RNA–RNA interactions and pre-mRNA mislocalizationas drivers of group II intron loss from nuclear genomesGuosheng Qua, Xiaolong Donga, Carol Lyn Piazzaa, Venkata R. Chalamcharlab,1, Sheila Lutzb, M. Joan Curciob,and Marlene Belforta,2

aDepartment of Biological Sciences, RNA Institute, University at Albany, State University of New York, Albany, NY 12222; and bWadsworth Center, New YorkState Department of Health, Albany, NY 12201-2002

Contributed by Marlene Belfort, March 10, 2014 (sent for review January 22, 2014; reviewed by Lynne Maquat and Roy Parker)

Group II introns are commonly believed to be the progenitors ofspliceosomal introns, but they are notably absent from nucleargenomes. Barriers to group II intron function in nuclear genomestherefore beg examination. A previous study showed that nuclearexpression of a group II intron in yeast results in nonsense-mediated decay and translational repression of mRNA, and thatthese roadblocks to expression are group II intron-specific. Todetermine the molecular basis for repression of gene expression,we investigated cellular dynamics of processed group II intronRNAs, from transcription to cellular localization. Our data showpre-mRNA mislocalization to the cytoplasm, where the RNAs aretargeted to foci. Furthermore, tenacious mRNA–pre-mRNA interac-tions, based on intron-exon binding sequences, result in reducedabundance of spliced mRNAs. Nuclear retention of pre-mRNA pre-vents this interaction and relieves these expression blocks. Inaddition to providing a mechanistic rationale for group II intron-specific repression, our data support the hypothesis that RNA si-lencing of the host gene contributed to expulsion of group IIintrons from nuclear genomes and drove the evolution ofspliceosomal introns.

intron-mediated nuclear gene silencing | spliceosomal intron evolution

Group II introns that reside in genomes of bacteria, archaea,and eukaryotic organelles are ribozymes that self-splice

from pre-mRNA transcripts independent of protein catalysis(1–3). Group II introns are also mobile retroelements that in-tegrate into DNAs via an RNA intermediate (2, 3). Group II intronsplicing is usually facilitated in vivo by an intron-encoded proteinthat acts as a maturase to help form the required secondary andtertiary structures (3). The intron RNA–protein complex is alsorequired for group II intron retromobility. Both splicing and mo-bility of group II introns require interactions between exon-bindingsequences (EBSs) within the intron and intron-binding sequences(IBSs) in the flanking exons of RNA or DNA targets (2, 3).The chemical steps of group II intron splicing are identical

to those of nuclear spliceosomal introns (4, 5). There are alsosimilarities of RNA sequences at the splice sites and of RNAstructures within the ribozyme and the spliceosome (6–9). Be-cause of these parallels, the catalytic group II introns are be-lieved to be the progenitors of spliceosomal introns (6, 10, 11). Itis widely speculated that group II introns entered the eukaryoticlineage with the mitochondrial endosymbiosis, invaded the nu-cleus, and evolved from RNA catalysts into efficient spliceosome-dependent introns. However, group II introns are strikingly ab-sent from modern nuclear genomes (1), which are replete withspliceosomal introns. It is still elusive how the ancestral group IIintrons might have evolved into spliceosomal introns or how theywere expunged from nuclear genomes.As an initial effort to answer these questions, we had probed

the fate of group II introns introduced into RNA polymerase IItranscripts in Saccharomyces cerevisiae (12). We used LtrB, agroup II intron from Lactococcus lactis, as a model. That workshowed that the group II intron splices accurately and efficiently,albeit in the cytoplasm, and that the intron-containing pre-mRNA

and the spliced mRNA (S-mRNA) are subject to nonsense-mediated decay (NMD) and translational repression, respectively(12) (Fig. S1). Strikingly, this intron-stimulated gene silencing isunique to group II introns, with neither group I nor spliceosomalintrons in the same location having any effect on RNA stabilityor translation (12). Here, we investigated possible mechanismsfor group II intron-specific gene silencing in yeast. Our datademonstrate strong mRNA–pre-mRNA interactions and RNAmiscompartmentalization, reflected in export of the pre-mRNAto the cytoplasm and its localization to cytoplasmic foci, possiblyincluding processing bodies (PBs) and stress granules (SGs).Both phenomena result in a reduction in the abundance ofmRNAs from which group II introns were removed and a re-duction of gene expression. This work supports a relationshipbetween nucleus-cytoplasm compartmentalization and evolutionof gene-silencing group II introns into spliceosomal introns innuclear genomes.

ResultsRNA Modification and Processing Are Normal. In eukaryotic cells,mRNA translation can be regulated at multiple levels, from theprocessing of the transcript, through RNA–RNA or RNA–proteininteractions, to cellular localization. Aberrations at any step couldaccount for reduced expression of spliced mRNA (S-mRNA)that previously contained a group II intron. We therefore firstexamined the nature of RNA transcripts from a construct usedas a group II intron-splicing reporter (12) (Fig. 1A and Fig. S2A).

Significance

For over three decades, group II introns have been conjecturedto be the ancestors of splicesomal introns, but there are nogroup II introns in extant nuclear genomes. Might these intronshave been expunged as spliceosomal introns proliferated? Weshowed previously that nuclear expression of a group II intronin yeast resulted specifically in down-regulation of its host gene.Here, we report on the discovery that pre-mRNA mislocalizationand a consequent interaction between the pre-mRNA or intronand spliced mRNA together account for the mechanism of genesilencing. Our data support the hypothesis that such road-blocks to gene expression resulted in purging of group IIintrons from nuclear genomes while promoting the evolutionof spliceosomal introns.

Author contributions: G.Q. and M.B. designed research; G.Q., X.D., C.L.P., and V.R.C.performed research; S.L. and M.J.C. contributed new reagents/analytic tools; G.Q. andM.B. analyzed data; and G.Q. and M.B. wrote the paper.

Reviewers: L.M., University of Rochester; and R.P., University of Colorado Boulder.

The authors declare no conflict of interest.

See Commentary on page 6536.1Present address: Laboratory of Biochemistry and Molecular Biology, National CancerInstitute, National Institutes of Health, Bethesda, MD 20892.

2To whom correspondence should be addressed. E-mail: mbelfort@albany.edu.

This article contains supporting information online at www.pnas.org/lookup/suppl/doi:10.1073/pnas.1404276111/-/DCSupplemental.

6612–6617 | PNAS | May 6, 2014 | vol. 111 | no. 18 www.pnas.org/cgi/doi/10.1073/pnas.1404276111

Dow

nloa

ded

by g

uest

on

Nov

embe

r 19

, 202

0

Examination of the 5′-ends, the RNA 5′-cap structures, and thelength of the 3′-polyadenylated [poly(A)] tail (Figs. S2 and S3)revealed no obvious differences between the S-mRNA and controlmRNA (C-mRNA), the latter of which is identical to S-mRNAin coding sequence but never contained the group II intron (12),countering the possibility that silencing of the S-mRNA is due toaberrant RNA processing.

RNA–RNA Interactions Repress Gene Expression. Unspliced pre-mRNAinteracts with S-mRNA. To identify molecules that might bind topre-mRNA, a streptavidin aptamer was introduced into the groupII intron (Fig. 1A) and the resulting pre-mRNA was coexpressedwith the intron-encoded protein, LtrA, which promotes splicing.Lysates were applied to streptavidin resin to purify pre-mRNAsthat were analyzed by a reverse transcription (RT) terminationassay developed previously to distinguish pre-mRNA from S-mRNA(12) (Fig. 1 B, i). Remarkably, S-mRNA was coisolated with thepre-mRNA (Fig. 1B, ii). Conditions, such as wash times (Fig. S4A);resin-to-lysate ratio (Fig. S4B); magnesium concentration in lysis/washing buffer (Fig. S4C); and preincubation of cell lysate withavidin, a streptavidin analog, did not prevent either pre-mRNA orS-mRNA from binding, and the relative ratio of S-mRNA to pre-mRNA was generally constant (Fig. 1 B, iii and Fig. S4). Whiledemonstrating the specificity of pre-mRNA binding to the strep-tavidin resin, these observations indicated an interaction betweenS-mRNA and intron-containing pre-mRNA. To eliminate thepossibility that mRNA binds directly to the streptavidin resin,lysate from cells expressing C-mRNA (Fig. 1A) was passed over

the streptavidin resin. No C-mRNA bound to the resin (Fig. 1 B,ii), supporting the conclusion that the unspliced precursor and theS-mRNA interact in vivo.Group II intron interferes with S-mRNA expression. Considering se-quence complementarities between IBSs in the exons and EBSsin the intron (Fig. 2A, Left), we hypothesized that an interactionbetween pre-mRNA or excised intron and S-mRNA might re-press S-mRNA expression (Fig. 2A, Right). To test this hypoth-esis, an intron-containing ORF fused to URA3 (Fig. 2B, GpII-URA3) was coexpressed with C-mRNA, containing ligated exonsfused to CUP1 (Figs. 1A and 2B). The resulting strain showedslightly less resistance to copper than a strain in which C-mRNAwas coexpressed with an intronless URA3 counterpart (Fig. 2C,compare rows 1 and 2). A more dramatic result was observedwhen LtrA was expressed (Fig. 2C, rows 3 and 4). It is unclear ifthe LtrA effect is due to excision of the intron, which interactswith the S-mRNA; to RNA binding by LtrA, which could affectthe phenotype; or to an observed slowing of cellular growthcaused by LtrA expression. Regardless, the phenotypic differencebetween isogenic intron-containing and intron-lacking strains isconsistent with the expectation that the group II intron repressesC-mRNA expression by RNA–RNA interactions. To relate phe-notypes to gene expression levels, Cup1 protein (Cup1p) andmRNA levels, respectively, were monitored by Western blottingand RT. Coexpression of the group II intron from GpII-URA3RNA (Fig. 2D, lane 2) caused the protein product of C-mRNA todecrease to 47% of that in the strain expressing the intronlessURA3 (Fig. 2D, lane 1; control C1 and C2 contain plasmidsexpressing only CUP1 C-mRNA or the group II intron, respec-tively). Interestingly, coexpression of the intron-bearing RNAalso led to a significant decrease of abundance of both C-mRNA[Fig. 2E, lane 2 vs. lane 1 (21% vs. 100%)] and GpII-URA3 (Fig.S5A, lane 2 vs. lane C2). These results imply an interaction be-tween exon sequences in CUP1 C-mRNA and intron sequencesin GpII-URA3, corroborating the putative RNA–RNA inter-actions. The decreased RNA levels also suggest that these inter-actions target RNA for degradation. Taken together, these dataindicate that interactions of the mRNA with an intron-contain-ing pre-mRNA result in reduction of translatable mRNA andgene expression.EBS-IBS base pairings mediate mRNA–pre-mRNA interactions. To dem-onstrate that mRNA silencing was caused by EBS–IBS interactions,a mutant C-mRNA was made with IBS nucleotide substitutionsto disrupt the potential pairings between C-mRNA and the intron-containing RNA GpII-URA3 while maintaining the frame of theCup1 protein (Fig. 3A). The copper resistance phenotype of theWT IBS strains was slightly stronger in the absence of the EBS-containing group II intron than in its presence (Fig. 3B, row 1 vs.row 2). However, this subtle difference disappeared when muta-tions in IBS disrupted the EBS-IBS pairing (Fig. 3B, row 4 vs. row3). A reduction in Cup1p was revealed by Western blotting in thepresence of WT EBS–IBS interaction [Fig. 3C, lane 2 vs. lane 1(47% vs. 100%)] and was reversed with disruption of EBS-IBS[Fig. 3C, lane 4 vs. lane 3 (92% vs. 100%)]. Likewise, formation ofEBS–IBS interaction reduced C-mRNA levels to 21% of thosewhen the interaction could not form (Fig. 3D, lane 2 vs. lane 1),whereas EBS-IBS disruption restored levels of C-mRNA to 97%of those when the interaction could not form (Fig. 3D, lane 4 vs.lane 3). The GpII-URA3 RNA was also reduced in abundancewhen coexpressed with C-mRNA bearing a WT IBS and was re-stored to 62% with the IBS mutant compared with the completeabsence of IBS sequences (Fig. S5B, lane 4 vs. lane C2). Silencingof C-mRNA was eliminated by mutation of IBS sequences in theC-mRNA and was recovered when IBS-EBS base pairingswere restored by compensatory mutations of EBS sequencesin GpII-URA3 RNA (Fig. S6). Together, these results indicatethat EBS-IBS base pairings mediate interactions between a groupII intron-containing pre-mRNA and an mRNA and that these

Pre-mRNA CUP1CUP1E2E2E1E1 MycMyc

Splicing

S-mRNA CUP1CUP1E2E2E1E1 MycMyc

SA

C-mRNA CUP1CUP1E2E2E1E1 MycMyc

B U B U B U B U1X 4X 8X 16XAvidin

Mock L F B L F BS- mRNA C- mRNA

GCGGUACCUCCCUACUUCAC CAUAUCAUUUUU

UCGUGAACACAUCCAUAAC CAUAUCAUUUUU38

40

Intron

Ex1

Ex2

Pre-mRNA

mRNA

A

B

(ii) (iii)

(i)

75 65 65 61%

B U0X

65

Fig. 1. mRNA–pre-mRNA interactions. (A) Schematic of RNA aptamer-harboring construct. Pre-mRNA bears the ΔORF variant of the LtrB intron(black line), which is flanked by exon 1 and exon 2 (E1 and E2) and fused tothe CUP1 ORF containing a C-terminal Myc tag (12). The mRNA generatedfrom splicing (S-mRNA) has the same RNA sequence as the intron-lackingC-mRNA (12). The streptavidin aptamer (SA) in the intron was used as anaffinity tag for pre-mRNA purification. (B) mRNA–pre-mRNA interactions invivo. (i) RT termination assay. Affinity-purified RNAs were detected as perthe schematic (12) with a primer that terminates differentially at the sitesdepicted by black ovals. (ii) RNA–RNA interactions. cDNAs from i were re-solved on a 10% (wt/vol) polyacrylamide gel. (iii) Stability of RNA binding.Competition of binding to streptavidin by increasing concentrations of avidin(from 1× to 16×) was measured on an 8% (wt/vol) polyacrylamide gel. Therelative ratio (%) of S-mRNA to pre-mRNA is shown below. In ii, ‘‘Mock’’indicates the absence of RNA templates. B, resin-bound; F, flow-through; L,lysate; U, unbound.

Qu et al. PNAS | May 6, 2014 | vol. 111 | no. 18 | 6613

BIOCH

EMISTR

YSE

ECO

MMEN

TARY

Dow

nloa

ded

by g

uest

on

Nov

embe

r 19

, 202

0

interactions are required for repressing mRNA abundanceand expression.

Group II Intron RNAs Are Mislocalized to the Cytoplasm, Where TheyForm Foci. Pre-mRNA and S-mRNA accumulate in the cytoplasm as definedfoci.Demonstration of themRNA–pre-mRNA interaction promptedus to examine cellular localization of theseRNAs. To visualize groupII intron RNAs, FISH was performed with DNA oligonucleo-tide probes against CUP1 coding sequence and with DAPI tostain genomic DNA. In all cases, the CUP1 FISH signalappeared predominantly outside of the nucleus (Fig. 4A, RNA),indicating that these RNAs are localized in the cytoplasm. Thisobservation is in accord with previous speculation based onNMD, which suggested cytoplasmic localization of pre-mRNA (12).Additionally, foci were often observed in cells that expressed pre-mRNAor both pre-mRNAandS-mRNA(Fig. 4A). In contrast, fociwere seldom present in cells containing C-mRNA. Foci accu-mulated in approximately one-third as many cells when C-mRNAwas expressed as opposed towhenpre-mRNAorpre-mRNAplus S-mRNA was expressed. These results suggest a correlationbetween the silencing of S-mRNA expression and its localization incytoplasmic foci.Dcp2 and Pab1 are both enriched in pre-mRNA–S-mRNA complexes. PBsand SGs are two cytoplasmic ribonucleoprotein particles thatform under stress and are enriched with translationally re-pressed mRNAs (13). Group II intron-related RNAs in punc-tate forms prompted us to examine a potential relationshipbetween these RNAs and cytoplasmic particles. We thereforeused their respective core component proteins, decappingenzyme Dcp2 and poly(A)-binding protein Pab1, fused toC-terminal GFP tags. Because we were unable to demonstrate adifferential colocalization of S-mRNA/pre-mRNA over C-mRNAwith GFP-tagged PB and SG proteins, we performed immuno-precipitation (IP) of Dcp2/GFP and Pab1/GFP using an anti-GFP

CUP1CUP1E2E2E1E1

CUP1CUP1E2E2E1E1

EBSs

IBSs

CUP1CUP1E2E2E1E1

EBSs

IBSs

OR

A

C

C1 C2

Cup1p

Tubulin

1 2

C-mRNA

ScR1

100

66

82

C1 C2 1 2

CUP1CUP1E2E2E1E1

~ 82 5'- end

4042

D

E

0 0.05 0.1 0.5 1.0

+

mM

1

2

GpII

3

4 LtrA

LtrA

GpII

+

(-)

% 211000183

GpII --

C-mRNA ++-+

A

3'

III

III

IV

V

VIIB

S2

IBS

1

EBS2EBS1 ORF

'

5'

% 471000106

GpII +-+-

C-mRNA ++-+

EBS2 EBS1

U G A A

GUGU A GUGUU

C A C A U C A U A AC

GGU A

CC A U A U C A

IBS2 IBS1

5'- ... -3'...

GpII-URA3

C-mRNA CUP1CUP1E2E2E1E1

EBSs

IBSs

B

URA3URA3E2E2E1E1

Ex-URA3 URA3URA3E2E2E1E1 (GpII)-

(GpII)+

+ +

M

(-)

Fig. 2. Group II intron coexpression interferes with mRNA expression. (A)Models of intron–exon interactions. Base pairings between EBS1, EBS2, and δ inthe intron (red) and IBS1, IBS2, and δ′ in the flanking exons (black) are indicatedby dashed lines and detailed below (Left). Hypothesized mRNA–pre-mRNA orintron–mRNA interactions with EBS-IBS base pairings (Right) are denoted byvertical dashed lines. (B) Schematics of coexpressed RNAs for model testing. Theintron-less CUP1 C-mRNA was coexpressed with the group II intron fused withURA3 (GpII-URA3, GpII+) or URA3 ligated exons (Ex-URA3, GpII−). (C) Copper-resistant (CuR) phenotypes. The intron-less CUP1 C-mRNAwas coexpressed withGpII-URA3 (rows 2 and 4, GpII) or without the group II intron [Ex-URA3, rows 1and 3, (−)], in the absence (rows 1 and 2) or presence (rows 3 and 4) of theintron-encoded protein, LtrA. Copper sulfate concentrations (millimolar) in theplates are shown at the top and molecules coexpressed with the CUP1 C-mRNAare shown on the right. (D) CUP1 mRNA translation. Cup1p was detected byWestern blotting in strains with intron-less and intron-containing RNA coex-pressed (strains 1 and 2 as in C). Tubulin was the loading control. Lanes C1 andC2 are from control strains expressing Cup1p but no group II intron (C1) or thegroup II intron fused to URA3 in the absence of CUP1 (C2). Cup1p levels (%)relative to strain 1 were normalized to the tubulin loading control. (E) RNAlevels. C-mRNA in strains 1 and 2 was analyzed by RT using Integrated DNATechnologies (IDT) primer IDT3271 (arrow) with the cDNA length shown.Strains C1 and C2 are as in D. ScR1 RNA served as a loading control to normalizeC-mRNA levels (%) relative to those in strain 1 (lane 1). M, P32-labeled ΦX174DNA ladder (Promega). An analysis of GpII-URA3 RNA levels is shown in Fig. S5A.

IBS1A

B

C

D

IBS

IBS-mutH A H Q H

IBS2

TTTTTACTAAAGTGCTAGCTGCACCCAGTAH I H I H

0 0.1 0.5 1.0

+

mM

1

2

IBS-mut +

IBS-mut +

3

4

EBS

(-)

EBS

(-)

IBS-wt

+IBS-wt

1Cup1p

Tubulin

% 9210047100

2 3 4

1 3

C-mRNA

ScR1

2 4

EBS +-+-IBS mutmutwtwt % 9710021100

EBS +-+-IBS mutmutwtwt

δ '

CAC CATATC AAC CAT

ATGACCCACGTCGATCGTGAA ATCATTTTTCAT CACGCC CAA CAT

Fig. 3. EBS-IBS pairings mediate mRNA–pre-mRNA interactions. (A) LigatedLtrB exons. WT IBS and mutated IBS (IBS-mut) sequences are shown withrelevant codons underlined and corresponding amino acids shown below.Nucleotide substitutions and resulting amino acid mutations are shown inlarger bold letters. Exon ligation junction is indicated by an arrow. (B) CuR

phenotypes. The intron-less CUP1 C-mRNA with WT IBS (rows 1 and 2) or IBS-mut (rows 3 and 4) was coexpressed with the EBS-containing group II intronfused to URA3 (rows 2 and 4, EBS) or without the intron [rows 1 and 3, (−)].Features of coexpressed RNAs are shown on the right. (C) CUP1 mRNAtranslation. Cup1p levels in strains 1–4 (lanes 1–4) from B were analyzed byWestern blotting, with tubulin as the loading control. Levels of Cup1p (%)from EBS-containing strains (lanes 2 and 4) are shown relative to their in-tron-minus EBS-less counterparts (lanes 1 and 3). (D) RNA levels. Levels ofCUP1mRNA were analyzed as in Fig. 2E. Lanes 1–4 correspond to rows 1–4 inB. The abundance of C-mRNA normalized to that of ScR1 RNA (%) in EBS-containing strains (lanes 2 and 4) is shown relative to EBS-less counterparts(lanes 1 and 3). Analysis of GpII-URA3 RNA levels is shown in Fig. S5B.

6614 | www.pnas.org/cgi/doi/10.1073/pnas.1404276111 Qu et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 19

, 202

0

antibody. Immunoprecipitated RNAs were compared with snRNAU6, which apparently does not exist in the cytoplasm. Indeed, verylittle U6 RNA was copurified (relative IP ratio <0.02; Fig. 4B),indicating its virtual absence from Dcp2- and Pab1-associated ri-bonucleoprotein complexes (Fig. 4B). In contrast, both pre-mRNAand S-mRNA were coisolated with Dcp2/GFP and Pab1/GFP.C-mRNA also appeared in both IP fractions, but with significantlylower abundance. For example, the C-mRNA level was approxi-mately threefold lower than the S-mRNA level (relative IP ratio:0.21 vs. 0.60 for Dcp2/GFP and 0.29 vs. 1.00 for Pab1/GFP). Theco-IP results reveal a markedly enhanced interaction of the groupII intron RNA complex with Dcp2 and Pab1, possibly because oflocalization of the RNA to PBs and SGs (13).

Nuclear Retention of Pre-mRNA Relieves Gene Silencing. Splicing ofspliceosomal intron-containing RNAs is usually completed in thenucleus, and S-mRNA is exported to the cytoplasm. In contrast,group II intron-containing pre-mRNA is exported to the cyto-plasm, where it interacts with the S-mRNA (Figs. 1 and 4). It wastherefore of interest to test whether nuclear retention of pre-mRNA may disrupt mRNA–pre-mRNA interactions and relievegene silencing. To retain the pre-mRNA in the nucleus, weinserted the sequence of the human box C/D small nucleolar

RNA (snoRNA) U24 (hU24) into the intron (Fig. 5A), takingadvantage of hU24’s K-turn structure for nuclear localization(14, 15). The hU24-containing strain showed a slightly increasedresistance to copper (Fig. 5B, compare rows 2 and 3), suggestingthat nuclear retention of CUP1 pre-mRNA increased S-mRNAexpression. Consistent with this observation, Cup1p levels werealmost doubled in the presence of hU24 [Fig. 5C, compare lanes2 and 3 (13% and 23%)]. Furthermore, the S-mRNA level wassignificantly elevated in the presence of hU24 [Fig. 5D, comparelanes 2 and 3 (15% and 51%)], whereas pre-mRNA levels werecomparable [Fig. 5D, compare lanes 2 and 3 (100% and 93%)],suggesting that nuclear retention of pre-mRNA boosts levels ofS-mRNA. Together, these results support the hypothesis thatnuclear export of pre-mRNA to the cytoplasm contributes tomRNA–pre-mRNA interactions and S-mRNA silencing.

DiscussionPrompted by the absence of group II introns from nucleargenomes and the silencing of yeast genes into which a group IIintron was inserted, we performed a study of mRNAs origi-nating from a group II intron-containing precursor (S-mRNA)or from its intron-less counterpart (C-mRNA) to investigategroup II intron-specific inhibition of gene expression. AlthoughS-mRNA and C-mRNA were identical in terms of RNA pro-cessing and end-modification, we discovered that S-mRNAinteracts avidly with the unspliced pre-mRNA and that the pre-mRNA is mislocalized to the cytoplasm, where the interactingRNAs tend to form foci. Moreover, our data show that pre-mRNA nuclear export and the resulting mRNA–pre-mRNAinteractions cause silencing of S-mRNA. Such blocks couldprofoundly affect the persistence of group II introns in nucleargenes (Fig. 6).

A

Pre-mRNA

C-mRNA

Pre-mRNA + S-mRNA

DNARNA Merge

71%

67%

20%

(DAPI)(Quasar 570)DIC

B

Pre-mRNA

S-mRNA

mRNA

Pre-mRNA

C-mRNAU6

0.520.60

0.0090.210.011

I F W4 W8 B I F W4 W8 BS-mRNA C-mRNA

U6

Dcp2 (PBs)

0.581.00

0.0050.29

0.015

I F W4 W8 B I F W4 W8 BS-mRNA C-mRNA

Pab1 (SGs)

Fig. 4. Localization of pre-mRNA and S-mRNA. (A) Cytoplasmic localization.Yeast cells were fixed, processed for FISH using CUP1 ORF-specific DNAoligomers labeled with Quasar570, and stained with DAPI. Fluorescencemicroscopy images were collected using filters for visualizing RNA (Qua-sar570, red) and genomic DNA (DAPI, blue). Images were collected usingdifferential interference contrast (DIC). RNA foci are indicated by whitearrows. The percentage of cells that have visible RNA foci is indicated for oneof a duplicate set of experiments that yielded similar ratios. (Scale bar:10 μm.) (B) Group II intron-related RNAs were coprecipitated with markerproteins of PBs and SGs. Cell lysates containing GFP-tagged PB marker Dcp2or SG marker Pab1 were incubated with anti-GFP monoclonal antibodies,and coprecipitated RNAs were analyzed by the RT termination assay. F, flow-through; W4, fourth wash; W8, eighth wash. Relative ratios of the boundRNA (B) to the input (I) are shown under gel images.

A

B

Transcription

Export

nucleus

cytoplasm

Splicing

5' - cap AAAA - 3’

Translation

5' - cap AAAA - 3’

GpII Intron

5' - cap AAAA - 3’

5' - cap AAAA - 3’

C

D

0 0.01 0.05 0.10.040.02 0.5 mM

C-mRNA

Pre-mRNA

hU24-pre-mRNA

1

2

3

1 2

Tubulin

Cup1p

%13 23100

3

1 2

mRNA

ScR1

Pre-mRNA

pre-mRNA %mRNA %15 51

100 93100

0

3

Fig. 5. Nuclear retention of pre-mRNA relieves silencing of S-mRNA. (A)Schematic of nuclear retention by hU24 snoRNA (blue ovals). (B) CuR phe-notypes. Intron-containing pre-mRNA with (row 3) or without (row 2) thehU24 insertion was coexpressed with a nuclear localization signal-bearingLtrA (NLS-LtrA) (12). C-mRNA coexpressed with NLS-LtrA (row 1) served asthe CuR control. Molecules coexpressed with NLS-LtrA are shown on theright. (C) CUP1 mRNA translation. Cup1p levels in strains 1–3 from B wereanalyzed as in Fig. 2D. (D) RNA levels. mRNA and pre-mRNA were analyzedfrom strains 1–3 as described in Fig. 1B, with ScR1 as the loading control. Therelative level (%) of S-mRNA was normalized to C-mRNA in strain 1 (lane 1),and pre-mRNA was normalized to that in strain 2 (lane 2).

Qu et al. PNAS | May 6, 2014 | vol. 111 | no. 18 | 6615

BIOCH

EMISTR

YSE

ECO

MMEN

TARY

Dow

nloa

ded

by g

uest

on

Nov

embe

r 19

, 202

0

RNA–RNA Interactions, Gene Silencing, and Nuclear MembraneEvolution. S-mRNA–pre-mRNA interaction, revealed by affinitypurification of pre-mRNA (Fig. 1), is consistent with coenrichmentof S-mRNA and pre-mRNA in nonpolysomal sucrose gradientfractions observed previously (12). The group II intron-containingpre-mRNA coexists with the S-mRNA in the cytoplasm (Fig. 4),which provides the opportunity for mRNA–pre-mRNA inter-actions that result in gene silencing. This hypothesis was verified bydemonstrating down-regulation of a translation-competent mRNAby coexpression with a group II intron-containing RNA. The basisfor this interaction is base pairing between the intron’s EBSand the mRNA’s IBS (Figs. 2 and 3 and Fig. S6). This scenariowas further supported by retaining pre-mRNA in the nucleus,thereby minimizing the opportunity for mRNA–pre-mRNAinteractions and resulting in partial relief of silencing (Fig. 5).It is unclear how the formation of the 14-bp duplex betweenS-mRNA and pre-mRNA is facilitated and maintained. Pos-sibly, a dsRNA-binding protein is required for stabilizing theRNA–RNA complex, as Staufen proteins do on duplexes betweenlong noncoding RNA (lncRNA) short interspersed nuclear ele-ments (SINEs) and mRNA SINEs (16, 17). Previously, coenrich-ment of pre-mRNA and S-mRNA in polysomal fractions wasdisrupted in an UPF1 deletion mutant (12), suggesting that Upf1might be a partner of the protein that maintains the RNA–RNAinteraction (18).Eukaryotes seem to have solved the problem of interactions

between intron-containing pre-mRNA and its spliced product bydevelopment of a nuclear membrane and compartmentaliza-tion of pre-mRNA and S-mRNA in the nucleus and cytoplasm,

respectively (19). Evolution of the spliceosome, which is postu-lated to have occurred concurrently with development of thenuclear membrane (20), may have been concomitant with lossof the EBS–IBS interaction. However, there are still examplesof cytoplasmic splicing in eukaryotic cells, such as in anucleateplatelets (21) and in the dendroplasm of neuronal cells (22).Moreover, cytoplasmic splicing by the minor spliceosome pathwayhas been reported (23). Nevertheless, gene expression seems un-perturbed, likely because of the absence of EBS–IBS interactions.Interestingly, a brown algal group IIB intron, which differs fromthe L. lactis group IIA intron in part by its extensive EBS-IBSinteractions, is similarly silenced when expressed from the yeastnucleus (24). These considerations raise the question of how thepotential mRNA–pre-mRNA interactions and resulting genesilencing are avoided in bacteria or organelles, where there is nonuclear-cytoplasmic compartmentalization. Possibly, in thesehost environments, there are different mechanisms that eitherprevent RNAs from interacting or melt the duplex to achieveprotein synthesis. The absence of degradative cytoplasmic com-plexes, such as PBs and SGs, may also play a role in preservingtranslation in bacteria.

RNA Miscompartmentalization as a Roadblock to Gene Expression.Two main quality control mechanisms prevent nuclear exportof mRNAs containing errors (25). One is nuclear mRNA decay,which degrades RNAs (26), and the other is the Mlp1-Mlp2gating system, which holds premature mRNA in the nucleus withthe nuclear pore complex (27). Interestingly, group I introns,which also have intron-exon pairings but do not impose silencing,are retained in the nucleus (28), whereas group II intron-containingpre-mRNAs bypass these nuclear RNA surveillance systems.Thus, premature termination codons in pre-mRNAs are notsufficient for nuclear retention, specifically for group II introns.Like eukaryotic pre-mRNAs that are accidently exported to thecytoplasm, group II intron-containing pre-mRNAs are subject toNMD (12). Interestingly, we observed a lower abundance ofintron-containing RNA when interacting mRNA was providedin trans (Figs. 2 and 3 and Fig. S5), suggesting that RNA–RNAinteractions might stimulate RNA decay as well. Notably, thereduction of pre-mRNA and S-mRNA levels caused by NMDdid not account for silenced expression (12); thus, we invokedtranslational repression as a possible explanation for silencingcaused by the intron in cis. The relative roles of RNA stability,NMD, and translational repression when the intron is expressedin cis or in trans remain to be determined.A striking feature of group II intron-related RNAs is the

punctate appearance of pre-mRNA and S-mRNA in contrastto the C-mRNA transcribed from an intron-less construct. Asmentioned before, the NMD protein Upf1, which is transientlylocalized to PBs (13), appeared to be involved in polysome/monosome partitioning of group II intron-containing pre-mRNA(12). Our current data reveal that Dcp2 and Pab1 are signifi-cantly enriched in intron-related RNA–protein complexes (Fig.4). Dcp2 catalyzes removal of the 5′-cap of mRNAs triggered by3′-deadenylation (29, 30), whereas Pab1, the major poly(A)-tailbinding protein in yeast, functions in mRNA biogenesis, nuclearexport, translation, and RNA decay [refs. 31, 32 and referencestherein]. Although the association of the group II intron-relatedRNAs with Dcp2 and Pab1 needs to be interpreted with caution,this association may be reflective of translational repressionor sequestration of group II intron-related RNAs in ribonucleo-protein (RNP) granules, particularly PBs and SGs, which com-municate NMD (33, 34) and inhibit mRNA translation (13). Itremains to be determined if targeting to these particles mayresult from mRNA–pre-mRNA interactions, or if mRNA–pre-mRNA interactions could result from in situ splicing in PBs and/or SGs.

Cytoplasmic granules

5' - cap

AAAA - 3’

5' - cap AAAA - 3’AAAA - 3’

Transcription

5' - cap AAAA - 3’

Export

Nonsenserecognition

NMD

AAAA - 3’

Splicing

SilencedExpression

nucleus

cytoplasm

AAAA - 3’

5’ - cap AAAA - 3’

3’ - AAAA cap - 5’3’- AAAA cap - 5’

3’ - AAAA

5’- cap AAAA - 3’

5' - cap AAAA - 3’

3’ - AAAA cap - 5’

3’ - AAAA cap - 5’

AAAA - 3’

AAAA - 3’

GpII Intron

AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

AAAA - 3’AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA

Fig. 6. Model for the mechanism of group II intron-specific nuclear genesilencing. Intron-bearing pre-mRNAs are exported to the cytoplasm, whereRNA splicing occurs, and pre-mRNA is subject to NMD (12). Pre-mRNAsthat escape NMD or excised introns interact with S-mRNAs by EBS-IBS basepairings, resulting in silencing of mRNAs, which are localized to cyto-plasmic granules.

6616 | www.pnas.org/cgi/doi/10.1073/pnas.1404276111 Qu et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 19

, 202

0

Expulsion of Group II Introns and Evolution of Spliceosomal Introns.The origin and evolution of spliceosomal introns has been thesubject of much debate (11, 35, 36), but given structural equiv-alences, splicing parallels, and chemical reaction identities, thereis little doubt that they evolved from group II introns (37). Themobile and invasive group II introns are proposed to have en-tered the ancestral eukaryotic lineage with the mitochondrialendosymbiosis. It is argued that nucleus-cytoplasm compart-mentalization and NMD evolved as a defense against thedeleterious effects of group II intron invasion (10, 36, 38). Thehost is then surmised to have evolved the spliceosome, alsoas an adaptive response to intron invasion (36). Our previousstudy showed that roadblocks to gene expression in S. cerevisiaeare NMD and translational repression (12). Here, we furtherdemonstrated that RNA mislocalization to the cytoplasm andmRNA–pre-mRNA interactions account for reduction of S-mRNAand translation products. The group II intron-mediated genesilencing could have been the pressure that stimulated spli-ceosome evolution and nuclear splicing. Indeed, gene silencingwas relieved by separation of splicing and translation throughretaining pre-mRNA in the nucleus (Fig. 5). Therefore, theseobservations provide a molecular basis for understanding whygroup II introns are absent from nuclear genomes, and theysupport the hypothesis that cytoplasm-nucleus partitioning con-tributed to the emergence of spliceosomal introns with the ex-pulsion of group II introns from nuclear genomes.

Materials and MethodsDetails of yeast strains, plasmid construction, RT analyses, the copper re-sistance assay, Western blotting, RNA FISH and fluorescence microscopy, andIP are provided in SI Materials and Methods.

For RNA affinity purification, cell lysate was prepared as previously de-scribed (39). Briefly, yeast cells were collected at midlog phase (OD600 of∼0.8) and disrupted in RNP-lysis buffer [20 mM Tris·HCl (pH 8.0), 140 mM KCl,1.8 mM MgCl2, and 0.1% Nonidet P-40] by vortexing (24 s, resting for 1 min,18 cycles) using zirconia glass beads (Biospec). Lysates were cleared by tworounds of ultracentrifugation in a TLA120.1 rotor (Beckman) (40,000 rpm for28 min and 60,000 rpm for 34 min). To pull down RNAs, extract containing2.5 mg of protein was incubated with 25–50 μL of streptavidin resin (ThermoScientific) with rocking at 4 °C overnight; the resin was then washed six timeswith RNP-lysis buffer. For competition assays, cell extract was preincubatedwith 12.5 μg of egg-white avidin (1× corresponds to 5 μg of avidin permilligram of protein) for 1 h and the mixture was incubated with strepta-vidin resin. RNPs were eluted with 5 mM biotin for 1 h. RNAs were extractedfrom the eluates, and their identities were determined by the primer ex-tension termination assay.

DNA oligonucleotides and plasmids used in this work are listed in Tables S1and S2, respectively.

ACKNOWLEDGMENTS. We thank Roy Parker for yeast strains and usefuldiscussions, Robert Singer and Susan W. Liebman for plasmids, Hua Shi forthe streptavidin aptamer template, Karl Bertrand and Jeff Travis fortechnical help with the confocal microscope, and Cara Pager and PrashanthRangan for comments on the manuscript. This work was supported byNational Institutes of Health Grants GM39422 and GM44844 (to M.B.) andGrant GM52072 (to M.J.C.).

1. Candales MA, et al. (2012) Database for bacterial group II introns. Nucleic Acids Res40(Database issue):D187–D190.

2. Belfort M, et al. (2000) Mobile Introns: Pathways and Proteins. Mobile DNA II, edsCraig NL, et al. (ASM Press, Washington, DC), pp 761–783.

3. Lambowitz AM, Zimmerly S (2011) Group II introns: Mobile ribozymes that invadeDNA. Cold Spring Harb Perspect Biol 3(8):a003616.

4. Sontheimer EJ, Gordon PM, Piccirilli JA (1999) Metal ion catalysis during group II in-tron self-splicing: Parallels with the spliceosome. Genes Dev 13(13):1729–1741.

5. Fica SM, et al. (2013) RNA catalyses nuclear pre-mRNA splicing. Nature 503(7475):229–234.

6. Cech TR (1986) The generality of self-splicing RNA: Relationship to nuclear mRNAsplicing. Cell 44(2):207–210.

7. Keating KS, Toor N, Perlman PS, Pyle AM (2010) A structural analysis of the group IIintron active site and implications for the spliceosome. RNA 16(1):1–9.

8. Toor N, Keating KS, Taylor SD, Pyle AM (2008) Crystal structure of a self-spliced groupII intron. Science 320(5872):77–82.

9. Galej WP, Oubridge C, Newman AJ, Nagai K (2013) Crystal structure of Prp8 revealsactive site cavity of the spliceosome. Nature 493(7434):638–643.

10. Martin W, Koonin EV (2006) Introns and the origin of nucleus-cytosol compartmen-talization. Nature 440(7080):41–45.

11. Roy SW, Gilbert W (2006) The evolution of spliceosomal introns: Patterns, puzzles andprogress. Nat Rev Genet 7(3):211–221.

12. Chalamcharla VR, Curcio MJ, Belfort M (2010) Nuclear expression of a group II intronis consistent with spliceosomal intron ancestry. Genes Dev 24(8):827–836.

13. Decker CJ, Parker R (2012) P-bodies and stress granules: possible roles in the control oftranslation and mRNA degradation. Cold Spring Harb Perspect Biol 4(9):a012286.

14. Yin QF, et al. (2012) Long noncoding RNAs with snoRNA ends.Mol Cell 48(2):219–230.15. Samarsky DA, Fournier MJ, Singer RH, Bertrand E (1998) The snoRNA box C/D motif

directs nucleolar targeting and also couples snoRNA synthesis and localization. EMBOJ 17(13):3747–3757.

16. Gong C, Maquat LE (2011) lncRNAs transactivate STAU1-mediated mRNA decay byduplexing with 3′ UTRs via Alu elements. Nature 470(7333):284–288.

17. Gong C, Tang Y, Maquat LE (2013) mRNA-mRNA duplexes that autoelicit Staufen1-mediated mRNA decay. Nat Struct Mol Biol 20(10):1214–1220.

18. Kim YK, Furic L, Desgroseillers L, Maquat LE (2005) Mammalian Staufen1 recruits Upf1to specific mRNA 3′UTRs so as to elicit mRNA decay. Cell 120(2):195–208.

19. Lodish H, Berk A, Zipursky S (2000) Processing of Eukaryotic mRNA. Molecular CellBiology (Freeman, New York), 4th Ed.

20. Koonin EV (2006) The origin of introns and their role in eukaryogenesis: A compro-mise solution to the introns-early versus introns-late debate? Biol Direct 1:22.

21. Denis MM, et al. (2005) Escaping the nuclear confines: Signal-dependent pre-mRNAsplicing in anucleate platelets. Cell 122(3):379–391.

22. Glanzer J, et al. (2005) RNA splicing capability of live neuronal dendrites. Proc Natl

Acad Sci USA 102(46):16859–16864.23. König H, Matter N, Bader R, Thiele W, Müller F (2007) Splicing segregation: The minor

spliceosome acts outside the nucleus and controls cell proliferation. Cell 131(4):

718–729.24. Zerbato M, et al. (2013) The brown algae Pl.LSU/2 group II intron-encoded protein has

functional reverse transcriptase and maturase activities. PLoS One 8(3):e58263.25. Kelly SM, Corbett AH (2009) Messenger RNA export from the nucleus: A series of

molecular wardrobe changes. Traffic 10(9):1199–1208.26. Saguez C, Olesen JR, Jensen TH (2005) Formation of export-competent mRNP: Es-

caping nuclear destruction. Curr Opin Cell Biol 17(3):287–293.27. Casolari JM, Silver PA (2004) Guardian at the gate: Preventing unspliced pre-mRNA

export. Trends Cell Biol 14(5):222–225.28. Brehm SL, Cech TR (1983) Fate of an intervening sequence ribonucleic acid: Excision

and cyclization of the Tetrahymena ribosomal ribonucleic acid intervening sequence

in vivo. Biochemistry 22(10):2390–2397.29. Muhlrad D, Decker CJ, Parker R (1994) Deadenylation of the unstable mRNA encoded

by the yeast MFA2 gene leads to decapping followed by 5′→3′ digestion of the

transcript. Genes Dev 8(7):855–866.30. Franks TM, Lykke-Andersen J (2008) The control of mRNA decapping and P-body

formation. Mol Cell 32(5):605–615.31. Chritton JJ, Wickens M (2011) A role for the poly(A)-binding protein Pab1p in PUF

protein-mediated repression. J Biol Chem 286(38):33268–33278.32. Tsuboi T, Inada T (2010) Tethering of poly(A)-binding protein interferes with non-

translated mRNA decay from the 5′ end in yeast. J Biol Chem 285(44):33589–33601.33. Sheth U, Parker R (2006) Targeting of aberrant mRNAs to cytoplasmic processing

bodies. Cell 125(6):1095–1109.34. Shyu AB, Wilkinson MF, van Hoof A (2008) Messenger RNA regulation: To translate or

to degrade. EMBO J 27(3):471–481.35. Rodríguez-Trelles F, Tarrío R, Ayala FJ (2006) Origins and evolution of spliceosomal

introns. Annu Rev Genet 40:47–76.36. Rogozin IB, Carmel L, Csuros M, Koonin EV (2012) Origin and evolution of spliceo-

somal introns. Biol Direct 7:11.37. Strobel SA (2013) Biochemistry: Metal ghosts in the splicing machine. Nature 503(7475):

201–202.38. Lynch M, Kewalramani A (2003) Messenger RNA surveillance and the evolutionary

proliferation of introns. Mol Biol Evol 20(4):563–571.39. Beach DL, Keene JD (2008) Ribotrap: Targeted purification of RNA-specific RNPs from

cell lysates through immunoaffinity precipitation to identify regulatory proteins and

RNAs. Methods Mol Biol 419:69–91.

Qu et al. PNAS | May 6, 2014 | vol. 111 | no. 18 | 6617

BIOCH

EMISTR

YSE

ECO

MMEN

TARY

Dow

nloa

ded

by g

uest

on

Nov

embe

r 19

, 202

0