sumoylation in aspergillus nidulans inactivation

Available online at www.sciencedirect.com

www.elsevier.com/locate/yfgbi

Fungal Genetics and Biology 45 (2008) 728–737

Sumoylation in Aspergillus nidulans:sumO inactivation, overexpression and live-cell imaging

Koon Ho Wong a, Richard B. Todd a, Berl R. Oakley b, C. Elizabeth Oakley b,Michael J. Hynes a, Meryl A. Davis a,*

a Department of Genetics, The University of Melbourne, Grattan Street, Parkville, Vic. 3010, Australiab Department of Molecular Genetics, Ohio State University, Columbus, OH 43210, USA

Received 14 September 2007; accepted 21 December 2007Available online 11 January 2008

Abstract

Sumoylation, the reversible covalent attachment of small ubiquitin-like modifier (SUMO) peptides has emerged as an important reg-ulator of target protein function. In Saccharomyces cerevisiae, but not in Schizosaccharyomes pombe, deletion of the gene encodingSUMO peptides is lethal. We have characterized the SUMO-encoding gene, sumO, in the filamentous fungus Aspergillus nidulans.The sumO gene was deleted in a diploid and sumOD haploids were recovered. The mutant was viable but exhibited impaired growth,reduced conidiation and self-sterility. Overexpression of epitope-tagged SumO peptides revealed multiple sumoylation targets in A. nidu-

lans and SumO overexpression resulted in greatly increased levels of protein sumoylation without obvious phenotypic consequences.Using five-piece fusion PCR, we generated a gfp-sumO fusion gene expressed from the sumO promoter for live-cell imaging of GFP-SumO and GFP-SumO-conjugated proteins. Localization of GFP-SumO is dynamic, accumulating in punctate spots within the nucleusduring interphase, lost at the onset of mitosis and re-accumulating during telophase.� 2007 Elsevier Inc. All rights reserved.

Keywords: SUMO; Conidiation; Sexual development; Fusion PCR; Cell cycle

1. Introduction

Sumoylation, the covalent addition of a small ubiquitin-like modifier (SUMO) peptide, is a conserved post-transla-tional modification that can influence the activity, interac-tion or subcellular location of a diverse array of proteins(Melchior, 2000; Verger et al., 2003). The addition ofSUMO peptides to target proteins is catalyzed by a seriesof enzymatic steps in which the SUMO peptide precursoris first cleaved to produce a mature peptide with a C-termi-nal di-glycine motif (Johnson et al., 1997; Kamitani et al.,1997). SUMO peptides are activated by the E1-activatingenzyme and transferred to the E2-conjugating enzymeUbc9 for covalent attachment, via the di-glycine motif, toa lysine residue on the target protein by a member of the

1087-1845/$ - see front matter � 2007 Elsevier Inc. All rights reserved.

doi:10.1016/j.fgb.2007.12.009

* Corresponding author. Fax: +61 3 83445139.E-mail address: [email protected] (M.A. Davis).

E3-SUMO ligase family (Johnson and Blobel, 1997; Sch-warz et al., 1998; Takahashi et al., 2001). The covalentattachment of SUMO peptides to proteins is reversible bya family of SUMO-specific proteases (Gong et al., 2000;Gong and Yeh, 2006; Li and Hochstrasser, 1999; Yehet al., 2000).

In higher eukaryotes, sumoylation is involved in cellcycle progression, genome stability, DNA repair, transcrip-tional regulation and signal transduction (see Gill, 2004;Johnson, 2004; Verger et al., 2003 for reviews). Proteomicanalyses in Saccharomyces cerevisiae has revealed thatsumoylation is involved in a similarly broad range of func-tions including transcription, translation, DNA replicationand stress responses (Denison et al., 2005; Hannich et al.,2005; Panse et al., 2004; Wohlschlegel et al., 2004; Zhouet al., 2004). SUMO peptides are a highly conserved familyof proteins found in all eukaryotes. In vertebrates, theSUMO family comprises four genes while eight SUMO

mailto:[email protected]

K.H. Wong et al. / Fungal Genetics and Biology 45 (2008) 728–737 729

genes have been identified in Arabidopsis thaliana (Bohrenet al., 2004; Kurepa et al., 2003; Su and Li, 2002). In con-trast, the yeasts S. cerevisiae and Schizosaccharomyces

pombe each contain a single gene (SMT3 and pmt3, respec-tively) (Giaever et al., 2002; Johnson et al., 1997; Tanakaet al., 1999). Deletion of SMT3 in S. cerevisiae is lethalwhereas the pmt3D mutant in S. pombe is viable but showsseverely reduced growth and aberrant cellular and nuclearmorphologies (Giaever et al., 2002; Johnson et al., 1997;Tanaka et al., 1999).

We have identified the sumO gene encoding the SUMOpeptide in Aspergillus nidulans and show that inactivationof this gene is not lethal in this filamentous fungus. The roleof sumoylation has been investigated by determining thein vivo effects of gene inactivation and of sumO overexpres-sion. The tagging of the SUMO peptide with GFP hasrevealed a dynamic pattern to the subcellular localizationof sumolyated proteins during the cell cycle.

2. Materials and methods

2.1. Fungal strains, media and molecular methods

Complete and ANM minimal media were as describedby Cove, 1966 and YAG medium contained 5 g/L of yeastextract and 20 g/L D-glucose. Minimal medium contained1% glucose or xylose where indicated to induce expressionfrom the xylP promoter. Nitrogen sources were added at aconcentration of 10 mM unless otherwise indicated. Fortesting sensitivity to compounds, 0.0025% methyl methane-sulfonate (MMS) or 5 mM hydroxyurea (HU) was addedto glucose minimal medium containing ammonium tartrateas the nitrogen source. Glufosinate solution was preparedas described (Nayak et al., 2006) and used at a final concen-tration of 25 ll/ml. Benlate� (1 lg/ml) was added to com-plete medium to induce haploidization. Standard geneticmanipulations and gene symbols were as described (Clut-terbuck, 1974; Todd et al., 2007a,b). For sexual develop-ment in homokaryons, MH1 (biA1) and MH10992 (biA1;wA3; sumOD) conidia were inoculated onto solid biotin-supplemented minimal medium with 10 mM sodium nitrateas the nitrogen source, incubated at 37 �C for 2 days beforethe plate was sealed and further incubated at 37 �C for 7days. For analysis of sexual development in heterokaryonswild-type (A234: yA2 pabaA1) and sumOD (MH10992:biA1; wA3;sumOD) were inoculated to solid complete med-ium and grown for 2 days. A mixture of hyphae from eachparent was transferred to unsupplemented solid 10 mMsodium nitrate-minimal medium, incubated at 37 �C for 2days, sealed and incubated for a further 7 days. The prep-aration of protoplasts and transformation was as described(Andrianopoulos and Hynes, 1988). Colony growth(hyphal extension) of MH1 (biA1) and MH10992 (biA1;sumOD) was measured as the radius of the colony fromthe point of conidial inoculation to the outermost edgeon solid complete medium incubated at 37 �C. Spore countwas as described (Todd et al., 2006). TNO2A7 (nkuA:argB

pyroA4 pyrG89 riboB2) was the recipient for the gfp-sumO

construct. R153 (wA3; pyroA4) was used as a control strainto verify that gfp-sumO fully substitutes for the sumO gene.Time-lapse GFP-SumO images were made with LO1655(pyrG89 Aspergillus fumigatus pyrG+; pabaA1; gfp-sumO;mipAR243) or with progeny of a cross between LO1761(mCherry-c-tubulin, pyrG89 A. fumigatus pyrG+; pabaA1;pyroA4; riboB2) and LO1655. Standard molecular methodsfor DNA manipulations, nucleic acid blotting and hybrid-ization were as previously described (Sambrook et al.,1989). Genomic DNA was isolated as described (Lee andTaylor, 1990). Oligonucleotide sequences are listed inTable 1. DNA sequencing was performed by the AustralianGenome Research Facility (Brisbane, Australia).

2.2. Isolation and deletion of the A. nidulans sumO gene

The single A. nidulans sumO gene AN1191.3 was identi-fied by tblastx and blastp searches (Altschul et al., 1990)using S. cerevisiae Smt3 (Accession No. AAB01675)against the A. nidulans genome database (AspergillusSequencing Project. Broad Institute of MIT and Harvard(http://www.broad.mit.edu)). The open reading framewas annotated using the GeneScan algorithm in Biomanag-er of ANGIS (http://biomanager.angis.org.au) and con-firmed by alignment with the full-length EST sequence(GenBank Accession No. AA965561). A 3962 bp PCRproduct containing the sumO gene and flanking sequenceswas amplified from wild-type (MH1: biA1) genomic DNAusing sumo-F (�2153 to �2135) and sumo-R (+1809 to+1788) primers. The fragment was cloned into pGEMT-easy (Promega) (pCW6726) and sequenced. The HindIII/SmaI fragment of pCW6726, which includes the entiresumO coding region, was replaced by the HindIII/EcoRVfragment of pMT1612 containing the dominant selectablemarker Bar conferring glufosinate resistance (Monahanet al., 2006), to generate pCW6042. A linear PCR productgenerated using sumo-F and sumo-R primers frompCW6042 was transformed into a diploid strain(MH6590: suA1adE20 yA2; AcrA1; galA1; pyroA4;

facA303; sB3; nicB8; riboB2/biA1; wA3; amdI9; niiA4

riboB2 facB101). sumOD heterozygotes were identified bySouthern blot analysis using a PCR product amplified withsumo-F3 (�26 to �5) and sumo-R (+1809 to +1788) as aprobe.

2.3. Generation of a xylP(p)sumOFLAG overexpressionstrain

A PCR product, amplified from wild-type genomicDNA with sumo-F3 (�26 to �5) and sumo-R primers(+1809 to +1788), was cloned into the EcoRV site ofpBluescriptSK+ (pCW6572). The SmaI/HindIII fragmentof pCW6572 was subcloned into the SmaI/HindIII sitesof pSM6130, which carries the xylose inducible promoter(xylP(p)) (Zadra et al., 2000), to give rise to pCW6574.The Bar gene was then cloned as an EcoRV fragment from

http://www.broad.mit.edu

http://biomanager.angis.org.au

Table 1Oligonucleotides used in this study

sumo-F: 50-TCGTGCCGTTGCTGTTAC-30

sumo-R: 50-CACCCCAGACTGACGCCATAC-30

sumo-F3: 50-TCGATAACTCCCAAATAGTTTCFlag-sumo-InvF: GATGACGATAAACCATCTGCTCCCACTCCTGAGGCFlag-sumo-InvR: TACGATATCTTTGTAATCAGACATTGTTGAAACTATTTGGP1: GAGCGCTGAGTCGGCGAGGTAP2: TACTTACATTCAATGACGCGP3: CGAAGAGGGTGAAGAGCATTGAGTATCCAAGCGAATTACATCATGpyrGF2: CAATGCTCTTCACCCTCTTCGPyrGR: CTGTCTGAGAGGAGGCACTGATGCP4: CATCAGTGCCTCCTCTCAGACAGCAGGAGCAAATTGTACTTGP5: AGTGAAAAGTTCTTCTCCTTTACTCATTGTTGAAACTATTTGGGAGLIZP186: ATGAGTAAAGGAGAAGAACTTTTCACTLIZP184: GGCACCGGCTCCAGCGCCTGCACCAGCTCCTTTGTATAGTTCATCCATGCCP6: GGAGCTGGTGCAGGCGCTGGAGCCGGTGCCATGTCTGATCCATCTGCTCCCACP7: AGGAACAGCGAGCTTACGAP8: ATTCGAGCGCCCAAGAGGACGG

730 K.H. Wong et al. / Fungal Genetics and Biology 45 (2008) 728–737

pSM5962 into the SmaI site of pCW6574 to createpCW6575. Flag-sumo-InvF and Flag-sumo-InvR primers,each containing the sequences for half of the Flag epitope(underlined in Table 1) were used for inverse PCR onpCW6575 and the product was digested using the EcoRVrestriction site (in bold in Table 1) incorporated into theFlag-sumo-InvR primer and self-ligated to introduce thefull Flag epitope coding sequence in-frame between thethird and fourth codons of the sumO gene (pCW6747).Co-transformation of this construct used the pyroA select-able marker plasmid pI4 (Osmani et al., 1999) and asumOD recipient (MH10996: biA1; wA3; pyroA4; sumOD).To target the xylP(p)sumOFLAG construct to sumO,pCW6747 was transformed into MH11036 (pyroA4;nkuA::argBD; riboB2), glufosinate resistant transformantswere isolated and homologous integration at sumO wasconfirmed by Southern blot analysis.

2.4. Detection of SumOFLAG and SumOFLAG-modified

proteins

Fifty micrograms of crude protein extracts from thespecified growth conditions were resolved on denaturing15% SDS–PAGE, blotted onto PVDF membrane (Milli-pore) and probed with Anti-FLAG (M2, Sigma) antibodyat 1/10,000 dilution followed by anti-mouse IgG HRP(Promega) at 1/4000 dilution and chemiluminescence withthe ECL Plus Western blotting detection system(Amersham).

2.5. GFP tagging of SumO

Five separate fragments were made by PCR. Three frag-ments of the sumO gene were amplified from A. nidulans

genomic DNA: the 50 untranslated region from �1589 to�521 relative to the start codon of sumO was amplifiedwith primers P1 and P3, a fragment (�521 to �1) contain-ing the sumO promoter was amplified with primers P4 and

P5 and a fragment (+1 to +1009) carrying the sumO codingsequence and a region of the 30 untranslated region wasamplified using primers P6 and P8. Primers P3, P4, P5and P6 were synthesized with extensions that overlap A.fumigatus pyrG and gfp amplified from plasmid pFN03(Yang et al., 2004). A fragment carrying the A. fumigatus

pyrG gene (Weidner et al., 1998) was amplified with prim-ers pyrGF2 and pyrGR and a fragment carrying the GFPcoding sequence was amplified with primers LIZP186 andLIZP184. The 30 primer (LIZP184) was designed to encodefive glycine–alanine repeats at the C-terminus of GFP toprovide a flexible linker. The five PCR fragments weremixed as template for the fusion PCR and amplified withnested primers P2 and P7 (see Fig. 4).

2.6. Live imaging of fluorescent proteins

Conidia were inoculated into minimal medium withappropriate supplements in LAB-TEK, 8-well chamberedcoverglasses (Nunc 155411) and grown for approximately16 h at 30 �C before observations. TNO2A7 transformantsfor GFP-SumO observations were grown in minimal med-ium supplemented with pyridoxine and riboflavin. As ribo-flavin is fluorescent, it was washed out immediately beforeimaging. Several gfp-sumO transformants were imaged andgave the same GFP-SumO localization patterns. Time-lapse images were made with one transformant, LO1655.Progeny of a cross between LO1761 and LO1655 were usedfor dual mCherry-c-tubulin and GFP-SumO imaging.Growth and imaging was the same as for the gfp-sumO

transformants except that the growth medium was supple-mented additionally with p-amino benzoic acid.

Image sets were collected with two Olympus IX 71microscopes. Both were equipped with 1.42 N.A. planapo-chromatic objectives. One was equipped with a Hamama-tsu ORCA ER ccd camera, a Prior shutter and excitationfilter wheel and a Semrock GFP/DsRed-2X-A ‘‘Pinkel” fil-ter set [459–481 nm bandpass excitation filter for GFP and

Fig. 1. Deletion of sumO in A. nidulans. (A) Alignment of the A. nidulans

SumO predicted peptide sequence (An_SumO) with the SUMO homologsfrom Saccharomyces cerevisiae (Sc_Smt3: Accession No. AAB01675),Schizosaccharomyces pombe (Sp_Pmt3: Accession No. BAA32595), Homo

sapiens (Hs_SUMO1: Accession No. AAH06462), Xenopus laevis

(Xl_SUMO: Accession No. CAB09807) and Drosophila melanogaster

(Dm_Smt3: Accession No. AAD19219). Identical residues present in atleast half of the sequences are indicated by the black boxes, whereas grayshading represents similar residues. Sequences were aligned using Clustal W(Thompson et al., 1994) in Biomanager (http://biomanager.angis.org.au)with manual manipulation where necessary and shaded by MacBoxshadev2.15E. The conserved di-glycine motif required for SUMO conjugation totarget proteins is boxed. (B) Gene replacement strategy for sumO. Thepredicted sumO open reading frame (AN1191.3) was gene replaced with adominant selectable marker, Bar, in one homolog in a diploid strain(MH6590).


a separate 546–566 bandpass exitation filter for mCherry, adual reflection band dichroic (457–480 nm and 542–565 nmreflection bands, 500–529 and 584–679 transmission bands)and dual wavelength bandpass emission filter (500–529 nmfor GFP and 584–679 nm for mCherry)]. The other micro-scope was equipped with a Hamamatsu ORCA ERAGcamera, Prior shutter, Prior excitation and emission filterwheels, and a Semroch GFP/DsRed2X2M-B dual band‘‘Sedat” filter set [459–481 nm bandpass excitation filterfor GFP and a 546–566 nm bandpass excitation filter formCherry, dual reflection band dichroic (457–480 nm and542–565 nm reflection bands, 500–529 and 584–679 trans-mission bands) and two separate emission filters (499–529 nm for GFP and 580–654 nm for mCherry)]. Becauseof the greater selectivity between the two wavelengths,the dual filter wheel setup was used for most dual wave-length imaging. Both systems were driven with Slidebooksoftware (MacIntosh version). Z-series stacks were decon-volved using the constrained iterative method with Slide-book software.

3. Results

3.1. A single SUMO peptide-encoding gene is present in A.

nidulans

A single gene (AN1191.3), designated sumO, was identi-fied in the A. nidulans genome sequence using the Blastpalgorithm for sequences predicted to encode a SUMO-1-like peptide. The sumO gene was PCR amplified fromgenomic DNA, cloned and sequenced (Section 2). Compar-ison of the sumO genomic sequence and a full-length sumO

EST (GenBank Accession No. AAB01675) revealed a sin-gle 98 bp intron (+223 to +320). The predicted sumO geneproduct of 94 amino acids shows considerable similarity toS. cerevisiae Smt3 (63%) and S. pombe Pmt3 (68%) and thedi-glycine residues required for target attachment are con-served (Fig. 1A).

Considering the pleiotropic roles of the SUMO ortho-logs and the lethal phenotype of the smt3D mutant in S.

cerevisiae, we replaced the entire sumO open reading framewith the dominant selectable marker Bar (Straubingeret al., 1992) in the diploid recipient MH6590 (Fig. 1B).Glufosinate resistant transformants were isolated and atransformant (MH10968) with the expected genomic diges-tion pattern for a heterozygous sumOD diploid was chosenand haploidized. Glufosinate resistant sumOD haploidswere recovered, indicating that deletion of sumO is notlethal in A. nidulans. The resistance marker segregated inthe haploidization progeny with the facB101 mutation onlinkage group VIII, consistent with the physical locationof the sumO gene (AN1191.3).

3.2. Deletion of the sumO gene has pleiotropic effects

The sumOD mutant has a severely reduced growth phe-notype on complete medium. This phenotype is less

extreme on ANM minimal or on YAG medium. After 5days incubation on complete medium at 37 �C, the wild-type strain produced large smooth-edged colonies, whereasthe sumOD mutant formed smaller colonies with raggededges suggesting non-uniform growth arrest at the periph-ery of the colony (Fig. 2A). Measurement of colony growthshowed that wild-type reproducibly maintained a lineargrowth rate whereas the growth of the sumOD mutantgradually slowed and ultimately ceased approximatelythree days after inoculation (Fig. 2B). The timing ofgrowth cessation in the sumOD mutant showed consider-able variation between replicates consistent with a stochas-tic basis for the growth arrest (Fig. 2B). Microscopicexamination of the sumOD mutant after 5 days growthon complete medium did not reveal an aberrant morphol-ogy or branching at the hyphal tip (data not shown). Re-introduction of the sumO gene by transformation fullyrestored wild-type growth (data not shown) confirmingthat the growth defect was specific to the loss of sumO

function. In S. pombe, the pmt3D mutant displays sensitiv-ity to heat, DNA-damaging agents and DNA synthesisinhibitors (Tanaka et al., 1999). The sumOD mutant exhib-ited slightly increased sensitivity to the DNA-damagingagent methyl methanesulfonate (MMS) and to the DNAsynthesis inhibitor hydroxyurea (HU) compared with thewild-type (Fig. 2D). However, there was no evidence of

http://biomanager.angis.org.au


increased heat sensitivity, as the relative growth of thesumOD mutant was not markedly affected at 42 �C com-pared with 37 �C on either minimal medium (Fig. 2D) orcomplete medium (data not shown).

Aspergillus nidulans undergoes two developmental pro-grams: asexual development, leading to the formation ofasexual reproductive structures (conidiophores) and asex-ual spores (conidia), and sexual development, which gener-ates meiotic products (ascospores) contained within

3

fruiting bodies (cleistothecia) surrounded by Hulle cells.The production of conidia was substantially reduced inthe sumOD mutant compared with wild-type (Fig. 2C),although the morphology of individual sumOD conidio-phores appeared normal (data not shown). As A. nidulans

is homothallic, the production of viable ascospores doesnot normally require a mating partner. While sumODmutant homokaryons (MH10992: biA1 sumOD) producednormal Hulle cells the cleistothecia were very small com-pared with those formed by wild-type homokaryons(biA1) (Fig. 2E–G) and failed to produce progeny. Micro-scopic examination revealed that the cleistothecia did notcontain ascospores (data not shown). Therefore, thesumOD mutant is self-sterile indicating a requirement forsumoylation of key proteins involved in development ofviable meiotic progeny. Hybrid cleistothecia formed by a[wild-type + sumOD] heterokaryon contained viable prog-eny and the sumOD mutation segregated as a single genein the progeny indicating that the sumOD mutation is reces-sive in the heterokaryon and ascospores carrying this muta-tion were able to germinate.

3.3. Overexpression of SumO is not detrimental

Overexpression of the SumO peptide was achieved byfusing sumO-coding sequences to the highly inducible xylP

promoter (Zadra et al., 2000). As commercially availableanti-SUMO antibodies raised against the S. cerevisiae

Smt3 and Arabidopsis SUMO-1 proteins did not cross-react with A. nidulans SumO-conjugated proteins in Wes-tern blot analysis (data not shown), the SumO peptidewas tagged with the FLAG epitope for detection (Section2). Introduction of the FLAG tag between residues threeand four of SumO did not affect its function as the modi-fied sumOFLAG gene fully complemented the growth pheno-type of the sumOD mutant in co-transformation

Fig. 2. The sumOD mutant shows growth, asexual development andsexual development phenotypes. (A) The growth of the wild-type strain(MH1) and the sumOD mutant (MH10992) on complete media after 5days incubation at 37 �C. (B) The radius of the colony at various timeintervals after inoculation on complete medium and incubation at 37 �Cwas determined as a measure of hyphal extension. Four replicates areshown. (C) Asexual spore (conidia) numbers were determined for wild-type (MH1) and sumOD (MH10992) strains after 48 h growth on completemedia or minimal media with 10 mM ammonium tartrate as nitrogensource at 37 �C. Average number of spores � 106 per cm2 is shown withstandard error in parentheses. (D) Growth of wild-type (MH1) andsumOD (MH10992) strains on complete media, minimal media with10 mM ammonium tartrate and minimal media containing 0.0025%methyl methanesulfonate (MMS) or 5 mM hydroxyurea (HU) at 37 �Cand minimal media at 37 �C or 42 �C for 2 days. (E) and (F) Sexualdevelopment of wild-type and sumOD homokaryons. MH1 and MH10992strains were grown on solid minimal media with 1% glucose and 10 mMsodium nitrate at 37 �C for 2 days, the plates were sealed to induce sexualdevelopment and further incubated at 37 �C for 7 days. Cleistothecia (S)and conidiophores (A) are indicated by arrows and the scale bar represents100 lm. (G) Sizes of the cleistothecia from wild-type and sumOD werecompared. The scale bar represents 50 lm.


experiments using the pyroA gene on pI4 (Osmani et al.,1999) as the selectable marker (data not shown).

Fig. 3. Overexpression of sumOFLAG in A. nidulans. (A) The xylP(p)

sumOFLAG construct was targeted to the genomic sumO locus by singlecrossover. The solid black box within the sumO coding region indicates therelative position of the introduced FLAG epitope. (B) Western blotting of50 lg of crude protein extracts from the wild-type and xylP(p)sumO strainsgrown in minimal media containing either 1% glucose (G) or 1% xylose (X)with 10 mM ammonium tartrate at 37 �C for 16 h. Sumoylated proteinswere detected using a-FLAG antibodies. Molecular weight markers areshown. Asterisk indicates unconjugated SumOFLAG peptide.

Fig. 4. Creation of gfp-sumO five-piece fusion PCR. (A) Amplification of threein black), the sumO promoter (yellow), and the sumO coding sequence (red)extensions that hybridize to the GFP coding sequence and primers P3 and Pfumigatus pyrG gene (AfpyrG) (Weidner et al., 1998). (B) After primer and nucleand amplified with primers P2 and P7, which are nested primers. The five piecesas shown. Primers were designed such that GFP is fused in frame with the sumO

promoter. Upon transformation this fragment integrates at the sumO locus byconstruct shown. (For interpretation of the references to colour in this figure

The xylP(p) sumOFLAG construct (pCW6747) was inte-grated by a single homologous recombination event at thesumO locus (Fig. 3A). Western blot analysis using Anti-FLAG antibodies detected low levels of a variety of sumoy-lated proteins in protein extracts prepared from myceliagrown in glucose medium indicating that SumOFLAG isexpressed at low levels from the xylP promoter even inthe absence of inducer (Fig. 3B). Unconjugated SumOFLAG

was detected at approximately 10.4 kDa. Extracts preparedfrom mycelia grown on xylose medium to induce SumOFLAG

expression contained increased amounts of sumoylatedproteins and elevated levels of free, unconjugated SumOpeptide (Fig. 3B). Remarkably, while overexpression ofSumO led to a dramatic increase in the abundance ofsumoylated proteins, growth tests revealed no obvious phe-notypic difference between overexpression and wild-typestrains on glucose or xylose media containing ammonium,alanine, proline or nitrate as sole nitrogen sources, onxylose medium containing MMS or HU or at 42 �C (datanot shown). Therefore, SumO peptide overexpression didnot detectably interfere with the normal function of cellularproteins involved in growth or metabolism.

fragments from genomic DNA, the 50 untranslated region (50 UTR) (shownand 30 untranslated region (30 UTR) (black). Primers P5 and P6 carry

4 carry extensions that hybridize to a fragment carrying the Aspergillus

otide removal, these fragments were mixed with AfpyrG and gfp fragmentshybridize during fusion PCR and amplification results in a single fragmentcoding sequence and the fusion is under control of the endogenous sumO

homologous recombination, replacing the endogenous sumO gene with thelegend, the reader is referred to the web version of this article.)


3.4. In vivo localization of SumO

To examine the distribution of SumO over time in livingcells, we created a Green Fluorescent Protein (GFP)-SumOfusion expressed under the control of the endogenoussumO promoter. As SUMO peptides are ligated to targetproteins by their C-terminus, GFP was fused to the N-ter-minus of SumO. To construct a transforming DNA frag-ment that carried a gfp-sumO fusion gene under thecontrol of the sumO promoter, we developed a fusionPCR procedure in which five fragments were fused in a sin-gle fusion PCR reaction (Fig. 4). The linear product wastransformed into an nkuAD strain (TN02A7) to facilitategene targeting (Nayak et al., 2006). Transformants withthe desired integration at the sumO locus were identifiedby diagnostic PCR and confirmed by Southern blot analy-sis. Growth rates of the GFP-SumO transformants werethe same as the wild-type control strain R153 indicatingthat fusion of GFP to SumO did not affect SumO conjuga-tion to target proteins or SumO function. Several GFP-SumO transformants examined by fluorescence microscopygave identical localization patterns for GFP-SumO andthus for sumoylated proteins.

In interphase cells, sumoylated proteins were highly con-centrated in the nucleus (Fig. 5). Within the nucleus, therewere a number of spots with higher concentrations ofsumoylated proteins and the concentration of sumoylatedproteins was lower in the nucleolus than in the surroundingnucleoplasm (Fig. 5A). Through-focus series revealed thatthe spots were not confined to the nuclear periphery butwere located throughout the nucleoplasm. In S. pombe,

GFP-Pmt3 is predominately nuclear and forms intensespots, which are colocalised with the spindle pole body ininterphase cells (Tanaka et al., 1999). To investigatewhether any of the GFP-SumO spots corresponded tothe spindle pole body, we crossed the GFP-tagged sumO

gene into a strain (LO1761) carrying an mCherry c-tubulinfusion (constructed by Yi Xiong and Dr. Edyta Szewczyk),a diagnostic spindle pole body marker. Examination of Z-series stacks revealed that there was no preferential associ-ation of GFP-SumO with the spindle pole body (Fig. 5A).

Fig. 5. SumO distribution in living cells. (A) A maximum intensityprojection of a Z-series stack of GFP-SumO and mCherry-c-tubulin.There are multiple intense spots of SumO in each nucleus. The mCherry-c-tubulin localizes to spindle pole bodies (arrows) and there is no increasedconcentration of SumO at the spindle pole bodies. The insert shows thesecond nucleus from the right prior to deconvolution for comparison. (B–E) GFP-SumO in mitosis. Each panel is a maximum intensity projection ofa deconvolved Z-series stack from a time-lapse image set. The time (inminutes) from the beginning of image collection is at the lower left of eachpanel. The images were collected with minimal exposure to minimizebleaching, and at wider Z-series intervals than panel A so the GFP-SumOspots are less clear. SumO is present in G2 nuclei (B), is nearlyundetectable in mitotic nuclei (C), re-accumulates in daughter nuclei asthey exit mitosis (D) and is present in G1 nuclei (E). B–E are the samemagnification (scale in E).

"

To monitor the localization of sumoylated proteinsthrough the cell cycle, we collected four-dimensional imagesets (Z-series collected over time) (Fig. 5B–E). Sumoylatedproteins were concentrated in the nucleus throughout inter-phase. As the cells entered mitosis, sumoylated proteinsdisappeared rapidly from the nucleoplasm, apparently exit-ing the nucleus. The nuclear envelope is known to become


permeable at the onset of mitosis (De Souza et al., 2004).Sumoylated proteins re-accumulated in the nucleoplasmin telophase.

4. Discussion

An incredibly diverse range of cellular proteins serve assubstrates for the covalent attachment of SUMO peptidesin vertebrates and in yeast (e.g. Hannich et al., 2005; Wohl-schlegel et al., 2004). It is not clear how sumoylation affectsthe various cellular processes in which it is involved and theconsequences of SUMO attachment vary between sub-strates. The covalent linkage of SUMO peptides candirectly affect the activity of target proteins by altering theirprotein or DNA interactions, subcellular location or byacting as an antagonist to ubiquitination (Johnson, 2004).In addition, SUMO peptides can participate in non-cova-lent interactions and SUMO modification of certain targetproteins may facilitate their interaction with other proteinsbearing a SUMO-binding motif (SBM). The SBM ofhuman RanBP2/Nup358 important for interaction withsumoylated RanGAP1 has been identified and a similarSBM sequence has been defined in S. cerevisiae by two-hybrid analysis (Song et al., 2004; Hannich et al., 2005).However, as S. cerevisiae and S. pombe mutants lackingthe SUMO-conjugating enzyme (encoded by the UBC9

and hus5 genes, respectively) show similar defects tomutants lacking SUMO peptides (Johnson and Blobel,1997; Al-Khodairy et al., 1995), it is clear that the mostcritical functions of SUMO require covalent attachment.

In A. nidulans, as in S. cerevisiae and S. pombe, SUMOpeptides are encoded by a single gene. The phenotypes ofthe S. cerevisiae SMT3 and S. pombe pmt3 deletionmutants are not equivalent as the S. pombe mutant is viablewhereas the S. cerevisiae mutant is lethal (Giaever et al.,2002; Johnson et al., 1997; Tanaka et al., 1999). As the sit-uation in the filamentous fungi was unknown, we createdthe A. nidulans sumOD mutant in a diploid context andthen uncovered the mutation by haploidization. Thismutant was found to be viable although it exhibited pleio-tropic defects including a reduced capacity for continuedhyphal growth, an increased sensitivity to DNA-damagingagents and effects on both asexual and sexual reproduction.Our data demonstrate that SumO is not essential formitosis in A. nidulans unlike S. cerevisiae where sumoyla-tion is required for mitotic cell cycle progression and chro-mosome segregation (Biggins et al., 2001; Dieckhoff et al.,2004; Meluh and Koshland, 1995; Motegi et al., 2006).However, the stochastic nature of hyphal growth cessation,the reduced levels of conidiation and increased sensitivityto DNA-damaging agents suggest sumO may have anancillary role in mitosis. SUMO plays a role in maintainingproper chromosome segregation, telomere length and theDNA damage response in S. pombe (Ho and Watts,2003). We established that SumO is required for sexualdevelopment as reduced fruiting body size and self-sterilitywere observed in sumOD homokaryons. In S. cerevisiae,

Smt3 is associated with the synaptonemal complex (Chenget al., 2006; Hooker and Roeder, 2006) and sumoylation ofthe transcription factor Ste12 promotes mating (Wang andDohlman, 2006).

Using GFP-SumO we were able to follow changes in thesubcellular location of SUMO peptides through the cellcycle. These studies revealed that sumoylated proteins and/or SUMO peptides were localized throughout the nucleusconcentrated as punctate spots in chromatin-free subnuclearregions. These spots are not associated with spindle polebodies whereas in S. pombe Pmt3 fused to GFP is localizedin intense spots in the nucleus corresponding to spindle polebodies (Tanaka et al., 1999). Human SUMO-1/2/3 peptidesare localized on the nuclear membrane, nuclear bodies andcytoplasm, respectively (Su and Li, 2002). Many of the cellu-lar processes influenced by sumoylation, including transcrip-tion factor modification, DNA repair and chromosomalmaintenance and stability, occur within the nucleus. Imagingin live cells using GFP-tagged SumO revealed a fascinatinglink between SumO subcellular distribution and nucleardivision. In interphase cells, GFP-SumO accumulatedwithin the nucleus but GFP-SumO fluorescence was unde-tectable from entry to mitosis until telophase. It is not knownwhether this cyclic concentration and loss of the GFP signalis due to exit of sumoylated nuclear proteins as the nuclearenvelope becomes permeable or changes in the sumoylationstate of target proteins during the cell cycle. The co-localiza-tion of SUMO-conjugating and SUMO-deconjugatingenzymes with the nuclear pore suggests that sumoylationof nuclear proteins may be a dynamic and rapid process asso-ciated with nucleocytoplasmic transport (Hang and Dasso,2002; Smith et al., 2004; Zhang et al., 2002).

Many processes in which sumoylation has been impli-cated are central to cell growth and genome integrity andare likely to be conserved across the eukaryota. We havedemonstrated using denaturing SDS–PAGE that epitope-tagged SumO peptides can be covalently attached to a largenumber of A. nidulans proteins. The unique features of thefilamentous fungi and the amenability of genetic analysis incertain of these species offers significant opportunities tofurther explore these processes. Furthermore, it is remark-able, given the range of processes in which sumoylation hasbeen implicated, that SumO overexpression produced noobvious growth or developmental phenotype. This mayprovide an additional tool for further study of this impor-tant post-translational modification providing valuableinsights into the influence of sumoylation on key cellularprocesses in filamentous fungi.

Acknowledgments

We acknowledge the support of the Australian ResearchCouncil, the award of an International Postgraduate Re-search Scholarship (IPRS) and Melbourne InternationalResearch Scholarship (MIRS) to Koon Ho Wong, andthe support of the National Institute of General MedicalSciences (Grant GM031837) to Berl Oakley. We thank


K. Nguyen for expert technical assistance and Yi Xiongand Dr. Edyta Szewczyk, The Ohio State University, forconstruction of mCherry c-tubulin. We acknowledge sup-port from the David Hay Memorial Fund in the prepara-tion of this manuscript.

References

Al-Khodairy, F., Enoch, T., Hagan, I.M., Carr, A.M., 1995. TheSchizosaccharomyces pombe hus5 gene encodes a ubiquitin conjugatingenzyme required for normal mitosis. J. Cell Sci. 108, 475–486.

Altschul, S.F., Gish, W., Miller, W., Myers, E.W., Lipman, D.J., 1990.Basic local alignment search tool. J. Mol. Biol. 215, 403–410.

Andrianopoulos, A., Hynes, M.J., 1988. Cloning and analysis of thepositively acting regulatory gene amdR from Aspergillus nidulans. Mol.Cell. Biol. 8, 3532–3541.

Biggins, S., Bhalla, N., Chang, A., Smith, D.L., Murray, A.W., 2001.Genes involved in sister chromatid separation and segregation in thebudding yeast Saccharomyces cerevisiae. Genetics 159, 453–470.

Bohren, K.M., Nadkarni, V., Song, J.H., Gabbay, K.H., Owerbach, D.,2004. A M55V polymorphism in a novel SUMO gene (SUMO-4)differentially activates heat shock transcription factors and is associ-ated with susceptibility to type I diabetes mellitus. J. Biol. Chem. 279,27233–27238.

Cheng, C.H., Lo, Y.H., Liang, S.S., Ti, S.C., Lin, F.M., Yeh, C.H.,Huang, H.Y., Wang, T.F., 2006. SUMO modifications controlassembly of synaptonemal complex and polycomplex in meiosis ofSaccharomyces cerevisiae. Genes Dev. 20, 2067–2081.

Clutterbuck, A.J., 1974. Aspergillus nidulans genetics. In: King, R.C. (Ed.),Handbook of Genetics, vol. 1. Plenum Press, New York, pp. 447–510.

Cove, D.J., 1966. The induction and repression of nitrate reductase in thefungus Aspergillus nidulans. Biochim. Biophys. Acta 113, 51–56.

De Souza, C.P., Osmani, A.H., Hashmi, S.B., Osmani, S.A., 2004. Partialnuclear pore complex disassembly during closed mitosis in Aspergillus

nidulans. Curr. Biol. 14, 1973–1984.Denison, C., Rudner, A.D., Gerber, S.A., Bakalarski, C.E., Moazed, D.,

Gygi, S.P., 2005. A proteomic strategy for gaining insights into proteinsumoylation in yeast. Mol. Cell. Proteomics 4, 246–254.

Dieckhoff, P., Bolte, M., Sancak, Y., Braus, G.H., Irniger, S.,2004. Smt3/SUMO and Ubc9 are required for efficient APC/C-mediated proteolysis in budding yeast. Mol. Microbiol. 51,1375–1387.

Giaever, G., Chu, A.M., Ni, L., Connelly, C., Riles, L., Veronneau, S.,Dow, S., Lucau-Danila, A., Anderson, K., Andre, B., Arkin, A.P.,Astromoff, A., El-Bakkoury, M., Bangham, R., Benito, R., Brachat,S., Campanaro, S., Curtiss, M., Davis, K., Deutschbauer, A., Entian,K.D., Flaherty, P., Foury, F., Garfinkel, D.J., Gerstein, M., Gotte, D.,Guldener, U., Hegemann, J.H., Hempel, S., Herman, Z., Jaramillo,D.F., Kelly, D.E., Kelly, S.L., Kotter, P., LaBonte, D., Lamb, D.C.,Lan, N., Liang, H., Liao, H., Liu, L., Luo, C., Lussier, M., Mao, R.,Menard, P., Ooi, S.L., Revuelta, J.L., Roberts, C.J., Rose, M., Ross-Macdonald, P., Scherens, B., Schimmack, G., Shafer, B., Shoemaker,D.D., Sookhai-Mahadeo, S., Storms, R.K., Strathern, J.N., Valle, G.,Voet, M., Volckaert, G., Wang, C.Y., Ward, T.R., Wilhelmy, J.,Winzeler, E.A., Yang, Y., Yen, G., Youngman, E., Yu, K., Bussey, H.,Boeke, J.D., Snyder, M., Philippsen, P., Davis, R.W., Johnston, M.,2002. Functional profiling of the Saccharomyces cerevisiae genome.Nature 418, 387–391.

Gill, G., 2004. SUMO and ubiquitin in the nucleus: different functions,similar mechanisms? Genes Dev. 18, 2046–2059.

Gong, L., Millas, S., Maul, G.G., Yeh, E.T., 2000. Differential regulationof sentrinized proteins by a novel sentrin-specific protease. J. Biol.Chem. 275, 3355–3359.

Gong, L., Yeh, E.T., 2006. Characterization of a family of nucleolarSUMO-specific proteases with preference for SUMO-2 or SUMO-3. J.Biol. Chem. 281, 15869–15877.

Hang, J., Dasso, M., 2002. Association of the human SUMO-1 proteaseSENP2 with the nuclear pore. J. Biol. Chem. 277, 19961–19966.

Hannich, J.T., Lewis, A., Kroetz, M.B., Li, S.J., Heide, H., Emili, A.,Hochstrasser, M., 2005. Defining the SUMO-modified proteome bymultiple approaches in Saccharomyces cerevisiae. J. Biol. Chem. 280,4102–4110.

Ho, J.C., Watts, F.Z., 2003. Characterization of SUMO-conjugatingenzyme mutants in Schizosaccharomyces pombe identifies a dominant-negative allele that severely reduces SUMO conjugation. Biochem. J.372, 97–104.

Hooker, G.W., Roeder, G.S., 2006. A role for SUMO in meioticchromosome synapsis. Curr. Biol. 16, 1238–1243.

Johnson, E.S., 2004. Protein modification by SUMO. Annu. Rev.Biochem. 73, 355–382.

Johnson, E.S., Blobel, G., 1997. Ubc9p is the conjugating enzyme for theubiquitin-like protein Smt3p. J. Biol. Chem. 272, 26799–26802.

Johnson, E.S., Schwienhorst, I., Dohmen, R.J., Blobel, G., 1997. Theubiquitin-like protein Smt3p is activated for conjugation to otherproteins by an Aos1p/Uba2p heterodimer. EMBO J. 16, 5509–5519.

Kamitani, T., Nguyen, H.P., Yeh, E.T., 1997. Preferential modification ofnuclear proteins by a novel ubiquitin-like molecule. J. Biol. Chem. 272,14001–14004.

Kurepa, J., Walker, J.M., Smalle, J., Gosink, M.M., Davis, S.J., Durham,T.L., Sung, D.Y., Vierstra, R.D., 2003. The small ubiquitin-likemodifier (SUMO) protein modification system in Arabidopsis. Accu-mulation of SUMO1 and -2 conjugates is increased by stress. J. Biol.Chem. 278, 6862–6872.

Lee, S.B., Taylor, J.W., 1990. Isolation of DNA from fungal mycelia andsingle spores. In: Innis, M.A., Gelfand, D.H., Sninsky, J.S., White, T.J.(Eds.), PCR Protocols: a Guide to Methods and Applications.Academic Press, San Diego, pp. 282–287.

Li, S.J., Hochstrasser, M., 1999. A new protease required for cell-cycleprogression in yeast. Nature 398, 246–251.

Melchior, F., 2000. SUMO—nonclassical ubiquitin. Annu. Rev. Cell.Dev. Biol. 16, 591–626.

Meluh, P.B., Koshland, D., 1995. Evidence that the MIF2 gene ofSaccharomyces cerevisiae encodes a centromere protein with homologyto the mammalian centromere protein CENP-C. Mol. Biol. Cell. 6,793–807.

Monahan, B.J., Askin, M.C., Hynes, M.J., Davis, M.A., 2006. Differentialexpression of Aspergillus nidulans ammonium permease genes isregulated by GATA transcription factor AreA. Eukaryot. Cell 5,226–237.

Motegi, A., Kuntz, K., Majeed, A., Smith, S., Myung, K., 2006.Regulation of gross chromosomal rearrangements by ubiquitin andSUMO ligases in Saccharomyces cerevisiae. Mol. Cell. Biol. 26, 1424–1433.

Nayak, T., Szewczyk, E., Oakley, C.E., Osmani, A., Ukil, L., Murray,S.L., Hynes, M.J., Osmani, S.A., Oakley, B.R., 2006. A versatile andefficient gene-targeting system for Aspergillus nidulans. Genetics 172,1557–1566.

Osmani, A.H., May, G.S., Osmani, S.A., 1999. The extremely conservedpyroA gene of Aspergillus nidulans is required for pyridoxine synthesisand is required indirectly for resistance to photosensitizers. J. Biol.Chem. 274, 23565–23569.

Panse, V.G., Hardeland, U., Werner, T., Kuster, B., Hurt, E., 2004. Aproteome-wide approach identifies sumoylated substrate proteins inyeast. J. Biol. Chem. 279, 41346–41351.

Sambrook, J., Fritsch, E.F., Maniatis, T., 1989. Molecular cloning: alaboratory manual. Cold Spring Harbor Laboratory, Cold SpringHarbor, NY.

Schwarz, S.E., Matuschewski, K., Liakopoulos, D., Scheffner, M.,Jentsch, S., 1998. The ubiquitin-like proteins SMT3 and SUMO-1are conjugated by the UBC9 E2 enzyme. Proc. Natl Acad. Sci. USA95, 560–564.

Smith, M., Bhaskar, V., Fernandez, J., Courey, A.J., 2004. DrosophilaUlp1, a nuclear pore-associated SUMO protease, prevents accumula-


tion of cytoplasmic SUMO conjugates. J. Biol. Chem. 279, 43805–43814.

Song, J., Durrin, L.K., Wilkinson, T.A., Krontiris, T.G., Chen, Y., 2004.Identification of a SUMO-binding motif that recognizes SUMO-modified proteins. Proc. Natl. Acad. Sci. USA 101, 14373–14378.

Straubinger, B., Straubinger, E., Wirsel, S., Turgeon, G., Yoder, O., 1992.Versatile fungal transformation vectors carrying the selectable bargene of Streptomyces hygroscopicus. Fungal Genet. Newsl. 39, 82–83.

Su, H.L., Li, S.S., 2002. Molecular features of human ubiquitin-likeSUMO genes and their encoded proteins. Gene 296, 65–73.

Takahashi, Y., Toh-e, A., Kikuchi, Y., 2001. A novel factor required forthe SUMO1/Smt3 conjugation of yeast septins. Gene 275, 223–231.

Tanaka, K., Nishide, J., Okazaki, K., Kato, H., Niwa, O., Nakagawa, T.,Matsuda, H., Kawamukai, M., Murakami, Y., 1999. Characterizationof a fission yeast SUMO-1 homologue, pmt3p, required for multiplenuclear events, including the control of telomere length and chromo-some segregation. Mol. Cell. Biol. 19, 8660–8672.

Thompson, J.D., Higgins, D.G., Gibson, T.J., 1994. CLUSTAL W:improving the sensitivity of progressive multiple sequence alignmentthrough sequence weighting, position-specific gap penalties and weightmatrix choice. Nucleic Acids Res. 22, 4673–4680.

Todd, R.B., Hynes, M.J., Andrianopoulos, A., 2006. The Aspergillus

nidulans rcoA gene is required for veA-dependent sexual development.Genetics 174, 1685–1688.

Todd, R.B., Davis, M.A., Hynes, M.J., 2007a. Genetic manipulation ofAspergillus nidulans: heterokaryons and diploids for dominance,complementation and haploidization analyses. Nat. Protoc. 2, 822–830.

Todd, R.B., Davis, M.A., Hynes, M.J., 2007b. Genetic manipulation ofAspergillus nidulans: meiotic progeny for genetic analysis and strainconstruction. Nat. Protoc. 2, 811–821.

Verger, A., Perdomo, J., Crossley, M., 2003. Modification withSUMO. A role in transcriptional regulation. EMBO Rep. 4, 137–142.

Wang, Y., Dohlman, H.G., 2006. Pheromone-regulated sumoylation oftranscription factors that mediate the invasive to mating developmen-tal switch in yeast. J. Biol. Chem. 281, 1964–1969.

Weidner, G., d’Enfert, C., Koch, A., Mol, P.C., Brakhage, A.A., 1998.Development of a homologous transformation system for the humanpathogenic fungus Aspergillus fumigatus based on the pyrG geneencoding orotidine 50-monophosphate decarboxylase. Curr. Genet. 33,378–385.

Wohlschlegel, J.A., Johnson, E.S., Reed, S.I., Yates 3rd, J.R., 2004.Global analysis of protein sumoylation in Saccharomyces cerevisiae. J.Biol. Chem. 279, 45662–45668.

Yang, L., Ukil, L., Osmani, A., Nahm, F., Davies, J., De Souza, C.P.,Dou, X., Perez-Balaguer, A., Osmani, S.A., 2004. Rapid production ofgene replacement constructs and generation of a green fluorescentprotein-tagged centromeric marker in Aspergillus nidulans. Eukaryot.Cell 3, 1359–1362.

Yeh, E.T., Gong, L., Kamitani, T., 2000. Ubiquitin-like proteins: newwines in new bottles. Gene 248, 1–14.

Zadra, I., Abt, B., Parson, W., Haas, H., 2000. xylP promoter-basedexpression system and its use for antisense downregulation of thePenicillium chrysogenum nitrogen regulator NRE. Appl. Environ.Microbiol. 66, 4810–4816.

Zhang, H., Saitoh, H., Matunis, M.J., 2002. Enzymes of the SUMOmodification pathway localize to filaments of the nuclear porecomplex. Mol. Cell. Biol. 22, 6498–6508.

Zhou, W., Ryan, J.J., Zhou, H., 2004. Global analyses of sumoylatedproteins in Saccharomyces cerevisiae. Induction of protein sumoylationby cellular stresses. J. Biol. Chem. 279, 32262–32268.

sumoylation in aspergillus nidulans inactivation

Documents