., et al.
(2002). BLyS and BLyS receptor expression in non-
Hodgkin’s lymphoma. Exp Hematol 30, 135.
4. Burger, J. A., Ghia, P., Rosenwald, A., et al. (2009).
The microenvironment in mature B-cell malignancies:
a target for new treatment strategies. Blood 114, 3367.
5. Chiorazzi, N., Rai, K. R., and Ferrarini, M. (2005).
Chronic lymphocytic leukemia. N Engl J Med 352,
804.
6. Collins, R. J., Verschuer, L. A., et al. (1989). Spontane-
ous programmed death (apoptosis) of B-chronic lym-
phocytic leukaemia cells following their culture in vi-
tro. Br J Haematol 71, 343.
7. Damle, R. N., Wasil, T., Fais, F., et al. (1999). Ig V gene
mutation status and CD38 expression as novel prognos-
tic indicators in chronic lymphocytic leukemia. Blood
94, 1840.
8. Elphee, E. E. (2008). Caring for patients with chronic
lymphocytic leukemia. Clin J Oncol Nurs 12, 417.
9. Endo, T., Nishio, M., Enzler, T., et al. (2007). BAFF
and APRIL support chronic lymphocytic leukemia B-
cell survival through activation of the canonical NF-
kappaB pathway. Blood 109, 703.
10. Ferrer, G., Hodgson, K., Montserrat, E., et al. (2009). B
cell activator factor and a proliferation-inducing ligand
at the cross-road of chronic lymphocytic leukemia and
autoimmunity. Leuk Lymphoma 50, 1075.
11. Ferrer, G., Hodgson, K., Pereira, A., et al. (2011). Com-
bined analysis of levels of serum B-cell activating fac-
tor and a proliferation-inducing ligand as predictor of
disease progression in patients with chronic lympho-
cytic leukemia. Leuk Lymphoma 52, 2064.
12. Guadagnoli, M., Kimberley, F. C., Phan, U., et al.
(2011). Development and characterization of APRIL
antagonistic monoclonal antibodies for treatment of B-
cell lymphomas. Blood 117, 6856.
13. Haiat, S., Billard, C., Quiney, C., et al. (2006). Role
of BAFF and APRIL in human B-cell chronic lympho-
cytic leukaemia. Immunology 118, 281.
14. Hallek, M., Cheson, B. D., Catovsky, D., et al. (2008).
Guidelines for the diagnosis and treatment of chronic
lymphocytic leukemia: a report from the International
Workshop on Chronic Lymphocytic Leukemia updat-
ing the National Cancer Institute-Working Group 1996
guidelines. Blood 111, 5446.
15. Hernandez JA, G. M. a. H. J. (2012). Prognostic fac-
tors in chronic lymphoid leukemia and identification
of new clinically relevant molecular markers, Chronic
lymphcoytic leukemia).
16. Kern, C., Cornuel, J. F., Billard, C., et al. (2004). In-
volvement of BAFF and APRIL in the resistance to
apoptosis of B-CLL through an autocrine pathway.
Blood 103, 679.
17. Mackay, F., and Tangye, S. G. (2004). The role of the
BAFF/APRIL system in B cell homeostasis and lym-
phoid cancers. Curr Opin Pharmacol 4, 347.
BAFF and APRIL in CLL; Correlation with Disease Progression 63
18. Mackay, F., Silveira, P. A., and Brink, R. (2007). B cells
and the BAFF/APRIL axis: fast-forward on autoimmu-
nity and signaling. Curr Opin Immunol 19, 327.
19. Molica, S., Digiesi, G., Mauro, F., et al. (2009). In-
creased serum BAFF (B-cell activating factor of the
TNF family) level is a peculiar feature associated with
familial chronic lymphocytic leukemia. Leuk Res 33,
162.
20. Molica, S., Digiesi, G., Battaglia, C.,et al. . (2010).
Baff serum level predicts time to first treatment in early
chronic lymphocytic leukemia. Eur J Haematol 85,
314.
21. Montillo, M., Hamblin, T., Hallek, M., et al. . (2005).
Chronic lymphocytic leukemia: novel prognostic fac-
tors and their relevance for risk-adapted therapeutic
strategies. Haematologica 90, 391.
22. Nishio, M., Endo, T., Tsukada, N.,et al. (2005). Nurse-
like cells express BAFF and APRIL, which can promote
survival of chronic lymphocytic leukemia cells via a
paracrine pathway distinct from that of SDF-1alpha.
Blood 106, 1012.
23. Novak, A. J., Bram, R. J., Kay, N. E.,et al. (2002).
Aberrant expression of B-lymphocyte stimulator by B
chronic lymphocytic leukemia cells: a mechanism for
survival. Blood 100, 2973.
24. Novak, A. J., Grote, D. M., Ziesmer, S. C.,, et al.
(2006). Elevated serum B-lymphocyte stimulator levels
in patients with familial lymphoproliferative disorders.
J Clin Oncol 24, 983.
25. Okaly, G. V., Nargund, A. R., E, V., Jayanna, P. K., et
al. (2013). Chronic lymphoproliferative disorders at an
Indian tertiary cancer centre - the panel sufficiency in
the diagnosis of chronic lymphocytic leukaemia. J Clin
Diagn Res 7, 1366.
26. Planelles L, C.-G. S., Medema JP, Morales-Luque A,
et al. (2007 ). APRIL but not BLyS serum levels are
increased in chronic lymphocytic leukemia: prognos-
tic relevance of APRIL for survival. Haematologica
September,92, 1284.
27. Sawicka-Powierza, J., Jablonska, E., Kloczko, J., et al.
(2011). Evaluation of TNF superfamily molecules re-
lease by neutrophils and B leukemic cells of patients
with chronic B - cell lymphocytic leukemia. Neoplasma
58, 45.
28. Schena, M., Larsson, L. G., Gottardi, D., et al. (1992).
Growth- and differentiation-associated expression of
bcl-2 in B-chronic lymphocytic leukemia cells. Blood
79, 2981.
29. Siegel, R., Naishadham, D., and Jemal, A. (2013). Can-
cer statistics, 2013. CA Cancer J Clin 63, 11.
30. Tangye, S. G., Bryant, V. L., Cuss, A. K., et al. . (2006).
BAFF, APRIL and human B cell disorders. Semin Im-
munol 18, 305.
31. Zhao, F., Mancuso, A., Bui, T. V., et al. (2011). Ima-
tinib resistance associated with BCR-ABL upregulation
is dependent on HIF-1alpha-induced metabolic repro-
graming. Oncogene 29, 2962.
Elmougy, M. I & Elgohary G.M.64
االتحليل المشترك لمستويات العامل المنشط للخاليا بي في مصل الدم والجين المحفز لالنتشاريه في حاالت سرطان الدم الليمفاوي المزمن مع بيان االرتباط بين السمات االكلينيكيه وتقدم المرض
مهيرM الموجي - غادM الجوهري
!لمق�مه: يشت(; ك9 م5 عام9 تنشي8 !لخاليا بى 7!لجي5 !لمحف1 للتكاث(يه !النتشا(يه فى بقا& !لخاليا بى !لعا�يه 7تميي1ها !له�@ م5 !ل�(!سه تقيي= �7( عام9 تنشي8 !لخاليا بى 7!لجي5 !لمحف1 لالنتشا(يه فى حاال? س(8ا5 !ل�= Cلتشخي! !ك� 50 م(يضا مم5 !ل�(!سه !لبح� شمل? !لحاال? 87(� !لم(� بمسا( !لتنب� فى 7!هميتها !لليمفا�7 !صابته= بس(8ا5 !ل�= !لليمفا�7 !لم1م5 307 !خ(ي5 م5 !الصحا& !لمت7!فقي5 فى !لعم( 7 !لن�7 لتقيي= مست�7 عام9 تنشي8 !لخاليا بى 7مست�7 !لجي5 !لمحف1 لالنتشا(يه فى !ل�= ع5 8(ي� تقنيه قيا� !الن1ي= !لمناعى( !اللي1! !لنتائج: !�ه(? !ل�(!سه !نخفا� مست�7 عام9 تنشي8 !لخاليا بى فى مص9 !ل�= ل�� م(ضى س(8ا5 !ل�= !لليمفا�7 !لم1م5 بكتي( مما !لمحف1 لالنتشا(يه !على !لجي5 !لضاب8ه فى حي5 كا5 مست�7 !لمجم7عه ن�ي(� فى بص7(� ملح�7ه ع5 كا5 عليه فى مجم7عه !الصحا& 7!(تب8 مست�7 عام9 تنشي8 !لخاليا بى !لى ح� كبي( بع�� !لصفائح !ل�م7يه �7ه7( ب(7تيcd5 5 7ع�� !لخاليا !لليمفا7يه !ل8(فيه فى !ل�= 7!(تشا" !لنخا� !لع�مى 7عال�7 على !ل; كا5 مست�7 �ه7( عام9 تنشي8 !لخاليا بى !ق9 م5 !ل; بكثي( ل�� !لم(ضى !ل!ي5 يعان57 م5 !لم(حله � م5 تل; !لم7ج��7 فى !لمجم7عه � 7!لمجم7عه ! 7فقا ل�ا= !لتصني@ بيني? 7!(تب8 مست�7 !لجي5 !لمحف1 لالنتشا(يه فى مص9 !ل�= بشك9 كبي( ب�ه7( ب(7تيcd 38 5فضالع5 !لم(حله !الكلينيكيه !لمتق�مه للم(� �7ه( !لتحلي9 !لمشت(; لك9 م5 عام9 تنشي8 !لخاليا بى 7!لجي5 !لمحف1 لالنتشا(يه فى مص9 !ل�= كم�ش( مستق9 لتق�= !لم(� !لخالصه تشي( !لنتائج !لى !مكانيه !العتما� على !لتحلي9 !لمشت(; لك9 م5 عام9 تنشي8 !لخاليا بى 7!لجي5 !لمحف1 لالنتشا(يه فى مص9 !ل�= كم�ش( مستق9 لتق�= !لم(� !لخالصه :تشي( !لنتائج !لي !مكانيه !العتما� علي !لتحلي9 !لمشت(; لعام9 تنشي8 !لخاليا بي 7!لجي5 !لمحف1 لالنتشا(يه كعام9 تنب� م7ث�7 فيه لحاال? س(8ا5 !ل�= !لليمفا�7 مع !لتاكي� علي !هميته في !لتع(@ علي !لم(ضي !�7 !لخ78(�
!لعاليه لتق�= !لم(�
IN VITRO APOPTOTIC EFFECT OF METFORMIN ON HUMAN
CERVICAL CANCER CELLS Dina Sabry*, Sahar H. Ahmed** and Mohamed A. S. Al-Ghussein***
ABSTRACT
Aim: We aimed to estimate whether metformin treatment against cervical cancer Hela cell line could affect cellular viabil-
ity or not and to evaluate the genes expression of p53, caspase-3, Bcl2, COX-1 and cyclin-D1 as apoptotic and proliferation
markers genes. Methods:Hela cell line was cultured and treated with different concentrations of metformin. Cells viability was
investigated by MTT proliferation assay. Cells was treated by metformin for 48 h and 72 h and harvested for RNA extraction.
RNA was transformed to cDNA and p53, caspase-3, Bcl2, COX-1 and cyclin-D1 genes’ expression was assessed by qPCR.
Results:Metformin was cytotoxic for Hela cervix cancer cells and reduced the survival fraction in a dose response relationship.
Metformin affects many genes’ expression that reflects life and death. P53 and caspase-3 genes’ expression were raised by the
drug effect while Bcl-2, COX-1 and cyclin-D1 genes’ expression levels were reduced. Conclusions:Metformin showed potent
apoptotic activities against cervical cancer Hela cell line through the elevation of p53 and caspase-3 and the elevation of Bcl-
2, COX-1 and cyclin-D1 genes’ expression. Metformin could be the new, safe and effective treatment against cervical cancer.
Keywords Hela,Cervix, p53, caspase-3, Bcl2,COX-1, cyclin-D1
Departments of *Medical Biochemistry and Molecular Biology faculty of Medicine, Cairo University, **Medical
Laboratory Technology, Faculty of Applied Medical Science, Misr University for Science and Technology, Egypt,
***Biochemistry, Faculty of Pharmacy, Al-Azhar University Gaza
Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 65 - 72
INTRODUCTION
The second female cancer worldwide is the
cancer of cervix as the most common malig-
nancy in both incidence and mortality(24).Unfor-
tunately, more than 80% of cervical cancer cases
are found in developing countries(34). Many lines
treatments were developed and used for cervical
cancer, but each of them has apparent drawbacks.
Surgical treatment line is restricted only for pa-
tients with early stage and the young patients
who have lost fertility(13). Radiotherapy and che-
motherapy are randomized, not specific to only
cancer cells and often bring severe adverse ef-
fects including bone marrow suppression, nerve
injury,gastrointestinal adverse reactions, renal
impairment and second cancer occurrence(13). In
spite of the advanced technology and methods,
up to one third of patients will still develop per-
sistence/recurrence/metastatic disease when the
treatment results are poor.
New therapeutic strategies must be evalu-
ated to improve survival. Thus, finding a safer
and more efficient treatment remains an arduous
task.
Metformin belongs to a class of compounds
called biguanines that were first isolated from
the plant Galegaofficinalis (French lilac or goat’s
rue) known for its medicinal value(27).
It is the most widely prescribed drug for treat-
ment of diabetes type 2 in the world(20). Metfor-
min’s beneficial effects in diabetic patients have
been shown to be largely through repression of
hepatic gluconeogenesis, which reduces the glu-
cose levels. In addition, it also increases insulin
sensitivity and glucose uptake(30).
In the past decade, metformin had gained
wide attention for its anticancer properties.
Studies have shown that in vitro treatment with
metformin inhibited the growth of myriad cancer
cell lines(37).An early study done in breast cancer
mouse model showed that metformin treatment
significantly decreased the tumor accumulation
of mammary adenocarcinomas accompanied by
increase in the life span of mice(1).
Metformin is also being tested as an adjuvant
cancer therapy(11), studies on both laboratory
animals and humans, showed that metformin
not only exerts a major protective effect against
the development of a wide range of cancers but
also improves prognosis in those found to have
these cancers(12). It was suggested that it inhibits
cancer cell proliferation, tumor growth and pro-
vokes cell-cycle arrest or apoptosis in G0–G(3).
Many genes can be considered as apoptotic
markers such as p53 and caspase-3. Not only
Sabry D., et al.66
p53 can be considered a marker gene for apop-
tosis, but also it controls cellular apoptosis and
proliferation(22).P53 plays a major role in many
cancer cells death specially cancer cervix(31). In
the same way, caspase-3 is considered a death
cascade promoter for cancer cells. The High lev-
els of this gene may demonstrate the degree of
Hela cell death (37).
On Contrarily, The anti-apoptotic Bcl2 gene
expression reflects the cancer cells viability and
vitality(29). Additionally, the novel biomarker
in many types of cancers is COX-1. Recently,
COX-1 gene expression has a vital role as bio-
marker for the detection of cervical cancer de-
velopment and progression (17,29). Moreover, Cy-
clin-D1 gene was observed to be over expressed
in cervical carcinoma(39).
The emergence of metformin as a potential
anticancer and cancer-preventive therapeutic
tool is exciting. With the added benefits of be-
ing readily available, economical, and easily
tolerated with good safety profile, it can be ef-
fortlessly transitioned from bench to bedside for
cancer therapy(39). We aimed to evaluate whether
there is any effect of metformin treatment on the
viability of cervical cancer Hela cell line or not
and to assess the gene expression of p53, cas-
pase-3,Bcl2, COX-1 and cycin-D1 as apoptotic
and proliferation markers genes.
MATERIALS AND METHODS
Dulbecco’s modified Eagle medium (DMEM),
fetal calf serum, and 3-(4, 5-dimethylthiazol-
2-yl)- 2, 5-diphenyltetrazoliunbromide (MTT)
were purchased from GIBCO BRL (Grand Is-
land, NY, USA). Trypsin 2.5%, penicillin, strep-
tomycin, metformin and all other chemicals em-
ployed in this study were of analytical grade and
were purchased from Sigma Chemical Co. (St.
Louis, USA).
Cell culture and cell proliferation assay
Metformin was dissolved in complete
DMEM, the pH value adjusted to 7.2 and steril-
ized through a 0.2 μm filter to the desired work-
ing solutions (equivalent to 15.6–1000 μg/mL,
w/v)(39). Human cervical carcinoma cell line
(Hela) was provided by American Type Cul-
ture Collection (ATCC, Minisota, U.S.A.). Cells
were cultured in DMEM medium supplemented
with 5% fetal bovine serum (FBS), 100 mg/mL
streptomycin and 100 units/mL penicillin at
37°C in a humidified incubator in an atmosphere
of 5% CO2. Hela cells were seeded in 96-well
plates (103- 104 cells/well) for 24 h incubation,
cell viability was evaluated using MTT assay as
described previously (9). In brief, cells were treat-
ed with metformin at a various concentration 0,
15.6, 31.3, 62.5, 125, 250, 500 and 1000 µg/ml
for 48 h and untreated cells served as a control.
Prior to determination, 10 μL MTT (2.5 g/L)
was added to each well. After 4 h incubation, the
culture media were discarded followed by addi-
tion of 100 μL of detergent reagent to each well
and vibration for 10 min. The absorbance (A) in
the experimental wells was measured at 570 nm
with a microplate reader (ELISA reader). The ab-
sorbance in the experimental wells to that of the
control wells (without test compound) is mea-
sured. The percentage of viable cells was calcu-
lated as follows: (A of experimental group/A of
control group) × 100%. Following this, the IC50
(cytotoxic concentration for 50% cell death) was
determined from the dose-response curve.
Total RNA isolation
Cells were detached by trypsin (2.5%) and
total RNA was isolated with RNAeasy Mini Kit
(Qiagen) and further analyzed for quantity and
quality with Beckman dual spectrophotometer
(USA). The RNA integrity and the GAPDH-
RNA (house keeping gene) ratio were used as
the quality control.
Real Time PCR (qRT-PCR) for quantita-
tive expression of p53, Caspase-3, Bcl2, COX-
1 and CyclinD1
The mRNA expression level was quanti-
fied by qRT–PCR (Real time PCR). 1000 ng of
the total RNA from each sample was used for
cDNA synthesis by reverse transcription using
high capacity reverse transcriptase kit (Applied
Biosystem, USA). The cDNA was subsequently
amplified with the Syber Green I PCR Master
Kit (Fermentas) in a 48-well plate using the Step
One instrument (Applied Biosystem, USA) as
follows: 10 minutes at 95oC for enzyme activa-
tion followed by 40 cycles of 15 seconds at 95oC,
20 seconds at 55oC and 30 second at 72oC for the
In Vitro Apoptotic Effect Of Metformin On Human Cervical Cancer Cells 67
amplification step. Changes in the expression of
each target gene were measured relative to the
mean critical threshold (CT) values of GAPDH
housekeeping gene by the ΔΔCt method. We
+��5���
5����
�
�
-��������/�����'�26$ �&6 � �������5�
�����������
� %�������7��
����������
��������
-2&� � -�!(!(���!�!((���!�����
9-�(���(!�(��!((!���(!��
3J��R�
�
�
�
NS7G8JG6*��
������$
&�
�
�
�
-�(��!��(�(!((�((��(��
9-��(�������(!((���(��
37��R�
�
�
�
NS7G.7�8*��
3��"� � -���(���(!(����((���(!!(!!(!(!��
9-�
!!�(�((��(�!(((!�(!((!!!�����!!�
J.��R� � :(T..G$J�*� �
��4$��
�
�
�
-����(��(!��(��(!��!�������
9-�!!(!��!��!�!!!�(�!�(((��
33��R�
�
�
��N���.7G.*��
������$
���
� -�����������((!(�!����
9-���(�!(�!�!!����������
33��R�
�
�
�
:(T..8$83*� �
%-��� � -������!��((�(��(��!!((���
9-�(���!��!��(!�!�(��((�
33��R�
�
�
�
:�T..G83G*�J�
���������������������
Table (1):Primer`s sequence and annealing temperature specific for each gene :
Statistical analysis
Results were disclosed as means ± standard
deviations. One-way ANOVA and Tukey’s mul-
tiple comparison post hoc tests were performed.
P< 0.01 was considered significant.
RESULTS
Metformin cytotoxicity and IC50 against
Hela cell line
Metformin significantly reduced Hela cell line
viability in a dose response relationship after 24
h incubation period (Figure 1). Beginning with
the lowest metformin concentration 15.6 µg/mL,
it decreased the cancer cell line viability signifi-
cantly to 95.25%±2.19%; P< 0.001 against the
untreated control. IC50; the cytotoxicity concen-
tration value that fifty percent of cells were dead;
was calculated and examined to equal 720.5µg/
mL. The maximum cytotoxicity against Hela
cell line effect was reached to 33.75%±4.40%;
P< 0.001 against the untreated control, after the
exposure to 1000 µg/mL.
P53 and caspase-3 elevated genes expres-
sion after metformin treatment
Both apoptotic marker genes were elevated for
Hela cell line 48 h after the metformin treatment
as shown in figure 2. Cells p53 expression
were increased significantly (0.177±0.075;
P< 0.001 compared to untreated control group
0.034±0.012) and remain unchanged after 72
h treatment. Similarly, caspase-3 expression
was increased 2 fold after 48 h drug treatment
(0.77±0.26;P< 0.001) and remained constant
after 72 h when compared to control value
(0.44±0.11).
Bcl-2, COX-1 and Cyclin-D1 reduced genes
expression after metformin treatment
Complementary to the previous results, Bcl-
2; an anti-apoptotic gene for cells viability or
life; expression was significantly reduced in
a time dependent to almost one half fold each
time after 48 h and 72 h metformin treatment
against the control (0.74±0.27 for 48 h and
0.43±0.21 for 72 h; P < 0.001 for both compared
to 0.122±0.17). In the same direction, COX-1
gene expression value was reduced in a time de-
pendent manner after 48 h and 72 h that reflect
the reduction of cancerous effects (1.23 ±1.04 for
48 h and 0.95±0.64 for 72 h; P < 0.001 for both
compared to control3.8±1.3). Parallel to these
results, Cyclin-D1 gene expression was mark-
edly decreased after 48 h and 72 h metformin
treatment when compared to control (5.62±4.4
for 48 h and 2.3±1 for 72 h; P < 0.001 for both
compared to 9.68±4.7).
used 1μM of both primers specific for each tar-
get gene. Primers sequence and annealing tem-
perature specific for each gene demonstrated in
table (1).
` `
Sabry D., et al.68
�
Figure1:Metformin cytotoxicity against
Hela cell line, survival fraction per-
centage of Hela cells were reduced
after treatment of different metfor-
min concentrations. Data are means
± SD,(*) p value value ≤ 0.001versus
untreated control group.
�
Figure2:P53 and caspase-3 elevated
genes expression after metfor-
min treatment of Hela cell line.
Data are means ± SD, (*) p val-
ue value ≤ 0.001versus untreated
control group.
�
Figure3: Bcl-2, COX-1 and Cyclin-D1
reduced genes expression after
metformin treatment of Hela
cell line.Data are means ± SD,
(*) p value value ≤ 0.001versus
untreated control group.
In Vitro Apoptotic Effect Of Metformin On Human Cervical Cancer Cells 69
DISCUSSION
Metformin was significantly cytotoxic for
Hela cervix cancer cell line in a dose dependent
manner as shown in figure 1. This apoptotic ef-
fect conceded with previous anticancer, prophy-
lactic and adjuvant activities against other types
of cancers(37,3). Recently, metformin was effec-
tive against pancreatic(11,32), ovarian(39), breast
cancer(26) melanoma(6) and neuroblastoma(8).
Metformin was not so far from its anti-diabetic
group in cancer treatment (21).
The anticancer effect of metformin was ex-
plained through its relationship and regulation of
the transcriptional certain genes (CHOP, CAV-1,
HO-1, SGK-1 and Par-4) on MCF-7 cell line(28).
Build and complementary for this information
transcriptional, regulator and apoptotic genes’
expression were examined for p53, caspase-3,
Bcl-2, COX-1 and cyclin-D1 genes. Moreover,
each mentioned gene affects cell proliferation or
apoptosis of cancer cells specially Hela cervix
cancer cells (22-39).
Not only p53 gene expression was partici-
pated for cancer cervix cell death (31), but also
metformin affect the cancer cells susceptibility
for p53 gene expression,(10). Even though the
low concentration of metformin induces a p53-
dependent senescence in hepatoma cells via ac-
tivation of the AMPK pathway(35). In the same
direction, caspase-3 was induced in cancer by
metformin(33). Moreover, both p53 and caspase-3
genes were induced by the effect of metformin in
prostate cancer (2).
On the other hand, Metformin reduces growth
of cutaneous squamous cell carcinoma by target-
ing mTOR signalling pathway and the reduction
of Bcl-2 gene expression (7).Furthermore, metfor-
min and aspirin reduced COX-1 gene expression
by targeting AMPK-mTOR and inflammation for
pancreatic cancer prevention and treatment(36).
Confirmed with our cyclin-D1 results, metfor-
min suppresses hepatocellular carcinoma cell
growth through induction of cell cycle G1/G0
phase arrest and p21CIP and p27KIP expression
and downregulation of cyclin D1 in vitro and in
vivo(4).
In vitro cell system analyses have demon-
strated that metformin: i) inhibits the growth of
various endometrial cancer cell lines; ii) attenu-
ates the invasion and metastasis of endometrial
cancer cell lines by modifying the nuclear fac-
tor-κB, matrix metalloproteinase-2/9/Akt and
Erk1/2 pathways; and iii) enhances endometrial
cancer cell chemosensitivity to cisplatin and pa-
clitaxel by reducing glyoxalase I expression and
regulating the mTOR signaling pathway (5). At
the molecular level, the fundamental activity
of metformin inhibits mitochondrial oxidative
phosphorylation, and may exert energy-associ-
ated stress on neoplastic cells (23). This inhibition
of oxidative phosphorylation reduces the produc-
tion of ATP, activating the cellular energy regu-
lator AMPK and its downstream effectors, in-
cluding mTOR(14). At the whole-organism level,
the anti-proliferative effects of metformin may
be attributed to the decrease in circulating insu-
lin levels induced by the reduced hepatic gluco-
neogenesis characteristic of insulin-responsive
tumors (25). Metformin potently inhibits growth
in a dose-dependent manner in endometrial can-
cer cell lines. Metformin resulted in G1 phase
cell cycle arrest, induction of apoptosis and de-
creased human telomerase reverse transcriptase
expression in endometrial cancer cells(5). Treat-
ment with metformin attenuates the estrogen-
dependent proliferative expression of c-myc
and c-fos in the obese rat endometrium, an ef-
fect which was accompanied by inhibition of the
phosphorylation of insulin and IGF1 receptors,
as well as Erk1/2 (38).
Precisely, metformin impairs growth of en-
dometrial cancer cells that neighbouring cervi-
cal cancer via cell cycle arrest and concomitant
autophagy and apoptosis(33).
Accordingly, we recommend metformin to
be a new, safe and effective therapeutic agent
against cervical cancer.
Conclusion
Cervical cancer was the new type of cancer
treated by metformin. Metformin has an apop-
totic potent cytotoxic activities were shown by
the dose response relationship against human
cervical cancer Hela cells. Even if metformin
Hela treatment raised p53 and caspase-3 genes’
Sabry D., et al.70
expression as apoptotic markers, it reduced Bcl-
2, COX-1 and cyclin-D1 genes’ expressions as
proliferation markers.
Acknowledgement
The authors had an acknowledgement for all
staff members at Medical Biochemistry and Mo-
lecular Biology Unit at the Faculty of Medicine,
Cairo University.
Financial Support
No grants and no financial support.
REFERENCES1. Anisimov VN, Berstein LM, Egormin PA, et al. 2005
Effect of metformin on life span and on the develop-
ment of spontaneous mammary tumors in HER-2/neu
transgenic mice. ExpGerontol;40 (8-9):685.
2. Ben Sahra I, Laurent K, Giuliano S, et al., 2010 Target-
ing cancer cell metabolism: the combination of metfor-
min and 2-deoxyglucose induces p53-dependent apop-
tosis in prostate cancer cells.Cancer Res. ;70(6):2465.
3. Ben Sahra I, Le Marchand-Brustel Y, Tanti JF et al.,
2010 Metformin in cancer therapy: a new perspec-
tive for an old antidiabetic drug?.MolCancer Ther;9
(5):1092.
4. Cai X, Hu X, Cai B, et al., 2013 Metformin suppresses
hepatocellular carcinoma cell growth through induc-
tion of cell cycle G1/G0 phase arrest and p21CIP and
p27KIP expression and downregulation of cyclin D1 in
vitro and in vivo.Oncol Rep. ;30(5):2449.
5. Cantrell LA, Zhou C, Mendivil A, et al., 2009 Bae-
Jump VL. Metformin is a potent inhibitor of endome-
trial cancer cell proliferation - implications for a novel
treatment strategy. GynecolOncol. 2010;116:92–98.
doi: 10.1016/j.ygyno..09.024.
6. Cerezo M, Tomic T, Ballotti R, et al., 2015 Is it
time to test biguanide metformin in the treatment of
melanoma?Pigment Cell Melanoma Res. ;28(1):8.
7. Chaudhary SC, Kurundkar D, Elmets CA, et al., 2012
AtharM.Metformin, an antidiabetic agent reduces
growth of cutaneous squamous cell carcinomaby tar-
geting mTORsignalingpathway.PhotochemPhotobiol.
;88(5):1149.
8. Costa D, Gigoni A, Würth R, et al., 2014 Metformin
inhibition of neuroblastoma cell proliferation is dif-
ferently modulated by cell differentiation induced by
retinoic acid or overexpression of NDM29 non-coding
RNA.Cancer Cell Int ;14:59.
9. Cui FJ, Li Y, Xu YY, et al., 2007 Induction of apoptosis
in SGC-7901 cells by polysaccharide-peptide GFPS1b
from the cultured mycelia of Grifolafrondosa GF9801.
Toxicol In Vitro. ; 21(3):417.
10. Do MT, Kim HG, Choi JH, et al., 2014 Metformin in-
duces microRNA-34a to downregulate the Sirt1/Pgc-
1α/Nrf2 pathway, leading to increased susceptibility of
wild-type p53 cancer cells to oxidative stress and thera-
peutic agents.FreeRadicBiol Med;74:21.
11. Donghui LH. 2011 Metformin as an antitumor agent in
cancer prevention. J Diabetes ;3:320.
12. Duncan BB, Schmidt MI 2009. Metformin, Cancer,
Alphabet Soup, and the Role of Epidemiology in Etio-
logic Research. Diabetes Care;32 (9):1748.
13. Fujimoto J 2009. Novel strategy of anti-angiogenic
therapy for uterine cervicalcarcinomas. Anticancer Res,
29:2665.
14. Hardie DG, Ross FA, Hawley SA. et al,. 2012 A nutri-
ent and energy sensor that maintains energy homeosta-
sis. Nat Rev Mol Cell Biol. ;13:251–262. doi: 10.1038/
nrm3311.
15. Hirchaud F, Hermetet F, Ablise M, et al,. 2013
Isoliquiritigenin induces caspase-dependent apoptosis
via downregulation of HPV16 E6 expression in cervi-
cal cancer Ca Ski cells.Planta Med. ;79(17):1628.
16. Jang SY, Kim A, Kim JK, et al,. 2014 Metformin inhib-
its tumor cell migration via down-regulation of MMP9
in tamoxifen-resistant breast cancer cells.Anticancer
Res. ;34(8):4127.
17. Jung YW, Kim SW, Kim S, et al., 2010 Prevalence and
clinical relevance of cyclooxygenase-1 and -2 expres-
sion in stage IIB cervicaladenocarcinoma.Eur J Obstet-
GynecolReprod Biol. ;148(1):62.
18. Kim TH, Suh DH, Kim MK, 2014 Metformin against
cancer stem cells through the modulation of energy
metabolism: special considerations on ovarian cancer.
Biomed Res Int2014;:132702.
19. Koay MH, Crook M, Stewart CJ 2012.Cyclin D1, E-
cadherin and beta-catenin expression in FIGO Stage
IA cervical squamous carcinoma: diagnostic value
and evidence for epithelial-mesenchymal transition.
Histopathol;61(6):1125.
20. Kourelis TV and Siegel RD. 2012 Metformin and
cancer: new applications for an old drug. Med
Oncol;29(2):1314.
21. Menendez JA, Quirantes-Piné R, Rodríguez-Gallego
E, et al., 2014 Oncobiguanides: Paracelsus’ law and
nonconventional routes for administering diabetobigu-
anides for cancer treatment.Oncotarget. ;5(9):2344.
22. Mollereau B, Ma D.2014 The p53 control of apoptosis
and proliferation: lessons from Drosophila.Apoptosis.
;19(10):1421.
23. Owen MR, Doran E, Halestrap AP 2000:. Evidence that
metformin exerts its anti-diabetic effects through inhi-
bition of complex 1 of the mitochondrial respiratory
chain. Biochem J. ;348:607–614. doi: 10.1042/0264-
6021:3480607.
In Vitro Apoptotic Effect Of Metformin On Human Cervical Cancer Cells 71
24. Parkin DM. 2001 Global cancer statistics in the year
2000. Lancet Oncol ,2:533.
25. Pollak M 2012. The insulin and insulin-like growth fac-
tor receptor family in neoplasia: An update. Nat Rev
Cancer. ; 12:159.
26. Radilova H, Libra A, Holasova S, et al., 2009 COX-1
is coupled with mPGES-1 and ABCC4 in human cervix
cancer cells.Mol Cell Biochem. ;330(1-2):131.
27. Rattan R, Ali Fehmi R, and Munkarah A 2012 Met-
forminan emerging new therapeutic option for tar-
geting cancer stem cells and metastasis. J Oncol;
2012:928127.
28. Salis O, Bedir A, Ozdemir T, 2014 The relationship
between anticancer effect of metformin and the tran-
scriptional regulation of certain genes (CHOP, CAV-1,
HO-1, SGK-1 and Par-4) on MCF-7 cell line.Eur Rev
Med Pharmacol Sci;18(11): 1602.
29. Sharawat SK, Bakhshi R, Vishnubhatla S, 2015 High
receptor tyrosine kinase (FLT3, KIT) transcript versus
anti-apoptotic (BCL2) transcript ratio independently
predicts inferior outcome in pediatric acute myeloid
leukemia.Blood Cells Mol Dis. Blood Cells Mol Dis. ;
54(1):56.
30. Shaw RJ, Lamia KA, Vasquez D, et al. 2005 The kinase
LKB1 mediates glucose homeostasis in liver and thera-
peutic effects of metformin. Science; 310 (5754):1642.
31. Shukla S, Dass J, Pujani M. 2014 p53 and bcl2 expres-
sion in malignant and premalignant lesions of uterine
cervix and their correlation with human papilloma virus
16 and 18.South Asian J Cancer. ; 3(1):48.
32. Snima KS, Jayakumar R, LakshmananVK.2014 In Vitro
and In Vivo Biological Evaluation of O-Carboxymeth-
yl Chitosan Encapsulated MetforminNanoparticles for
Pancreatic Cancer Therapy.Pharm Res. ;31(12):3361.
33. Takahashi A, Kimura F, Yamanaka A, et al., 2014 Met-
formin impairs growth of endometrial cancer cells via
cell cycle arrest and concomitant autophagy and apop-
tosis.Cancer Cell Int. ;14:53.
34. World Health Organization 2006. Comprehensive cer-
vical cancer control: A guide toessential practice. Ge-
neva: WHO; .
35. Yi G, He Z, Zhou X, et al., 2013 Low concentration
of metformin induces a p53-dependent senescence in
hepatoma cells via activation of the AMPK pathway.
Int J Oncol.;43(5):1503.
36. Yue W, Yang CS, DiPaola RS, 2014 Tan XL.Repurposing
of metformin and aspirin by targeting AMPK-mTOR
and inflammation for pancreatic cancer prevention and
treatment.CancerPrev Res (Phila). ;7(4):388.
37. Zakikhani M, Dowling R, Fantus IG, 2006 Metformin
is an AMP kinase-dependent growth inhibitor for breast
cancer cells. Cancer Research ;66:10269.
38. Zhang Q, Celestino J, Schmandt R, et al. 2013 Che-
mopreventive effects of metformin on obesity-associ-
ated endometrial proliferation. Am J Obstet Gynecol.
2013;209:e1–e24. doi: 10.1016/j.ajog..03.008.
39. Zhao H, Zhang M, Zhao L, 2011 Changes of constitu-
ents and activity to apoptosis and cell cycle during fer-
mentation of tea.Int J Mol Sci. ;12(3):1862.
Sabry D., et al.72
تاثبر المتقورمبن علي موت الخالبا المبرمج لسرطان عنق الرحم
دينا صبري - سحر حسن احمد - محمد الغسين
الهدف من هذC الدراسة هو تحديد ما إذا كان العالج بالميتفورمين ضد خط خاليا سرطان عنق الرحم Hela له تأثير على حيوية Cyclin D1 ، كجينات دالة على موت الخاليا المبرمج و التعبير الجينى لـ P53 ، Caspase الخاليا ام ال وتقييم التعبير الجينى لـCox-1 BCL2 كجينات داله على تكاثر وانتشار الخاليا. تم زرع خاليا Hela ومعامالتها بتركيزات مختلفة من الميتفورمين وكانت
RNA لقياس التكاثر وتمت معالجة الخاليا بالميتفورمين 48، 72 ساعة ثم تم الحصاد الستخراج MTT حيوية الخاليا تقاس عن طريقالذى تم تحويله إلى cDNA ثم التقييم الجينى لـ P53 ، Caspase ، BCL2 ، Cox-1 و و Cyclin D1 باستخدام PCR. النتائج: الميتفورمين أثبت انه ذو تأثير سام على خاليا سرطان عنق الرحم Hela وتقليل حيويتها فى عالقة معتمدة على الجرعات وللميتفورمين Cy- 3 أماCaspase ، P53 تأثير على عدد من الجينات التى تعكس حياة الخاليا او موتها. ارتفع التعبير الجينى باستخدام الميتفورمين لـclin D1، Cox-1 ، BCL2 انخفض التعبير الجينى. الخالصة: أظهرت نتائج معالجة خاليا سرطان عنق الرحم Hela بالميتفورمين
ارتفاع نسبة موت الخاليا السرطانية المبرمج من خالل زيادة التعبير الجينى لكال من 3Caspase ، P53 وانخفاض التعبيرالجينى Cyclin D1، Cox-1 ، BCL2 كجينات مسؤولة عن تكاثر الخاليا وانتشارها وعلى هذا يمكن ان يكون الميتفورمين عالج جديد و
mمن وفعال ضد سرطان عنق الرحم.
ROLE OF INTERCELLULAR ADHESION MOLECULE-1 (ICAM-1) G241R AND K469E GENE POLYMORPHISM AND SOLUBLE ICAM-1 SERUM
LEVELS IN THE DEVELOPMENT OF ISCHEMIC STROKE IN EGYPTIAN PATIENTS
Abeer Mohamed Mohy*, Ahmed Abd Allah Hassan Ali **and Heba Omar***
ABSTRACTBackground: Stroke is currently the third leading cause of death worldwide. Intercellular adhesion molecule-1 (ICAM-1)
was involved in the pathogenic mechanisms responsible for ischemic stroke. Objectives: To determine the association of ICAM-1 G241R and K469E polymorphisms and soluble ICAM-1 level with ischemic stroke in Egyptian patients. Subjects and Methods: ICAM-1 G241R and K469E, were detected by allele specific polymerase chain reaction (ASP) and polymerase chain reaction-restriction fragment length polymorphism (PCR – RFLP) techniques respectively, in 40 Egyptian patients with ischemic stroke and 40 healthy subjects as a control group. Serum sICAM-1 was measured by enzyme linked immunosorbent assay (ELISA). Results: ICAM-1 241R allele and 469E allele were significantly associated with increased risk of ischemic stroke. The median sICAM-1 levels were significantly higher in cases than control group. Conclusion: These results suggest that ICAM-1 G241R and K469E gene polymorphism may influence the susceptibility to acquire ischemic stroke in a sample of Egyptian population Keywords:Ischemic stroke - ICAM-1 - K469E - G241R - gene polymorphism - PCR-RFLP
INTRODUCTION
Stroke is currently the third leading cause of death and the biggest single cause of major dis-ability worldwide. Each year more than 700 000 people experience a new or recurrent stroke and on average someone dies every 4 minutes of a stroke. Despite the diagnostic and treatment de-velopment in medicine, the recovery rate from stroke is poor (9).
The commonest type of stroke is an ischemic stroke, resulting from disruption of blood flow within the brain caused by occlusion of an artery. This deprives the brain of oxygen and nutrients and initiates a dynamic sequence of pathophysi-ological events (12).
Intercellular adhesion molecule-1 (ICAM-1) is a member of immunoglobulin (Ig) superfam-ily of cell adhesion molecules with glycoprotein structure. The ICAM-1 gene is located on chro-mosome 19 P13.2-13.3 and includes 7 exons that code a protein with five extracellular Ig-like domains, a transmembrane domain and a short cytoplasmic tail (1).
ICAM-1 is expressed on vascular endothe-lium, macrophages and activated lymphocytes
and is up-regulated by inflammatory cytokines. It plays an important role in the adhesion and subsequent transendothelial migration of circu-lating leukocytes into the vascular endothelium which is one of the earliest events in the patho-genesis of atherosclerosis (3, 13).
Proteolytic cleavage of ICAM-1 near its membrane region leads to production of a solu-ble form, sICAM-1, which is partially detectable in the serum of healthy subjects, but its level is elevated in inflammatory and malignant disor-ders, also associated with increased risk of future ischemic stroke (1).
Two single-nucleotide polymorphisms (SNPs) in the ICAM-1 gene have been rec-ognized, first at position +241 (+241 G/A or G241R) (rs 1799969) located in exon 4 coding Ig-like domain 3 of the ICAM-1 protein (GGG → AGG; Glycine → Arginine) and the second one at position +469 A/G or K469 E) (rs 5498) located in exon 6 coding Ig-like domain 5 of the ICAM-1 protein (AAG → GAG; lysine → Glu-tamic acid)(1,10) .
The Ig-like domain 3 mediates binding to macrophage antigen-1 (Mac-1) and may also af-fect accessibility of leukocyte function associat-
Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 73 - 80
Departments of Clinical & Chemical Pathology*, Internal Medicine** and Biochemistry***, Faculty of Medicine, Cairo University, Egypt .
Mohy, A.M. et al.74ed – antigen-1 (LFA-1) binding to the Ig-like do-main-1. ICAM-1 mediates adhesion interactions of circulating leukocytes to the blood vessel wall by binding to Mac-1 and LFA-1, and increased expression of ICAM-1 has been found during all phases of atherogenesis(5, 14).
The Ig-like domain 5 was reported to involve in cell adhesion. This region seems to be particu-larly important for maintaining normal protein structure, affecting the adhesion of circulating leukocytes to the activated endothelium. This domain is of crucial importance for the activ-ity of the ICAM-1 protein because it modulates the interactions between ICAM-1 and LFA-1(8,11)
and the influences the adhesion of B-cells (14).
These variations have been reported to be related to some inflammatory and autoimmune diseases and atherosclerosis (1, 10).
The purpose of the present study was to de-termine the association of ICAM-1 G241R and K469E polymorphisms and solule ICAM-1 level with ischemic stroke in Egyptian patients.
SUBJECTS AND METHODS
Subjects:
The study population included 40 ischemic stroke patients (21 males and 19 females; mean age 49 ± 3.1 years) from Neurology Depart-ment, Kasr Al-Aini Hospital, Cairo University, Egypt. They were diagnosed by neurological examination and CT scan. Patients with hemor-rhagic stroke, cancer, autoimmune disease were excluded from this study. As controls, 40 healthy subjects were considered, similar to the patients for age and sex distribution (20 males and 20 fe-males; mean age 49.5 ± 4.0 years). The controls had no clinical evidence or history of neurologi-cal diseases, no history of stroke. All controls came from the same geographical area as the patients. Besides neurological history, history of hypertension, diabetes mellitus (DM) and smok-ing were recorded for all participants.
The study was conducted at period from Sep-tember 2013 to July 2014. Patients and controls were enrolled in this study after giving informed
consent to the use of part of their blood samples for an experimental study. The study was ap-proved by the local ethical committee.
Biochemical variables and ICAM-1 genotyping:
Six ml venous blood samples were collected from all subjects after at least 12-hours fast. Se-rum total cholesterol, triglyceride (TG) levels were measured by standard enzymatic meth-ods. Serum high-density lipoprotein cholesterol (HDL-C) level was determined by direct as-say. Serum low-density lipoprotein cholesterol (LDL-C) level was calculated by Friedwald for-mula(6). Plasma fasting glucose was measured by a glucose oxidase procedure. These biochemical parameters were measured using Dimension R X L automatic analyzer (Siemens Healthcare Di-agnostics, USA). Serum sICAM-1 was assayed using enzyme-liked immunosorbent assay (ELI-SA) (Biovision, Egypt).
Molecular analysis: All kits were supplied by (Thermo-Scientific, USA)
Genomic DNA from EDTA-treated venous blood was extracted by standard techniques us-ing a DNA spinspacecolumn extraction kit.
G241R polymorphisms:
To detect the G241R polymorphism, an al-lele-specific polymerase chain method (ASP) was performed using two sets of specific prim-ers (G for nucleotide G, R for nucleotide A) and one common primer(1). The sequence of these primers is shown in Table 1. PCR reaction was performed in a total volume of 25 µl, which in-cluded 12.5 µl 2 x PCR master mix {0.05 units/μl Taq DNA polymerase, 2 x PCR buffer, 3 mM MgCl2 and 400 μM of each dNTP (dATP, dCTP, dGTP, dTTP)}, 1 µl of either G or R primer, 1 µl common primer, 1µl of each µ-globin primer F and R as the internal control, 6 µl nuclease free water and 2.5 µl genomic DNA.
PCR program included an initial denaturation at 95oC for 5 minutes followed by 30 cycles con-sisting of 95oC for 1 minute, 62oC for 1 minute, 72oC for 1 minute, and a final extension at 72oC for 10 minutes.
Role of ICAM-1 and sICAM-1 in Ischemic Stroke 75Then the 137bp PCR amplification prod-
ucts were run electrophoretic on 2% ethidium bromide-stained agarose gel and the bands were visualized under UV light.
K469E polymorphisms:For this polymorphism, the PCR-RFLP meth-
od was used on two forward (K) and reverse (E) primers (Table 1) and Fast Digest Bst UI restric-tion enzyme(1). The PCR reaction was performed in a total volume of 25µl that contained 8 µl nuclease free water, 12.5 µl 2 x PCR mater mix, 1 µl of each primer and 2.5 µl genomic DNA. The cycling conditions consisted of an initial de-naturation of 5 minutes at 94oC followed by 35 cycles of 45 seconds at 96oC, 1 minute at 59oC and 1 minute at 72oC. The reaction was termi-nated after a final extension of 5 minutes at 72oC.
Then 7 µl of the 223bp PCR products were then digested with 1µl (5 units) of Fast Digest Bst UI enzyme at 37oC for 15 minutes. The Bst UI restriction enzyme was able to cut the E469 allele but not K469.
RESULTS
Characteristics of the subjects:
The clinical and laboratory data of the pa-tients and controls are presented in table (2).
Distribution of the ICAM-1 polymorphism in pa-tients and control group
The ICAM-1 G241R and K469E polymor-phism distributed in accordance with Hardy-Weinberg equilibrium (HWE) in both studied
After digestion, the fragments were run on 3.5% ethidium bromide – stained agarose gel and visualized under UV light. The EE genotype corresponded to the presence of 136 and 87bp fragments. The KE genotype corresponded to presence of 223, 136 and 87bp fragments. The KK genotype corresponded to a 223bp fragment.
Statistical Analysis
Data was analyzed using SPSS version 15 (Chicago, IL, USA). Quantitative data was pre-sented as mean ±SD. For comparison of two groups, Student’s t -test was used. Non paramet-ric quantitative data was expressed as median (25th – 75th percentile); Mann-Whitney test was used for comparison of medians between two groups. Qualitative data was expressed as frequency and percentage. Association between qualitative data was done using Chi-square test. Odds Ratio (OR) was calculated. P-value < 0.05 was significant.
groups. The distribution of G241R and K469E genotypes in exons 4 and 6 of ICAM-1 gene are shown in tables 3 and 4.
Association of genotypes with the risk of isch-emic stroke:
By logistic regression analysis adjusted for age, sex, smoking, diabetes, hypertension, fasting blood glucose, lipid profile, sICAM-1, ICAM-1 469 KE + 469 EE genotypes were sig-
Table (1): The primers sequence of ICAM-1 G241R and K469E polymorphisms
Mohy, A.M. et al.76
Table (2): Clinical and laboratory data of ischemic stroke patients and control group
- Qualitative data is presented as number (%) * Data presented as mean +SD+ Data presented as median (25th – 75th percentile) ** P-value < 0.05 is statistically significant
Table (3): Frequency distribution of ICAM-1 K469E genotypes and alleles among the studied groups
Role of ICAM-1 and sICAM-1 in Ischemic Stroke 77
Table (4): Frequency distribution of ICAM-1 G241R genotypes and alleles among the studied groups
Table (5): ICAM-1 genotypes and allele frequencies among males and females ischemic stroke patients
nificantly associated with increased risk of de-veloping ischemic stroke (OR: 7.857, 95% CI (2.786-22.158), p= 0.000). Carriers of 469E al-lele or 241R allele had significantly increased risk of developing ischemic stroke (OR: 3.37, 95% CI (1.650-6.885); p= 0.001, OR= 3.769, 95% CI (1.683-8.441); p= 0.001, respectively).
In the current study it was found that the me-dian sICAM-1 levels were significantly higher in combined 469 KE + 469 EE genotypes; 390.8 (363.2-577.2 ng/l) as compared to 469 KK geno-type; 368.5 (305.02-418.8 ng/l); p=0.046.
There was no statistical significant difference between sICAM-1 levels in different G241R genotypes, p= 0.229.
Regarding sex, it was found that the frequen-cies of 469 KE and EE genotypes were higher in females than males, but it didn’t reach statistical
significance as shown in table (5).
Haplotype analysis:
The genotype combination of K469E and G241R polymorphisms of the ICAM-1 gene re-vealed that the frequency of the E/R haplotype (+469 K/E and +241 G/R, respectively) signifi-cantly increased in patients compared to control group (18.8% vs 5%). Then individuals with E/R haplotype had a significantly increased risk of ischemic stroke (OR = 4.385, 95% CI = 1.942-9.898, p= 0.000).
DISCUSSION
A cross sectional study was performed to asses the role of genetic variation of ICAM-1 G241R and K469E and serum sICAM-1 levels on risk of ischemic stroke in Egyptian patients and compared the results with healthy individuals.
Mohy, A.M. et al.78The 469 KE + EE genotypes and 469 E allele
were more frequent in ischemic stroke patients than control. Also the mutant 469 E allele was found to be a significant risk factor for develop-ing ischemic stroke (OR = 3.37, 95% CI (1.650-6.885; p= 0.001), it was found that 469 EE genotype was higher in females than males but it didn’t reach statistical significance (p= 0.06).
The 241 GR + RR genotypes and 241R allele were significantly increased in ischemic stroke patients than control. Also the mutant 241R al-lele was found to be a significant risk factor for development of ischemic stroke (OR= 3.769, 95%, CI (1.683-8.441); p=0.001. Our results also indicate that the (469 E / 241 R) haplotype was significantly higher in patients (18.8%) than in controls (5%) p= 0.000.
This agrees with the study done by Li et al.(10) which was conducted on 309 Chinese patients with ischemic stroke and 309 elderly apparently healthy subjects serving as control group, they reported that KE and EE genotype frequencies were significantly higher in patients than con-trol, with KK genotype as a reference genotype. Also E allele had a significantly increased risk of ischemic stroke in overall population (OR= 1.79, 95% CI = 1.30-2.46; p=0.000) and in fe-males (OR= 2.36, 95% CI= 1.41-3.96, p=0.001), but not in males (OR= 1.48, 95%, CI= 0.98-2.22; p=0.062).
Similar results were obtained by another Chinese study (17) who had found that carriers of 469E allele had a higher risk of ischemic stroke. Similarly, a German study had shown that 469E allele was a genetic factor that may determine an individual susceptibility for coronary heart dis-ease and myocardial infarction (7).
Consistent with our results, Volcik et al.,(16) showed that ICAM-1 241RR genotype was as-sociated with significantly increased risk of isch-emic stroke in both Whites (hazard rate ratios HRR=2.18 (1.01-4.68), (p= 0.05) and African Americans (HRR = 7.04 (3.7-13.3), p< 0.001), However there was no significant findings ob-served for the ICAM-1 K469E polymorphism and incident ischemic stroke.
The current study showed that the median sICAM-1 levels were significantly higher in
ischemic stroke patients than in control group, p= 0.001. Similar to these results, the study done by Volcik et al., (16) and Tanne and Coworkers (15)
who found that mean sICAM-1 concentrations were significantly higher in ischemic stroke cas-es (379±100 ng/l) compared to controls (350±97 ng/l), p= 0.02, a marker of inflammation, are as-sociated with increased risk of ischemic stroke, independent of other traditional cerebrovascular factors. Also they stated that these high levels of sICAM-1 were found to significantly predict fu-ture ischemic stroke.
Our results showed that median triglyceride levels were significantly higher in patients than in the control group, p= 0.013, while other rou-tine laboratory parameters didn’t show any sig-nificance.
These results agree with those reported by Li et al. (10) and Bansal et al. (2), who found triglyc-erides to be an important risk factor for ischemic stroke and also for coronary heart disease as re-ported by Criqui (4).
It is therefore conceivable that polymor-phisms in the ICAM-1 gene might increase the risk of stroke; the observed association with stroke risk is potentially due to the functional impact on the binding affinity of ICAM-1 to both Mac-1 and LFA-1, thus possibly affecting adhesion and further interactions of circulating leukocytes to the vascular wall. Individuals car-rying ICAM-1 241R allele, 469E allele and the 241R/469E haplotype might be more susceptible for developing ischemic stroke. More impor-tantly, the linkage disequilibrium of the ICAM-1 gene with other ischemic stroke predisposing genes should be taken into accounts.
REFERENCES1. Arandi N., Talei A., Erfani N., et al (2008). Intercellular
adhesion molecule-1 genetic markers (+241 G/A and +469 A/G) in Iranian women with breast cancer; cancer genet cytogene 184 : 9.
2. Bansal S., Buring JE., Rifai N et al (2007). Fasting compared with non-fasting triglycerides and risk of cardiovascular events in women. J AMA; 298:309.
3. Buraczynska M., Zaluska M., Buraczynska G., et al (2012). The intercellular adhesion molecule-1 (ICAM-1) gene polymorphism K469E in end-stage renal dis-ease patients with cardiovascular disease. Hum Immu-nol 37: 824.
Role of ICAM-1 and sICAM-1 in Ischemic Stroke 794. Criqui MH. et al (2007) Triglycerides and coronary
heart disease revisited (again). Ann Intern Med; 147: 425.
5. Diamond MS., Staunton DE., deFougerolles AR., et al (1990). JCAM-1: a counter-receptor for Mac-1. J Cell Biol 111: 3129.
6. Friedwald WT., Levy RI., Fredrickson DS (1972). Esti-mation of the concentration of low density lipoprotein cholesterol in plasma, without use of the preparative ultracentrifuge. Clin Chem 18: 499.
7. Jiang H., Klein RM., Niederacher D (2002). C/T poly-morphism of the intercellular adhesion molecule-1 gene (exon6, codon 469). A risk factor for coronary heart disease and myocardial infarction. In J Cardiol 84: 171.
8. Joling P., Boom S., Johnson J (1994). Domain 5 of the intercellular adhesion molecule-1 (ICAM-1) is in-volved in adhesion of B-cells and follicular dendritic cells. Adv Exp Med Biol; 344: 131.
9. Lerant and Csiba (2012). The role of extracranial ul-trasound in the prevention of stroke based on the new guidelines. Perspect Med 1-12: 94.
10. Li XX., Liu JP., Cheng IQ., et al (2009). Intercellular adhesion molecule-1 gene K469E polymorphism and ischemic stroke: a case-control study in a Chinese pop-ulation. Mol Biol Rep; 36: 1565.
11. Reilly PL., Woska JR., Jeanfavre DD (1995). The native structure of intercellular adhesion molecule-1 (ICAM-1) is a dimmer. Correlation with binding to LFA-1. J Immunol; 155: 529.
12. Rekik I., Allassonniere S., Carpenter TK., et al (2012). Medical image analysis methods in MR/CT-imaged acute-subacute ischemic stroke lesion. Segmentation, prediction and insight into dynamic evolution simula-tion models. A critical appraisal; Neuroimage: Clinical 1:164.
13. Risk NM., Derbala MF (2013). Genetic polymorphisms of ICAM-1 and IL28 as predictors of liver fibrosis se-verity and viral clearance in hepatitis C genotype 4. Clin Res Hepatol Gas 37(3): 262.
14. Staunton DE., Dustin ML., Erickson HP., et al (1990). The arrangement of the immunoglobulin-like domains of ICAM-1 and the binding sites for LFA-1 and rhino-virus. Cell; 61: 243.
15. Tanne D., Haim M., Boyko V (2002). Soluble intercel-lular adhesion mdecule-1 and long term risk of acute coronary events in patients with chronic coronary heart disease. J Am Coll Cardiol; 39: 1133.
16. Volcik KA., Ballantyne CM., Hoogeveen R., et al (2010). ICAM-1 G241R polymorphism predicts risk of incident ischemic stroke: the atherosclerosis risk in communities (ARIC) study. Stroke; 41(5): 1038.
17. Wei YS., Liu YU., Huang RY (2005). Intercellular adhesion molecule-1 gene K469E polymorphism and genetic susceptibility of ischemic stroke in Chinese Zhuang populations. Zhonghsa Yi Xue Yi Chuen Xue Za Zhi; 22: 305.
Mohy, A.M. et al.80
sICAM-1 ومستوى , K469E)و (G241R ICAM-1 1-دور تعدد األشكال لجين جزيء االلتصاق الخلوىفى المصل في تطوير السكتة الدماغية في المرضى المصريين
عبير محمد محي - أحمد عبد اهلل حسن علي -هبة عمرالعالم. وشارك جزيء االلتصاق الخلوى-ICAM-1( 1( في للوفاة في الدماغية هي حاليا ثالث سبب رئيسي خلفية: السكتة االلتصاق جزيء لجين األشكال تعدد بين العالقة لتحديد األهداف: الدماغية. السكتة ظعن المسؤولة لألمراض المسببة اآلليات الخلوى-G241R ICAM-1 1) و(K469E , ومستوى sICAM-1فى المصل في تطوير السكتة الدماغية في المرضى المصريين المواضيع وطرق:تحليل الحمض النووى ل G241R ICAM-1 وK469Eتعدد االشكال الجينى بواسطة تقنية )ASP( وتفاعل البلمرة المتسلسل )PCR - RFLP( ، في 40 مريض يعانون من السكتة الدماغية و 40 اصحاء كمجموعة ضابطة. وقد تم قياس 469Eأليل و ICAM-1 241R النتائج: فى الدراسة الحالية تم الكشف عن ان .)ELISA( فى المصل عن طريق تقنية sICAM-1أليل مرتبطان بشكل كبير بزيادة مخاطر السكتة الدماغية. وكانت مستويات sICAM-1 فى المصل أعلى بكثير في مجموعة المرضى. االستنتاج: هذه النتائج تشير إلى أن G241R ICAM-1 وK469E تعدد األشكال الجيني قد تؤثر على قابلية الكتساب السكتة الدماغية
فى المجتمع المصرى.
γ- GLOBIN GENE XMN1 POLYMORPHISM-158 AND ITS CORRELATION TO THE RESPONSE TO HYDROXYUREA IN βTHALASSEMIA MAJOR
PATIENTS IN BENISUEF GOVERNORATE(EGYPT)Abdel Meged A. Abdel Meged*, Dalia G. Amin**, Dalia S. Morgan*and Safwat L. Shaker*
ABSTRACTβ-thalassemia is an inherited disorder characterized by a deficient or absent β-globin chain production, resulting in hypo-
chromic microcytic hemolytic anemia. Xmnl polymorphism has been reported to increase the level of hemoglobin F (HBF) and to give a better response to Hydroxyurea (HU) therapy in B-thalassemia patients. This study was conducted on 80 randomly selected cases of ß-thalassemia major patients and 40 age and sex matched controls; to study the prevalence of γ- globin gene Xmn1 polymorphism -158 in β- thalassemia patients by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP), results were correlated with percent of HBF, response to HU, and other clinical and hematological variables. Nine out of 80 ß-thalassemia major patients (11.25%) were heterozygous for Xmn1 polymorphism, homozygous Xmn1 poly-morphism was not detected in any of the included patients. The frequency of Xmn1 polymorphism in males and females showed no significant difference. Nearby frequency for heterozygous Xmn1 polymorphism was found among control subjects (5 out of 40, 12.5%), none was homozygous for Xmn1 polymorphism. Among the ß-thalassemia major group, a significant association was found between the presence of Xmn1 polymorphism and older age at first blood transfusion (p value = 0.02), higher Hb F levels (p value = 0.04), lower incidence of splenectomy (p value = 0.04) and decreased frequency of blood transfusion after HU treatment (p value = 0.03). The frequency of blood transfusion before HU treatment was lower in the presence of Xmn1 polymorphic site, however, statically it was not significant (p value = 0.76). Key wards: β-Thalassemia, Xmn1 polymorphic site, Hydroxyurea.
INTRODUCTION
In patients with β-thalassemia, blood trans-fusion at regular intervals eliminates anemia-related complications, compensatory marrow expansion and extends survival(11). Iron chela-tion reduces the accumulation of iron secondary to multiple transfusions, thereby dramatically improving the prognosis(12). However, adequate iron chelation is expensive; therefore alterna-tives to blood transfusion and chelation would be valuable to increase the safety and decrease the cost of thalassemia treatment and to provide effective treatment for patients who do not have access to blood transfusions(9).
Hydroxyurea is a pharmacological inducer of fetal hemoglobin (HbF) that significantly in-creases Hb levels and reduces transfusion needs in patients with thalassemia(14). Hydroxyurea induced increase in γ-chain synthesis may de-crease the imbalance between α and non α chain inβ-thalassemia patients.
It has been reported that in patients with β-thalassemia the presence of Xmnl polymor-
phic site, is associated with higher level of HbF(6), and better effect of Hydroxyurea(14).Also, there is strong evidence that the homozygous state of Xmn1 polymorphic site which is associ-ated with increased expression of Gγ gene may play an important role among other factors in ameliorating the clinical features of homozygous β -thalassemia intermedia(14).
Aim of the Work
The aim of this study is to determine the prevalence of Xmnl polymorphic site (C/T) 5’ to the Gγ gene in position -158 in a group of Egyptian β-thalassemia major patients as well as another group of healthy subjects, also to study its co-relation to the age of receiving first blood transfusion, rate of splenectomy, level of Hb F and response to HU in β-thalassemia major pa-tients in Egypt.
SUBJECTS AND METHODS
The present work is a prospective study con-ducted on 80 cases of β-thalassemia major and 40 age and sex matched control subjects; patients
Egypt. J. Lab. Med. Vol.(27) No.3, October, 2015, 81 - 88
Departments of Pediatrics*, Faculty of Medicine, Beni-Suef University and Clinical & Chemical Pathology**, Faculty of Medicine , Cairo University.
Abdel Meged, A. A. et al.82were randomly selected from the Hematology Clinic of follow up and blood transfusion;Beni-Suef University Hospital in collaboration with the Clinical Pathology Department, Faculty of Medicine, Cairo University. The study was ap-proved by the Ethics Committee of Cairo Uni-versity as well as Beni-Suef University and all procedures performed in studies involving hu-man participants were in accordance with their Ethical Standards. Informed Consent was ob-tained from each participant’s guardian.
Patients were subjected to full medical histo-ry and thorough physical examination stressing on the following points: age of presentation of anemia, age of first blood transfusion, frequency of blood transfusion, history of splenectomy, ad-ministration of HU, and facial bony deformities.
For both groups venous blood samples were collected in EDTA containing vacutainers to be used for performing: complete blood picture (CBC), high performance liquid chromatography (HPLC) for proper determination of HbF percent using variant II TM Hb testing system, Bio-Rad and study of single-nucleotide Xmn1 polymor-phism (C/T) in γ- globin gene position -158 in β- thalassemia patients, which was performed by polymerase chain reaction-restriction fragment length polymorphism assay (PCR-RFLP).
Statistics:The data was analyzed with the Sta-tistical Package for Social Science (SPSS)pro-gram version 16 under windows 7 in the form of description of qualitative variables by frequency and percentage, description of quantitative vari-ables in the form of mean and standard devia-tion (mean ± SD), Chi-square ( )test was used for comparison of qualitative variables with each other, comparison between quantitative variables was carried by using: Student unpaired t-test of two independent samples, and Significance level
For PCR-RFLP; genomic DNA was extracted from peripheral blood leukocytes, and stored at -80o C. Amplification of a 650-bp fragment 5’ to the γ- globin gene that contains the Xmn1poly-morphism was done by PCR using the primers and technique that were described before(14). The 25µl reaction mixture contained 1x PCR Buffer (100 mMTris HCL, 500 mMKCl, 0.8% Nonidet P40) 1mM MgCl2, 100µM dNTPs (dATP, dGTP, dCTP, dTTP), 10 pm/µl PCR primers, 3 units/µl Taq DNA polymerase (Fermentas life Science, USA) 100 ng of genomic DNA and the final vol-ume was made up with autoclaved MilliQ water. Working conditions were as follows: the initial denaturation at 94oC for 5 minutes, and then 30 cycles of: denaturation at 94oC for 1 minute, an-nealing at 55oC for 1 minute and extension at 72oC for 1.5 minutes followed by a final exten-sion step at 72oC for 5 minutes.
Genotyping of wild type and mutant allele of Xmn1 was carried out using RFLP method; about 10µ of the amplified PCR product was digested with five units of Xmn1 restriction en-zyme and electrophoresed on a 2% agarose gel. In the presence of T allele (mutant), two frag-ments of 450- and 200-bp were produced. The presence of the normal allele (C) loses cleavage site for Xmn1 and thus an intact 650-bp frag-ment was produced (Fig. 1).
(p) was expressed as following: P value > 0.05 is insignificant, P value < 0.05 is significant and P value < 0.001 is highly significant.
RESULTSThis study included 80 patients with β thal-
assemia major 48 (60%) were males and 32 (40%) were females. The age of the study group ranged from 3 year to 16 years, with a mean of 8.4 ±2.98.Nine out of 80 ß-thalassemia major patients (11.25%) were heterozygous for Xmn1
Table (1): Primer sequence and restriction enzymes used in the PCR-RFLP reaction
ᵒ
ᵒ
ᵒ
γ- Globin Gene Xmn1 Polymorphism and Response to HU in βThalassemia 83polymorphism (+/-), homozygous Xmn1 poly-morphism (+/+) was not detected in any of the included patients. Nearby frequency for hetero-zygous Xmn1 polymorphism was found among control subjects (5 out of 40, 12.5%), none was homozygous for Xmn1 polymorphism.
The frequency of Xmn1 polymorphic site in males and females was 10 %(5 out of 48) and 12.5 % (4 out of 32) respectively with no signifi-cant difference (p value = 0.589).
Pre transfusion Hb ranged from 6 g. /dl to 9 g. /dl. with a mean value 7.56 ± 0.52 and the age of first blood transfusion ranged from 5 months of age to 30 months old.
Although, Hb levels were higher in the group of patients with Xmn1 polymorphism compared to the group without Xmn1 polymorphism, how-ever that difference was not statistically signifi-cant (p value = 0.78).
A statisticallysignificant correlation was found between the presence of Xmn1 polymor-phic site and the age of first blood transfusion (P = 0.02). In the presence of Xmn1 polymor-phic site, the need for blood transfusion was at an older age.
The frequency of blood transfusion before HU, showed a mean value of 13.46 ±2.53 times/year as it ranged from 8 to 20 times/year, while after HU the mean value became 3.89 ± 4.98 as
it ranged from 0 to 15 times/year.
The frequency of blood transfusion before HU treatment was decreased in the presence of Xmn1 polymorphic site,however, statistically it was not significant (p value = 0.76), while after HU treatment a significant correlation was found between the presence of Xmn1 polymorphic site and the frequency of blood transfusion. The fre-quency of blood transfusion after HU treatment was decreased in the presence of Xmn1 poly-morphic site (p value = 0.03).
A significant correlation between Xmn1 polymorphic site and Hb F level was detected. Hb F levels were higher in the presence of Xmn1 polymorphic site compared to the absence of Xmn1 polymorphic site (p value = 0.04).
A significant negative association was found between the presence of Xmn1 polymorphic site and splenectomy (p value = 0.04). Splenectomy-was done for 23 patient among our studied group none of them was carrying the Xmn1 polymor-phism.
No significant correlation was found between the presence of Xmn1 polymorphic site with his-tory of consanguinity, family history of similar condition, duration of illness, or incidence of chelation therapy.
Table (2): Parameters associated withγ- globin gene -158Xmn1 polymorphism
Abdel Meged, A. A. et al.84
DISCUSSION
Beta-Thalassemia major has a spectrum of clinical severity which is associated with inef-fective erythropoiesis, bone marrow expansion and rapid destruction of erythrocytes. Anemia demands frequent blood transfusion to maintain life while hemosiderosis and other complications of the disease require a continuous and distress-ing treatment regimen that includes iron chela-tion treatment, regular medical supervision, and frequent admission to the hospital and on many occasion surgeries. The only curative treatment for this disease is bone marrow transplantation (BMT) which is expensive and has a variable success rate of 60-70%(2).
Patients with severe β-thalassemia are usu-ally diagnosed between 6 months and 2 years of age when the normal physiological anemia of the newborn fails to improve. Sometimes, the patients cannot be recognized until the child reaches 3 to 5 years of age because the infant is able to partially compensate for the marrow’s inability to produce hemoglobin A by prolonged production of Hb F(23).
In the present study the frequency of pres-ence Xmn1 polymorphic site in 80 patients with β-thalassemia major was found to be 11.25%, the prevalence of Xmn1 polymorphic site 5′ to the Gγ gene is different among various populations.
Among Egyptians, a frequency of 6.25%,9%, 4%and 8.3 have been reported for Xmn1 poly-morphism among Egyptians with β-thalassemia, respectively(18, 10, 21, 20).
In agreement Wong et al. (2006)(24) found that the frequency in Chinese β-thalassemia ma-jor patients was 10.3%, a nearby frequency was reported by Geoffrey etal(8). in Hong Kong who demonstrated that the frequency of Xmn1 poly-morphism (at nucleotide 158 bp5`) was 13%.
On the other hand, Mehrnoosh et al(11). report-ed that 76% of Iranians β-thalassemia major pa-tients had positive Xmn1 polymorphism, while a frequency of 25% for Xmn1 polymorphic site in 64 β-thalassemia patients from India has been reported(18,24).
Regarding the current study, the most fre-quent genotype observed was homozygosity for the absence of the XmnI site (-/-) in 88.75% of cases, heterozygosity (+/-) genotype was detect-ed in 11.25 % of cases, while homozygosity for the XmnI polymorphic site (+/+) genotype was absent.
The 158 (C-T) polymorphism of the Gγ-globin gene (Xmn1 polymorphism) is known to ameliorate the severity of the disease because of its strong association with an increased pro-duction of HbF(1).HbF production can partially compensate for the lack of adult hemoglobin (Hb A) in patients with β-thalassemia major or intermedia, and ameliorate the clinical severity of these diseases(8). The presence of Xmn1 poly-morphic site 5′ to the Gγ-globin promoter region was positively correlated with elevated synthe-sis of fetal Hb and its Gγ-globin component in term newborn infants and is associated with de-layed switch over from fetal to adult hemoglo-
Fig. 1 An agarose gel electrophoresis pattern of some of PCR products with 650 bp from patients digested with Xmn1.Lane 1: DNA ladder (100, 200, 300, 400 bp,…), Lanes 2, 4, 6, 7, 9 and 10 are homozygous for the wild allele Xmn1(-/-); showing one band at 650 bp.Lanes 3, 5, 8 and 11 are heterozygous for Xmn1 polymorphism (+/-); showing three bands (one at 450 bp and the second at 200 bp and the third at 650 bp).
γ- Globin Gene Xmn1 Polymorphism and Response to HU in βThalassemia 85bin. It is unknown that how Xmn1 polymorphic site influences the expression of the Gγ-globin gene. It seems that interaction of a multi-protein transcription complex to be involved. In a ge-nome-wide linkage study of large Asian Indian kindred, a genetic interaction between the Xmn1 polymorphic site and a locus on chromosome 8q was reported to have influence on adult F cell (FC) levels(22).
Analysis of β-globin gene cluster showed a strong association between the Xmn1 polymor-phic site and FC levels. Unlike the rare mutations in the γ-globin promoter that are consistently as-sociated with large discrete effects of increased Hb F levels of 10-35% in heterozygote, the so-called pan cellular hereditary persistence of fetal hemoglobin (HPFH), the change at Gγ-158 does not always raise the Hb F levels in otherwise normal individuals. The Xmn1 polymorphic site is not a recognized binding motif for any of the known transcription factors. Nonetheless, al-though it has little effect in normal individuals, clinical studies have shown that, under condi-tions of hemopoietic stress, for example in ho-mozygous β-thalassemia and sickle cell disease, the presence of Xmn1 polymorphic site favors a higher Hb F response. This may explain why the same mutations on different β-chromosomal backgrounds (some with and others without the Xmn1 polymorphic site) are associated with dif-ferent clinical severity.
However, Hb F response associated with the Xmn1 polymorphic site is usually moderate and may not be sufficient to explain the wide differ-ence in phenotype observed in some cases(13, 20).
Rahimi et al. in a study on sickle cell patients from Southwest Iran, showed that in the pres-ence of Xmn1 polymorphic site the Hb F levels and Gγ: Aγ ratio were increased(15).
One more study demonstrated that in patients with hypoplastic syndromes the presence of Xmn1 polymorphic site, significantly correlated with Hb F levels(19).
Ballas et al., revealed that there was a signifi-cant correlation between the presence of Xmn1 polymorphic site and increased Gγ: Aγ ratio. However, the Hb F level was not significantly-
increased in the presence of Xmn1 polymorphic site in their study. Although Xmn1 polymorphic site maintains a Gγ: Aγ ratio typical of fetal life but does not necessarily cause elevation of Hb F. The latter seems to depend on factors other than the Xmn1 polymorphic site(3).
The present study demonstrated that cases with Xmn1 Gγ (+/-) showed higher Hb F, as Hb F level was 76.38 % in comparison with the mean Hb F in Xmn1 Gγ (-/-) cases which was 26.55%. This agrees with the finding of Garner et al.(7) they reported that the β-thalassemia patients who had also co-inherited the Xmn1 polymorphism in the Gγ-globin gene promoter had higher mean HbF than non carriers of this polymorphism, also Majid et al.,(25) found that C-T polymorphism at 158 upstream of the Gγ globin gene, has been shown to be responsible for high HbF levels in β-thalassemia and sickle cell disease. This was strengthened byMehrnoosh et al.(11) they postu-lated that the presence of the Xmn1 marker un-der the condition of hematopoietic stress might contribute to over production of Hb F causing persistence of high fetal hemoglobin HPFH. It seems that this phenomenon carries mild feature of the disease.
In the present study 29% of β-thalassemia pa-tients had been splenectomized. All of them were negative for Xmn1 polymorphic site. We found that there is a significant negative association be-tween the presences of Xmn1 polymorphic site and splenectomy. Splenectomy indicated when massive splenomegaly causes hypersplenism, which aggravates anemia, thrombocytopenia, and leucopenia and increases transfusion re-quirements. Removing of the spleen often brings the situation back to what it was earlier in life. The anemia gets better, so some people can stop transfusions again after splenectomy(5).
In this study the frequency of blood transfu-sion after HU treatment was significantly de-creased in the presence of Xmn1 polymorphic site Xmn1 +/- in comparison to Xmn1 -/-, hy-droxyurea enhances fetal hemoglobin produc-tion.
In agreement, Mehrnoosh et al.(11) reported that β-thalassemia major or intermedia with Xmn1 polymorphism showed better response of
Abdel Meged, A. A. et al.86HU than Xmn1 -/- genotype. In consolidation, it is reported that treatment of β-thalassemia patients with hydroxyurea, in the presence of Xmn1 polymorphic site has affected the clinical response to hydroxyurea therapy and a better re-sponse has been achieved(16).
An increase in total Hb level has been re-peatedly reported during hydroxyurea treat-ment in patients with sickle cell disease and β-thalassemia. A marked elevation of total Hb levels with hydroxyurea can eliminate trans-fusion requirements in children with severe β-thalassemia(4).
Majid et al.(25) studied the response of hy-droxyurea treatment in Iranian transfusion de-pendent β-thalassemia patients and found that erythroid cultures from different thalassemia pa-tients showed different results in the presence of hydroxyurea. The number of HbF-cells and the Hb F content per cell increased in some individ-uals, while in others, only the HbF-cell number increased with a moderate rise in HbF content per cell, whereas in other studies only a minimal effect was observed. This variation in response to HU suggested that one or more genetic factors are involved.
The present study revealed that in the pres-ence of Xmn1 polymorphic site, the average age at first blood transfusion was increased com-pared to the absence of a polymorphic site. A significant correlation was identified between Xmn1 polymorphic site and age at first blood transfusion in the present study. It seems that in the presence Xmn1 polymorphic site the need to blood transfusion is decreased.
This was in agreement with Nemati et al.(14) who reported that transfusion dependency start-ed fairly late in the presence of Xmn1 polymor-phic site and thus increased the age at first blood transfusion in patients
REFERENCES1) Agouti I, Badens C, Abouyoub A et al. (2007): Genotypic
correlation between six common beta-thalassemia mu-tation and the Xmn I polymorphism in Moroccan popu-lation. Hemoglobin 31(2):141.
2) Anita Saxena (2003): Growth retardation in thalassemia major patients. Int J Hum Genet. 3 (4): 237.
3) BallasS K, Talacki CA, Adachi K, et al (1991): The Xmn1 site(-158,c→T) 5′ to the G gamma gene: cor-
relation with the Senegalese haplotype and G gamma globin expression. Hemoglobin 15(5):393.
4) Bradai M, Pissard S, Abad MT, et al (2007): Decreased transfusion needs associated with hydroxyurea therapy in Algerian patients with thalassemia major or interme-dia. Transfusion 47(10):1830.
5) Cohen A.R., Galanello R., Pennell D.J. et al. (2004): Thalassemia. Hematol.2004 (1):14.
6) Creary, L.E., Ulug, Menzel, S., Mckenzie, C.A, et al (2009): Genetic variation on chromosome 6 influences F. cell levels in healthy individuals of African descent and HbF levels in Sickle cell patients. Plos One, .4(1): e 4218.
7) Garner C., Tatu T., Best S., et al. (2002): Evidence for ge-netic interaction between the beta-globin complex and chromosome 8q in the expression of fetal hemoglobin. Am J. Hum Gent. 70(3):793.
8) Gibney GT, Panhuysen CI, So JC, et al. (2008): Variable and heritability of HbF and F-cells among β-thalassemia heterozygotes in Hong Kong. Am. J. Hematol. 83(6): 458.
9) Goldstein,D.B. (2009): Common genetic variation and human trials . N_Engl_J_Med. 360 (17): 1696 .
10) Kaddah N, Rizk S, Kaddah A.M., et al (2009): Study of Possible Genetic Factors Determining the Clinical Pic-ture of Thalassemia Intermedia. J. Med. Sci., 9(3): 151.
11)Kosaryan M, VahidshahiK, KaramiH,Ehteshami S. (2009):Effect of Hydroxyurea on Thalassemia major and Thalassemia Intermedia in Iranian patients. Pak. J. Med.Sci., 25(1):74.
12)Mohamed B, Serge P, Moohand TA et al. (2007): De-creased transfusion needs associated with hydroxyurea therapy in Algerian patients with thalassemia major and intermedia. Transfusion 47(10):1830 .
13) Najmabadi H, Karimi-Nejad R, Sahebjam S, et al (2001): The β-thalassemia mutation spectrum in the Iranian population. Hemoglobin 25(3):285.
14)Nemati H, Rahimi Z and Bahrami G. (2010): The Xmn-lpolymorphic site 5’ to theGγ gene and its correlation to theGγ :Aγ ratio, age at first blood transfusion and clinical features in β- Thalassemia patients from West-ern Iran. Mol. Biol. Rep., 37(1):159.
15) Rahimi Z, Karimi M, Haghshenass, et al (2003): Beta globin gene cluster haplotypes in sickle cell patients from Southwest Iran. Am J Hematol., 74(3):156.
16) Rund D and Rachmilewitz.E (2005): β-thalassemia. N. Engl. J. Med., 353(11): 1135.
17) Said F and Abdel-Salam A (2015):XmnI polymor-phism: Relation to b-thalassemia phenotype and gen-otype in Egyptian Children. The Egyptian Journal of Medical Human Genetics 16, 123.
γ- Globin Gene Xmn1 Polymorphism and Response to HU in βThalassemia 8718) Serafi TI, Ismail EF, Mahmoud MA, et al (2008): Ef-
fect Alpha Globlin Gene Deletion And Gamma Globin Gene -158 (C/T) Polymorphism In Beta-Thalassemic Patients. Egyptian Journal of Biochemistry and Mo-lecular Biology Vol. 26 (2): 85.
19) Shimmoto MM, Vicari P, Fernandes AC, et al (2006): Xmn1 polymorphism is associated with fetal hemoglo-bin levels in hypoplastic syndromes. Sao Paulo Med J 124(2):110.
20) Steinberg MH, Forget BG, Higgs DR, et al (2001): Disorders of hemoglobin: genetics, pathophysiology, and clinical management. Cambridge University press, Cambridge,pp 356.
21) Tantawy AAG, Andrawes NG, Ismaeli A, et al (2012): Prevalence of Xmn l G gamma polymorphism in Egyp-tian patients with beta-thalassemia major. Ann Saudi
Med 32(5): 487.
22) Thein SL. (2002): β-thalassemia prototype of a single gene disorder with multiple phenotypes. Int. J. Hema-tol., 76 (Suppl 2) : 96-.
23)Weatherall DJ (2001): Phenotype-genotype relation-ships in monogenic disease.Lessons from the thalas-semias. Nat. Rev. Genet., 2(4): 245.
24)Wong YH, George E, Kim Lian, et al. (2006): Molecular characterization and frequency of XmnI polymorphism in Chinese and Malay β-thalassemia patients in Malay-sia. Malaysian J.Pathol., 28(1): 17.
25)Yavarian M, Karimi M, Bakker E, et al (2004): Re-sponse to hydroxyurea treatment in Iranean trans-fu-sion-dependent β-thalassemia patients. Haematologica 89(10): 1172 .
Abdel Meged, A. A. et al.88
تعدد أشكال γ غلوبين جين Xmn1 -158 وعالقتها باالستجابة لعالج الهيدروكسييوريا
في مرضى الثالسيميا الكبرىβ – في محافظة بني سويف (بمصر)
عبدالمجيد ابوالمجد عبدالمجيد - داليا جميل امين - داليا صابر مرجان - صفوت لطفي شاكر
البيتاثالسيمياهومرض وراثي يتميزبنقص إنتاج أوغياب سلسلة β- غلوبين، مما يؤدى إلى فقرالدم االنحاللي صغير الكريات. تم دراسة تعدد األشكال في جين Xmnl وعالقته بزيادة مستوىالهيموجلوبين ((HBF وإعطاءاستجابة أفضل للعالج بالهيدروكسي يوريا (HU) في المرضى الذين يعانون من الثالسيميا الكبرى β وقد أجريت هذه الدراسة على 80 حالة تم اختيارها عشوائيا من بين مرضى الثالسيميا الكبرىβ و 40 شخص متجانسين في العمر والنوع كمجموعة ضابطه لدراسة انتشار γ تعدد األشكال في الجين γ غلوبين (PCR-RFLP) بواسطة تفاعل البلمرة المتسلسل متبوعا بالتقطيع المحدد االطوال. تعدد األشكال -β في مرضىالثالسيميا Xmn1 -158تم دراسة االرتباط بينه وبين نتائج النسبه المئويه لHBF، االستجابه للعالج بالHU، وغيره امن المتغيرات االكلينكيه والمعمليه. تسعة منأصل ß 80 مرضىالثالسيميا الكبرى (٪11.25) متخالف لXmn1 تعدد األشكال. أظهرXmn1 تعدد األشكال في الذكورواإلناث اليوجد فرق احصائي. تم العثورعلى نسبه متقاربهXmn1تعدد األشكال بين المجموعه الضابطة (5 منأصل 40، ٪12.5). من بين مجموعة كبيرة-ß الثالسيميا تم العثورعلى ارتباط كبير بين وجودXmn1 تعدد األشكال وكبرالسن في نقل الدم للمره األولي ( القيمة = 0.02)،وارتفاع مستويات الهيموجلوبين F (قيمةP = 0.04)، انخفاض نسبة استئصال الطحال (قيمة = 0.04) ، وانخفضت وتيرة نقل الدم بعد العالج HU (قيمةP = 0.03). وكان تواترنقل الدم قبل العالج HUأقل في وجودXmn1موقع متعدد األشكال، ولكن، بشكل ثابت
لم يكن ذو دالله احصائيه (قيمةP = 0.76). كلمات مفتاحيه: β-الثالسيميا،Xmn1متعدد األشكال، هيدروكسي يوريا.
Modern Commercial Press22, Idress Ragheb St., - El Daher -Ramsis
Tel.: 2590 33 64 - 2590 23 67 , Fax : 2590 23 68-cairo
Email : [email protected] Mobil: 01001400710
Modern Commercial Press22, Idress Ragheb St., - El Daher -Ramsis
Tel.: 2590 33 64 - 2590 23 67 , Fax : 2590 23 68-cairo
Email : [email protected]