rna-protein interactions within (3'utr) of the resistance 1 mrna · 2020. 4. 7. ·...
TRANSCRIPT
RNA-protein interactions within the 3'untranslated region (3'UTR) of the human multidrug resistance type 1 (MDR1)
mRNA
Christine D. Albino
A thesis submitted in conformity with the requiremenri for the degree of Master of Science
Graduate Department of Pharmacology UNIVERSITY OF TORONTO
8 Copyright by Christine D. Albino (2000)
National Library 141 of Canada Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services services bibliographiques
395 Wellington Street 395, rue Wellington OttawaON K1AON4 Ottawa ON K I A ON4 Canada Canada
The author has granted a non- exclusive licence ailowing the National Library of Canada to reproduce, loan, distribute or sel1 copies of uiis thesis in microform, paper or electronic fonnats.
The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fiom it rnay be prïnted or otherwise reproduced without the author's permission.
L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de rnicrofiche/film, de reproduction sur papier ou sur format électronique.
L'auteur conserve la propriété du droit d'auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.
RNA-protein interactions within the 3'untranslated region (3'UTR) of the humaa
multidrug raistance type 1 (MDRI) mRNA
by Christine D. Albino
Master of Science in Pharmacology, 2000
Graduate Department of Pharmacology
+. u nivenity of Toronto
ABSTRACT
The human MDRl 3'UTR was shown to be an inefficient mRNA destabilizer despite
similarities of its AU-rich elements to that of the labile c-myc (1). In this work, we
characterized the RNA-protein interactions within the MDRl 3'UTR to identifi regdatory
sequences that confer MDRl mEWA stabilization. RNA gel shift assays indicated that nt 4421-
4577 in the MDRl 3'UTR (termed MDRB) was the major protein binding site. LJV cross-
llliking andysis and cornpetition assays reveaied two proteins of 42- and 80-kDa in molecular
mass, fiom both HepGZ and K562 RSW, have a lower ability to bind MDRB compared to Myc
AU-rich elements (ARE) while a 32 kDa protein only binds the latter. Further rnapping using
antisense oligonucleotides localized the protein binding sites to U-rich regions (nt 4470-4487,
453 1-4548) of the MDRl mRNA. These results, together with secondary structure predictions,
suggest differences between the Myc ARE and MDRB RNA recognition by ARE-bùiding
proteins based on sequence and structure to modulate mRNA stability.
To Becky, 1 am very grateful for your support and encouragement throughout the 7ips7' and &downs' of my
Masten. Your ingenuity and bnlliance is admirable. Thank you for beiieving in my abilities. 1 am honored to have worked with you. 1 wish you ail the bat.
To Dr. Riddiclq Thank you for your helpful discussions, valuable advice and support.
To Dr. Okey and k. Harper? Thank you both for yow support. It was a learning experience in journal club.
.;\ Mana Merci beacoup mon amie. Tu est une personne très gentille. J'espère quelque jour, nous dons travailler ensemble et tout temp! You are the sister 1 never had! Thank you for keeping me Company and putting
up with me. What can 1 say, you corne in a great package (no need to List them ail)!
To .hahita, Thank you for teaching me the value of tirne and th& you for your fnendship. 1 admire your patience
(with me) and your conceni for others. You are one of the kindes? people I've ever known.
To Vien, Thank you for being such a great neighbor! I appreciate your sincerity, the really h y e-mail jokes,
and most of ad your fnendship. Thank you for those SipaStats lessons.
To Chunja, It's been fun working with you. Tbank you for your technical help and advice. Thank you for your
fiiendship.
To Chris, Thank you for your support and encouragement.
To Anahita. Afshin, Chunja, Maria Vien. Mary, Linnia Lisa Ricky, Yamini. Kirao. It's been fun to work in the company of geat fkienùs! Ifonly 1 can take you al1 to McGill with me!
1 wish to thank the Medicai Reseatch Council o f Canada for their support of this project. I also thank Dr. Lori Frappier of the Department of Medicai Genetics for the SW60 rotor used for the RSW preparahons. 1 also th& Dr. Tang for lending me the PCR machine. 1 am very pteful to the
Department of Pharmacology office &(Alice, Hirmberto, Paî, Janet, Diaua) for their help in matters which 1 am no expert in.
To my ioving mother, Thank you for your dailing support, understanding and patience.
Thank you God for everything.
I dedicare this thesis to Dr. Rebecca D. Prokipcak
TABLE OF CONTENTS
. . ABSTRACT ................................................................................................................................ u
... .......................................................................................................... ACKNOWLEDGMENTS 1ii
TABLE OF CONTENTS .......................................................................................................... iv
LIST OF TABLES
LEST OF FIGURES ..................................................................................................................... ix
.. LIST OF ABBREWATIONS .......................... ...... ..................................................................... XII
1 STATEIMENT OF TBE PROBLEM . . ~ . . . . o ~ . ~ o . . . ~ . . . ~ e ~ ~ m ~ ~ a ~ ~ ~ ~ ~ e ~ ~ ~ ~ ~ ~ ~ ~ m e t ~ ~ e m ~ ~ ~ O . 1 GENERAL BACKGROUND" .....~......................................................................m..............m..... 2 1.1 MESSENGER RNA S T m I L W ..e.oo o . e o e e e ~ e e ~ m ~ o ~ ~ e ~ o ~ ~ o ~ o ~ o o o o o o o o o o o o o m o o o e e 2
1 . 1 . 1 Importance in regdation of gene expression: ................................................. 2 1.1.2 Mechanisms of mRNA degradation .................................................................... 6
1.2 DETERMINANTS OF MRNA STABILITY/DECAY~.o..oo~o.o...~...~oo..".o..o~.o..t....o.o.o.~ooo 8 1.2.1. Cis elernents: RNA sequences .............................................................................. 8
.................... . * 1.2.1.1 The mRNA cap 5 'untransklted region und the poiy (A) tract 9 1.2.1.2 The coding regio n. ............................................................................... 10 1.2.1.3 The 3 'untransluted region ..................................................................... 1 1
1.2.2 Truns-acting factors: RNA-binding proteins ....................................................... 17 1 . 2.2. I MA-specf ic RNA-bidmg protezm: ..................................................... 19
Iron Regulatory protein (IRP) .......................................................................... 19 c-fos coding region deteminant-binding proteins ........................................... 19 c-myc coding region determinant-biading protein (CRD-BP) ........................... 20
1.2.2.2 Sequence-specifc RNA-binding protezns: .............................................. -20 Poly(A)-binding protein (PABP) .................................................................... 2 0 Proteins that bind to ARES in many mRNAs: ................................................. 20 The Embryonic lethal abnormal visuai (ELAV) family of RNA-binduig proteins: ................................................................................. 23 Heterogeneous nuclear nionucleo proteins (hnRNPs): ..................................... 23
1 3 TBE CONCEPT OF MULTIDRUG RESISTANCE : ......... ......-...... ~ W o o . , o o o ~ ~ ~ . . . ~ ~ ~ ~ o o o . 25 1.3.1 Multidrug Resistance Type 1 Gene: MDR 1 ....................................................... 26
Structure ............................................................................................................... 27 ............................................................ 1.3.3 Regdation Of MDR 1 Gene Expression: 2 8
................................................................................... 1.3.3. Z Gene amph$cution 3 0 ......................................................................... 2.3.3.2 Transcriptional regdation 30
.................................................................................................. Inducers. 3 0 ....................................................................... Putative B inding Elements 31
1.3.4 Tissue distribution ............................................................................................. 32 ............................................................. 2.3.4.1 Pgp expression in n o d tissues 32
.......................................................................................... 13 RATIONALE OF TEE WORK 37
...................................................................................................... 1.6 PRELIMINARY DATA: 38
1.8 OBJECTIVES: .................................................................................................................... 39
................................. 2 3 PREPARATION OF RIBOSOMAL SALT WASH 0 .......l......*.**e**m.. 40 ...................................................................................... 2.2.1 Polysome preparations 4 0
............................................................................................... 2.2.2 RSW preparations 41
23 PREPARATION OF Rbh!3 BY IN MTRO TRANSCRIPTIONo.*.*.*****.m*m* a . . m 42 ................. 2.3.1 Preparation of radiolabeled RNAs ... ......................................... 45
.................................................... 2.3.2 Preparation of unlabeled compeûtor RNAs 46
..................................................................... 2-4 ANALYSIS OF RNA-PROTEIN INTERACCIONS 50 ......................................................................................... 2.4.1 RNA gel shift assays 50
..................................................... 2.4.2 W cross-luiking of RNA-protein complexes 51
2.5 MAPPING OF PROTEIN BINDING SITES ON THE MDRB REGION ...........,..l....m.***o***o* ..a 52 .................................................................................. 2.5.1 Antisense oligonucleotides 52
........................ 2.5.2 RNA secondary structure prediction and design of ideal ODNs 52
PART 1.
THE BlJMAN MDRi mRNA * ~ * ~ * m ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ w ~ ~ ~ ~ m ~ e ~ w e ~ ~ m o e w ~ ~ a ~ w e w e e e m m a w w o e e w 55
3.1 OVERALL OBJECIIVE: .....................e..me...~~..~....o.e.......oo..........mm...m~..e~.~.........~...e.~.em. 55 3.1.1 The 3'UTR of the MDRl mRNA binds proteins found in the ribosomal salt
wash fraction h m human hepatoma (FIepG2) and erythroieukemia (K562) cytosolic extracts .............. .............. .. ..................... 56
3.1.2 Ration.de for the use of the r i i o s o d salt wash (RSW) in the experiments: .... 56 3.1.3 Majority of the RNA-protein interactions occur at the distal
157-nt sequence of the MDRl 3'UTR. ................................... . ... .. ............. ...... .59 3.1.4 Characterization of the molecular mass and binding specificity of
RNA-binding proteins and binding specificity on the MDRB region ............... 62
PART 2.
33. USE OF ANIlSENSE OLICODEOXYNUCLEOTIDES (ODNS) AS A MEANS OF
MAPPING RNA-PROTEIN INTERACT~ONS' S I T f s S ~ . ~ ~ ~ ~ ~ ~ e ~ . ~ w ~ ~ ~ ~ m ~ ~ ~ a m . ~ m ~ ~ ~ . ~ ~ e ~ ~ ~ ~ w ~ e e e e e e e 69 3.3.1 Design of ODNs: Factors to consider for efficient binding to target ........ . .......... 69
3A FIRST SCREEM NG: EFFECTS OF OD NS : 1, 49 6 ~ 9 79 99 13 AND 14 ...m..m.......e. *.*we****a**w*e***.* 7 1 3.4.1 Determination of the optimal concentrations for detection of
ODN effects on RNA-protein complex formation ... ..... ... .. . .. . ... ... . . . . . .. . . . . . . . . . . . . . 71 3 -4.2 RNA gel shifi assays to measure total binding . .. .... . . . .... ... .. . ..-. -. . .. . . . . . . . . . . . . . . . 7 4
3.4.3 Initial screening of MDRB ODNs: ODN7 enhanced the RNA-protein complex formation in both gel shifi and UV cross-linking assays. ..................... 74
3.4.4 Effect of other fint set ODNs on UV cross-linking: Initial screening showed that ODN13 is effective in inhibiting complex formation by W cross-linking experiments ......................................................................... 80
N . DISCUSSION ..................................................................................................................... 88
............................................................. V . SUMMARY AND CONCLUSIONS 107
APPENDIX 1.0. WORK IN PROGRESS ......................................................... ..132 Part 3: MUTATIONAL ANALYSIS: CONFIRMATION OF PROTEIN
BINDIlYG SITES.. ............................................................................ 133 ..................................................................... OVERALL OBJECTlVE 133
........................................................ MATERLALS AND METHODS -134 ............................................................ Preparation of mutant RNAs 134
................................................................. PRELIMINARY RESULTS 141
APPENDIX 1.1: PREDICTED SECONDARY STRUCTURES OF THE MUTANT MDRB W A S ................................................................... 146
LIST OF TABLES
Table 1:
Table 2:
Table 3:
Table 4:
Table 5:
Table 6:
Table 7:
Table 8:
Appendix 1.0
Table Al-0: Primers and templates used to generate T7 DNA templates for in vipo
lranscription of RNAs used in the mutational analysis ...*....8..~..-88................008000~000 136
LIST OF FIGURES
Figure 1: The fateofanmRNAinmammaliancells ........................................................ 3
Figure 2: Mechanisms of mRNA degradation in eukaryotes ........................................... 7
Figure 3: Schematic representation of the P-glycoprotein (Pgp) structure ..................... 29
Figure 4.4: Location o f W U 1 RNA probes within the MDR 1 32llX in
gel shift and W cross-linking experiments .................................... 44
Figure 4B: Sequences of RNA probes used ..................................................... 44
Figure 5:
Figure 6:
Figure 7:
Figure 8:
Figure 9:
Integrity of in vitro-transcribed "P-RNA probes ......................................... -47
Generation of in vitro-transcribed unlabeled MDRB RNAs ......................... .49
Subcellular localization and distribution of ARE-binding proteins from
SI 30. polysomes and ribosomal salt wash (RSW) isolated from HepGZ and
K562 celis which bind a segment of the MDR 1 3WT'R .................................. 57
Subcellular localization of RNA-binding proteins which bind a section
of the MDR1 3'UTR region (nt 42554440) by W cross-linking .................. 58
Determination of the specific region in the MDRl 3'UTR which binds
the RNA-binding proteins found in HepG? RSW ........................................... 61
Fipre 10: Determination of the approximate molecular mass of the
RNA-binding proteins interacting with the MDRi3 region
by UV cross-linking ...................................................................................... 63
Figure 11: Relative ability of the unlabeled MDRA, MDRB and Myc ARE probes
to compete for binding to the 80 kDa MDRB-binding protein ...................... 65
Figure 12: Relative ability of the unlabeled MDRA, MDRB and Myc ARE probes
to compete for binding to the 42 D a MDRB-binding protein ...................... 66
Figure 13:
Fipre 14:
Figure 15:
Figure 16:
Figure 1 7:
Figure 18:
Figure 19:
Figure 20:
Figure 21:
Figure 22:
Figure 23:
Figure 24:
Figure 25:
Figure 26:
Figure 27:
.......................... Specificity of the MDRB RNA-protein complex formation 67
Schematic diagram of the locations of the MDRB ODNs used
in part 2 of this study ..................................................................................... 70
....... Effect of ODNs on HepG2 RS W proteins' binding to the MDRB RNA 73
......................... Determination of the optimal concentration of ODN effects 75
Effects o f ODN7 (Panel A ) and ODNh ( h m second çcreening)
(Panel B) on the fiee MDRB RNA on the formation of
RNA-protein interactions ............................................................................ 77
Effects of ODNl3 on free MDRB RNA and RNA-protein interactions
in the gel shifl assay ...................................................................................... -78
Effect of ODN7 on the binding of HepG2 RSW proteins on
................................................... the MDRB RNA using UV cross-linking 79
Effect of ODN 13 on binding of HepG2 RSW proteins on the MDRB RNA
using UV cross-linking ................................................................................. -81
Dose-response curves: second screening of MDRB ODNs: 3.5. 6 and 8
using gel shifi analysis ................................................................................. 8 2
Effect of 0DN6 on the binding of the HepG:! RSW proteins ....................... 84
Effects of ODNs 3.5. 6 and 8 on the 80 kDa protein signal binding in . . .............................................................................. U V cross-linking analysis 85
Summary of effects of the most consistent ODNs investigated .................... 87
Predicted secondary structure of Myc ARE RNA using the RNAstnicture
3.5 program ................................................................................................... 9 9
Predicted secondary structure of MDRB RNA and locations of ODNs
used to target this region ........................................................................... 100
Predicted secondary structure of MDRA RNA using ~As t ruc tu re 3 .5 .... -101
APPENDIX 1.0 FIGURES:
Figure Al :
Figure A2:
Figure A3:
Figure A4:
Figure AS:
Figure A6:
Figure hl:
.................... Schematics of riboprobes used in part 3: mutational analysis 137
...................................................... Sequences of the mutant MDRB RNAs 138
Generation of T7 DN A templates for the MDRB mutant
.................. and control (MDRBw12 1- 130) RNAs for in vifru transcription 139
........... Generation of in vitro-trmcribed unlabeled MDRB mutant W A s 140
Confi~rmation of the predicted secondary structure similarity of
MDRB wt2 1 . 1 30 to the onginal MDRB RNA ............................................ 142
Effect on the 80 kDa protein binding by mutations of the binding sites
of ODN6. 0DN7 and ODN 13 on the MDRB RNA ................................... 144
Efféct on the 42 D a protein binding by mutations of the binding sites of
ODN6. 0DN7 and ODN 1 3 on the MDRB RNA ........................................ 145
LIST OF ABBREVIATIONS
a-glo bin a-MEM BAR P8 ~r~/crn' PI
3'UTR 5'UTR A A260 AAF AhR M O V A ARE ATP AU AU-BP AUFl AUG AUH BIalP bp C CAAT CAMP CD3 ~ ~ 3 4 + cDNA CO2 cpm CRD CRD-BP C-terminal cm CYP ddH20 DEPC DNA mTPs DTT EDTA ELAV
alpha-globin alpha-minimal essential medium beta-adrenergic receptor "crogram ( 1 od gnuns) microJoules ( 1 0" Joules) per square centime ter area microlitre ( 1 od litres) micromolar (lo4 molar) 3 'untranslated region 5' untrançlated region adenine absorbante at 360 nanometers 2-(acety lamino)-fluorene Aryl hydrocarbon receptor anaiysis of variance Adenylate/uridyIate-rich element adenosine S'-triphosphate adeny lateluridy late AU-binding proteins also called hnRNP D, member of the ELAV-like RNA-binding proteins initiation codon enoyi-coenzyme A hydratase RNA-binding protein benzo[a] pyrene base pair cytosine GCT/CCAATCT, modifying elements of TAAT box 3',5'-cyclic adenosine monophosphate cluster Wignation 3, T-ce11 membrane rnarker I,
tumor markers for antigens in lymphomas and leukemias complementary DNA reverse transcnbed fiom RNA carbon dioxide counts per million coding regioo deteminant c-mye coding region determinant binding protein carboxyl terminal cytidine S'-triphosphate cytochrome P450 filtered doub le-distilleci water diethy lpyrocarbonate deoxynbonucleic acid deoxynucleotide triphosphates dithiothreitol ethylenediarnine tetracetic acid embryonic lethal abnormal visual
xii
g G GAP-43 GLUTI GM-CSF GTP HCl Hem1 HepG2 hnRNA hnRNP hr IGF-II IL n2.E IRE-BP IRP K562 KB kcaUmo1 KCI kDa Kd
mdr MDRI mdria mdrlb MDR2 mdrl MDRA MDRB M M mg MgCh min ml mM mRNA
fetal bovine senun far upstream element binding protein gravitational force guanioe growth-associated protein 43 glucose transporter type 1 granulocyte-macrophage colony-stimulating factor guanosine S'-triphosphate hy droc hloric acid human neuron-specific RNA-binding protein human heparoma ceil iine heterogeneous nuclear RNA heterogeneous nuclear ribonucleoprotein hr/ hrs insulin growth factor II interleukin iron responsive elements iron responsive elements-binding protein (also known as IRP) iron regdatory protein human erythroleukemia ce11 line squamous ce11 carcinoma kilocalories per mole potassium chloride kilodaltons dissociation constant, a measure of the binding afinity of a protein for its substrate; defied as the initial concentration of substrate that yields half maximal velocity. rnolar 7-methy lguanosine double-minute-associated amplified DNA sequences in a tumorigenic derivative of NIH 3T3 ce1 1s muitidnig resistance genes human rnultidrug resistance type 1 class I mdr gene in rnice (also hown as rndr3) class II mdr gene in mice (also known as mdr 1) human rnultidrug resistance type 2 (also known as MDR3) class III mdr gene in mice proximal portion of the MDRl 3'UTEt (nt 4255-4440) distal portion of the MDRl 3'UTR (nt 442 1-4577) mating pheromone factor miiligram ( 1 O" grams) magnesium chloride minutes millilitre ( 1 O" litres) rniUimolar (105 molar) messenger RNA
mRNP Myc ARE NaCl NF1
PABP P m PBS PCBPfaCP
PCR Pm plPl ~ g ~ 2 P ~ P J poly (A) tail Poly(A)* PO~Y(A)+ PTB RNA RNase rpm RSB RSBG Rsw SDS SDSPage SE snRNP SPI SP6 T tu2 T7 TATA TBE TCDD
messenger ribonucleoprotein c-myc AU-rich elements in the 3'UTR sodium chloride (also known as CTF) family of different proteins that recognize the core sequence CCAAT nanogram ( 1 O" grams) nanomolar (1 O-' molar) nucieotide amino terminal nucleoside 5'-triphosphates anrisense oiigodeoxynucleotides probabilit. AUF I isoform with molecular weight of 37 D a A m 1 isoform with molecular weight of 40 D a poly (Akbinding protein polycyclic arornatic hydrocarbon phosphate buffered saline polycytidylate [poly(C)]-binding protein a-complex protein (also known as hnRNP E) polymerase chah reaction P-glycoprotein, product of the the mdr genes class I mdr gene in hamsters class II mdr gene in hamsters class III mdr gene in hamsters polyadenylate residues at the 3'end of an mRNA mRNA without a poly(A) tail mRNA with a poly (A) tail polypyrimidine tract binding protein ribonucleic acid ribonuclease revolutions per minute nisoma1 solubilizing b a e r RSB plus 10% glycerol ribosomal salt wash sodium dodecy 1 sulfate sodium dodecy 1 sui fate-pol y acry lamide gel elecaop horesis standard error s m d nuclear nïonucleoprotein eukaryotic transcription factor which binds to a GC-rich sequence SP6 RNA polymerase thymine half-li fe T7 RNA polymerase TATANTA, most cornmon eukaryotic promoter sequences Tns-Borate EDTA 2,3,7,&tetr;ichlorodi'be11~0-pdioxio
transfonning growth factor beta transmem brane melting temperature (or annealing temperature) tumor necrosis factor alpha transfer RNA uracil Undine S'-triphosphate ultraviolet iight volume per volume weight per volume wild type
L INTRODUCTION
1. STATEMENT OF THE PROBLEM
The developrnent of multidrug resistance is a major obstacle in cancer chemotherapy. It
determines the success or failure of controlling disease progression due to decreased
cytotoxicity of cancer chemotherapeutic dmgs. The most well-characterized and frequently
overexpressed of the rnultidmg resistance proteins in tumor cells is P-glycoprotein (Pgp),
encoded by the human multidnig resistance type 1 (MDR1) gene. Research to overcome this
bamier in treatrnent has k e n focused in two areas: (1) advanced and sensitive detection of
MDRl mRNA or Pgp protein and function in human tumor samples (2) development of Pgp
modulaton. While the majority of studies to date focus on the tmcriptional regulation of
MDRl and/or direct uihiiition of Pgp transport hction, evidence fiom rat liver studies
suggests that pst-transcriptional regulation, in the fom of mRNA stability, is a key
mechanism that leads to increased class 11 Pgp mRNA levels. At present, studies on the
stability of the human MDRl mRNA are scarce. If mRNA stabiiity is indeed a major
mechanism controllhg Pgp overexpression in liver cancers, then ways of circumventing MDRl
cm be directed at the level of its mRNA. For example, studies have descnbed the use of
antisense oligonucleotides (ODNs) which interact with mRNAs in the S'UTR, AUG codon
region, stop codon and 3'UTR (2, 3). Binding of ODNs can lead to mRNA destruction and
reduced expression of the target mRNA.
Our research focused on characterization of the 3'-untranslated region (3'UTR) of the
MDRl mRNA for several reasons: (1) 3'UTRs have been characterized as important
determinants of mRNA decay, (2) several tru12~-acting factors (RNA-binding proteins) have
been shown to bind these regions and regula-îe mRNA stability or decay, (3) understanding the
biological fiinction and importance of these regions in the context of MDRl mRNA
metabotism, will provide insights on the contribution of mRNA stability to the development of
multidrug resisîance. Finally, these studies will also provide useful information for the
development of ODNs that will effectively decrease MDRl mRNA levels, and consequently
decrease Pgp ievels.
GENERAL BACKGROUND
In order for the reader to appreciate the regulatioa of MDRl rnesseager RNA (mRNA)
stability and the studies that are to be presented in this thesis, an overview of rnRNA
degradationlstability is first presented.
1.1 MESSENGER RNA STABILITY
Figure 1 shows a schematic diagram of the fate of a mRNA molecule. Post-
transcriptional regdation of mRNA occurs at the Ievel of heterogeneous nuclear (hn) RNA
processing (4, 5)- nuclear cytoplasmic transport of mature mRNA (6), and mRNA stability (7,
8).
1.1.1 Importance in regulation of gene expression
The regulation of messenger RNA degradation is a powerful way of sustainhg or
inhiiiting gene expression. All mRNAs have an intrinsic half-life (tin). This is defined as the
time it takes for half of the mRNA molecules to be degradeci. The h&life of mRNAs can
range £tom as short as several minutes, as in the case of some proto-oncogene and cytokine
mRNAs, to days, as in the case of the globin mRNAs. Because of the stability of the globin
M A S , they are widely used as ideal systems for idenwing factors which promote mRNA
FIGURE 1: THE FATE OF AN mRNA IN MAMMALIAN CELLS. The initial heteronudear transcript (hn RNA) is synthesized by RNA polymerase type II from the genomic DNA template. After the transcript is processed into the mature mRNA within the nucleus, it is translocated from the nucleus to the cytoplasm. In the cytoplasm the mature mRNA is subjected to different processes including locdization, translation, and degradation.
stability/degradation. Several evidences point to a pivotal role of mRNA tumover as a means of
regulatuig gene expression. The steady-state levels of many mRNAs correlate more closely
with their cytoplasmic haKlives rather than their transcriptional rates (9). Regulation of
mRNA stability cm d o w a ceil to respond quickly to environmental cues.
Most mRNA half-lives change in response to nutritionai stanis, stages of the ce11 cycle
or ceil differentiabon. In fact, many important events in deveiopment- such as pattern
formation and terminal differentiation- are regulated by an array of pst-transcriptional
mechanisrns, controlling mRNA stability, locdization, and translation (10- 12).
In cases of rapid turnover rates, this pennits the ce11 to respond quickly to signals.
Short-lived mRNAs are necessary to ensure transient expression at distinct stages, as
demonstrateci by the pattern of c-Myc protein expression (9, 13). On the other hand, long-lived
mRNAs are generally found in special ized di Rerentiated cells. This pemits the accumulation
of distinct proteins (e-g. the accumulation of hemoglobin in erythrocytes) or during stage-
specific mRNA stability during development (9).
Regulation of messenger RNA stability is ais0 important in regulation of specific genes
which play important d e s in maintaining homeostasis, of which there are nurnerous examples.
For example, mRNA stability is a key reguiator of beta-adrenergic @-AR) receptor levels.
Upon fl-agonist exposure, rapid destabiiization of the human BI- and -AR as well as the
hamster p2-AR mRNAs occur, which shorten the half-lives by about 50% (14-18). mRNA
stability is also important in the regulation of iron homeostasis. The presence of Iron-response-
elements (IRES) on the mRNAs of two key proteins necessary for iron transport and storage
namely: transfenîn and femtin, allow for interaction with the IRE-binding protein (IRE-BP) in
response to varying levels of iron. Not only does regulation of mRNA decay important in
normal biological processes but it also plays an important role in disease processes, including
cancer.
With the important contributions of mRNA haif-life modulation, one can concede that
aberrant regdation of mRNA degradation can influence the pathways of carcinogenesis and
also influence the phenotype of certain neoplastic cells. mRNA degradation rnediated by
adenylate-uridyiate eiemenrs (AREsj found in the 3'untranslated region of &-As are
associated with ce11 transformation and oncogenesis (19). One example is the deletion of the
ARE from the 3'UTR of the c-fos mRNA. This deletion activates the c-fos prolo-oncogene into
an oncogene (20). Recently, Hsing et al. (2 1) showed that induction of mdm2 mRNA by
benzo [a] pyrene (B [a]P ), a po ly cy clic ary l hy drocarbon (PAH) ) was dependent on P AH-induced
genotoxicity. This induction could not be accounted for by increases in transcriptional rate (the
mdm2 promoter contained AhR-binding sites) nor by p53 response elements. Instead, the
increased mRNA level was brought about by an increase in mdm2 mRNA half-life (i-e.
stabilization of the mRNA). This was the first report to show that mdm2 can be regulated at the
pst-transcriptional level and independent of p53. This study is important in that it provides an
important association between DNA damage and RNA stability which can have profound
consequences to carcinogenesis fiom environmental stress by PAHs.
Alterations in mRNA stability have also been shown to be key mechanisms in the
regdation of mRNA steady-state levels during liver regeneration for many genes including
mdm2, p53, TGF-p as well as multidmg resistance genes (22). It is therefore essential to
i denw the factors that duence mRNA half-Me and understand how changes in this
parameter can affect ceil growth, differentiation and neoplastic transformation.
1.1.2 Mechasisms of mRNA degradation
Figure 2 shows a summary of the pathways of mRNA degradation in eukaryotes. One
of the major pathways implicated for decay of most mRNAs is the prior shortening of the 3'
poly(A) tail in the cytoplasm (23). Severai observations demonstrateci that the removal of the
poly(A) tail precedes the decay of the mRNA body. Tmcnpts without poly(A) tails degracie
more rapidy than adenylatrd dWAs in cells. Funhennore, cis elements such as sequences in
the 3'UTR of the unstable yeast MFA2 mRNA, the coduig region of the unstable rnammalian
c-fos mRNA, and the AU-rich motif in the c-fos 3'UTR also promote rapid deadenylation aside
from their own role as mRNA degradation determifliints. Once triggered, the rate of
deadenylation is not constant rather, it occurs in several phases. In yeast, deadenylation is slow
with removal of the poly(A) tail occuring at a specific rate until the tail is reduced to about five
to 15 adenosine residues or 30 - 60 adenosine residues in other organisms. This oligo(A) tail is
then slowly shortened by a process terrned terminal deadenylation (23). As will be discussed in
other sections, the AU-rich sequences can achially detemine two distinct kinetic pathways for
ths deadenylation step (19). Transitions in deadenylation rate may also involve modulation of
messenger nbonucleoprotein (mRNP) composition or structure (24-26). In yeast,
deadenylation leads to removal of the S'cap followed by mRNA degradation in a 5' to 3'
direction. There is evidence of a similar enzyme which removes the S'cap in mammalian cells
(27-29).
A second mechanism of mRNA decay involves intemal (endonucleolytic) cleavage of
the mRNA which occurs independent of prior poly(A) tail removaf. The detection of 5' and
3'poly(~)+mEW~ fragments as intermediates in vivo after transcriptionai shutdown support the
existence of this pathway (30). ui the case of the rnammalian histone mRNAs, which do not
S'UTR CODING REGION 3'UTR Deadenylation- A A A A A A Endonucled ytic
independent decappin I 'Fi cleavage
,, \r decay Decapping 3 '45 '
rn 7b4 , , P A Exonucleolytic decay
1 *.
5'-3' ~ ~ G P P P p> 4
Exonucleol ytic decay * 4
FIGURE 2: MECHANlSMS OF mRNA DEGRADATION IN EUKARYOTES. The diagram above shows diverse pathways of decay for adenylated mRNAs. (A) The deadenylation-dependent pathway is shown in the center. This pathway is likely to occur in yeast, as well as other eukaryotes. However, deadenylation can also lead to 3' -5' exonucleolytic digestion. (8) In certain situations, decapping can occur without prior deadenylation. (C) Alternatively, the mRNA degradation can be initiated by endonucleolytic cleavuge within the 3'untranslated region (3'UTR) independent of deadenylation. Since this type of cleavage is functionally equivalent to deadenylation, endonucleolytic cleavage may stimulate decapping of the S'fragment, leading to 5 ' 3 3' degradation of both fragments. Alternatively, the 5' fragment may be degraded in a 3'45' direction.
Poly(A) s hortening Decapping 3'- 5' + Exonucleolytic 7
Gppp W . > 51,38 decay
1 \ Exonucleol ytic
contain poly(A) tails, disruption of the characteristic stem-loop structure at the 3'end serves as
the initiating event in its 3' to 5' mRNA decay. The endonuclease cleavage sites can
significantly determine the differential decay rates of rnRNAs. RNA-binding proteins uniquely
bind some of these target sites. These pans-acting factors have the capacity to inhibit
endonuclease binding (for example, by modulating their f i n i t y or activity ) thereby altering
mREjA stability by modulanng the afftnity or activities of these proteins (23,3 1).
In summary, most, if not all, polyadenylated rnRNAs undergo deadenylation-dependent
mRNA degradation at some rate. The decay rate for a given mRNA could be regulated by
changes in the activity of several trum-acting facton that interact with specific cis elements
within that mRNA. In addition to this default pathway, the complexity of the degradation
pathway can aiso be determined by decay mechanisms specific to individual mRNAs, or
classes of mRNAs. Such mRNA-specific mechanisms include sequence-specific endonuclease
cleavage sites and/or mRNA-specific cis elements and mm-acting facton such as RNA-
binding proteins, as well as mRNA features that promote decapping independently of
deadenylation. For instance, it has been observed that a mRNA containing a premature
nonsense codon is decapped directly without pnor poly(A) shortening (32).
1.2 DETERMINANTS OF mRNA STABILITY/DECAY
1.2.1. Cis elernents: RNA sequences
With a variesr of cellular processes such as subcellular localization, transport into
polyribosomes for protein synthesis, and mRNA degradation to narne a few, how does the ce11
discriminate one mRNA fiom another? Specific cis elements contribute to the steady-state Level
of mRNA by promoting degradation or stabilization (33, 34). Sequences that function as
determinants to promote mRNA degradation have been identified in al1 regions of the
tninscript, such as the S'untnmlated region (S'UTR), the protein coding region, and the
3'untranslated region (3'UTR). Each of these regions are discussed below. By far, the bat-
characterized mRNA decay determinants are adenylate-uridylate (AU) sequences in the
3'untranslated region. Furthemore, some rnRNAs, such as the prolo-oncogenes, cifus and c-
myc harbor more than one crs element whch are iocated in different regions. This complexïty is
probably a compensatory mechanism which ensures strict control of protein expression. Cis
elements may fomi sefondary stem-loop RNA structures that facilitate binding of regdatory
tram-acting proteins.
1.2.1.1 The mRNA cap, 5 '~nZrans~ed region, and the poly (A) tract
Most eukaryotic mRNAs are protected from degradation by particular elements at either
of their termini. At the S'end, the m7G cap structure dong with the capbinding proteins,
protects the S'end from most 5'43' exoribonucleases (32). Transcripts without the cap
structure are about four times less stable than the capped mRNAs in oocytes and in ceii-free
mRNA decay systems (35-38). Although the role of the S7UTRs on mRNA stability is less
clear, this region, in some cases c m drastically affect specific mRNA half-lives. In theory, the
M A haKlife can depend on how the S'UTR influences the translational efficiency of the
mRNA (34). This is demonstnited, for example when a translation-inhi'biting stem-loop
structure is inserted in the S'UTR, which in tum changes the haif-life by several orden of
magnitude (39). In addition, the length of the S'UTR can dso affect M A half-life, as in the
case of the c-myc mRNA. This effect was show to be independent of translation (40-44). At
the 3'end, the poly (A) tract, in conjunction with the poly (A)-binding protein, prote& the
mRNA fiom 3'45' exoribonucleases (34). The fact that the poly(A) protects the mRNAs from
degradation is based on two lines of evidence: i) deadenylation is a key first step in the decay of
many mRNAs ii) A poly(A)- poly(A)-binding protein (PABP) complex, which is found to form
at the 3'terminus, protects mRNAs fiom rapid degradation in vitro. Furthexmore, rnRNAs
which lack the 3' poly(A) tract are unstable regardless of whether or not PABP is present in
excess. This is not to Say mat deadenyiarion auromaticdly mggers mREiA decay, since there
are examples of deadenylated or oligoadenylated rnRNAs that are relatively stable (45-50). In
yeast, however, the poly(A)-PABP complex appears to be a signal for degradation instead of
stability because a PABP-dependent nuclease exists in this systern (24, 5 1-54). The bais for
this difference between yeast and higher eukaryotes remah unknown. PABP has also been
shown to interact with other RNA-binding proteins in vitro. Recent work by Wang et ai. used
the well-characterized a-globin &A in in vitro rnRNA decay systems and demonstrated an
interaction between PABP and two 3'UTR RNA-binding proteins, aCP 1 and aCP2 (55). Their
findings confirmed the stabilizing b c t i o n of the PABP protein and aiso demonstrated its
involvement with two 3'UTR-binding proteins to stabilize the globin mRNA in vitro. ui
addition to protecting the M A , the S'cap and the poly (A) tract also affect the translatabiiity
of the rnRNA (56'57).
l.28 1.2 Tlie coding region
c-Jos mRNA contains three destabilinng elernents: one is located in the 3'UTR and two
in the coding region. One of the coding region determinants has been well characterized It
comprises 320 nucleotides near the center of the mRNA and encodes the basic and leucine
zipper regions of the protein which is criticai to its fûnction A 5'globin-f~-globin-3' chimeric
transcript resulting from an in-frame fusion of the 320 nucleotide sequence to the globin
mRNA coding region was fourfold less stable than the wild type globh rnRNA (50,58).
The c-myc coding region determinant specifies the last 60 amino acids, including part of
the helix-loophelix and al1 of the leuzine zipper motif. This region also Uifluences the mRNA
half-life when translation is inhibited (34). In intact cells, a globin-myc-globin mRNA is two to
three-foid iess stable than giobin mREjA and it is aiso at ieast threefold less stable than globin-
GAPDH-globin mRNA in ce11 fiee extracts. (59). Several observations show that the coding
region can infiuence mRNA half-life. i) mutations in the coding region of the mRNAs like c-
fos and c-myc, and tubulin c m drastically change the respective half-life. The presence of
destabilizing coding region elements found in these two mRNAs, cm fùnction independently to
that of the 3'UTR AUUUA motifs (60). ii) c-fos and c-myc mRNAs without most of their
3'UTRs including the AU-rich elements have half-lives still shorter than most mRNAs (58, 59,
6 1,62). Therefore, the instability detemiinants are assurned to be present either in the 5' region
or the coding region. iii) the introduction of a nonsense mutation in the 5' portion of the coding
region of most of the mRNAs investigated destabilizes the respective mRNA (39). iv)
antisense oligodeoxynucleotides which target the binding site of CRD-BP, a 70 kDa protein
which binds to the CRD region of c-myc mRNA and protects it fiom degradation, significantly
reduced both mRNA and protein expression levels (3 1). This reduction was associated with the
observed inhibition of KS62 ceU growth.
1.2.1.3 The 3'untramIated region
3'UTRs consist of sequence motifs which were found to be important in cellular
processes such as subcellular localization, translation efficiency and mRNA stability (34). By
sequence dignment of riiTZNA sequences, it was show that the coding region of cytokine
mRNAs for example, c m share about 60-80% homology at the nucleotide level. On the other
hand, the 3'UTRs can have up to 90% homology (60, 63). This highly conserved region
strongly suggests a very sigmhmt function. Therefore, it is not surprising that mutations or
deletions of ths region can have profound consgluences to mRNA metabolism. This region
has been the most characterized of al1 the cis elements in tem of its ability to regulate mRNA
stability. This has been due to a number of observations which show that the majority of the
signals for mRNA degradation are containeci within the 3'UTR. Some examples of hown
RNA-protein interactions in the cytoplasm ofien involve the 3'UTR of the M A . These
interactions cm be sequence-specific, such as the existence of AU-rich sequences in many
rnRNAs, or gene-specific, such as in the case of the GAP-43 (a membrane phosphoprotein
important in the development and plasticity of neural connections) pyrimidine-rich element
(64). This element serves as the stability determinant of the GAP43 mRNA and is
competitively bound by two proteins: FPB (far upstream element binding protein), and a PTB-
like (polypyrirnidine tract binding protein) (65). It was noted by transfection experiments that
the 3'WïR by itself could function as an iastability determinant. This region may contah
specific secondary structures, such as stem-loops or nucleotide sequences, such as AU-rich
sequences which in conjunction with tram-regdatory factors act as signals for mRNA
degradation or stability.
i ) stemIoop stmhrres In some rnRNAs, complete characterization of the 3'UTR showed that
it contains a specific secondary structure important for directhg mRNA decay by acting as a
recognition site for RNA-binding prote&. One example is the ceii cycle- regdateci histone
&NA. This mRNA lacks a poly (A) tracf yet its 3'UTR c m affect RNA processing in the
nucleus, localization and transport, translation and mRNA degradation. Implicated in the latter
process is a 30-nucleotide segment within the 3'UTR of the mRNA which forms a 6-bp stem
and a 4-bp loop. When this 30-nt portion is fuseci to globin mRNA, the chimeric tmoscript is
pst-transcri ptionally regulated sirnilarly to wild type histone mRNA. The stem-loo p structure
m u t also be located preciseiy at or near the 3' terminus to be effective as a degradation signal.
This stem-loop motif is present in al1 histone mWAs and is responsible for their rapid
ciisappearance at the end of the S phase of the ce11 cycle. (66-73).
Another example is the Iron-responsive element (IRE). This element has also been well
characterized in both the transferrin and femtin mRNAs. These mRNAs encode the transferrh
receptor and femtin proteins, which both play a role in iron homeostasis. Their mRNA
stability is dependent on iron concentration. There is an inverse correlation between the levels
of transfemn receptor mRNA and intracellular iron. The IRE is a 23- to 27-bp stem with a
mismatched C and a 6-nucleotide loop with C at its 5' end. (33,74). The IRE is bound by an
iron-regdatory protein (IRP) and the IRE can function differently depending on its location on
the mRNA. For exarnple, in the transferrin receptor mRNA, three out of the five IRES present
in the 3'UTR function to regdate M A turnover rates. On the other hanci, the IRE on the
ferritin mRNA is located in the S'UTR and it regulates translation. When the intracellular iroa
is in excess, no IRE-iRP complex foms which renden the transfenin rnRNA m a b l e . With
femtin mRNA, when the iron concentration is low, the IRP binds to the IRE of the ferritin
mRNA which then inhibits femtin mRNA translation The homeostasis is achieved by strict
control of the tninsferrin receptor and femtin proteins so as to maximize or minimize the
transport and storage of iron under varying iron conditions.
A third exarnple is the long-range stem-loop structure found in the 3'UTR of the
insulin-like growth factor II (IGF-II) mRNA. IGF-U is highly expressed in fetal ceiis and
probably contributes to cell proliferation and differentiation. The stem-loop structure of human
mouse and rat IGF-II mRNAs acts in two ways: i) as a site for endonucleolytic cleavage ii) as a
stability detenninant. The decay products detected were a stable 1.8 kb polyadenylated 3'
hagrnent and a larger but kss stable 5' ikagment. By compurer andysis and mase sensihvity
assays, two regions, one 75 nt 3' of the translation termination site, the other , a 300 nt (- 2 kb
From the 3' termination site) form a stable duplex structure with several outcrops of additional
stems and loops (75). One of the loops serves as the cleavage site. Interestingly, although the
duplex structure is maintained by inversion of the nucleotide sequences of the major stem, there
was a decrease or blockage of endonucIeolytic cleavage (75). This suggests that sequences of
the stem-loop are precisely situated for efficient hc t ion or that the secondary structure duplex
formed by inversion is different nom the wild-type that it cannot serve as a signai for tram-
acting factors. Furthemore, the stem loops are independentiy cleaved regardless of their
locations in the 3'UTR.
ii) Adenosine-Uridine-@ch mmnts (ARES). The ben characterized regions of mRNA
stability are located in the 3'-untranslated region. In facc the 3'UTR cm direct mRNA decay
independent to that of the remaining regions of the mRNA (34). The importance of ARE-
mediated mRNA degradation in regulating eukaryotic gene expression was initially recognized
as a consequence of three experimental observations:
i) oncogenic forms of the c-fos gene were discovered to have lost a 67-nt AT-rich 3'UTR
sequence present in non-oncogenic forms of the gene (20). This tnuicated c-fos mRNA is more
stable than wild-type, and results in over-expression of the c-fos protein.
ii) AU-rich sequences, specifically the sequence AULTLIA, were found in the 3'UTRs of
highly regulated proto-oncogene, transcription factor, cytokine, and lymphokine mRNAs (19,
39,41,46,50,76-79)
iü) Chhenc mRNA experiments dernonstrated that AU-rich segments of the GM-CSF and
c-fos 3 'UTRs could destabilize the otherwise stable p-globin reporter mRNAs (80,8 1)
A large number of unstable mRNAs have been shown to have AU-rich sequences containeci in
their 3'UTRs (60,82,83). However, not dl sequences have comparable destabilizing effects on
reported mRNAs. It is now recognized that there is considerable sequence and functional
heterogeneity among the ARES. 3'UTRs with destabilization activity include those with (e.g.
c-fis mRNA) and without (e.g. c-jun mRNA) A W A pentamen, and the number of such
pentamers, when present, can v q fiom one to seven.
TABLE 1: FEATURES OF THE THREE CLASSES OF ARES
AUUUA- containhg Class 1
Class II
lrnpllnm c-fus
GM-CSF
f - 3 scattered copies of AULTUA coupled with a nearby U-rich region
2- at least two overlapping copies of the nonarner U U A W A (U/A)(U/A) U-rich region and other features (?)
Biphasic: deadeny lation
precedes decay of RNA body
Biphasic: Same as class 1
Biphasic: Same as above
S y nchronous: resuits in decay intermediates with po ly (A) tai 1s of 30-60 nuc botides (nt)
Asynchronous: Results in poly(A)- de=y intermediates
Synchronous: Results in decay intermediates with poly(A) tails of 30-60 nt.
Based on sequence and known function of these AREs, Chen et al. subdivided these
AREs into at lest three classes. These are summarized in Table 1 (19). Class 1 and class II
AREs contain varying aurnbers of AUUUA motifs whereas class III do not contain this motif
Class I AREs contain one to three dispersed A W A motifs with nearby U-rich
sequences. They are usually O bserved in early-response-gene mRNAs suc h as nuclear
tramcnption factors (19,46), as well as mRNAs whch encode cytokines, such as interleukm 4
(IL-4) and IL-6 (76,81). It was shown by mutagenesis that each of these motifs in Class 1 has a
distinct role but the final destabilizing potency is determined by their additive effects (45).
Class II AREs consist of clustered multiple copies of AUUUA which are mostIy found
in cytokine mRNAs such as GM-CSF and tumor necrosis factor alpha (TM-a) ARES. Class III
AREs which contain n o n - A W A elements are found in the c-jun 3'UTR. Moreover, these
three classes of ARES direct rapid mRNA degradation by two distinct kinetics. Class II directs
asynchronous cytoplasmic deadenylation which yields poly(A)' mRNA intermediates. Class 1
(e.g. c-fhF) and III (c-jun) undergo synchronous poly(A) shortening which yields poly(~)+
mRNAs, which is then followed by decay of the mRNA body. Both classes exhibit a biphasic
decay pattern. During the first phase, a11 the mRNAs undergo a unifon rate of deadenylation
(with little or no degradation). During the second phase, the shortened poly(A) mRNAs are
quickly degraded.
Futther work by Xu et al. (77) studied the deadenylation kinetics of these different
classes of mRNAs. Their results demonstrated that the AUUUA motif, rather than the nonamer
ZTUAUCTLIA(UIA)(UIA), comprises the essential and the minimal sequence motif of AREs.
This is in contrast to previous hdings which demonstrateci that the me destabiliUng motif is
the nonamer, UUAULIIIA(U/A)(U/A) as reiterations of AüUüA were not destabilizing (84,
85).
1.2.2 Tramacting factors: RNA-binding proteins
The cts deterrninants discussed play a role in determining the stability or decay of most
mRNAs. However, a number of studies have s h o w that although these elements may target an
mRNA for degradation there are cases whereby a stimulus (such as a dmg, hormone,
intracellular factors) can in fact modulate the inherent mRNA half-life (9, 83, 86-88). in
majority of the studies to date, it has been shown that RNA-binding proteins form the primary
means of regulating this half-life by their ability to bind to these elements or structures (89).
The nuclear RNA processing reactions mediated by interactions between proteins and relatively
short crs-acting elements can be found almost anywhere along the RNA. However, an
ovemding majority of these interactions which regulate M A expression in the cytoplasrn is
regulated via the 3'UTRs (90).
The rnRNA-binding proteins in the cytoplasm may be associated with polynbosomes
which may form a major uncharacterized fraction of this large cornplex. Due to the large
number of mRNAs which are subject to pst-transcriptional gene regulation by mRNA
stabilization, we will restnct our focus on those RNA-binding proteins which are either rnRNA-
specific and those which bind the major cis elements, the A W A motifs, in the 3'UTRs of
most post-transcriptionally-regdated mRNAs (60). Table 2 shows recent examples of RNA-
protein interactions fiom different mRNAs.
TABLE 2: Examples of RNA-protein interactions within the 3'UTRs of rnessenger RNAs
2. chidren eiasün
4. lactate dehydrogenase A W H - A )
5. trkB (an mRNA localireci to hippucampal dendrites)
7. glucose transporter 1 (GLUTi )
9. amyioid precutsor protein (APP)
to 625 of the 3'UTR 52 k ~ a ; distinct horn ELAV-like protein HuR Upregulated upon phenylepherine (ai
agonist) treatment of
secondary k c t u r e (G3A motif) in 3'UTRs present in
(un~unfied) pmsent in nuclear and cytosolic fractions
several species 71 -nt hairpin loop 37139 kDa protein region betweten bases 1 %SI655
30 nt U-rich sequence with a predicted stemloop structure; the CAMP- stabilizing region (CSR), bound by CSR-binding
induced upon pyrazole treatment Present in poiyn'bosarnes (stronger induction) and nudei Cytosolic pmteins: 96,67,5% and 50-kDa each 3'UTR binding adivity upmgulated after PKA activation
RNA (dsRNA) protein): neuron- speafic calcium binding protein, binds dsRNA in a calaurn- dependent manner
Nonamer. 55 kDa protein-induœd UUAUUUAUU by llpopolysaaharide mgion
NC+U-rich mgion -36 kDa $ARB ((PAR within the 3'UTR 1 RNA-bindin~ protain):
mRNA stability upon phenylepherine tmatment
composed of ~ ~ R N P A i and HuR(dorninant cornponent of WRB; i n d u 4 by fEAR agoni*
29 bp (AU+&) 5 cytoplasmic proteins:
i stabiiity due to decrease in binding of cytosolic protein(s)
dernent
t stability upon pyfazole treatment
70,48,47-kDa : a n fragments of nudeolin 39.38. kDa are the hnRNP C
t stability due to CAMP-inducsd rnRNA stabilization
t ~tabililty and relief h m ARE-rnediated translational blockade (maior fundion) t stability mediatetd by enhanced binding of the two proteins to bases 2240-2347 in the S'UTR
4 stability upon tmatment with &AR agonist or dired adivaton of PKA
29 bp + proteins promote stabiiii 3 data not show
1.2. 2. 1 MA-specljic RNA-binding proteins:
Lron Reguiatory protein (IRP)
The IRP is an example of an RNA-binding protein which confers stability to its mRNA
(transfenin mRNA) when bound to the IRE (see section 1.2.1.3 (i) ). It acts as a stabilizer when
bound to the 3'UTR of bansfemn mRNA and as a translational repressor when bound to the
S'UTR of tèmtin (33, 74). The binding aftinity of W to the W. elements 1s controlled by a
"sulfhydryl switch" (99, 100). When the concentration of iron is high, an iron-sulfur cluster
becomes saturated with iron. This saturation then stimulates a conformational change within
the protein, reducing its afinity for the IRE. When iron concentrations are low, the RP binds
with high affinity to the IRE, protecting it fiom endonucleolytic attack.
c-fos codiag regioo determinant-binding proteins
Two proteins, with molecular masses of 64- and 53-kDa bind to a purine-rich segment
w i t b the 320-nt c-fos mRNA coding-region stability determinant (61). The 64-kDa protein is
predominantly found to be associated with polysomes. The 53-kDa protein is found in
polysomes and the cytosol or postpolysomal supernatant (S130). The primary binding site of
these two proteins has been localized to a 56-nt purine-rich segment at the 5' end of the
determinant. Their binding is inhibited by poly(A) and poly(G). The protein-binding site is
necessary, but not sufficient to detemine c-fos &NA stabilization because deletion of the 56-
nt site or the rernainder of the 320-nt region does not confer instability. Therefore, additional
proteins may be required to bind the 3'segment of the region (6 1).
c-mye coding region determinant-binding p rotein (CRD-BP)
The Cm-BP binds specificaily the c-myc coding region determinant RNA (10 1,102).
CRD-BP has been show to have fivefold higher affinity for c-myc than for N-myc RNA even
though they are stnicturally sirnilar. Its specificity for the c-myc mRNA is also illustrated by
the fact that this protein does not bind to globin mRNA. The protein is nomally bound to
polysome-associated c-myc mRNA, protecting it tiom endonucleolytic attack. Recently, it was
demonstrated by other worken in our lab (3 1) that dismption of the Cm-BP-RNA complex in
K562 cells by antisease oligonucleotides (ODNs) lead to a concentration-dependent decrease
in both c-myc mRNA and protein levels (at a maximal 65% decrease in protein) which
correlated with a reduction in K562 ce11 growth.
1.2.2 2 Sequence-specijc RNA-binding proteins
Poly(A)-binding protein (PABP)
PABP binds to the poly(A) tails of mRNAs and the resulting poly(A)-PABP complex
protects the mRNA Rom rapid degradation in mammalian cells. However, PABP promotes
deadenylation in yeast The mechanism for this difference is poorly understood, although there
have been suggestions of additional factors in yeast. PABP cm also bind tmnslation initiation
factors located at the 5' end of the mRNA where it stimulates initation of translation (103).
This "circu1arisation" of the mRNA is thought to add efficiency to the translation process by
allowing for proximity of the terminating ribosomes to the translation start site (56).
Proteins that bind to ARES in many mRNAs
To date, several proteins that bind ARES with varying degrees of specificity have been
identified and cloned These include a family of mamrnalian proteins related to the Drosophila
neuronal RNA-binding protein elav termed Hel-NI (a human neuron-specific RNA-binding
20
protein), HUC, HO, and HuR (104-106). Also included in this group are the heterogeneous
nuclear nionucleoproteins (hnRNPs) AO, A 1, and C (107, 108), as well as some RNA-binding
proteins displaying catalytic activities, namely, glyceraldehyde-3-phosphate dehydrogenase
(GNDH) ( 109) and the enoy 1-CoA hydratase AUH ( 1 10).
These factors have been correlated with either mRNA destabilizing (1 11-1 13), or stabilizing
mechamsrns (1 14, 115). Interestmgly, some proteins associated wth mRNA turnover also
possess additional biological functions (100, 1 10, 1 16, 1 17), indicating that mRNA metabolism
may be coupled with other physiological events.
AU-binding proteins (AU-BPs) bind with high affinity to RNAs containing AU-rich
and, in some cases, U-rich regions. Some of these proteins are located primarily in the
cytoplasm, while othen are nuclear and still others shuttie between both compartrnents (1 18).
Several observations point to the role of AU-BPs in influencing mRNA stability by
interacting with ARES.
( i) As previously discussed, many unstable mRNAs encoding transcription factors,
lymphokines, or cytokines contain ARES in their 3'UTRs (see section 1.2.1.3 (ii))). The
stabilization of inRNAs in response to varying stimuli also coincides with the increase or
decrease of some AU-BPs (see Table 2). For example, the decrease in the stability of the
chicken elastin mRNA (which is highly homologous to other species) during development is
govemed in part by the attenuated binding of cytosolic proteins (91). Another example is the
increased stability of the Phase 1 drug-metabolking enzyme, cytochrome P450 2aS (CYP2a5)
by pyrazole treatment. The increase in CYP2a5 rnRNA half-life is due to binding to a 71-nt
hairpin loop on the 3'UTR by a pyrazole-induced 37/39 kDa protein (92, 93) (See Table 2).
m e r examples include the stabilization of mRNAs encoding glucose transporter 1 and
amyloid precunor protein in tumor necrosis factor alpha-treated prdpocytes and in phorbol
ester-treated mononuclear cells, respectively, correlates with AU-BP induction (1 12).
(ii) In other cases, the pattern of induction or activity of other AU-BPs correlates
invenely with the rnRNA half-life. For exarnple, the level of an AU-BP called AU-B is
invenely proportional to the GM-CSF mRNA haif-life in T cells activated by a phorbol ester
pius an antibody to CD3 (1 12, i 19 j , and a 36-kDa protein that binds to f3-adrenergic receptor
mRNA is up-regulated when the rnRNA is destabilized by p-adrenergic agonists (see Table 2)
( W 7
(iii) ARE-containing mRNAs form polysomes that sediment slightly faster than
ARE-lacking mRNAs of the sarne size (8), perhaps because a large complex of one or more
AU-BPs is bound to the ARES.
(iv) Two observations suggest that AU-BPs affect mRNA stability in vitro. First, a
protein called AUF 1, which has high afinity for ARES and for poly(U), was £kt identified and
purified by virtue of its capacity to induce rnRNA destabilization in vitro ( 1 1 1, 12 1). Second,
when polysomes isolated from peripheral blood rnononuciear cells are incubated in vitro, GM-
CSF mRNA is degraded with a half-life of 90 min (1 15). However, if a competitor RNA with
ARES is added to the system, the mRNA is destabilized approximately fivefold. It is therefore
possible that under normal circurnstances (without cornpetitor RNA), the AU-BP is probably
bound to the ARE of the mRNA but in the presence of the competitor RNA, this AU-BP is
remited by the ARE site of the competitor thereby exposing the mRNA for nionucleolytic
attack.
The Embryonic lethal abnormal visual (ELAV) family of RNA-binding proteins
The ELAV proteins modulate mRNA stability via the ARES. These proteins have been
well studied arnoag other ARE-binding proteins as they exhibit high binding afinity to AU- or
U-rich sequences (64,104-106, 1 13, 122- 124).
The mouse HUC and the human HuR, have been demonstrated to simultaneously bind
the poiy(A j tail and the ARE m vitro ( t 25, 126 j. HelNi overexpression leab to enhanced
cytoplasmic expression of the glucose transporter (GLUTI) mRNA which harbon a U-rich
region in its 3 'UTR ( 127).
These proteins also form the mRNP complexes by bindmg to some p l y ( ~ ) + mRNA in
vivo. associating with ribosomes during translation (124). The ELAV proteins are found both
in the nucleus and cytoplasm, shuttling between the two compartments.
Heterogeneous nuclea r ribonucleo proteins (hnRNPs)
The hnRNPs were initially known as the major group of chromath-associated RNA-
binding proteins (128, 129). This group plays a role in packaging heterogeneous nuclear RNAs
(hnRNAs) into hnRNP particles (1 30). Following immunoprecipitation, cloning and functional
characterization of the hnRNP proteins, it was determined that the individual proteins in these
complexes contain RNA-binding motifs with differential sequence specificities ( 128, 129).
Approximately 30 proteins have been identified by twodimensiond gel electrophoresis of
human hnRNP complexes. A number of isoforms of hnRNPs are generated by alternative pre-
mRNA splicing. The s t ~ ~ c h ~ e s of the majority of these proteins are known (26).
A sttiking structural feature of hnRNPs is that they contain both RNA-binding motifs
and auxiliary domains which have been associated with protein-protein interactions. Most
hnRNPs are predorninantly found as nuclear proteins although they shuttle between the nucleus
and cytoplasm. Aside from interactions with other hnRNPs, these proteins also interict with
other factors. The hnRNPs: C, D (also called AUF I), L and PCBP/hnRNPE proteins (1 17,
13 1- 133) are among the major RNA-binding proteins. For exarnple, hnRNP L is involved in
the regulation of the human vascular endothelial growth factor (VEGF) mRNA stability during
hypoxic condrtions (133). hnRNP C has k e n proposed ro be involved in stabilization of the
APP mRNA (see Table 2, example 9). Because of the hown shuttling capabilities of hnRNPs,
there is a link between regulation of ARE-mediated decay and spatial distribution of ARE-
binding proteins during development. In humans, the hnRNPD proteins also function in mRNA
stability and it has been demonstrated that hnRNP D (AUFI) and the PCBPiaCP proteins
comprise the a-globin mRNA stability complex. This complex binds to the C-rich 3'UTR of
the highly stable a-globin mRNA ( 1 17).
hoRNP D (AUFI). AUFl comprises a farnily of four protein isoforms with apparent
molecular weights of 37, 40, 42, and 45 D a generated by alternative splicing of a common
pre-mRNA (134). Several lines of evidence indicate a role for AUFI in targeting ARE-
contalliing rnRNAs for decay: (i) ~ 3 7 ~ " [ and p40 were fmt purifieci fiorn a cornplex
capable of rapidly degradmg c-myc mRNA in vitro (1 1 l), (ii) both purifid and recombinant
AUF 1 isoforms indicate binding specificity for ARE-containhg RNAs in vitro (1 2 1, 13 2, 134),
(iii) the affuuty of p37*'" bincfing to ARE-containhg rnRNAs correlates with the mRNA
destabiliting potential of these sequences ( 132), and (iv) alterations in AUF 1 activity and/or
expression in vivo has been associated with changes in the decay rate of some ARE-containing
-AS (135-137).
1.3 THE CONCEPT OF MULTIDRUG RJWSTANCE:
Majority of patients with large tumor burdens during initial diagnosis subsequently
undergo a relapse of their disease and die as a consequence of hg-resistant malignancies.
Several factors contribute to failure in chemotherapy. Foremost among these is the inability of
the cytotoxic drugs to reach the critical cellular target. This is detemiined by the physiological
conditions surroding the neoplasm. The absorption, disnibunon. metaboiisrn. and
elimination of the drug are key deteminants of successfil cancer chemotherapy and by no
means play a minor role in a tumor cell's response to the drug. However, for the purposes of
this thesis, the focus will be on changes in cellular and molecular factors associated with the
development of rnultidrug resistance.
Multidrug resistance can be classifieci into two types: intrinsic resistance and acquired
resistance. Tumor types with an overall poor response rate to chemotherapy, such as those for
colon cancer, adenocarcinorna of the lung, disseminated malignant melanoma, as well as
tumors which normdly express multidrug resistant genes such as MDRl are considered to have
intrinsic drug resisîance. In contrast, patients who Uiitially respond to chemotherapy but
undergo relapse and become refractory to the same dmgs (and possibly cross-resistant to other
h g s ) are said to have acquired multidnig resistance. Therefore, spontaneous mutations occur
which select for drug resistant cells by continued treatrnent. A number of different mechanisms
have been shown to account for various types of dnig resistance. Examples of such include
increased dihydrofolate reductase expression which confers resistance to methotremte,
increased 06-methylguanine DNA methyltransferase which confers resistance to BCNU
(carmustine), increased glutathione and/or glutathione tramferase activiîy which confers
resistance to nitrogen mustard cornpounds, and increased metallothionein levels which confen
resistance to cisplatin ( 138). Ln addition, expression of other multidrug resistance genes such as
MRP (rndtidrug resistance-associated protein) (1 39), LRP ( h g resistanceassociated protein)
(140), as weil as altered topoisornerase II, and tissue-specific genes, have also been discovered
to be expressed in certain mon (138). One of the most extensively studied and common
forms of dnig resistance mechanisms is mediated by P-glycoprotein, encoded by the MDRl
gem which resdts in a broiid sprctrum of resistance tu chernotheniputic agents (Mi j.
It is necessary to understand the underlying mechanisms responsible for the
development of dmg resistance in order to devise rationai therapeutic approaches aimed at
revening or preventing the emergence of rehctory tumors.
13.1 Muitidnig resistance type 1 gene: MDRl
P-glycoproteins were f ist discovered by Juliano and Ling (142) in 1976 as large ce11
membrane proteins which are overexpressed in cancer cells and confened resistance to a
diverse array of hydrophobic drugs.
TABLE 3: NOMENCLATURE FOR MWLTLDRUG RESISTANCE G E N S DESIGNA'MON
The mammaiian P-glywproteins are encoded by a srnail gene f d y with two members
in humans, and three in rodents and hamsters. (Table 3). These mdr genes have been
subdivided into classes based on the similanties of their 3'UTRs (143). The cunent
26
1 Mouse 1 mdr3 (mdrl a) mdr 1 (mdr l b ) 1 mdr2 l
nomenclature is shown in Table 3. It was determined by complementary DNA (cDNA)
transfections that only classes 1 and II are involved in dnig resistance. This corresponds to the
MDRl in humans and mdrl(a1so known as mdrl b) and mdr3 (mdrla) in mice (144, 145). The
human MDRl gene (146), the mdrl (or mdrlb) and mdr3 (or mdrla) genes of mice (147), and
the pgpl and pgp2 genes of hamster (148) encode related proteins which transport
hydrophobic subsnates.
Evidence for a second P-glycoprotein gene in humans which corresponds to MDR3
(also called MDR2) came fiom a cloned cDNA from human liver (148, 149). The MDR3 P-
glycoprotein is the most conserved among mammalian P-glycoproteins. At the arnino acid
Ievel, MDR3 is 90% identical to the mdr2 gene in mice (147), and the pgp3 gene in hamsters
(148).
1.3.2 P-glycoprotein
Structure
The MDRl gene encodes a 1,280 amino acid protein, temed P-glycoprotein (Pgp). Pgp
belongs to a class known as the ATP-binding cassette transporter proteins (148, 150). These
proteins form an ancient farnily which includes memben specialized in rnany different
transport hinctions. The compounds range fiom large hydrophobic drugs to small oxyanions,
from a large hem01 ytic protein to peptides ( 148, 1 5 1 ). Perhaps the most interesting feature of
Pgp is its ability to bind and transport a broad range of compounds. Dmgs which are
transported are usuaily lipophilic and it has been proposed that the dmg-binding site(s) are
sihiated within the transmembrane domains of Pgp (1 51).
Pgp has a molecular weight of 170-kDa and is a single polypeptide chah containhg
two homologous halves of equal length. A schematic diagram of its structure and orientation in
the membrane is s h o w in Figure 3. Hydropathy profile analysis of its arnino acid sequence
shows that Pgp comprises 12 hydrophobic regions, suggestive of a transmembrane (TM)
channel which is detected by TM loops in situ. Pgp contains two cytoplasmic binding regions
located near the C-terminal which are mvolved in ATP binduig and hydrolysis ( 152). The Pgp
protein has a half-life of 1 2 hours ( 1 53).
Similarity of Pgp's arnino acid sequence and structure to those of other membrane-
associated proteins, such as hemolysin B, a bacterial transport protein (154), supports the role
of Pgp as an energy-dependent h g emux purnp. M e r evidence that this protein funnions as
a dnig efflux purnp cornes fiom studies whereby plasma membrane vesicles prepared fiom
multidnig-resistant cells in an inside-out manner showed that vinblastine, a substrate of Pgp,
was transported against a concentration gradient, required a constant supply of energy, and did
not occur in vesicles ftom hg-sensitive cells lacking Pgp (155-157). In addition,
nonhydrolyzable analogs of ATP did not permit this transport (1 55,157).
1.33 Regulation of MDRl gene expresion
The increase in MDRl mRNA levels in tumor cells c m m u r via gene amplification of
the MDRl gene during selection of cells for resistance to a single agent, transcriptional
induction by transcription factors and upon exposure to many agents, and by stabilization of
the MDRl mRNA,
Glycan moieties
OUT 7 0 Membrane
.m.*..*. m.. *.a.
FIGURE 3 : SCHEMATIC REPRESENTATION OF M E P-GLYCOPROTEIN (Pgp) STRUCTURE.
Pgp is ernbedded in the plasma membrane, transmembrane domains 1 to 12 are shown in blue, ATP- binding sites (A) are shown in red ; N: N-terminus, C: C-teminus of Pgp. Location of glycosylated sites are also shown.
1.3.3.1 Gene amp~flcation:
Several studies have identified amplified MDRl DNA sequences from multidrug-
resistant ce11 lines (158- 160). The elevated 4.5-kb MDRl messenger RNA levels during
selection of hurnan KB carcinoma cells as well as other multidrug-resistant sublines of hurnan
leukemia and ovarian carcinoma cells selected in colchicine, vinblastine, or adriamy cin is
associated with amplification of the EiDRi DNh squences ( i6 i j. increase in EVDRI &FA
expression can also precede gene amplification (16 1).
1.3.3.2 Ttumcripfio na1 regdation:
hducers
By far, the most studied regdation of MDRl is at the level of transcriptional induction.
MDRl mRNA leveis have been show to be enhanced by various factors, including hormones
and environmental circumstances. Induction is seen after heat shock, treatment by heavy met&
(162) or chemotherapeutic agents (1 58), or in response to carcinogens in the liver ( 163-165).
Treatment with cytotoxic agents ( l66), ultraviolet radiation, or partial hepatectomy has
also been shown to increase MDRl expression in both rodent and human ce11 lines (163, 167-
172). The effects of the increase in MDRl expression seen following exposure to
antineopiastic agents, including those which are not Pgp substrates, persisted for several weeks
following removal of the dnig (167). There have been reports that noospecific protein kinase
inhibitors block dnig-mediated MDRl induction. However, recent work by Parissenti et al.
(173) showed no apparent change in Pgp levels or cellular sensitivity by inhibition of PKA
activity to block MDRl gene expression in adnamycia-resistant MCF-7 breast cancer cells.
Furthemore, there is evidence that MDRl mRNA may be co-induced by 2,3,7,8-TCDD, which
is also a ptent inducer of the CYP450 1 gene family (163).
In addition, treatment of human colon cancer ce11 lines with differentiating agents such
as dimethyl sulfoxide or sodium butyrate has been s h o w to elevate MDRl gene expression
( 170).
Putative Binding Eiemenh
The MDR 1 gene contains at least two promoter regions ( 146, 174, 175). Ueda et al.
( 146, 175) demonstnited that MDRl transcription can be initiated fiom a major downstrearn
prornoter (at positions -136 to -140) or From a minor upstream promoter (at positions -155 to -
180) which was found to be the case in colchicine-, but not doxorubicin- or vinblastine-selected
KB cells. The major downsaeam prornoter is used in most of the normal tissues.
The major downstream promoter of human MDRl has a CAAT box and two GC-rich
regions with putative SP- 1 binding sites. Consensus binding sites for AP- I , CEBP and Y-box
proteins in the S'flanking region of MDRl genes have also been identified (176). The major
promoter lacks a TATA box, and this has been associated with the diversity of transcription
sites in eukaryotic cells (177).
Potential transcriptionai regulatory elements found withui the MDRl gene includes
several heat shock consensus elements, evidenced by an enhancement of MDRl mRNA after
heat shock treatment and a phorbol ester response element (162, 178). Cadmium chloride, and
sodium arsenite can also induce MDRl mRNA (162, 179) and the induction was found to be
sensitive to actinomycin D, therefore it requires synthesis of RNA (162). MDR-CAT reporter
gene constructs have demonstrateci that mutant Ras as well as both mutant and wild type p53
genes may stimulate the MDRl promoter (180, 181). There are also suggestions of
aanscriptional regdation of MDRl by the c-Ra€ signal tmnsduction pathway (1 82).
The mouse and hamster mdr promoter DNA sequences differ significantly fiom that of
the human This ciifference is generally thought to be the reason for the enhanced
responsiveness of the rodent promoters to certain kinds of environmental stresses. The murine
promoters contain both TATA and CAAT boxes as well as putative SP- 1, AP- 1. and AP-2 sites
(1 83-1 86). Studies show that there is more than one mdrla promoter, which, in combination
with alternative polyadenylation sites, may account for the multiplicity of mdrla transcripts
observed in mouse cells (184). In addition, elevated Pgp expression has been observed in the
gravid mouse utew which suggests hormonal influence on expression (187, 188).
Interestingly, the mdrl b promoter. which drives Pgp expression in the adrenal and secretory
glands of the endomeaium, contains a progesterone response element ( 183) .
1.3.4 Tissue distribution
1.3.4.1 Pgp expression In normal tissues
By immunohistochemical techniques, it has been shown that the MDRl gene product,
Pgp, is also distributed at varying levels in normal tissues (189). Moreover, its expression hss
been localized to the apical surface of the cells. High Pgp expression levels are found in human
adrenai cortical cells, the brush border of the rend proximal tubule epithelium, the luminal
surface of biliary hepatocytes, small and large intestinal mucosal cells, and pancreatic ductules
(158, 189- 197). Lower levels of Pgp has been found in capillary endotheLial celis of the brain
and testis (198, 199), placenta (19 l), lung (19 l), prostate (191), stornach (19 1), natural killer
cells (200,201), and ~ ~ 3 4 ~ stem ceils of the bone marrow (202).
It is important to note that while most of the cells in these tissues show a polarked
localization of MDR1, some tissues such as the adrenal gland, show Pgp as a cytoplasmic
protein rather than a plasma membrane protein where it may h c t i o n as an intracellular
transporter of steroids. In the brain and testis, Pgp may provide additional protection to keep
toxic metabolites and xenobiotics out of these tissues.
In moue, mdrla 1s hghly expressed in intestine, and high levels of mdrl b expression
are found in the adrenal and kidney ( 192). The mdrl b is also highly expressed in the gravid
mouse utenis (187, 188). Although al1 three rndr isofonns are expressed simultaneously in
normal adult rat liver, the mdrî form is the most abundant (203). These observations suggest
that tissue-specific transcription mechanisms are involved in the regulation of mdr gene
expression.
The physiological function(s) of Pgp is so far unknown, although its tissue distribution
suggests that it has an important role in cellular transport of specific metabolites (196, 204),
and a major role in drug absorption and disposition (205).
1.3.4.2 Pgp expression Ni tumors
Several observations suggest a role for the MDRI gene in both intnnsic and acquùed
dmg resistance:
i) full-length cDNAs for the human and moue genes cloned into expression vectors and
transfected into hg-sensitive cells (144, 145) was suficient to confer dmg resistance in
association with Pgp expression in the plasma membrane of transfected cells. It was obsewed
that only MDR 1 and mdr 1 confer MDR after transfection ( 144,145).
ii) Intrinsic multidrug resistance is generally found in tumon arising from tissues which
nomally express Pgp (189, 206)), although other mechanisms may also be induced. ûrgans
which express high levels of MDRl tend to give rise to higher percentages of tumon that
express Pgp. These include cancers of the colon (207), kidney, liver, pancreas, and adrenal
gland ( 1 89).
iiij Comparison OF primary and recurrsnt tumoa showcxi an increased expression of MDRi
rnRNA fier chemotherapy ( 158).
iv) malignancies which were initially sensitive to chemotherapy and then relapsed show
increased MDRl mRNA in several patients (208). Many others have also shown increased
MDRl RNA levels in relapsed patients (209-2 1 1). Acquired resistance is ofien seen in
lyrnphomas, leukemias, myelomas, breast and ovarian cancers ( 153).
In addition to multidrug resistance, high levels of Pgp expression may infiuence ceIl
locomotion (212) and intercellular adhesion (209), which leads to enhancement of tumor
aggressiveness. This additional role of Pgp in tumor tissues is thought to be due to its insertion
into the plasma membrane. Weinstein et al. (212) showed that a strong correlation exists
between the presence of anti-Pgp monoclonal antibody reactivity in uivading tumor cells (of
prirnary colon carcinomas) at the leading edge of the tumor and both vesse1 invasion (P <
0.00 1) and lyrnph node metastases (P < 0.0 1) (212).
1.4 MDRl IN LIVER
Overexpression of mdrl isoforms has been observed in rodent liver during cholestasis
(213), regeneration following partial hepatectomy (214) and in chemically-induced
hepatocarcinogenesis (164, 165, 215, 216). B u t et al. has shown that matment with certain
chemical carcinogens and xenobiotics increased RNA levels for the Pgp protein and CYPlA2,
a component of the system responsible for oxidation of potentially hamfbl xenobiotics; two
proteins involved in handling of toxic chernicals (163). Direct regulation of Pgp expression in
the liver by carcinogens, similar to that of the drug-metabolizing enzymes CYP450s has been
also k e n proposed by Schuetz et al. ( 163,2 17).
Marked incrases in Pgp mRiiSA have dso 'ken shown in regeneraring rat iiver (22,
171). Thorgeirsson and Fairchild ( 165, 171) previously reported that mdr 1 RNA levels are also
elevated in preneoplastic and neoplastic nodules in the Solt-Farber mode1 of carcinogenesis in
rat liver. The elevated mRNA levels showed a more transient but substantial increase in rndrl
RNA levels in liver foiiowing treatment with 2-(acety1amino)-fluorene (AAF) treatment (163,
165) or partial hepatectomy ( 17 1). Elevated levels of MDRl mRNAs have also b e n found in
human hepatocarcinomas (206, 2 18). However, in al1 these cases, it is not known which of the
Pgp genes are involved or the mechanisrn by which each Pgp gene is regulated in the normal
and malignant liver.
1.4.1 MDRl and the iiver: evidence for increased mRNA stability
While much of the focus on understanding the normal regulation of MDRl gene
expression in tissues is at the transcriptional level, there is growing evidence that suggests
enhanced mRNA stability plays a key role in this regulation, most especially in those tissues
whic h normally express the MDR 1 mRNA.
The observed association between the localkation of the MDRl gene product, Pgp, to
the lumenal surface of hepatocytes, and the enhanceci Pgp expression during rat liver
carcinogenesis (164, 165, 171, 2 19) which correlated with the process of tumor progression
(164, 2 19) has prompted studies on the regulation of Pgp in the liver as a mode1 system to
identi@ possible triggers whereby the Pgp system is dysregulated
Several important studies using the rat liver system led to the realization that mRNA
stability was involved in Pgp overexpression. Fust, results by Lee et al. (203) using gene-
specific probes generated fiom the 3'UTRs of each rat Pgp gene demonstrated that only one
member of the Pgp gene family, class 11 Pgp, was strongly induced when hepatocytes were
grown in primary culture. in addition, this overexpression paralleled that of the cytoskeletal
genes: actin and tubulin and suggested a possible comrnon regulatory mechanism in primary rat
hepatocytes.
Second, the class 11 Pgp, which is expressed at a very low level in normal liver, has also
been shown to be overexpressed in several models of rat liver carcinogenesis. By nuclear run-
on assays and mRNA decay studies, it was demonstrated that an increased mRNA stability is
the major mechanism involved in the increased expression of class lI Pgp. Moreover, studies
using various dmgs also indicate that the integrity of the cytoskeleton is important for the
maintenance of high expression of class 11 Pgp. Disruption of the cytoskeleton in cultured
hepatocytes with cytochaiasin D did not affect the transcriptional activity of the class iI Pgp
gene but rapidly destabilized its rnRNA. It is possible that an association between class II Pgp
mRNA and cytoskeletal elements may underlie the mechanism that regulates class II Pgp
mRNA stability (203).
Perhaps the strongest evidence which supports mRNA stability came nom follow-up
studies by Lee et al. Lee and CO-workers directly measured the in vivo mRNA half-life and
perfomed nuclear m n analysis of class LI Pgp mRNA and a diverse group of unrelateci
genes which they have previously determined to be overexpressed in primary monolayer of
adult rat hepatocytes during culturing (203). Interestingly, in 1998 their pubLished results
showed that these same transcripts were also overexpressed and stabilized in primary liver
cancers and transplantable turnors (220). Their findings led them to suggest that increased
rnRNA stability is a prirnary mechanism contributing to overexpression of Pgp and other genes
in rat liver turnors. Although this study focused on the rat counterpart of MDRI, it adds
support to the icnowiedge that MDRL mlWA srabiüty, aithougii ir stiii rernains iess
characterized, may be a potential mechanism of MDRl mRNA overexpression in human liver
tumors. An important point in this study is the observed global mRNA stabilization of other
genes besides MDRI. Does stabilization of the mRNA represent a characteristic mechanism for
upregulation of Pgp and other genes in rat liver tumors? If so, does this same mechanism
operate in the human liver system?
1.5 RATIONALE OF THE WORK
To date, no current knowledge of the human MDRl mRNA stabilization in vivo has
been shown. However, severd Liver cancer ce11 lines, such as the human hepatoma line
(HepG2) are available to address this.
We are interesteci in determining the contribution of changes in rnRNA stability to
alterations in the steady-state Ievels of the MDRl mRNA. The 3'untr;uislated region (3'UTR)
of the human multidrug resistance type I (MDR1) mRNA is very AU-rich (70%). MDRl
mRNA contains AU sequences which are sirnilar to rapidly degrading mRNAs of the c-myc, c-
fos and the lymphokines. In essence, it is tempting to suggest that the human MDRl 3'UTR
may fimction as a destabilinng element A destabïiizing fiuiction for MDRi has been proposed
(169,46) and previously pubiished work in our lab has provided the first test of this hypothesis
(1). Other studies suggested that the MDRl mRNA decays with a half-life of 10 houn or
longer (22 1).
in addition to studies with post-transcriptional regulation of the MDRl mRNA, these
midies will also help in understanding why AREs in some cases, confer destabilization and in
other cases, confer stabilization to a mRNA.
1.6 PRELiMINARY DATA
Previously published work from our laboratory ( l ) , has s h o w that the MDRl 3'UTR is
not an active mRNA destabilizer in HepG2 cells. The MDRl mRNA has an intermediate half-
life compared to that of the c-myc &A (8 h vs. 30 min, respectively). Furthemore, this
half-life was prolonged ( >20 h) upon exposure to cycloheximide, a protein synthesis inhibitor,
suggesting the requirement of protein synthesis. Using p-globin chimeric rnRNAs, whereby
the 3'UTR of c-myc or MDRl was fused to the fhglobin coding region, it was dernonstnited
that the c-myc 3'UTR, as predicted, destabilized the globin rnRNA. However, the MDRl
3'UTR had no effect on the stability of the globin mRNA. In addition, cornpetition analysis
showed that the MDRl 3'UTR had a fivefold lower affinity for AU-binding proteins which are
known to interact with c-myc AU-rich 3'UTR. Overall the data suggest an association between
the affinity of AU-binding proteins to the 3'UTR and the degree of rnRNA stability.
If indeed this is the case, then what sequences a d o r motifs in the 3'UTR do these
proteins bind and what makes these sites less attractive for RNA-binding proteins? What role
do these proteins play in inhi'biting the decay of the MDRl rnRNA? Characteriration of the
RNA-protein interactions of the MDRl 3'UTR is significant in that it will lead to a better
understanding of the role of RNA-protein interactions on the regulation of MDRl M A
stability. if mRNA stability is dso a key mechanisrn for Pgp ovetexpression in human liver
tumon, new therapeutic approac hes can be devised to effectively down- regulate Pgp by
targetùig its mRNA.
1.7 HYPOTaESIS
From the prwious work in our iab, we extend the fmdings ana propose die foilowing
hypothesis:
The stability of the MDRl mRNA is the result of the interaction between specific cis
elements in its 3'UTR and trans-acting factors (RNA-binding proteins). The uniqueness of this
interaction may contribute in part to the observed dserences in mRNA half-life between
MDRl and other genes bearing similar cis elements.
1.8 O ~ C T I V E S
To test our hypothesis, our goals are twofold:
1. To identiQ differences in the relative affinity of RNA-binding proteins to the c-myc AU-
rich 3'üTR and the MDRl 3'UTR.
2. To map the probable RNA-protein interactions which occuf in the last 157-nt region of the
MDRl 3'UTR by using antisense oligonucleotides.
II. MATERIALS AND METHODS
2.1 CELL CULTUIRE:
The human hepatoma ce11 line HepG2 and the human erythroleukernia ce11 line K562
were obtained fiom the American Type Culture Collection, Rockville, Maryland. HepG2 cells
were grown as monolayers in alpha-minimal essential medium (a-MEM) containing 10% fetal
bovine s e m (without antibiotics). K562 cells were gown in suspension culture in RPMi
medium containing 10% fetal calf serum (without antibiotics). Both ce11 lines were maintained
in an atmosphere of 5% C O / 95% room air at 37°C.
2.2 PREPARATION OF RIBOSOMAL SALT WASH (RSW)
2.2.1 Polysome preparations
K562 cells were grown to a final density of 3 to 6 x 10' cells/ml. HepG2 cells were
grown to approxirnately 90.95% confluency (- 2.6 X 108 cells) in Tî5 flasks. To achieve
higher protein yields when p r e p a ~ g HepG2 RSW, the cells were plated in Tl50 flasks in
subsequent preparations. Cells were harvested and pelleted at 1000 rpm for 5 min at 4°C.
Pelleted cells were resuspended in cold PBS (no se-) by gendy pipening up and down, then
subsequently pooled into one tube for a second centrifugation to pellet. Cells were washed two
times with cold PBS by resuspension and pelleting. Ce11 counts for K562 and HepG2 cells were
done using a Neubauer hemacytometer. Ceils were resuspended in Ribosomal Solubilizing
B a e r (RSB) (10 mM Tris-HCl (pH 7.6), 1 mM potassium acetate, 1.5 mM magnesium
acetate) using 1 ml for every 7 x 10' cells. Prior to addition of RSB to the cells, fresh
Dithiothreitol @TT) was added to the RSW to a final concentration of 2 mM. The suspension
of cells in RSB was transfened onto a Dounce Homogenizer. Homogenization was done with
30 to 40 strokes. Ce11 breakage was checked using a Phase contrast microscope. The
homogenate was aliquoted to microfbge tubes and centrifuged at 12,000 x g for 15 min at 4°C.
The supematant fiom this low spin was saved and used directly to prepare the polysomes. The
low speed supernatant was gentiy layered over a 30% (w/v) sucrose cushion in a polyallomer
tube. Final volume was adjusted to the top of the tube using EGB + D ï T when necessary.
Polysomes were pelleted by ultracentrifugation at 130,000 x g (36,000 rpm) for 2.5 h in a SW
60 rotor (Beckrnan) at 4°C. Al1 procedures from this point were camied out at 4°C. Following
ultracentrifugation, the top layer (SI30 fiaction) was removed and stored at -80°C. The
polysomal pellet was washed three times with RSB + DTï and then resuspended in RSB +
10% glycerol (RSBG) + DTT (10 m M TrisCl pH 7.6, 1 rnM potassium acetate, 1.5 rnM
rnagnesium acetate, 2 mM dithiothreitol (DTT), 10% glycerol) supplemented with leupeptin (1
pgh l ) , pepstatin A (1 pg/ml), and phenylmethylsulfonyl fluoride (10 pg/mI) using lpl RSBG
per 1 x 1 o6 cells. The resuspended pellet was transferred to a 2 ml Dounce hornogenizer and
gently hornogenized 5 to 20 times. This polysomal fraction was stored at -80°C to be used for
RSW preparations.
2.2.2 RSW p reparations
Some or most of the ribonucieases and other proteins that are associated with
polysomes can be solubilized and separated from the polysomes by high salt extraction
followed by ultracentrifugation to pellet the salt-washed polysomes. The resulting supernatant,
or nbosomal salt wash (RSW), has been used as a starting materid for purification of
nibonucleases and RNA-binding proteins (222, 223). Poly somes (section 2.2.1) were stirred
gently and brought gmddly to 1.0 M NaCl with dropwise addition of 1/3 volume of RSBG +
DTT plus 4 M NaCl over a 30-minute period After incubation at 4°C for an additional 30 - 60
minute period, soluble rnaterial (RSW) was separated frorn the "washed" polysomes by
centrifugation through a 30% (wh) sucrose cushion at 130,000 x g. The supernatant from this
spin was termed the "ribosomai salt wash" or "RSW" and stored at -70°C until needed. Protein
concentration was detexmined by the Bradford Protein Assay (Bio-Rad, Mississauga, ON).
2.3 PREPARATION OF RNAs Bk' Ii\i VITRO ïïWNSCRIPTION
Templates for in vitro transcription of RNA probes for the gel shift analyses and UV
cross-lihg experiments were prepared using Polymerase Chain Reaction (PCR) with SP6 or
T7 promoter sequences incorporateci into the 5' primer (101, 102). Table 4 shows the primers
and location of sequences used to synthesize the RNA probes used in part 1. The full length c-
myc CRD template (referred to as "CRD) corresponds to c-myc sequence 1705-1886. The
template for the PCR reactions to generate segments of the MDRl 3'UTR, MDRA and MDRB
DNAs was the plasmid pBBmdr (1). The template used for the Myc ARE was pBSmyc, which
contains the full length cDNA for the hurnan c-myc mRNA (kindly provided by Dr. J. Ross,
Madison). Sequences of the RNAs transcribed from these ternplates are shown in Figure 4.
The synthesis and sequence of the c-myc CRD template used has been described previously
(1 02).
TABLE 4: PRIMERS AND TEMPLATES USED TO GENERATE T7 DNA TEMPLATES* FOR IIV WTRO TRANSCRlPTlON
~ M ~ C AREa ( nt 2043-2 160 1 T7+ 2043-2061 1 2 139-2160 1 c-myc 3 'WR 1
CRD"
MDRl 3'UTRb I
of c-myc I I I I of c-myc I
of c-myc
nt 1705- 1886
MDRA~
*Ail DNA ternplates synthesized by PCR wil1 incorporate in their 5' end, the 25 nt T7 RNA polymerase promoter sequence: "CATAATACGACTCACTATAGGGCGA1', except for the CRD, which will incorporate the 24 nt SP6 RNA polymerase promoter sequence: "CATTTAGGTGACACTATAGAATAC1'.
0 Tempiate used is pBSmyc (kindly provided by Dr. J. Ross, Madison) ~emplateusedispBBmdr(l)
nt 42554577 of MDRl cDNA
MDRB~
SP6 + 1705-1722
nt 4255-4440 of MDRl cDNA
T7 + 4255 -4274
nt 442 1 -4577 of MDRl cDNA
1869 - 1886
T7 + 42554274
coding region
4558-4577
T7+ 442 1-4440
323 nt within the MDRl 3'UTR
442 1-4440 proximal part of MDR 1 3WTR
4558-4577 I
distalpartof MDRl3'UTR
A. LOCATION OF MDRI RNA PROBES WiTHlN THE MDRl S'UTR USED IN GEL SHIFT AND UV CROSS-LINKING EXPERIMENTS:
4421 4577
AAAAAAAAAA
184 nt b MDRA
157 nt 4 MDRB
B. SEQUENCES OF RNA PROBES USED
Myc ARE (1 18 nt) CUUUGGGCAUAAAAGAACUUULJJUAUWUMCCAJCUUUUUUUUUUCUUU AACAGAUUUGlJAUUUAAGAAUUGUUUUUAAAAAAUUUUAAGAUUUAM UGlJJUCUCUGUAAAMU -
MDRA AAAGCGCCAGTGAACUCUGACUGUAUGAGAUGUUAAAUACUUUUUAAUAU UUGUUUAGAUAUGACAUUUAUUCAAAGUUAAAAGCAAACACUUACAGAAU UAUGAAGAGGUAUCUGUUUAACAUUUCCUCAGUCAAGUUCAGAGUCUUCA GAGACUUCGUAAUUAAAGGAACAGAGUGAMGAC
MDRB AGGAACAGAGUGAGAGACAUCAUCAAGUGGAGAGAAAUCAUAGUUUAAAC UGCAUUAUAAAUUUUAUAACAGAAUUWGUAGAUUUUAAAAGAUAAAAUG UGUAAUUUUGUUUAUAUUUUCCCAUUUGGACUGUAACUGACUGCCUUGC - - UAAAAGA
FIGURE 4: SCHEMATICS OF THE LOCATIONS (PANEL A) AND SEQUENCES (PANEL 8) OF THE PROBES USED IN THIS STUûY. 'Underlined sequences in both Myc ARE and MDRB represent the 59 aligned nudedides using the GeneWorks program.
23.1 Preparation of radiolabeled RNAs
RNA transcripts were synthesized from PCR-amplified Myc 3'UT£Z, MDRA and
MDRB DNA templates with T î RNA polymerase in the presence of 1 pl RNAguard (34,650
U/ml) (RNase inhibitor; Phmacia Biotech), 5 m M DTT, 30 pCi of [ u " P ] - ~ ~ ~ ( 8 0 0 Ci/mmol;
Amenharn Pharmacia), 0.5 mM UTP and 5 mM each of ATP, GTP and CTP in 20 vl and
incubated at 37OC for 1.5 to 2 hr. Contaminating DNA template was rernoved by 20 units of
DNase I (FPLC pure, Amenharn Pharmacia) treatment at 37°C for 25 min. The radiolabeled
RNA transcripts were separated fiom unincorporated nucleotides using the B I 0 10 1 RNAid Kit
(BI0 1 O 1 Inc., California). Briefly, 60 pl of RNA binding sait was added to each sample and 1
pl was removed and diluted to 10 pl with RNase-free water for quantitation purposes of
specific activity. 5 pl of RNAmatrix was added to each sample followed by incubation for 5
min. Samples were then centrifuged at 3,500 rpm for I minute. The supernatant was discarded
into radioactive waste and the pellet resuspended twice with 500 pl of wash solution containing
ethanol and centnfuged each time at 3,500 for 1 minute. The pellet was air-dned for 5-10 min
followed by resuspension in 100 pl DEPC-treated water (BI0 10 1). Elution of the radiolabeled
RNAs was done by incubation of the samples at 55°C for 5-10 min followed by centrifugation
at 12,000 rpm for 1 minute. The RNA in the supernatant was then carefully removed and
transferred onto a new tube for a second spin to completely remove any matrix, and the final
supernatant was stored at -20 OC. For quantitation of percent radiolabeled UTP incorporation
and specific activity, 1p1 of the purified probe was dïluted to 10 pl with ddHIO water. This
dilution was done to minimize the amount of 3 2 ~ in the minigel and total couots can be done
using the same sample. Caicuiations were made according to the scintillation counts before and
after RNAid clan up. Radiolabeled probes were prepared at - 2-4 x 10' c p d p g and used at a
45
concentraton of 50,000 cpm (1-2 ng)/reaction for RNA gel shift assays and at 100,000
cpmheaction (2 ng) for UV cross-linking expenments. The quaiity of RNA probes was checked
on a 5% polyacrylamide gel containhg 8 M urea run in 1 X Tris-Borate EDTA (TBE) (80
m M Tris base, 80 mM boric acid, 2.5 mM EDTA) running buffer. A sample gel is show in
Figure 5. The gel was subsequently dned for 1 hou. and exposed for autoradiography. Sizes of
the probes are vsrifird by in vitro-transcribed radioiabeied mA Century Markers (Ambion,
Texas, USA).
23.2 Preparation of unia beled corn petitor RNAs
The method of Gurevitch et ai. (224) was used to prepare the larger quantities of RNAs needed
for cornpetitors in the gel shift and W cross-linking assays. Ttanscnption was carried out
using DNA templates at concentrations of 0.3 pgfp.1 (total of 9 pg per reaction) in 80 rnM
TrisCl, pH 7.6,2 rnM spermidine, 10 mM MgClr, 10 m M DTT, 2 mM NTPs, 2 pl RNA guard
(30,300 u/ml, Amersham Phamiacia) and 500 U of T7 RNA polymerase for 2.5 hr at 37'C
followed by DNase 1 treatment at 37°C for an additional 25 min. Purification of the uniabeled
RNA transcripts was done according to the BIOlOl RNAid kit protocol. Aliquots were set
aside for A260 spectrophotometric measurements to rneasure absorbante at 260 and 280 nm for
determination of RNA concentration. Anaiysis of RNA size and integrity of samples was done
similarly to the radiolabeled nboprobes except the samples (1 yg pet simple) were nui in a 6%
acrylamide/7M urea minigel for 15 to 20 min. The gel was subsequently stained in 1 X TBE
buffer (with final concentration of 2.5 pg/mL ethidium bromide) for 40 min and destained with
two wash changes of ddH20 water over 30 min. The stained bands were then visualized under
W light and photographeci with a Polaroid camera (an example of stained MDRB RNA is
FIGURE 5: INTEGRITY OF IN WRO-TRANSCRIBED RNA PROBES. After RNAid kit clean-up, 1 pl of each V-labeled transcript (1:IO dilution in DEPC water) was rnixed with 9 pl denaturing RNA loading dye. The samples were heated for 5 minutes and 50% of the sample volume was loaded ont0 a 5%i7 M urea gel and run at 250V for 15 to 20 minutes. The gel was dried for 1 hr and exposed to film for 3 hrs with 1 intensifying screen to visualize the bands. To verify the sizes, in vh-banscribed RNA centurym markers synthesized 4 weeks eariier were also loaded. Sires of the bands: Myc ARE (118 nt), MDRI 3'UTR (323 nt), MDRA (186 nt), MDRB (157 nt), MDRI coding (285 nt).
shown in Figure 6). Unlabeled in vitro-transcribed RNA Century markers (Arnbion, Texas,
USA) were also loaded to confïrm the moiecular size of the transcripts.
FIGURE 6: GENERATION OF IN WROlTRANSCRlBED UNLABELED MDRB RNAs. Sample urea gel showing in vbtranscribed unlabeled transcripts of MDRB RNA (lane 2) (used for compeütion experiments) and a ûuncated 1 IO-nt MDRB RNA (MDRBWl-130) (lane 3) (used for mutational analysis, see Appendix 1.0). The protocol is described in section 2.3.2 (Methods). One microgram of RNA sample was loaded in each lane on a 6% aciylarnide (30:l)i 7M urea gel, stained in 1 X TBE (with 2.5 pg/mL final ethidium bmmKle concentration) for 40 minutes and destained with two change washes of ddH,O for 30 minutes. Bands were visualized under UV light and photographeci using a Polaroid camera.
2.4 ANALYSIS OF RNA-PROTEIN INTERACTIONS
2.4.1 RNA gel shifi assays
The gel shift assay used was a modification of those previously described for c-myc
RNA-binding proteins ( 102, 1 1 1, 12 1). Eübosomal salt wash (RSW) samples (1-4 pg) were
incubated for 15 min at room temperature (20-22°C) with in vitro-transcribed 32~-labeled RNA
probes ( Lang) in a final volume of 10 pl containhg 10 mM Tris-HCI pH 7.6, 2.5 mM MgCI2,
2 mM DTT, 5% glycerol, 0.5 pglpl yeast tRNA, and 50 m M NaCI. The components of the
binding reaction have been previously optirnized in our laboratory ((1) and unpublished data).
In experiments with cornpetitor RNAs, the unlabeled RNAs and protein were added to the
reaction on ice prior to the addition of the "P-RNA probe. When indicated, Proteinase K
(Gibco BRL, Burlington, ON) was added to the reaction mixture to a final concentration of 2
pg/pl and the mixture was incubated at room temperature for 10 min prior to addition of
radiolabeled RNA. In experiments with ODNs, the ODNs and protein were added to the
reaction on ice prior to the addition of the "P-RNA probe. Prior to loading ont0 the gel, 3 pl of
6 X non-denaturing loading dye (0.25% (wh) bromophenol blue, 0.25% (wh) xylene cyanol,
30% glycerol, ddH20 water) was added to the samples. RNA-protein complexes were
separated From fiee RNA by electrophoresis in a 4% (30: 1 acrylarnidehis) non-denaturing
polyacrylamide gel in 1 X TBE buffer for 3 hr at 90 V. The gel was then dried for 1 hour,
exposed to film for autoradiography overnight, and quantitated using a Phosphorhager
(Molecular Dynamics).
2.4.2 W cross-ünking of RNA-protein complexes
Binding reactions were carried out as for the gel shifi assays, but reaction mixtures were
exposed to UV light prior to electrophoresis, so as to link the protein covalently to the "P-RNA
substrate. UV cross-linking of RNA-protein complexes was perforrned on ice using UV
Crosslinker (Fisher Scientific) at 5000 x 100 pJtcmL, followed by RNase A/TI digestion (10
uni= of lWase Ti and 0.5 pg of Wase A; Arnbion) for 25 min at 37°C. ~ B e r RNase
digestion, 10 yl of 2X SDS-PAGE sarnple loading b a e r (4% SDS, 20% glycerol, 200 m M
DTT, 120 mM Tris (pH 6.8), and 0.01% bromophenol blue) was added to the sarnples. The
samples were centrifuged bnefly and heated to 95°C for 5 min followed by incubation on ice
and a brief spin. Sarnples were analyzed under denaturing conditions by 1004 SDS-PAGE (for
a 7 cm (L) x 8 cm (W) 10% separating gel: 0.375 M Tris-HCI pH 8.8, 0.1 % SDS, 10 %
acrylamide/bis (30: 1)) in 1 X Tris Glycine running buffer (0.025M TrisIo. 192 M glycine/O.l%
SDS, pH 8.3) at 80 V for 2 hr. Subsequently, the gel was stained with 0.2% Coomassie Blue
(0.2% (wh) Coomassie Blue R-250 (BioRad, Mississauga, ON), 50% (vtv) methanol, 10%
(vtv) acetic acid, double-distilled water) for 5 min and destained with 30% (vh) methanol/lO%
(v/v) acetic acid for 2 to 3 hr, then dried for 1 hr. Radioactive signals were visuaiized by
autoradiography and quantitated by PhosphorIrnager or STORM (Molecular Dynamics). Sizes
of cross-linked complexes were determineci relative to either of the following molecular
weight standards: 1. (Boehringer Mannheim) stained with Coomassie Blue: p-galactosidase
(1 16 D a ) , hctose 6-phosphate dehydrogenase (85 ma), glutamate dehydrogenase (56 kDa),
aldolase (39 D a ) and triosephosphate isomerase (27 ma) or 2. Benchmark" Protein ladder
(Gibco BRL) moiecular weight standards consisting of 15 engiaeered proteins ranging in
molecular weight fiom 10 to 220 kDa The 20 and 50 kDa proteins are more prominent for easy
orientation and to ensure proper identification of each protein after staining with Coomassie
Blue.
2.5 MAPPING OF PROTEIN BINDING SII'XS ON THE MDRB REGION
2.5.1 Anthense oligonucleutides
Tables 5 and 6 show the sequences of the antisense oligodeoxynucleotides (ODNs) and
their MDRB target sequences used in part 2 of this study. ODNs targeting the MDRB were
either 15 or 18 nucleotides long. Their percentage G/C content as well as sequence and
predicted mealing temperatures (Tm) are also provided in Table 5. The ODNs were
synthesized as standard phosphodiester DNA derivatives in lyophilized form by Gibco BRL
(Burlington, ON). The ODNs were resuspended into water at a stock concentration of 0.5
mM (500 FM), and diluted concentrations of 1, 10, 25, 50 and 100 pmoVp1 were used in RNA
gel shift and W cross-linking reactions to make final concentrations of 100 nM, 1 yM, 2.5
pM, 5 tcM, 10 PM, respectively in 10 pl reaction volumes. Details of each expriment are
provided in the figure legends.
2.5.2 RNA secondary structure prediction and design of ideal ODNs
Conformational analysis of the secondary structures of Myc ARE, MDR-A, MDR-B and the
mutant RNAs were canied out using the RNAstruchire3.5 program available on the internet at
http//: m. roc hester. c hem. edu (225). These structures are included in the Discussion. This
program is based on the RNA folding algorithm developed by Zuker et al. (226,225) of fiee
energy minimization. Optimal lengths of the MDRB ODNs were determined using the
following fornula'
Amealing temp (Tm) = 2"(no. of A + T residues) + 4" (no. of G + C residues)
TABLE 5: MDRB OLIGONUCLEOTIDES USED IN THIS STUDY
TABLE 6: TARGET SEQUENCES OF T E MDRB ODNs
Sa 6 7 8 9
, 1 3 14 16
~ATAATGcAGTTTAAAc ATAAAAlTATAATGCAG AATCTACTTTAATTCTGT TTATCTrrrAAAATCTAC CACAl-nTATClllTAAA AAATGGGAAAATATAAAC AGGCAGTCAGlTACA CTITAGCAAGGCAG
3 4 5
, 6a 6 7 8
18 18 18 18
,. 18 18 15 15
AUCAUCAGGUGGAGA CAAGUGGAGAGAAAU GAAAUCAUAGU UUAAACU GUUUAAACUGCAUUAUAA
L I
4506-4523 4531-4548 45534567 ,
C - - - - -
4439-4453 44444458 4454-447 1 4463-4480
9 13
. 14
22 16 22 16 16 22 46 46
CUGCAUUAUAAAUUUUAU 1 4470-4487 ACAGAAUUAAAGUAGAUU 44894506 GUAGAUUUUAAAAGAUAA I 4500-451 7 UUUAAAAGAUAAAAUGUG GUUUAUAUUUUCCCAUUU UGUAACUGACUGCCU
16
32 ,
29 32 29 29 32 3 4 , 34
CUGCCUUGCUAAAAG 1 4562-4576
In addition, the OligoWalk module in RNAstructure3.5 was used to determine the energy of
binding compared to the stnictured RNA target for the ODNs used. These are shown in Table 7
(see Results section 3.3.1).
2.6 SEQUENCE ALIGNiMENT
Sequence aiignmem of Myc ARE and MDRB mA sequences were aone using the
sequence alignment module of the GeneWorks program version 2.3 (1994) (Intelligenetics,
Inc., California, USA). RNA sequences fiom Figure 4 were entered as DNA nucleotide
equivalents (where the "U" base is entered as T).
2.7 STATISTICS AND DATA ANALYSIS
3 L Quantitation of the hybridized P-labeled probes was determined usuig a
PhosphorIrnager or STORM (Molecular Dynamics), and data were subsequently anaiyzed
using ImageQuant cornputer software (Molecular Dynamics). Statistical analysis was
perfonned using One-way analysis of variance (ANOVA) (SigmaStat Version 1.0, Jandel
Corp., California) with a significance level of alpha = 0.05 (P c 0.05) followed by an all-
pairwise multiple comparison procedure: Student-Newman-Keuls method. For comparison of
treatment values with control values from the same experiment, a [paired t-test] was used (P c
0.05). Data are represented as the means * standard error (SE) (where n 3) or means (where
n=2).
Part 1.
DETECTION OF PROTEINS THAT INTERACT WiTH THE 3'UTR OF THE EIUMAN
MDRl mRNA
3.1 OVFIRAW, O&IECTIVE
Previously published work in our laboratory (1) has shown that the distal region of the
MDRl 3'UTR, termed MDRB, is able to compete with the c-myc 3'UTR in tenns of their
ability to bind to RNA-binding proteins found in ce11 extracts. Note that the half-lives of the
mRNAs containhg these two 3'UTRs are rernarkabiy different: c-myc has a half-life of 30
minutes while MDRl bas a half-life of 8 houn. Ln addition, when both 3'UTRs replaced the
3'UTR of the fbglobin mRNA, the c-myc 3 'UTR destabilized the p-globin chimenc messager
RNA while the MDRl 3'UTR did not. In accordance with these observations, we
hypothesized that differences in mRNA half-lives may be due to specific differences in mRNA-
protein interactions that occur within the 3'UTR of both rnRNAs. In particular, we were
interested in determinhg the differences in the binding patterns of the tram-acting factors that
bind to both rnRNAs.
Since many of the mRNA-protein interactions which takes place within the 3'UTR of
mRNA has ken shown to affect mRNA haif-Me (Le. mRNA stability) (25, 89,227), we fint
examineci the ability of HepG2 (a human hepatoma ceU h e ) and K562 (an erythroleukemia c e U
line) cytoplasmic proteins to bind to the c-myc 3'UTR and MDRl 3'UTTZ.
3.1.1 The 3'UTR of the MDRl mRNA binds proteins found in the ribosornal salt wash
fraction from human hepatoma (J3epG2) and erythroleukemia (K562) cytosoüc extracts
As a fust step in d e t e r e g the role that the 3'UTR of MDR 1 mRNA plays in
interacting with proteins and controlling mRNA stability, we performed RNA gel shifi assays
to detect RNA-protein interactions which occur in this region of the MDRl mRNA. Using
radiolabeled MDRl 3'UTR, we show by gel shifi assay s as represented in Figure 7, that the
MDRl 3'UTR indeed binds proteins found in both HepG2 and K562 ce11 extracts. Incubation
of radiolabeled MDRl 3'UTR with the Sl30, polysomal fraction and ribosornal salt wash
(RSW) From HepG2 and K562 ceil extracts detected RNA-protein complexes as shown in
Figure 7. Weak signals detected in HepG2 RSW was due to lower total protein concentrations
(Ipgpl) compared to the K562 RSW (4yg4l). Funhermore, Protehase K treatment shown in
lanes 5 to 7 (for HepG2 hctions) and lanes 1 1 to 13 (for K562 fractions) completely abolished
the signais, confirming that the bands are indeed RNA-binding proteins. RNA-binding proteins
to the MDRl 3'UTR were also detected by W cross-linking experiments in the different
fractions (Figure 8).
3.1.2 Rationale for the use of the ribosomal salt wash (RSW) in the experiments
Although RNA-binding proteins were seen in different fractions, for fiuther
characterization, 1 focused on the RSW for the foUowing reasons. Fint, in vitro mRNA decay
systems are widely used in identifjmg and characterizing the facton which regdate mRNA
stability in higher eukaryotes (223,228). These factors include ribonucleases and irm-acting
RNA- i complexes I Free RNA
probe
OL + Proteinase K + Proteinase K
FIGURE 7: SUBCELLULAR LOCALIZATION AND DISTRIBUTION OF RNA-BINDING PROTEINS FROM 5130, POLYSOMES AND RIBOSOMAL SALT WASH (RSW) ISOLATED FROM HEPG2 AND K562 CELLS WHfCH BIND A SEGMENT OF THE MDRI 3'UTR REGION. PP-labeled MDRI SUTR RNA ( 5 X 104 cpm/pl, details in Materials and Methods section 2.3) was incubated with 1 pg of S130. polysomes or RSW protein for 15 minutes and analyzed under nondenaturing conditions. No shifted bands are seen in RNA rnobility assays when the RSW is pretreated with proteinase K (2pg/pI in 10 pl reactions).
FIGURE 8: SUBCELLULAR LOCALIZATION OF RNA-BlNDlNG PROTEINS WHICH BlND A SECTION OF THE MDRi 3'UTR REGION (NT 4255 - 4440 ) BY UV CROSS- LINKING. Binding readions were camed out as for RNA gel shift analysis, followed by UV exposure to covalently bind the indicated radiolabeled RNA probe to proteins from S130, polysornes or RSW frorn HepG2 or K562 cells. After digestion with RNase A and Tl, complexes were resolved on a 10% SDS-PAGE. Sizes of molecular weight markers (Gibco BRL) are indicated at the left in kilodaltons.
regulatory factors such as RNA-binding proteins. One important characteristic of using these
systems is the observeci correlation between the relative mRNA half-lives in vitro and in celis
(228). Since polysomes contain both mRNA and mRNases, they can degrade the -As
which are associated with them (228). Ribosome-bound mRNases and probable regulatory
factors can be separated kom the polysomes by exposing the polysomes to high salt to peilet
them and harvest the supernatant or nbosomal salt wash (RSW). mRNases as well as
regulatory facton found in the RSW c m be assayed by incubation with in vitro-transcribed
mRNAs. The advantages of using RSW are twofold: (1) Polysornes contain an activity that
rapidly degrades uncapped transcnpts but RSW lacks this enzyme. (2) RSW contains soluble
RNases and RNA-binding proteins which can be purified (228). Second, although we cannot
rule out the possibility that the postpolysomai supernatant (S130), which have very little
mRNase activity, may contain regulatory facton of mRNA stability, we have chosen to work
with the RSW fraction because it is much more characterized and widely used by other
investigators of rnRNA decay (228,229). Since proteins associated with the ribosome itself are
left behind in the polysome Fraction, the RSW is e ~ c h e d for soluble proteins (223). Although
the RSW fiom K562 cells show a substantial arnount of protein, we proceeded to use the
HepG2 RSW to further chamterize the RNA-protein interactions of the MDRI 3'UTR
because previous work frorn our laboratory was carrieci out usîng HepG2 cells.
3.13 Majority of the RNA-protein interactions occur at the distal157-nt sequence of the
m m 3'UTR
To nanow down the specific regions where the majority of the protein binding takes
place within the MDRl 3'UTR, we m e r subdivided this region into two parts: the prcimal
59
region termed MDRA, and the distal region tenned MD-. The locations and sequences are
shown in Figure 4 (see Materials and Methods). Wolabeled versions of MDRA and MDRB
were then used to directly detect probable RNA-binciing proteins which bind these regions. For
the purposes of this project, a radiolabeled Myc ARE was used as the positive control since the
Myc 3'UTR has been extensively studied (1 1 1, 222) and is known to bind a number of AU-
binding proteins found in the K562 RSW, such as AUF 1.
Using RNA gel shift assays, RNA-protein complexes could be detected in HepG2 RSW using
the two probes. Gel shft analysis (Figure 9) showed that the pattern of binding by HepG2
RNA-binding proteins to the MDRl 3'UTR is sirnilar to MDRB. The gel shift assay detected
shifted bands with HepGZ RSW incubated in the presence of either radiolabeled Myc ARE,
the MDRl 3'UTR , MDRA, MDRB or a segment of the MDR l coding region. Note that a
similar band can be detected with both radiolabeled MDR 1 3 'UTR and MDRB probes but not
with MDRA. Under non-denaturing conditions, fke MDRB RNA always m as a doublet
which presumably is due to the presence of two dif3erent secondary structures (for example,
unfolded and folded). This doublet is not observeci in denatunng gels (see Figure 5, Materials
and Methods) where a single band is detected The imensity of Myc ARE complex is higher
compared to MDRB while MDRA only shows weak buiding to the RSW proteins. These
results are consistent with previous results in our laboratory that have shown MDRA to have
very weak protein interactions (unpublis hed data), and with previously published wor k
showing that MDRB is a better cornpetitor for AU-bindùig proteins than MDRA (1).
+ HepG2 RSW
FIGURE 9: DETERMINATION OF THE SPECIFIC REGION IN THE MDRI 3'UTR WHlCH BlNDS THE RNA-BINDING PROTEINS FOUND IN HEPG2 RSW. Autoradiograph of an RNA gel shift experiment Detection of RNA-protein complexes are shown in brackets. Unbound RNAs are shown on the IeR The resulting two bands seen with the MDRB is presumably due ta different MDRB RNA conformations. Arrows show the RNA-protein complexes detedeci for Myc ARE, MDRI 3'UTR, MDRA, MDRB and the MDRI coding region. Lanes 7 to 1 1 are samples incubated with the indicated probe and RSW-
3.1.4 Characterization of the molecuIar mass and binding specificity of RNA-binding
proteins on the MDRB region
3.1.4.1 To determine the approximate molecdar mass of the RNA-binding proteins
detected by RNA gel-shifts assays, W cross-linkmg experiments were performed with
MDRB, rnyc ARE, and c-nzyc CRD. Using the MDRB "P-labeled probes, two protein signals
of approximately 42-and 80-kDa were observed As shown in Figure 10, the major RNA-
protein complex detected was that of the 42 kDa protein, while the 80 kDa protein signal was
seen at a lesser intensity. Cross-linking with a radiolabeled MDRA RNA showed a very weak
signai (data not s hown).
Prokipcak et al. have previously identified a difference in the mRNA half-life
contributed by the Myc 3'UTR and MDRl 3'üTR to the globin mRNA by chirneric
experiments (1). Furthemore, because the MDRl half-life is intermediate compared to c-myc
in HepG2 cells (8 hr vs. 30 min, respectively) (l), it was imperative to determine whether this
difference in mRNA half-life can be attributed to ciifferences in RNA-binding profiles of the
detected RNA-binding proteins to the two 3'untranslated regions. As shown in Figure 10, W
cross-linking experiments revealed that RSW proteins from HepG2 and K562 bind at a higher
intensity to Myc ARE compared to the MDRB RNA and that the binding patterns are distinct
In particular, two proteins frorn both HepGZ and K562 RSW, with similar molecular masses
(42 kDa and 80 kDa), were detected to bhd to both MDRB and Myc ARE. However, the
intensity of the proteins' signals were çtronger for the Myc ARE. A third protein ftom both
HepG2 and K562 RSW, with an approximate molecular mass of 32 ma, was seen to bind only
the Myc ARE at a strong intensity (Figure 10, just below the 42 D a band). This protein was
62
ar a O n
MDRB MYC ARE C-mye CRD z 5 fY O
HepG2 K562 HepG2 K562 HepG2 K562 Cnide HepGP extracts
FIGURE 10: DETERMINATION OF THE APPROXIMATE MOLECULAR MASS OF THE RNA-BINDING PROTEINS INTERACTING WITH THE MDRB REGION BY UV CROSS- LINKING. Binding reactions were carried out as for gel shift analysis, followed by UV exposure to covalently bind to MDRB, Myc ARE or c-myc CRD radiolabeled RNA probe (as indicated) to proteins in the HepG2 (4 pg protein) and K562 RSW (4 pg protein). After digestion with RNases A and Tl, complexes were resolved on a 10% SDS-polyacrylamide gel. Sizes of molecular weight markers (Boehringer Mannheim) are indicated at the lefi in kDa. For cornpanson, the c-myc coding region deteminant (CRD) nboprobe was also included. Arrows indicate the detected bands for MDRB and Myc ARE. Note that the third band was only detected with Myc ARE probe and was distinguishable at low film exposure. Cnide HepG2 extracts refer to unfractionated total cellular proteins. Data shown are representative of two experiments.
detected to be distinct Eom the 42 kDa protein band under shorter film exposure time. In
addition, the radiolabeled C-myc coding region deteminant (CRD) which has been previously
shown to bind the CRD-binding protein (102) showed a different bhding pattern fiom MDRB
and Myc ARE.
3.1.4.2 To examine the sequence specificity of these proteins in their RNA-protein
interactions. cornpetition UV cross-luiking experiments were carried out. A "P-labeled MD RB
RNA was used as the RNA probe (Figure 11) and several unlabeled rnRNAs were tested for
their ability to compte with protein binding. As shown, large excess of tRNA (15pg) (last
lane) did not abolish the signal seen in the control (lane 1). In contrast, uniabeled Myc ARE,
MDRB as well as MDRA were able to compete with the 80 kDa protein binding in
concentrations of 100,250 and 500 ng. The Myc ARE, which has been shown to bhd AU-
binding proteins with high afinity (1 1 1, 1 X, 222), was able to compete with binding at a
concentration of about 150 ng while unlabeled MDRB competed at about 250 ng and MDRA
competed at concentrations p a t e r than 400 ng. For the 40-42 kDa protein, none of the
unlabeled cornpetitor RNAs were able to compete (Figure 12). Cornpetition assays were also
performed with eachribohomopolymerasshown inFigure 13. Gel shift analysis showed that
poly(A), poly(C), and poly(U) were not able to prevent the RNA-protein complexes signal
while poly(G) and poly(1) were able to decrease it at 250 ng.
Note that the minor variations in protein signals seen in üV cross-linking are due to
variable RNase digestion, however the 80 and 40 kDa protein signals were the rnost
consistently detected of these protein signals therefore we decided to quantitate these two.
3 cT)
+ e unlabeled competitor RNAs m w a. mdrb mdra myc are tRNA -
kDa 2 P IOO 250 500 100 250 500 100 250 500 I ~ P ~
Percent of controi 80 kDa protein signal
Concentration of unlabeled competitor RNA (ng)
FIGURE 11: RELATNE ABILITY OF THE UNLABELED MDRA, 6 AND MYC ARE PROBES TO COMPETE FOR BlNDlNG 70 THE 80 kDa MDRB-BINDING PROTEIN
Ribosomal salt wash (RSW) from human hepatoma (HepG2) cells was incubated with ZP-labeled MDRB RNA in the presence of increasing concentrations of unlabeled cornpetitor RNAs. Binding complexes were analyzed on a non-denaturing polyacrylamide gel.
A./ Autoradiograph of a UV cross-linking assay showing the presence of MDRB-binding proteins and cornpetition with 100, 250 and 500 ng of Myc ARE, MDRA and MDRB cornpetitor RNAs. Arrows indicate the two detected bands with MDRB probe and HepG2 RSW. Molecular weight marken (Gibco BRL) are indicated at the left in kDa.
BJ The 80 kDa RNA-protein cornplex was quantitated using a Phosphorlmager and expressed as a percent of the binding seen in the absence of any cornpetitor RNA.
s V)
+ = unlabeled cornpetitor RNAs m m
mdrb mdra mycare RNA 0 al -
kDa = 100 250 500 100 250 500 100 250 500 1 5 ~ g
Percent of controf 42 kDa protein signal
140 - + mdrb
Concentration of unlabeledcompetitor RNA (ng)
FIGURE 12: RELATIVE ABlLlTY OF THE UNLABELLED MDRA, B AND MYC ARE PROBES TO COMPETE FOR BlNDlNG TO THE 42 kDa MDRS-BINDING PROTEIN
Ribosomal salt wash (RSW) from human hepatoma (HepG2) cells was incubated with 32P-labeled MDRB RNA in the presence of increasing concentrations of un labeled wrnpetitor RNAs. Binding complexes were analyzed on a non-denaturing polyacrylamide gel.
A./ Autoradiograph of a UV cross-linking assay showing the presence of MDRB-binding proteins and competition with 100, 250 and 500 ng of Myc ARE. MDRA and MDRB wrnpetitor RNAs. Molecular weight markers (Gibw BRL) are indicated at the left in kDa. Arrows indicate the two detected protein bands when MDRB probe is incubated with HepG2 RSW. Autoradiograph shown is the same as that shown in Figure I l A .
B./ The 42 kDa RNA-protein cornplex was quantitated using a Phosphorlmager and expressed as a percent of the binding seen in the absence of any cornpetitor RNA.
RNA- protein
complexes i
FIGURE 13 : SPEClFlClTY OF THE MDRB RNA-PROTEIN COMPLU( FORMATION. RNA gel shifi assays were camed out with a radiolabelad MDRB probe in the presence of HepG2 RSW (1 pg) and 250 and 500 ng of poly(rA) (lanes 3-44), poly(rC) (lanes 5-6), poly(ffi) (lanes 7-8), poly(rü) (lanes 9-1 0) and poly(rl) ( lanes 1 1-12).
PART 2.
MAPPING AND CEARAC-TION OF THE PROTEIN BINDING SITES ON THE
MDRB REGION
3.2 OVERALL OBJECI[IVE
Once the MDRB region on the MDRl 3'UTR has been established as the major binduig
site for the RNA-bindmg proteins (42- and 80-kDa) found in HepG2 and K562 RSW, which
have similarities with the Myc ARE-binding profile, the next step is to know what sequences
(or binding motifs) are found in the MDRB region in order to characterize the candidate
proteins which bind these regions. In addition, this section will help to answer the question of
whether or not the sequences found have any similarities with the Myc ARE sequences bound
by known AU-binding proteins. 1s there a universal consensus sequence which regulates
mRNA degradation/stability? What is the underlying mechanism (with the associated tram-
acting factors) by which a messenger RNA is targeted for degradation or stability? Once a
mechanism is proposed, it will aid in determinhg strategies of reguiating gene expression by
reguiating the half-life of the mRNA.
In this study, the goal is to M e r narrow d o m the particular sequences on the MDRB
RNA where binding of pro teins are detected using antisense oligodeoxynucleotides (herein,
referred to as ODNs) which are complementary to a target site on the RNA and have the
potentid to inhibit protein binding to that site.
3.3. USE OF ANTISENSE OLIGODEOXYNUCLEOTIDES (ODNs) AS A MEANS OF
MAPPING RNA-PROTEIN INTERACTIONS' SITES
3.3.1 Design of ODNs: Factors tu consider for eflcient binding to target
As a first step in mapping the binding sites of RNA-binding proteins on the MDRB
N A , shon ODNs of i 5-mer ana i8-mer lengùis were designeci to span su'aregions of uie
sequence based on the formula: Melting temp (Tm) = 2°C (i: of A+T's) + 4' C( # of G + C's)
where the melting temperature refen to the hybridization temperature at which half the target
strands are bound to the ODN. This formula neglects any secondary structure in the ODN and
target mRNA, and assumes that the ODN is in excess. ODNs were designed to have qua1
hybridization temperature in order to show that any differences observai in their effects on
protein binding is due to their target sequence and not to variations in afinity. It is also
important to consider both the structures of the target RNA strand and the ODN. For this
reason, the FOLD module of the RNAstmcture3.5 prognrm, which uses the Zuker algorithm
(225, 226) to predict RNA secondary structure, was used along with the OligoWalk module
program (230), which walks along the RNA (folded structure option) and conf'irrn the stability
of the ODNs designed Twelve oligonucleotides correspondhg to düferent segments of the 157-
nt MDRB RNA probe as indicated in Figure 14 were used in RNA gel shift and W cross-
linking cornpetition assays. Details of the ODNs have been d e s c r i i in the Methods section
2.5 and are provided in Tables 5 and 6.
Location of MDRB antisense targets
MDRB
4421 MDRB REGION 4577
L\\\Y L\\\Y L\\\YL\\\Y \ 7 -
3 5 6 8 ODNs 16
FIGURE 14: SCHEMATIC DIAGRAM OF THE LOCATiONS OF THE MDRB ODNs USED IN PART 2 OF THIS STUDY. First screening MDRB ODNs chosen are shown in solid wlor. Second screening MDRB ODNs are shown in hatched segments. Details of the length, sequences, target sequenœs and annealing temperature are provided in Tables 5 and 6.
Table 7 shows the results of running the OligoWalk module of the RNA structure3.5
program. The position nurnber in column 3 of Table 7 refers to the 5'-most base in the MDRB
target where the ODN is supposed to bind. Total binding is the net free energy of ODN-target
binding when dl the factors are considered including breakmg the target structure and ODN-self
structure (Le. "intramolecular ODN" column). As shown in Table 7, the overall
thermodynamics (free energy) for the total binding is negative, indicating tight binding of the
ODNs to the target RNA. In addition, the intmmolecular (ODN-self structure) is zero for most
ODNs except for ODN14 and ODN 16 which indicates that majonty of the ODNs do not have
stable self-structures which can lead to unfavorable ODN-target binding. The intermolecular
(ODN-ODN) energy values are negative indicating one ODN can bind to another however, for
the purposes of ou . experiments, we assumed that the ODNs are in excess of the target
therefore t his parameter is ignored
3.4 FIRST SCREENLNG: EFF'ECTS OF ODNs: 1,4,6A, 7,9,13 AND 14
3.4.1 Determination of the optimal concentrations for detection of ODN effects on RNA-
protein corn plex formation
To effectively screen for the efects of the MDRB ODNs for the first initial screenuig,
RNA gel s hifi assays were canied out using 250 pmol/pl ODNs in 10 pl binding reactions. This
corresponds to 25 pM of final ODN concentration. As s h o w in Figure 15, a detectable
difference can be seen with ODN7 wMe no detectable effects on binduig were seen with the
other ODNs at 250 prnoVp1. We then proceeded to carry out a concentration-binding effects
Table 7: Predicted energy of binding of ODNs* compared to the MDRB RNA target by the OligoWalk module of RNAstructure 3.5.
3 TCTCCACTTGATGAT 19 -7.3 -1 6.3 60.2
4 AWCTCTCCACTTG 24 -7.9 -16.6 62.3 -8.7
1 3 AAATGGGAAAATATAAAC 111 2.9 -9.9 40.5
14 AGGCAGTCAGlTACA 133 -1 2 -1 7.4 65.8 -5.4
16 ClllTAGCCAAGGCAG 142 -1 0.9 -1 5.9 59.1 4 1 -0.7 -4.2
4
*Binding conditions used for the simulation are: 2.5 pM (ODN concentration), 37"C, folded MDRB RNA Details of the above parameters are provided in Results section.
h, -
-3.2 O -2.9
5
6a
6
AGTTJAAACTATGATITC
TTATMGCAGTITAAAC
ATAAAATTTATAATGCAG
34
43
50
-8.6
-10
-8.4
-13.9
-1 3.4
-1 1.2
50.7
48.8
43.4
-4.3
-2.8
-2.8
O
O
O
-9.5
-8
-5.5
FIGURE 15: EFFECT OF ODNs ON HEPGZ RSW PROTEINS' BlNDlNG TO THE MDRB RNA. Ribosomal salt wash ( M W ) (2 pg) from human hepatorna (HepG2) cells was incubated with aP-labeled MDRB RNA in the presence of 250 pmoVpI (25 PM) of the indicated ODN molecule. ODNs used for both RNA and UV cross-linking assays were phosphodiester derivatives. AL Schematics showing the relative positions of the ODNs used for the initiai screening. Bk Autoradiograph of an RNA gel shifi showing the MDRB-RSW protein complexes in the absence and presence of the indicated ODNs. Lane 1 shows the *P-labeled MDRB RNA alone. Second lane, RNA probe in the presence of the RSW. Lanes 3 throug h 9, RNA probe and RSW in the presence of the indicated MDRB ODNs.
c w e at lower concentrations. In gel shift assays, ODN concentrations of 1, 10,25, 50 and 100
pmoUp1 were used to determine the effects of each ODN at încreasing concentrations to the
formation of RNA-protein complexes compared to the control sample with RSW alone (no
ODN treatment). The dose-response curve (Figure 16) shows that this concentration range was
effective in discriminating the concentration-dependent effect of ODNî over the other ODNs at
a range of 1 to 100 pmoVpl (corresponding to 100 RM, 1, 2.5, 5 and 10 PM final ODN
concentration in the reaction), respectively.
3.4.2 RNA gel shift assays to measure total binding
Preliminary experiments to test the effectiveness of each ODN in inhibithg RNA
protein complex formation was carried out using RNA gel shifl assays. However this assay
detected heterogenous complexes under non-denaturing conditions therefore only total binduig
(in terms of the detected RNA-protein complex signai) was measured and quantitated For
ODNs with ability to alter total binding, fùrther characterization was canied out using W
cross-linking experiments.
3.4.3 Initial screening of MDRB ODNs: 0DN7 enbanced the RNA-protein complex
formation in both gei shift and iiV cross-linking assays and this enhancement
eorrclrtcd with chrngcs in sccondiry structure of thc MDRB RNA in the prcscncc of
ODN7.
Figure 16 shows a dose-respnse cuwc of the rffrcts to the RNA-protein complexes
formation of
graph shows
the: difTkrent ODNs exarmnwI during the initiai x d g by gel sshift assays. fhe
that except for ODN7, no sigmficant diference fiom the control was seen with the
Percent of control
O O 1 1 O 25 50 1 O0
ODN treatrnent (pmolfpl)
Graph shows the results of gel shift analysis after the first saeening with MDRB ODNs: 1. 4, 6a. 7. 9. 13 and 14. Quantitation was done using a Phosphorlmager and values were expressed as percent of the binding seen in the absence of the indicated ODN (control). Data are repre~en t~ve of three separate expenments with means k SE. Astensk (*) represents statistical significance (repeated measures 1-way ANOVA) of the indicated ODN at increasing mnœntrdons (p< 0.05).
other ODNs examinai While ODN6a showed an inconsistent decrease in complex signai,
ODN7 showed an unexpected and statistically significant increase in the RNA-protein
complexes' formation at increased concentrations. This effkct on RNA-protein interaction was
associated with an effect of ODN7 on MDRB RNA conformation. This is illustrated in lanes 3
to 7 of a representative gel shift assay (panel A, Figure 17) whereby ODN7 incubated with
MDRB RNA alone caused a shifi to the upper band RNA conformation. Note that the fke
MDRB RNA always mns as a characteristic doublet under non-denaturing conditions. This
increase in the amount of the upper RNA band is conelated with the increase in the RNA-
protein complexes' signal shown in lanes 8 to 12. In contrast, incubation of other ODNs such
as 0DN6 (Figure 17 panel B) or ODN 13 (Figure 18) with the MDRB RNA alone did not show
the m e effect of the ODN on the migration pattern of free RNA.
Since the gel shift results only showed total binding (Le. does not discriminate the
effects of the ODNs to the binding of the 42 and 80 -kDa proteins detected in pan I of this
study), üV cross-linking experiments were carried out whereby binding reactions similar to the
gel shift assays were done in the presence of increasing concentrations of the specified ODN,
followed by U V cross-luikuig of proteins to covalently bind them to their target site on the
MDRB RNA. Figure 19 (panel A) shows a representative W cross-linking autoradiograph of
ODN7 as the ODN cornpetitor. ODN7 consistently showed a statistically significant (by
repeated measures ANOVA, p < 0.05) (panel B) enhancement in the 80 kDa protein signal at
about 136 % of the control at 25 prnoUp1 while no effect on the 42 kDa protein signal was
detected.
+ HepG2 RSW r i
RNA- protein
complexes l
Free +
MDRB RNA +
protein complexes
+ HepG2 RSW I
FIGURE 17: EFFECTS OF 0DN7 (Panel A) AND ODN6 (fmm second screening) (Panel B) ON THE FREE MDRB RNA AND ON THE FORMATION OF RNA-PROTEIN INTERACTIONS. HepG2 RSW (Ipg) was incubated with UP-labeled MDRB RNA in the absense (lane 2) and presence of increasing concentrations of the ODNs (lanes 8-12 for each gel). Binding complexes were analyzed on a non-denaturing polyacrylamide gel. Lanel shows MDRB probe alone. As additional control, samptes incubated with the probe and the indicated ODN alone (lanes 3-7) were included. Note the doublet observed to be affecteci by 0DN7 (arrows) is presumably due to two conformations of the MDRB RNA.
77
RNA- protein (
Free +
MDRB RNA +
+ HepG2 RSW
FIGURE 18: EFFECTS OF ODNl3 ON FREE MDRB RNA AND RNA-PROTEIN INTERACTlONS IN THE GEL SHIFT ASSAY. Representative autoradiograph of an RNA gel shift assay with ODNI 3. HepG2 RSW (1 pg) was incubated with 32P-labeled MDRB RNA in the absence (lane 2) and presence of increasing concentrations of ODN13 (lanes 9-13). As additional control , MDRB RNA probe incubated with increasing concentrations of 0DNi3 without RSW were also included (lanes 3-1). Binding complexes were analyzed on a nondenaturing gel. Free MDRB RNA (arrows) and RNA-protein complexes are indicated.
Percent of protein signal
CT 1 10 25 50 1 O0
ODN7 treatment (pmollpl)
FIGURE 19:EFFECT OF ODN7 ON THE BlNDlNG OF HEPG2 RSW PROTEINS ON THE MDRB RNA USING UV CROSS-LINKING.
Al. UV cross-linking experiments showing the effect of increasing concentrations of MDRB 0DN7 on the 80 kDa (blue) and 42 kDa (red) proteins complexed with the MDRB RNA (shown in arrows). Binding reactions were carried out as for gel shift analysis, followed by UV exposure to covalently bind the radiolabeled RNA probe to proteins. After digestion with RNase A and T l , complexes were resolved on a 10% SDS-polyacrylamide gel. Concentrations of 0DN7 added are 100 nM (1 pmoVpI), 1 pM (10 pmoll pl), 2.5 pM (25 pmolf pl). 5 pM (50 pmoll pl), and 10 fl (100 pmoV pl) in I O pl reacüons. Locations of Coomassie blue stained protein markers are indicated on the right.
BJ The 80 kDa (blue arrow and ban) and 42 kDa (red armw and bars) protein signals were quantitated using a Phosphorlmager and expressed as a percent of the binding seen in the absence of the ODN. Data shown are means I SE for 3 experiments. (')= staüsticaily different from wntml (pe0.05, Student Newman Keuls procedure).
3.4.4 Effect of other fint set ODNs on W cross-iinking: Initial screening showed that
ODN13 is effective in inhibiting complex formation by W cross-linking experiments
W cross-linking analysis detected no statistically significant effect on the binduig
profiles of the 80 D a and 42 kDa proteins in the presence of increasing concentrations of
ODNs: 1,4,6a, 9 and 14 (data not shown). ODN13 did not show detectable differences fiom
the control in gel shift ûssays as shown in Figure 18. However, in W cross-linking experiments
(Figure 20 panel A), a statistically significant (p < 0.05) decrease of the 80 kDa protein signal at
increased concentrations of ODN 13 was detected (Figure 20 panel B).
As with ODN7, no statistically significant effect was seen on the 42 kDa protein signal. The
decreased bhding appeared to plateau at about 25 pmoVpl with a decrease of approximately
60% of the control. For al1 other ODNs, no detectable differences were seen on the binding
profiles of the 80 kDa and 42 kDa proteins in the presence of the cornpetitor ODN.
3.5 SECOND SCREENING: ODNs: 3,5,6 AND 8
From the initiai screening, the target RNA sites of 0DN7 and ODN13 showed an
enhancement and an inhibition of the 80 kDa protein signal at increased concentrations,
respectively. Therefore, we proceeded to choose new ODNs which overlapped these sites, in
addition to new target sites by other ODNs. The target seqwnces and locations of these sites
are summarized in Figure 18 and Tables 5 and 6 (Materials and Methods). In particular, ODN6
and ODN8 were included to overlap ODN7 and ODN6a sites. As s h o w in the dose-response
c w e in Figure 2 1 showing the effects of the different ODNs on complexes' formation by gel
Percent of protein signal
CT 1 1 O 2 5 5 0 1 O0
ODNl3 treatment (pmollpl)
FIGURE 20: EFFECT OF ODNI3 ON BlNDiNG OF HEPGZ RSW PROTEINS ON THE MDRB RNA USING UV CROSS-LINKING
A/. Representative autoradiogram of a UV cross-linking experiment of HepG2 RSW (2pg) proteins on the MDRB RNA with increasing concentrations of ODNI 3. Details of the method were as described previously.
B./ Quanatation of the enects by ODN13 on the 80 kDa (blue) and 42 kDa (red) RSW proteins deteded by UV cross-linking were as described previously. Data shown are means f SE for three experimenh. (*) =statistically different from control (pc0.05. Student Newman Keuls procedure).
Percent of control
50 -1 40
O 10 20 30 40 50 60 70 80 90 100
ODN treatment (pmol/pl)
FIGURE 21: DOSE-RESPONSE CURVES: SECOND SCREENING MDRB ODNs : 3, 5 , 6 , 8 and 16 USING GEL SHIFT ANALYSIS.
RNA-prdein complexes from a typical gel shift assay were quantitated using a Phosphorlmager and expressed as a percent of the binding seen in the absence of the indicated ODN (control). The entire gel-shifted regions were used for quantitation purposes. Data shown are means r SE for three independent experiments.
shi fi analy sis, ODN6 caused a statistically significant decrease in RNA- protein complex
formation (p < 0.05). Figure 22 (panel A), shows a representative gel of W cross-linking
canied out in the presence of ODN6. There is a statistically significant decrease (p4.05 by
repeated maures ANOVA) in the 80 kDa protein signal (blue ban) to about 60% of control at
100 pmoVpl of 0DN6 while the 42 kDa protein signal was unaffected (Figure 22 Panel B).
In addition, there was a statistically significant effect on the 80 D a protein by ODNs 3
and 5 compared to control in W cross-linking experiments and this effect corresponded to a
slight enhancement, though not significant, of the fiee RNA upper band signal in non-denaturing
gel shift assays which also appeared to plateau at ODN concentrations of 25 pmoVp1. In W
cross-linking experiments, it was determined that ODNs 3 and 5 were able to enhance the 80
kDa protein signai. Furthemore, there was a statistically significant efiect between ODNs 3, 5,
6, and 8 on the 80 kDa protein signal (p < 0.0001) (Figure 33).
Note that for both sets of ODNs tested, no detectable difference by any ODN was seen
in the 42 kDa protein signal compared to control with RSW alone (i.e. no ODN treatment).
1
Percent of protein signal
(CT=lOOOh)
1 10 25 50 100
ODN6 treatment (pmollpl)
FIGURE 22: EFFECT OF 0DN6 ON THE BtNDlNG OF THE HEPG2 RSW PROTEINS
A/. Representative autoradiogram of a UV cross-linking experiment of HepG2 RSW proteins (2pg) on the MDRB RNA with increasing concentrations of 0DN6. Details of the rnethod are described in the legend to Figure 19.
BJ Quantitation of the effects by 0DN6 on the 80 kDa (blue) and 42 kDa (red) RSW proteins detected were described previously. Data shown are means c SE for three expenments. C) indicates statistically different fiom control (pc0.05, Student Newman Keuls procedure).
Percent of 150 control 80 kD
signal
O O 10 20 30 40 50 60 70 80 90 100
ODN treatment (pmol/pl)
FIGURE 23: EFFECTS OF ODNs 3, 5 ,6 and 8 ON THE 80 kDa PROTEIN SIGNAL IN UV- CROSSLINKING ANALYSIS. Results are taken from UV cross-linking experiments. Data are repre~ent~ve of three separate experiments and are expressad as means k SE. (*) indicates statistical significance of the ODN at increasing concentrati.ons (p<O.OS, repeated measures 1- way ANOVA).
3.6 CUMULATIVE S U Y OF RESULTS: STATISTICAL, SIGNII;][CANCE
By the Student-Newman-Keuls method (following repeated measures 1-way ANOVA),
it was determined that at increasing concentrations of ODN6, 0DN7 and ODN13, their effects
on the 80 D a protein binding was significantly different from the control (MDRB probe
incubated with RSW done) (p <0.05). Painvise cornparisons between treatment groups (ODNs
3,5,6,7, 8, 13) indicated that the effects of ODN6 and ODN7, which target regions
adjacent to each other, exerted significantly different effects on the 80 kDa protein binding
(pc0.05). Similarly, ODN7 and ODN13 effects on binding were also significantly different
However, ODN6 and ODN13 did not show any difference in their effects on the 80 D a
protein. A summary chart of the effects of the most consistent ODNs at different
concentrations (in t e m s of their effects on the 80 kDa protein) are summarized in Figure 24.
Percent control 80
signai
ODM * 00N7 * ODNI 3 * ODN
FIGURE 24: SUMMARY OF EFFECTS OF THE MOST CONSISTENT ODNs f NVESlïGATED.
Bar graph shows the effects of ODNs: 6, 7 and 13 on the 80 kDa protein signal. Final concentrations (up to optimal effeds i.e. 2.5 PM) of the ODNs in the binding reactions are shown in the legend. (*) indicates statistical significance (p < 0.05, repeated measures ANOVA) in a concentration-dependent manner for each ODN. Details of staüstical analyses are included in the Results sedon.
IV. DISCUSSION
The molecular rnechanisms of pst-transcriptional regdation of the human MDRl
mRNA have not been elucidated but yet are significant because they can be a critical factor in
the development of multidrug resistance in tumor cells.
Numerous studies have shown that AU-rich elements (ARES) present within the 3'UTR
of proto-oncogene, cytokine, lymphokine, and more recently, the G protein-coupled receptor
M A S , mediate their rapid degradation (19, 76, 77). To add to this complexity, modulation of
the stability or decay is also governed by rranr-acting factors, which serve as regulators of
mRNA half-life, responding to both endogenous as well as exogenous signals.
Previous work in our lab (1) has demonstrated the fint evidence that the 3'UTR of the
MDRl mRNA does not behave as a classic ARE cis ekment in that, it does not function as an
efficient destabilizer of MDRl mRNA. Moreover, when rneasured in the human hepatoma ce11
line, HepG2, the MDRl rnRNA half-life is intermediate (8 hr) between that of the c-rnyc (30
min) and GAPDH (> 24 hr). The MDRl 3'LTR shares sequence similadies to the 3'UTRs of
rapidly degraded mRNAs. The MDRl 3'UTR is approximately 380 nucleotides long and
consists of 70% A and U residues.
In the present snidy, we set out to test the hypothesis that the observed differences in the
mRNA half-lives of the MDRl and c-myc mRNA is due in part to differences in the
interactions between the cis elements within their 3'UTRs and tramacting factors which bind
these regions. The uniqueness of the RNA-protein interactions that occur within these regions
may determine the underlying mechanisrn of differential mRNA stability between these two
mRNAs. As a f k t approach to studying the reasons for the apparent weakness of the MDRl
3'UTR as a destabiking ch element of mRNA decay, initial rnapping of the binding regions
within the 3'UTR were canied out. Since the majority of the RNA-protein interactions which
are responsible for pst-transcriptional regulation of mRNAs occur within the 3'UTR, we
focused on ths region to identiQ possible regdatory sequences which serve as binding sites for
the tram-acting factors which may play a role in the modulation of the half-life.
The first initial mapping of the MDRl 3'UTR was carried out by RNA gel shift assays
using two probes: the MDRA, whch spans the proximal part of the 3'UTR and the MDRB,
which spans the distal portion of the 3'UTR (refer to Figure 4 and Ref. (1)). Subcellular
localkation experiments have detected RNA-binding proteins present in the pst-polysomal
supernantant (S130) as well as the niosorna1 salt wash (RSW) which bind these two regions.
The fuidings that RNA-binding proteins c m be detected in the RSW are consistent with known
studies of mRNA stability as this compartment is an important source of RNA-binding
proteins. We cannot, however, exclude the possibility that RNA-binding proteins which bind
the MDRl 3'UTR may also be found in the nuclear or SI30 fractions. Indeed, some RNA-
binding proteins such as the HuR, cm shuttie between the nucleus and cytoplasm (23 1). Based
on gel shift assays, we were able to determine that the major protein binding site within the
MDRl 3'UTR is contained in the MDRB region. Frorn gel shift data, the MDRl 3'UTR
exhibited similar band shifts of RNA-protein complexes to those of the MDRB but not the
MDRA. This is not to Say that the MDRA does not participate in RNA-protein interactions
since a complex distinct fiom that of the MDRB pattern can also be detected. Previous work
has also shown that the MDRA exhibits weak binding to RNA-binding proteins (1). In addition,
the MDRl coding region exhibited similar binding patterns to that of the MDRl 3'UTR and
MDRB but not to MDRA. Whether the proteins which bind this region and those of the MDRl
3'UTR are the same remains to be investigated. The effeçt may also be due to sirnilarities in
sequence length alone. It is interesting to note that the MDRl coding region used in this study,
comprises a sequence that is unique to MDRl (i.e. not to MDW). It is also possible that these
proteins are able to bind MDRl 3'UTFt, MDRB and the MDRl coding region simply because
they might have similar secondary structures that cm provide binding sites for these proteins.
Although competition with non-specific competitoa showed that poly(G) and poly(1) were able
to compere for 'ainding to these cornpiexes, we conciuded riiat binding to poiy(Gj does not
necessarily point to a G-rich sequence specific binding protein as the regions do not contain G-
rich stretches, and may therefore be a result of contamination with ribonucleases of the stock
ribopolymer samples. The reason for the competition observed with poly(1) is h o w n as the
other ribopolymers, most especially poly(U) did not compte with these proteins therefore
showing that the interaction is selective to the MDRB sequence.
To determine whether there are sirnilarities in the binding profiles of MDRB and Myc
ARE to HepG2 and K562 RSW proteins, W cross-linking was camied out Two proteins
approximately 42 and 80-kDa in molecular weight bind to MDRB and to Myc ARE.
Interestingly, one protein of approxirnately 32 kDa was show to have preference for the Myc
ARE and not to the MDRB. The identity of this protein remains unknown, although there is a
good possibility that it might be an isoform of the AUFl RNA-binding protein (see
Introduction section 1.2.2.2 (hnRNPs)) based on the presence of AU sequences within the Myc
ARE and the molecular mass of the protein. The two proteins detected that bind the MDRB and
Myc ARE do not appear to be ceIl-specific, as these proteins were found in both He@ and
K562 cells. Whether or not the proteins which bind each region are in fact the same proteins, is
unclear at this time although binding of proteins from HepG2 RSW and K562 RSW to the c-
rnyc coding region determinant (CRD) is apparently distinguishable fiom the Myc ARE and the
MDRB (see Figure 10).
We hypothesize that the 42-kDa protein may be the ARE-binding protein, AUF 1 for the
following reasons. Fint, Brewer and CO-workers actually purified this protein from polysomes
derived from the K562 human erythroleukemia ce11 line, which was one of the sources of our
RSW in these experiments. Polysomes contaming ALiF 1 were show to rapidly degrade the c-
rnyc mRNA in vitro (1 1 l). This protein exists in four isoforms with rnolecular masses of 37,
40, 42 and 45 kDa ( 12 1, 136). Several studies have suggested the regdation of rnRNA decay
rates by differential expression of these AüF 1 isoforms in some ce11 types (136). Second, the
AUFl recognition sequence includes the ARE and ARE-related sequences with which AUFl
interacts with high *nity. Sequence alignment of MDRB and the Myc ARE revealed aligned
AU-rich elements. In fact studies of vanous AüFl ligands (232) defined the binding
specificities of AUF 1 to include synthetic RNAs containing (AUUU)J, as well as the wild-type
ARES of c-myc (12 l), c-fos (1 2 1), pi-adrenergic receptor (135), GM-CSF (12 1 ) and mutant
ARES of c-myc or c-fos with single U to A point mutations in their AüUUA pentarnen. It was
shown that the 3'UTR of AUFl selected mRNAs are diverse. As expected fiom previous
findings, rnany contain AUINA repeats, while others contain uridine-rich 3'UTRs with
occasional purines (232). Third, although the majority of the studies have demonstrated that
AUFl is involved in M A destabilization and targeted decay, findings by Kiledjian et (11.
(1 17) revealed that it can also function to stabilize a mRNA, as part of a rnRNA stability
complex in association with other RNA-binding proteins in the highiy stable a-globin mRNA
stability complex These findings suggest that AUF1 can fùnction to promote rapid
destabilization of the c-myc mRNA and perhaps, is also involved in the stability of the MDRl
mRNA. Indeed, previous studies in our lab using chirneric mRNAs whereby the 3'UTR.s of
Myc and MDRl were fused to the globin coding region indicated that the half-Iife of B-globin
mRNA was decreased by the presence of the c-myc 3'UTR but not the MDRl 3'UTR (1). At
this point we cannot rule out the possbility that other RNA-binding proteins may be binding to
the MDRB distinct from that of the Myc ARE due to the fact that characterization of the
complexes was not carried out.
Usiug unlabeled RNAs of Myc ARE, MDRB and MDRA as cornpetitors, the ability of
these proteins to bind the c-myc ARE was apparent as lower concentrations of this unlabeled
cornpetitor were required to inhibit MDRB-protein cornplex formation. The AU-binding
proteins appear to have greater ability to bind to this RNA target than to the two segments of
the MDRl 3'UTR. It is worth noting that this correlated with the higher intensity of cross-
linked proteins to the Myc ARE compared to the MDRB (Fig. 10, Results section) in the W
cross-linhg experiments even at similar concentrations of total protein in both HepG2 and
K562 RSW. The lack of ability of the MDRA region to compete for these AU-binding proteins
has been previously shown ( 1).
Work by DeMaria et al. (132) demonstrated that ARE binding afinities of AUFl
correlate with the potency of the ARE to direct the degradation of a heterologous mRNA.
Sequences within the MDRB region do not exhibit comparable binding ability for the EWA-
binduig proteins as the Myc ARE and are, therefore, less likely to act as signals for AUFI-
mediated degradation. The variable range of AUFl binding affinities for various RNA
substrates (Iow, moderate, and hi&) indicated that the affinity of AUF 1 for a given mRNA
rnight dictate the rate at which it is degraded Therefore, the concentrations of cellular AUF1
cm be an important contributor to mRNA half-life modulation. Thus, a mRNA that contains a
high afinity AUFLbinding site may only require low concentrations of this protein to initiate
degradation and thus have a shorter half-Me. On the other hami, a mRNA which contains a
low-affinity AUF 1-binding site may require higher cellular concentrations of this protein to be
able to be degradeci and thus, may have a slower rate of decay compared to the former. AUFl
can therefore direct degradation of multiple rnRNAs through alteredfvariable afinity of AüF1
for these sites (132). if other proteins such as AUF 1 exhibit the same lunetics in binding then
this will modulate mRNA stability by virtue of the affinity of the protein to its target RNA.
This couid be the case for the difference in the half-life observed for the c-mye mRNA and the
MDRl mRNA since even at similar RSW concentrations (corn both HepG2 and K562 cells), a
less intense binding is seen with MDRB compareci to Myc ARE (see Figure 10, Results).
Furthermore, cornpetition assays with both Myc ARE and MDRB showed that the former was a
better cornpetitor for AU-binding proteins (1).
From the initial characterization of the binding site, we have determined that the major
binding site for the MDRl 3'UTR-binding proteins is in the distal part of the 3'Um the
MDRB region. This region spans bases 4421 to 4577 of the human MDRl rnRNA and
compared to the MDRA region, is highly AU-rich and consists of AU-motifs surrounded by U-
stretc hes.
The next goal was to M e r narrow down the sites and determine the possible
sequences that are involved in the RNA-protein interactions. Our approach in rnapping the
sequences is by using antisense oligodeoxynucleotides (ODNs) in in vitro assays. ODNs are
short DNA segments that are complementary to the rnRNA. They were designeci to be specific
to one region and anned to the targes at approximately the same conditions for dl ODNs.
Since they target specific regions of the MDRB, my goal was to use the ODNs to m e r
narrow down the site of RNA-protein interactions. Table 8 shows the sequences targeted by
the most consistent ODNs (Le. in terms of their effects on RNA-protein complex formation)
and the extent of AU-richness within these sequences. As indicated previously in the Results
section (part 2), we were able to determine that ODN6 and ODN13 inhibited the buiding of the
80 kDa protein to the MDRB in a dose-dependent manner with a statistical significance (p <
O.Wj, whiie ODEi13 had a slight effect on the 42 D a whicii was not stausticaiiy significant.
From the results, we have deduced thaî two of the probable regions of binding are within bases
44704487 (target region of ODN6) and bases 4531-4548 (target region of ODN13) of the
MDRB RNA. Several observations are worth noting. Fint, from al1 the ODNs examined,
sequences 470-4487 and 45314548 contain the most AU-rich regions of the MDRB (see
Table 8). Interestingly, bases 4531-4548 (the ODN13 target site) on the MDRB region
contains 17 % A and 6 1 % U residues, which is by f' the highest U content in these regions. In
addition, bases 4470-4487 (the MDEü3 sequence targeted by ODN6) contains 33 % A and 50%
U residues; the second highest U content. These indicate that the proteins binding to the
MDRB region may have a preference for U-stretches rather than the AU motifs per se, although
the presence of the A residues may have a minor fiuiction since experiments with poly(U)
cornpetitor did not show any cornpetition for binding to the proteins. These findings of a U-rich
protein binding site is in accordance with recent findings by Wilson et a[. (233), which
demonstrated that A W A motifs are not requisite for AUFl binding. They M e r suggested
that uridylate residues may be the primary determinants of RNA recognition by AUF 1 and that
the A residues serve as c'secondary" recognition elements, to recruit ancillary factors or by
positionhg the AUF 1 proteins on the mRNA. Furthemore, studies by Haeussler et al. (234)
have shown that the HuR binduig site in the neurofibromin 3'UTR does not contain AUUUA
TABLE 8: INHIBITORY EFFECTS OF TBE ODNS AND EXTENT OF NU-RICHNESS OF THE TARGET SEQUENCES
GAACAGAGUGAGAGA 4423-4437 47 7 NIE AUCAUCAGGUGGAGA 4439-4453 33 20 + CAAGUGGAGAGAAAU 4444-4458 47 13 NIE GAAAUCAUAGUUUAAACU 4454-4471 44 33 + GUUUAAACUGCAUUAUAA 44634480 39 39 NIE CUGCAUUAUAAAUUUUAU 4470-4487 33 50 -* ACAGAAUUAAAGUAGAUU 44894506 50 28 +++* GUAGAUUUUAAAAGAUAA 4500-4517 50 33 NIE UUUAAAAGAUAAAAUGUG 45064523 50 33 NIE GUUUAUAUUUUCCCAUUU 4531-4548 17 61 -* UGUAACUGACUGCCU 4553-4567 20 33 NIE CUGCCUUGCUAAAAG 4562-4576 27 1 27 NIE
A and U residues are shown in bold. The comsponding effect on the 80 kDa protein binding is shown. NE: no statisticaily significant ciifference fiom control, *: statistically significant
(p < 0.05), +: enhancernent of binding, -: inhibitory effect. The degree of enhancement or inhibition is denoted by multiple + or - signs.
pentamers but rather, U stretches of 7 and 4 nt in length, separated by a CUUCUA insert You
and CO-workers also demonstrated that ARE-protein interaction is mediated by U stretches and
not A W U A motifs (235).
Based on the W cross-linking experirnents which we have carried out, we detected two
cross-linked complexes in both HepG2 and K562 RSW in the absence of the ODNs (Figure
,IC'h' IL 1
10 j. It is likeiy that the 42-Da protein may represent the p -' * isoform of AUF 1. However,
the ODNs which target the regions mention& were actuaily effective in inhibithg the 80 kDa
binding protein and not the 42-kDa protein. In fact, the majority of the W cross-linking
experiments revealed that most ODNs except ODN13, did not show an inhibitory effect of the
42-kDa protein. Several explanations exist. First, although we have used ODNs to target al1
the possible regions within the MDRB and saw no solid inhibitory effea on the 42 kDa protein,
it is possible that this 42 kDa protein may exhibit high enough afinity (higher than the ODN
targeting its binding site) that it is able to preciude or even overcome the ODN interaction with
the RNA. In this case, the &of the 4 2 - D a protein is lower than the Kd of the ODN targeting
its binding site. This is possible since in the experiments outlined, the RNA probe was added
last to the samples containing both competing ODN and RSW protein in al1 the experiments
canied out; with the assurnption that an equilibrium exists between the target, the ODN and the
protein, the hybridization will depend on the difference between the relative afinity of the
ODN to the target RNA versus the afinity of the protein to the same site on the RNA. One way
to test this hypothesis would be to incubate the ODNs with the probe alone prior to addition of
the RSW. If the K d of the protein for the MDRB RNA is lower compared to the Kd of the ODN
for the same target RNA, then no inhibition will be detected and the protein is able to bind to its
binding site regardless of the presence of the cornpetitor ODN. OtheMse, if the ODN has a
lower Kd than the protein for the site on the MDRB, then inhibition will be observed which will
correspond to an observed decrease in the 42-kDa binding. This codd be true since the 42 kDa
protein comprises the major complex formed with the MDRB (see Fig. 10 Results) in the
absence of the ODN. Second, recent studies have shown that ARE mediates binding of AUFl
dimers on the RNA and depending on their target RNAs, these dimen can also form tetramers.
nie t e m e n occur as a resuit of prorein-protein interactions rather han the RNA-protein
interactions although the initial dimerization process must be mediated by the ARE (233).
Binding of the AUFl dimer to an "optimal" site on a target mRNA. rnay facilitate additional
binding events at adjacent suboptimai site(s) due to free energy conaibutions from protein-
protein contacts. This rnay partially be the reason for the heterogeneity in ARE sequences since
conservation of a "stringent" sequence rnay only be required at the initial AUFl contact site.
In fact these proteins are part of multimeric complexes, associating not only with thernselves
but also with other tram-acting factors as well (e. g. AUF 1 f o m the mRNA stability complex
in alpha-globin mRNA and interacts with the aCPland aCP2 RNA-binding proteins (1 17)). If
the AUFl is indeed the 4 2 - D a protein detected in the W cross-linking experiments then,
there is a possibility that this protein together with the 80 kDa complex rnay represent the
monomeric and dimeric complexes which bind the MDRB RNA.
Because the cornpetitor ODN can bind to only one site in the presence of the RSW
proteins, then the observation that there are two probable binding sites and one protein of
rnolecular mass 80 kDa being af5ected by two ODNs targeting different sites on the MDRB
RNA, rnay support the mentioned phenornenon whereby complete abolishment of protein
binding is not achieved because one of the sites is still available for binding. The protein can in
tum bind to other suboptimal sites in which case, protein-protein interactions rnay occur.
However, the technique used in this study lirnits the delineation of the nature of the binding
events which occur prior to the cross-linking of the protein and the RNA therefore the above
cannot be clearly deduced at this time.
M e r candidate proteins which may bind the MDRB binding sites include HL& the
only ELAV-like protein expressed in the Liver, as it has been shown both in vitro and in vivo
that this protein is involved in the stabilization of severd mRNAs @%j. in addition, HL& has
been s h o w to bind to a 38 nt (U)-rich Fragment of the neurofibromin 3'UTR. HL& a 36-kDa
member of the ELAV-like family of RNA-binding proteins (see section 1.2.2.2), is
ubiquitously expressed in human cells. It has also been show that HuR has a poly(A)-binding
activity. Since the regions of the MDRl 3'UTR used in these studies do not include the
poly(A) tail, we cannot exclude the possibility that this protein, along with PABP may actually
be involved in the stabilization of this mRNA. However, in the context of previously published
work, the chimeric experiments which showed stabilization of the fi-globin-MDR1 3'UTR
mRNA also did not include the poly (A) tail.
While AU- sequences may be important cis elernents of mRNA stability, many
examples of RNA-protein interactions within the 3'UTR of rnRNAs demonstrate that RNA-
bindùig proteins bind to secondary structures in these regions.
Some RNA regulatory proteins recognize structures such as loops, stem-loops, bulges
and even combinations of these structures along with specific sequences within these structures
(236). There are aiso examples of proteins which can only recognize single stranded regions of
RNA, where specific interactions are detennined by specific RNA bases (237).
Figures 25 to 27, show the predicted RNA secondary structure of the Myc ARE, MDRA
and MDRB RNAs using RNAstnicture 3.5 which is based on the cornputer algorîthm of Zuker
STRUCTURE: Myc ARE
Energy: -1 6. 2 kcaVmol
FIGURE 25: PREDICTED SECONOARY STRUCTURE OF MYC ARE RNA USlNG THE RNA STRUCTURE 3.5 PROGRAM. RNA structures were evaluated based on the free energy minirnization amputer algorithm by Zuker (225,226).
STRUCTURE: MDRA
Energy: -37.8 kcal/mol
FIGURE 27: PREDiCTED SECONDARY STRUCWRE OF MDRA RNA USlNG RNASTRUCNRE 3.5. Structures were evaluated based on the free energy minimization cornputer algorithm of Zuker (225,226).
(225). As shown, the Myc ARE, MDRA and MDRB contain a ubiquitous RNA secondary
structural element, the stem-loop, that has been s h o w to be involved in recognition by RNA-
binding proteins.
Sequences of the Myc ARE and MDRB were analyzed for the presence of nucleotide
sequence patterns whch have been previously demonstrated to have hcnona l roies using the
UTRsite database (htto://bigarea.area. bacnr. it: 8OOO/EmbIT/UTRHorne/ (238).The resuIts
indicated that both Myc ARE and MDRB sequence patterns resemble those of the histone stem-
loop motif. The histone stem-loop structure has different roles depending on the location of the
mRNA. In the nucleus, it is involved in pre-rnRNA processing and nucleocytoplasmic
transport, whereas in the cytoplasm, it enhances translation efficiency and regdates histone
mRNA stability (see section 1.2.1.3 (i)). A 3 1 kDa nans-acting factor, present in both nuclei
and polysomes, interacts with this structure. In mammals, an additional factor, the U7 snRNP,
binds to the purine-rich element 10-20 nt downstream of the stem-loop sequence. Furthemore,
sequences of the stem, which are conserveci, and flanking sequences are cntical for binding
(239).
Several observations suggest a role of bot. sequence and structural specificiîy of RNA-
binding proteins to their binding sites. First, although Myc ARE, MDRA and MDRB contain
ARE elements, the majority of these motifs are present in the sequences of Myc ARE and
MDRB but not the MDRA. Second, sequences do play a role in the binding of these proteins
because the binding sites within the MDRB region contain AU-rich and U-rich regions. Third,
ODN7 which binds to the loop structure
RNA-protein cornplex fonnation in both
of MDRB, consistently showed an enhancement of
gel shift and W cross-linking data. Moreover, this
enhancement correlated with the increase in the proportion of fiee RNA in the upper
conformation in the absence of RNA-binding proteins under non-denaturing conditions (see
Figure 17). The effect of 0DN7 on the fiee MDRB RNA alone indicated that somebow, this
ODN is able to bind to its target and cause a conformational change to the RNA itself which
actuaiiy enhances the protein binding. The MDRB free RNA doublet seen in non-denaturing
conditions wnich we 'have assumed ro be due to die presence of w o conformen of RNA have
also been demonstrated with the vimentin 3'UTR free RNA (240). From Figure 26, the ODN7
target site encompasses the stem loop From positions 69 to 86 (this corresponds to bases 4489
to 4506 of the MDRl mRNA). Recent reports have demonstrated that this region of the stem
loop is a highly accessible site for ODNs of 20 bases or less (24 1). Since this region is adjacent
to the 0DN6 target site (see Figure 14), it is possible that binding of 0DN7 to regions which
include the "loop" stnicture altea MDRB RNA folding and dlows for greater accessibility of
RNA-binding proteins to their binding sites. In addition, the observed lower inhibitory effect
of ODN6 compared to ODN13 on blocking protein binding may be due to the presence of this
loop stnicture which can act as a compensatory binding site.
The structures rnay either contriiute to or reduce binding. That is, stem loops rnay form
binding sites or the presence of these structures may inhibit the ability of the protein to bind the
RNA. The enhanced strength of the MDRB secondary structure (-26.6 kcalhol) (see Figure
26) compared to Myc ARE (-16.2 kcalhol) (Figure 25) may contribute to its reduced affinity
for ARE-binding proteins.
Based on the above data, we propose the following mode1 for binding of RNA-binding
proteins to the MDRB region of the MDRl 3 ' U R The biading sites for these proteins may
involve regions 4470-4487 and 453 1-4548. These regions make up the long stem-loop
structure of the MDRB RNA and are highly U-rich. The fact that the target sites of both ODN6
and ODN13 are highly U-rich suggests that the core binding sequence is probably the U-nch
regions. Aithough the identity of the binding proteins were not exarnined, there is a hgh
probability that some of the proteins involved are AU-binding (or U-binding) proteins based on
the sequences of the rnapped binding sites.
Tiie presence of two binding sites, the detection of 42 and 89 Ki)a binding proteins, and
major inhibitory effects of ODNs on binding of the latter suggests several possibilities. Fint,
that there may be two proteins binding to each of these two sites, one with a greater afinity to
its binding site than the ODN which target that site. Second, both complexes may be the sarne
protein, yet can exist as dimen, as in the case for AUF 1, such that the monomer (42 D a ) exists
to bind at a suboptimal site whenever, the dimer (80 kDa) is inhibited to form. Third, that there
are more proteins involved and these interact with one another forming protein-protein
interactions which cannot be detected under denaturing conditions (SDS-PAGE), and may in
fact be dso important in stabilizing the MDRl mRNA.
While the majority of the predictions regarding RNA secondary structure in this
researc h were carried out using computer modeling, many midies of RNA- protein interactions
which have also used the Zuker algorithm (RNAstnicture3.5 or M-fold) have f o n d the
existence of the folded structures in solution (240, 242). Work in progress corroborates this
observation as a truncated (1 10 nt) version of the wild type MDRB which was determined by
computer foldhg to exhibit similar stmctural configuration to that of the wild type, showed
similar fke RNA and RNA-protein cornplex patterns in non-denaturing conditions.
Another point to consider is the acnial hybridization efficiency of the ODNs. It would
be ideai if one couid detect whether or not these ODNs bind their target regions or are
somehow recmited to bind to a more stnicturally favorable site due to accessible binding
pockets. Work by Gewirtz et (II . (conference proceedings) bas used a fluorophore-quencher
technique to detect the binding of ODNs to structured RNA (143).
In summaiy, this thesis has extended previous findings in our lab which support a role
of the 3'UTR in mediating the stability of the MDRl rnRNA. It was shown that this stability
may be reiateci to rhe faa that RNA-binding proteins fail to recognize the MDRl 3'UTR as a
high affini~, recognition element. Both the Myc ARE and the MDRB region contain AU-rich
regions as well as U-rich regions. The Myc ARE is a class ARE while the MDRB RNA
resembles a class I ARE yet its "AULTUA"-like motifs only approximate that of the canonical
AUJUA motifs (i-e. AUUUUA and AUUA). However, the secondary structure profiles of
each differ in the presence of stem-loop structures and in the total strength of the secondary
structure. The combination of sequence and structure may underlie the mechanism of
difference between recognition as a high-afinity (such as the Myc ARE) or a low-affinity
target (such as the MDRB region) by RNA-binding proteins in the 3'UTR. Further
confirmation of these binding sites can be done by mutational analysis which is currently in
progress. Prelirninary work is included in the Appendix.
The importance of AU-rich elements in RNA-protein interactions is apparent when one
considers sorne of the deleterious consequences that result when these highly conserved regions
within the 3'UTR are altered. The removal of the 3'UTR of theprofo-oncogenes c-myc and c-
fos activates these genes to become oncogenes and cornelate with increased neoplastic
transformation. Post-transcriptional regdation mediated by the presence of ARE elements is
vital in normal cellular processes. Just as promoter regions serve as transcriptional signals, cis
elements in the 3'UTR of -As serve as signals for mRNA decay.
At the transcriptional level, the mouse and human mdr promoten are significantly
different. At the pst-transcriptionai level, the key elements of mRNA stability predominantly
reside within the 3'UTR. The 3'UTR of the human MDRl and the rat mdrl b exhibits extensive
sequence homology. This conservation of sequence suggests an important biological function.
Indeed, the mdrlb (class II rnultidnig resistance gene in m o w ) is expressed at very low levels
in nonnai liver. However, a number of snidies has show that mdrlb becomes overexpressed
in the liver during cholestasis (2 13), regeneration following partial hepatectomy ( 17 1, 2 14), in
p n m w hepatocytes grown in culture, and in chemically-induced hepatocarcinogenesis (164,
165, 2 15, 2 16, 2 18) and that the majority of these events rely on mRNA stability as the key
reguiator of mdrlb gene expression (22, 220). If stabilization of mdrlb mRNA is mediated by
sequences in its 3'UTR, this has important implications in our understanding of the
development of multidrug resistance in prirnary liver cancers in humans.
V. SUMMARY AND CONCLUSIONS
These shidies have show that the 157-nt MDRB region of the MDRl 3'UTR is the site
of major protein binding. This region spans bases 4421-4577 of the MDRl rnRNA. When its
ability to bind AU-binding proteins is compared to that of the c-mye ARE (termed Myc ARE),
the MDRB exhibited lower ability to compte for AU-binding proteins than the Myc ARE.
Vsing antisense oligonucieoudes, sequences which piay a roie in prorein binding were nirther
narrowed down to bases 44704487 (ODN6 target site) and 4531-4548 (ODN13 target site).
These sequences contain highly U-nch regions compared to other sequences within the MDRB
region. RNA secondary structure predictions of Myc ARE and MDRB revealed that the Myc
ARE is less stable (-16.2 kcaVmo1) than that of the MDEW (-26.6 kcaYmo1). The Myc ARE
and the MDRB RNA structures di fier in t e m of the strength of the structures as well as in the
presence of stem-loop motifs. It is possible that the stability of the MDRB stnicture is involved
in determining the RNA-protein interactions in this region by lirniting the accessibility of the
binding sites. The combination of sequence and strength of stnicture may allow for alterations
in RNA-protein interactions by promoting a difference in the recognition of these proteins for
the AREs and therefore influence the way the AREs, along with the AU-binding proteins,
fiction to determine degradation or stabilization of the mRNA.
VI, FUTURE PERSPECTIVES
The identity of the binding proteins detected in W cross-linking experirnents cm be
detemiined in several ways. For example, RNA gel supenhift analysis using antiibodies to
AUFl or HuR cm be carrieci out. Purification can be done using the method of Wilson et al.
(222), which combines the use of h e p a ~ and poly (U) affinity chromatography. Purification
can be doae using biotinyiated RtriA probes of MDRB anci Myc ARE. Biotin-ùlp can be
incorporated by in vitro transcription of MDRB, shorter segments of MDRB which ùicludes the
proposed binding sites on the MDE2E3, and Myc ARE RNA. Altematively, one could
incorporate the ATP analog (@-(6-arninohexyl)~~~ during the transcription reaction and cany
out the biotinylation with a biotin-tagged cross-linking ragent. Separation of the specific
RNA-buiding proteins is then achieved by association of the biotinylated RNA probe to
streptavidin-agarose matrix before, during or imrnediately afier the binding reaction (86, 222).
Another approach is through isolation of the 42 kDa and 80 D a protein bands by SDS-PAGE,
trypsin digestion and mass spectrometric analysis. This method will depend on how isolatable
the bands are cornpared to other proteins prescnt in the RSW.
The role of the sequences and stnictures that we have identified could be addressed by
mutating these sites (work in progress, see Appendix). Following mutational analyses of the
potential binding regions for RNA-binding proteins in this study, the mie test for the biological
function of these sequences and their tram-acting factors in mediating MDRl mRNA stability
is in ce11 culture studies. Since the regions identified in this study bind RNA-binding proteins
with low flinity compared to the Myc ARE, then deletion of these regions, may not show large
ciifferences in the MDRl mRNA half-Me. Therefore, the mutant mRNA should be assessed in
a "nomial" non-transformed cell. A cornparison of fians-acting factors fiom tumor and
"normal" ce11 lines may also be investigated to detemine if these proteins are different.
In addition, since the mdrlb has been shown in vivo to be stabilized by carcinogens,
then the experiments carried out in this thesis can aiso be employed using mdrlb 3'UTR as
probe and mouse liver extracts to determine if the RNA-protein interactions which occur (i.e.
iow affinity 'binding, ü-rich binoing regions, similar nam-acting factorsa?j are similar to those
detected using the human MDRl 3'UTR. Using such an approach, extracts from normal liver
and from liver tumon could be cornpared. This is usefiil for several reasons. First, we already
have prior knowledge of an in vivo mechanism of mdrlb mRNA stabilization in mice. Second,
the 3'UTRs of MDRl and mdrlb are highly homologous.
Other methods cm also be used to map the binding sites of these proteins. Indeed,
many investigators complement structural predictions (using the Zuker algonthm to fold the
RNA) with hydroxyl-radical RNA footprinting studies and site-directed mutagenesis studies to
confirm RNA structure and binding sites (244,245). In addition, one can M e r subdivide the
MDRB region into smaller segments to confirm the protein binding sites.
In summary, the findings in this thesis contribute to our knowledge of MDRl pst-
transcriptional regulation and serve as a foundation for future circumvention of multidrug
resistance. The design of ODNs that will elicit specific effects by promoting the rapid
destabilization of the MDRl mRNA can be used either in those tissues, which have MDRl
mRNA stability as their primary mechanism of Pgp overexpression, or as a combinatonal
treatment dongside other anti-MDR therapies.
Prokipcak, R. D., A. Raouf, and C. Lee. The AU-rich 3'untranslated region of human MDR 1 M A is an ineficient mRNA destab ilizer. Bioclhem i c d cind Bivphysical Research Cammunications 261: 627-634 (1999).
Motomum, S., T. Motoji, M. Takanashi, Y.-H. Wang, H. Shiozaki, 1. Sugawara, E. Aikawa. A. Tomida, T. Tsuruo, N. Kanda, and H. Mizoguchi. Inhibition of P- glycoprotein and recovery of drug sensitivity of human acute leukemic blast calls by muitidrug resistaace pne (mdi 1 j antisense oligonucleotides. Blood 9: 3 163-3 1 7 1 (1998).
Alahari, S. K., R Delong, M H. Fisher, N. M. Dean, P. Viliet, and R. L. Juliano. Novel chernically rnodified oligonucleotides provide potent inhibition of P-glycoprotein expression. The J o u d of Pharmacology and Experimental Therupeutics 286: 4 19428 (1998).
Malyankar, U. M., S. R Rittling, A. Cornor, and D. T. Denhardt. The mitogen- regulated protein/proliferin transcript is depded in prirnary mouse embryo fibroblast but not 3T3 nuclei: altered RNA processing correlates with immortalization. Prucmlings uf (hc Ndiond Acczdeny of Sciences LISA 91 : 3 3 5-33 9 1 1 994).
Urlaub, G., P. J. Mitchell, J. Ciudad, and L. A. Chasin. Nonsense mutations in the di hy dro fola te reductase p n e affect RNA process hg. ~bfoirnilur trnd Cr lltrltir Biologv 9: 2868-2880 (1989).
larmolowski, A., W. C. Boelens, E. izaurralde, and 1. W. Mattaj. Nuclear export of different classes of RNA is mediated by specific factors. Jozitnd ofCeil Biologv 124: 627-635 ( 1994).
Johnson, T. R, S. D. Rudin, B. K. Blossey, J. Ilan, and J. Ilan. Newly synthesized RNA: simultaneous masurement in intact cells of transcription rates and RNA stability of insulin-like growth factor 1, actin, and albumin in growth-hormone-stimulated he patocytes. Proceel fings of lhe Nariond Acczdenzy a f Sciences CiSA 88: 52 87-529 1 (199 1).
Savant-Bhomale, S., and D. W. Cleveland. Evidence for instability of mRNAs containine AULTUA motifs mediated through translation-dependent assembly of a >20S degradation cornplex. Genes and Developmeni 6: 1927- 1939 ( 1992).
Williams, D. L., M. Sensel, M McTigue, and R Binder. Hormonal and Developmentai regdation of mRNA turnover, in Control of Meseengr RNA slnbililv (J. Belasco and G. Brawerman, eds.). Academic Press, Inc., San Diego, 16 1- 197 (1993).
10. St. Johnston, D. The intracellular localktion of messenger RNAs. Cell 81 : 16 1- 170 ( 1995).
Il.
12.
Curtis, D., R Lehmann, and P. D. Zamore. Translational regulation in development Cd2 81: 171-178 (1995).
Wickens, M., J. Kimble, and S. Stnckland. Translational control of developmental decisions. in Tr<inskifio)nd ontrol (J. W. B. Hershiey, M. B. Mathews and N. Sonenberg, eds.). Cold S p ~ g Harbor Laboratory Press, New York, 4 1 1450 (1996).
Wisdom, R., and W. Lee. Translation of c-myc mRNA is required for its p s t - transcriptional regdation d u ~ g myopnesis. Jozcmd of BiologiccrI Chernisi- 265: 190 IS-l9OSl (1990).
Damer, S., and M. J. Lohse. Ce11 type-specific regulation of beta2-adrenoceptor mRNA b y agonists. Ezrropem Jotcmd of Phcirmcrcology 33 1 : 73-78 ( 1997).
Hadcock, I. R., &Y. Wang, and C. C. Malbon. Agonist-induced destabilization of beta-adrenergic receptor mRNA. At tenuat ion of g lucocortico id- induced upregulation of beta-adrenergic recepton. Journal of Biological Chernia. 264: 19928-19933 ( 1 989).
Mitchusson, K., B. C. Blaxall, A. Pende, G. Brewer, and J. D. Port. Agonist-mediated destabilization of human beta 1 -adrenergic receptor mRNA: role of the 3'untrmslated region. Biochernicai and Biophysical Research Communications 252: 357-362 ( 1998).
Danner, S., M. Frank, and M. J. Lohse. Agonist regulation of hurnan beta2-adrenergic receptor mRNA stability occurs via a specific AU-rich elernent. J o i m d ~ ~ ~ B i o h g i c ~ z l Chemistry 273: 3223-3229 ( 1998).
Tittelbach, V., J. N. Volff, J. Giray, D. Ratge, and H. Wisser. Agonist-induced down- regulation of the beta2-adrenoceptor and its mRNA in hurnan rnononuclear leukocytes. Biochernicai Pharmacology 56: 967-975 ( 1998).
Chen, C. A., and A. Shyu. AU-rich elements: characterization and importance in mRNA degradation. Trencis in Biochemicd Sciences 20: 46 5-470 ( 1 99 5).
Schiavi, S. C., J. G. Belasco, and M. E. Greenberg. Regulation of proto-oncogene mRNA stability. Biochirnic<r rf Biup@sic<i Aclci 11 14: 95- 106 (1992).
Hsing, A., D. V. Faller, and C. Vaziri. DNA-damaging aryl-hydrocarbons induce Mdm2 expression via pS3-independent pst-transcriptional mechanism. Jorcmd ofBiologicrri Chemistry 275: 260242603 1 (2000).
ben, B. T., J. H. Trembley, and C. J. Steer. Alterations in mRNA stability dufing rat liver regeneration. Gtrsrroinreslind Liver Physiologv 33: G763-G777 ( 1996).
Decker, C. J., and R. Parker. Mechanisms of mRNA degradation in eukaryotes. Trends in Bioc-hemicnl Sciences 19: 3 36-340 ( 2 994).
Sachs, A. B., and R W. Davis. The poly(A)-binding protein is required for poly(A) shortenhg and 60s ribosomal subunit-dependent translation initiation. CeII 58: 857-867 (1989).
McCarthy, J. E. G., and H. Kollmus. Cytoplasmic mRNA-protein interactions in eukaryotic pne expression. Trends in Biochrrnicwl Sciences 20: 19 1 - 197 ( 1995).
Krecic, A. M., and M. S. Swanson. h W complexes: composition, structure, and function. Ctrveni Opinion in C d Bidogv 1 1 : 363-37 1 ( 1999).
Coutts, M., and G. Braweman. A S'exoribonuclease frorn cytoplasmic extracts of moue sarcoma 180 ascites cells. Biochirniccl el Biophysiccc Acka 1173: 57-62 (1 993).
Coutts, M., A. Krowczynska, and G. T. Brawerman. Protection of &A against nucleases in cytoplasmic extracts of mouse sarcoma ascites cells. Bic~*himi~cc et Biophysica Acta 1 173: 49-56 ( 1993).
Nuss, D. L., and Y. Furuichi. Characterization of the rn7G(S)pppN-pyrophosphatase activity frorn HeLa cells. Jo~irncd cfBiologiccrl Chemislry 252: 28 15-282 1 (1977).
Nielsen, F. C., and J. Chnstiansen. EndonucIeoIysis in the turnover of insulin-like growth factor II mRNA. Jotrmrl of Bioiogicd Chernisr? 267: 19404- 194 1 1 ( 1992).
Coulis, C. M., C. Lee, V. Nardone, and R. Prokiprak. Inhibition of c-myc expression in cells by targeting an RNA-protein interaction using antisense oligonucleotides. Mofecufar Phamcology 57: 485-494 (2000).
Muhlrad, D., and R Parker. Premaaire translationai termination triggers mEWA decapping. Nariire (London) 370: 578-58 1 ( 1994).
Klausner, R. D., T. A. Rouault, and J. B. Harford Reguiating the fate of M A : the control of cellular uon r~etabolism. Cell72: 19-28 (1993).
Ross, J. mRNA stability in marnrnalian cells. Micro6 iological Reviews 59: 423-450 (1995).
Furuichi, Y., A. LaFimdra, and A. J. Shatlcin 5'-terminai structure and &A stability. Narzcre nondon) 266: 235-239 (1977).
McCrae, M. A., and H. R. Woodland. Stabiliîy of non-polyadenylated viral mRNAs injected into frog oocytes. Eirropem Jo~rrnnl o/Biochemis~y 116: 467-470 (1 98 1).
Peltz, S. W., G. Brewer, G. Kobs, and J. Ross. Substrate specificity of the exonuclease activity that degrades H4 histone mRNA. Jo~rrncil of Bioiogictd Chernisr- 262: 9382- 9388 (1987).
Shimotohno, K., Y. Kodama, J. Hashimoto, and K. Miura. importance of the S'-terminal blocking structure to stabilize mRNA in eukaryotic protein synthesis. Proceeclings of the National Academy of Sciences USA 74: 2734-2738 (1977).
Aharon, T., and R. J. Schneider. Selective destabilization of short-lived mRNAs with the granulocyte-macrophage colony-stimulating factor AU-rich noncoding region is mediated by a cotranslational mechanism. Mdeculrr and Cellular Biology 13: 1 97 1 - 1980 (1993).
Bonnieu, A., M. Piechaczyk, L. Marty, M. Cuny, L M . Blanchard, P. Fort, and P. Jeanteur. Sequence determinants of c-myc mRNA turnover: uifluence of 3' and 5' non- coding regions. Oncogene Research 3: 155- 166 ( 1988).
Jones, T. R., and M. D. Cole. Rapid cytoplasrnic turnover of c-myc *A: requirement of the Yuntranslated sequences. iL.lofecirirrr imi1Celliritrr Biolugv 7 : 4513-4521 (1987).
Piechaczyk, M., J.-Q. Yang, J. M. Blanchard, P. Jeanteur, and K. B. Marcu. Postvanscnptional mechanisms are responsible for accumulation of truncated c-nyc mRNAs in murine plasma ce11 tumon. Cell42: 597-598 (1985).
Rabbitts, P. H., A. Forster, M. A. Stinson, and T. H. Rabbitts. Truncation of exon 1 from the c-mvc gene results in prolonged c - q c mRNA stability. EMBO Jotrrnd 4: 3727-3733 (1985).
Ray, D., P. Meneceur, A. Tavitian, and J. Robert-Lezenes. Presence of a c-myc transcript initiateci in intron 1 in Fnend erythroleukemia cells and in other murine ce11 types with no evidence of c-myc gene rearrangernent. Molecular and CelZui~r Biology 7: 940-945 ( 1 987).
Chen, C.-Y ., T.-M. C hen, and A.-B. Shyu. Interplay of two fwictionally and stnicturally distinct domains of the c$os AU-rich elernent specifies its &A-destabilizing function. Molecuhw and Cellular BioIogy 14: 4 16-426 ( 1994).
Chen, C.-Y., and A. B. Shyu. Selective degradarion of early-response-gene mRNAs: functionaly analyses of sequence features of the AU-rich elements. hloleczritn tind Ceiiulat Btologv 14: 847 1 - 8482 ( 1994).
Geoghegan, T. E., and L. McCoy. Biogenesis and ce11 cycle relationship of poly(A)- actin mRNA in mouse ascites cells. Eprimenld C d Resrnrch 162: 175-1 82 (1986).
Kaufmann, Y.. C. Milcarek, H. Berissi, and S. Penman. HeLa ceU poly(A)- mRNA codes for a suhset of po ly (~)+ mRNA-directed proteins with actin as a major produa. Proceedings of the National Academy of Sciences LISA 74: 480 1-4805 (1977).
Krowcynska, A., R. Yenofsky, and G. Braweman. Regulation of messenger RNA stability in mouse erythroleukemia ceus. Joiîrnd of bfolec~îlw Biology 181: 2 13-239 j 1985 j.
Shyu, A.-B., J. G. Belasco, and M. E. Greenberg. Two distuict destabilizing elements in the c$os message û igg r deadenylation as a fint step in rapid mRNA decay. Genes m d Development 5: 22 1-23 1 ( 199 1).
Lowell, J. E., R. Rudner, and A. B. Sachs. 3'-UTR-dependent deadenylation by the yeast poly (A) nuclease. Grnes <rnd Dtyrluprnrnr 6: 427-432 ( 1992).
Sachs, A. B., and R. W. Davis. Translation initiation and ribosomal biogenesis: involvement of a putative rRNA helicase and rpL46. Science 247: 107% 1079 ( 1990).
Sachs, A. B., R. W. Davis, and R. D. Komberg. A single domain of yeast poly(A)- binding protein is necessary and sufficient for RNA binding and ce11 viability. lMolecular and Cellular Biology 7: 3268-3276 (1987).
Sachs, A. B., and J. A. DeardoK Translation initiation requires the PAB-dependent poly (A) ribonuclease in y east. C d 70: 96 1-973 ( 1 992 ).
Wang, Z., N. Day, P. Trifillis, and M. Kiledjian. An mRNA stabilty complex functions with Poly (A)-binding pro tein to stabilize mRNA in vilro. 12.hluml<rr crnd Cellz~lw Biologv 19: 452-4560 (1999).
Jacobsen, A. Poly(A) metabolism and translation: the closed loop model, in Tmnsltrrionul conrral (J. Hershey. M Mathiews and N. Sonenberg. eds.). Cold Spring Harbor Laboratory Press, New York 451-480 (1996).
Shatkin, A. M A cap binding proteins: essential factors for initiating translation. Cell 24: 223-224 (1985).
Shyu, A.-B., J. G. Belasco, and M. E. Greenberg. The c-fos transcript is targeted for rapid decay by two distinct mRNA depdation pathways. Grnes und Dmelopmenr 3: 60-72 (1989).
Hemck, D. J., and J. Ross. The half-life of c-myc mRNA in growing and s e m stimulated cells: influence of the coding and 3'untranslated regions and role of ribosome translocation. Molecular and Cellular Biology 14: 2 1 19-2 12 8 ( 1994).
Rajagopalan, L. E., and J. S. Malter. Regulation of eukqotic messenger RNA turnover. Progress in NttcIeic Acids Resairch mtd bfc~lucirltrr Biolug~ 56: 257-283 ( 1997).
Chen, C.-Y., Y. Yoy and A.-B. Shyu Two cellular proteins bind specifically to a purine-rich sequence necessary for the destabilization Function of a c-Fos protein- coding region determinant of rnRNA instability. Molecular and Cellular Llrology 12: 5748-5757 (1992).
Wisdom, R., and W. Lee. The protein-coding region of c-myc mRNA contains a sequence that specifies rapid mRNA turnover and induction of pro te in sy nt hais inhibitors. Genes and Developmeni 5: 232-243 ( 199 1).
Pesole, G., G. Fiormarino, and C. Saccone. Sequence analysis and compositional properties of' untranslated regions of human mRNAs. Gene 140: 2 19-225 ( 1994).
Chung, S., M. Eckrich, N. Perrone-Binozero, D. T. Kohn, and H. Fumeaux. The Elav- like proteins bind to a conserved regdatory elernent in the 3'-untranslateci region of GAP-43 rnRNA. Jomal of Biologicai Chemistw 272: 6593-6598 ( 1997).
Irwin, N., V. Baekelandt, L. Goritchenko, and L. 1. Benowitz. Identification of two proteins that bind to a pyrimidine-rich sequence in the 3'-untnuislated region of GAP43 rnRNA. Nucleic Acidî Resemch 25: 128 1-1288 (1997).
Alterman, R.43. M., S. Ganguly, D. H. Schuize, W. F. Marzluff, C. L. Schildkraut, and A. 1. Skoultchi. Cell cycle regulation of mouse H3 histone mRNA metabolism. Mufecufar and Ceifufar Biology 4: 123- 132 ( 1984).
Baumbach, L. L., G. S. Stein, and J. Stein. Regulation of human histone gene expression: transcriptional and posttninscriptional control in the coupling of histone messenger RNA stability with DNA replication. Biochemistry 26: 6 178-6 1 87 ( 19 87).
Hams, M. E., R Bohni, M. H. Schneiderman, L. Ramarnurthy, D. Schurnperli, and W. F. Marzluff. Regulation of histone mRNA in the unpemirbed cell cycle: evidence suggesting control at two pst-transcriptional steps. Molecular and Cellular Biology 11: 24 16-2424 (199 1).
HofThann, i., and M. L. BUnstiel. Ce11 cycle-dependent regulation of histone precunor mRNA process h g by modulation of U7 snRNA accessibility . Nt~ïzmKondon) 346: 665-668 (1990).
Luscher, B., and D. Schurnperli. RNA 3'processing regulates histone mRNA levels in a rnarnmalian ce11 cycle mutant. A proussing factor becomes Iimiting in G1-arrested cells. E l 5 0 Journal 6: 172 1- 1726 ( 1987).
Levine, B. J., N. Chodchoy, W. F. Marzluff, and A. 1. Skoultchi. Coupling of replication type histone mRNA to DNA synthesis requires the stem-loop sequence at the 3'end of the mRNA. Proceedings of the National Academy of Sciences USA 84: 6189-6193 (1987).
Luscher, B., C. Stauber, R. Schindler, and D. Schurnperli. F a i t h l cell cycle regulation of a recombinant rnosue histone HJ gene is controlled by sequences in the 3'-terminal part of the gene. Proceedings of the National Academy of Sciences USA 82: 4389-4393 (1 985).
Pandey, N. B., and W. F. MarzluR The stem-loop structure at the 3'end of histone mRNA is necessary and suffcient for regdation of histone mRNA stability. khlenrlw and Cellulur Bio fogy 7: 4557-4559 ( 1987).
Harford, J. B., T. A. Rouault, and R. D. Klausner. The control of cellular iron homeostasis. in Iron mekrbofism in h r d h md diiseose. (J. H. Brock. J. W. Halliday. M. J. Pippard and L. W. Powell, eds.). The W. B. Saunders Company, Philadelphia, 123- 149 (1994).
Scheper, W., D. Meinsrna, P. E. Holthuizen, and J. S. Sussenback. Long-range RNA interaction of two sequencs elements for endonucleoly tic cleavage of hurnan insulin- like growth factor II rnRNAs. Molemfw and Cellular Biology 15: 235-245 (1995).
Caput, D., B. Beutler, K. Hartog, R. Thayer, S. Brown-Shimer, and A. Cerarni. Identification of a common nucleotide sequence in the 3'-untranslated regions of mRNA molecules speci fy ing inflammatory mediaton. Proceedings of the National Academy of Sciences USA 83: 1670-1674 (1986).
Xy N., C. A. Chen, and A. Shyu. Modulation of the fate of cytoplasmic mRNA by AU- rich elernents: key sequence features controiling mRNA deadenylation and decay. Mofecufar and Ceffufar Biology 17: 46 1 1-462 1 (1 997).
Xy N., P. Lofiin, C. A. Chen, and A. Shyu. A broader role for AU-rich element- mediated mRNA turnover revealed by a new transcriptional pulse strateW. Mrckic Acidr Research 26: 558-565 (1998).
Peppel, K., J. M. Vinci, and C. Baglioni. The AU-rich sequences in the 3'untramlated region mediate the increased turnover of interferon mRNA induced by glucocorticoids. Joumaf ofErpetimentaf Medicine 173: 349-355 (1991).
Treisman, R Transient accumulation of c-fos RNA following senmi stimulation requires a conserved 5' elerneni and crbs 3' sequences. Cell42: 889-902 (1985).
81. Shaw, G., and R Kamen. A conserveci AU sequence fiom the 3'untranslated region of GM-CSF mRNA mediates selective mRNA degradation. Ce21 46: 659-667 (1986).
Maurer, F., M. Tiemey, and R. L. Medcalf An AU-rich sequence in the 3'-UTR of plasminogen activator inhibitor type 2 (PAX-2) mRNA promotes PAL2 mRNA decay and provides a buiding site for nuclear HuR. Nucleic Acrds Research 27: 1664-1673 (1999).
Bloch, K. D. Regulation of endothelial NO synthase mRNA stability: RNA-binding proteins crowd on the 3'-untranslated region. Circvdtiiion Resecwch 85: 653-65 5 ( 1999).
Zubiaga, A. M., J. G. Belasco, and M. E. Greenberg. The nonamer W A W A U U is the key AU-tich sequence motif that mediates mRNA degradation. h.fulecr12or tind Cellular Biolugy 15: 22 19-2230 ( 1995).
Lagnado, C. A., C. Y. Brown, and G. J. Goodall. AUUUA is not sufficient to promote poly(A) shortening and degradation of an mRNA: the functional sequence within AU- rich elements may be L'UAUUUA(lJ/A). Molectrlar and Cellular Biology 14: 7984- 7995 (1994).
Bla'üill, B. C., A. C. Pellett, S. C. Wu, A. Pende, and J. D. Port. Purification and characterization of f3-adrenergic receptor mRNA-binding proteins. Jc)~ imi l qf Biological Chemistry 274: 42904297 (2000).
Tian, D., D. Huang, C. Brown, and R A. Jungmann. Protein kinase A stimulates binding of multiple proteins to a U-rich domain in the 3'untranslated region of lactate dehydrogenase A mRNA that is required for the regulation of mRNA stability . Journal uf Biologicul Chemisrry 2 73: 28454028460 ( 1998).
Liu, I., X. Shen, V. Nguyen, G. Kunos, and B. Gao. al adrenergic agonist induction of
1 Y f 7 'C@! mRhTA stabiliq in tmnsfectzd He*? cells correlûtes witb the incraseci PA binding of an AU-rich element binding factor. Journul of Biologicul Chemisfry 275: 1 18.16- I 185 1 (2000 j.
Siomi, H., and 0. Dreyfiiss. RNA-buiding proteins as regulatoa of gene expression. Cmenf Opinion in Genetics and BeveIopment 7: 345-3 53 ( 1 997).
Cusack, S. RNA-protein complexes. Current Opinion in Structural Biology 9: 66-73 (1999).
Hew, Y., C. Lau, 2. Grzelczak, and F. W. Keeley. Identification of a GA-rich sequence as a protein-binding site in the 3'-untranslated region of chicken elastin mRNA with a potential role in the developmental regulation of elastin mRNA stability. Journal of Biological Chemislry 275: 24857-24864 (2000).
92. Geneste, O., F. Wall i , and M. A. Lang. Identification and characterizaiion of a 44 kDa protein that binâs specifically to the 3'-untranslateci region of CYP2a5 mRNA: inducibility , subcellular distribution and possible role in rnRNA stabilization. Bioc.hemicd Jolrrncrl313: 1029-1037 (1 996).
93. Tilloy-Ellul, A., F. Raffalli-Mathieu, and M. A. Lang. Analysis of RNA-protein interactions of mouse liver cytochrorne P4502A5 mRNA. Biochernicd Jorirnd 339: 695-703 (2999).
94. Mathisen, P. M., J. M. Johnson, J. A. Kawczak, and V. K. Tuohy. Visinin-like protein (VILP) is a neuron-specific calcium-dependent double-stranded RNA-binding protein. Journal of Biological Chemistry 274: 3 1571-3 1576 ( 1999).
95. Lewis, T., C. Gueydan, G. Huez, J. 'ïoulmé, and V. Kruys. Mapping of a minimal AU- rich sequence required for lipopolysaccharide-induced bhding of a 55-kDa protein on tumor necrosis factor-a mRNA. Journal of Biological Chemistry 273: 1 3 78 1 - 1 3 786 (1998).
96. Qi, C., and P. H. Pekda. nie influence of inRNA stability on glucose tramporter (GLUTI) gene expression. Biochemical and Biophysicaf Research Communications 263: 265-269 ( 1999).
97. Zaidi, S. H., R. Denman, and J. S. blairer. Multiple protems inrenicr at a unique cis- element in the 3'-untranslated region of amyloid precursor protein mRNA. J o u d of Biofogica/ Chemistry 269: 24000-6 ( 1994).
98. Zaidi, S. H., and J. S. Malter. Nucleolin and heterogeneous nuclear ribonucleoprotein C proteins specifically interact with the 3'-untranslated region of amyloid protein precursor mRNA. J o d of Biological Chemistry 270: 17292- 17298 (1 995).
99. Constable, A., S. Quick, N. K. Gray, and M. W. Hentze. Modulation of RNA-binding activity of a regulatory protein by iron in vi1ro:switching between enzymatic and genetic hct ion? Proceedings of the National Academy of Sciences LISA 89: 4 5 5 4 4 5 8 (1992).
100. Hentze, M. W., and P. Argos. Homology between IRE-BP, a regulatory RNA-binding protein, aconitase. and isopropylmalate isomerase. Nircieic Acids Resemch 19: 1739- 1740 (1991).
101. Bernstein, P. L., D. J. Herrick, R. D. Rokipcak, and J. Ross. Control of c-myc mRNA half-life in vilrn by a protein capable of binding to a coding region stability determinant Genes and Datelopment 6: 642-654 ( 1992).
102. Rokipcak, R D., D. J. Hemck, and L Ross. Purification and properties of a protein that binds to the C-terminai coding region of human ~ m y c mRNA. J o m d of Biologicd Chemistry 269: 926 1-9269 (1994).
Gingras, A L , B. Raught, and N. Sonenberg. eIF4 initiation factors: effectors of M A recniitment to ribosomes and regdators of translation Anntctrl Reriew of Biochemisîry 68: 9 13-963 (1999).
Levine, T. D., F. Gao, P. H. King, L. G. Andrews, and J. D. Keene. Hel-NI: an autoimmune RNA-binding protein with specificity for 3'uridylate-rich untranslated regions of growth factor mRNAs. Molecular and Cellular Biology 13: 3494-3504 ( 1 993).
Ma, W.-J., S. Cheng, C. Campbell, A. Wright, and H. Furneaux. Cloning and characterization of HuR. a ubiquitously expressed Elav-like protein. Jotrrnd of Btological Chemistry 271 : 8 144-8 15 1 ( 1996).
Chung, S., L. Jiang, S. Cheng, and H. Fumeaux. Purification and properties of HuD, a neuronal RNA- binding pro tein. Jorcmi of Biologicd Chemisfy 271 : 1 1 5 1 8- 1 1 524 ( 1996).
Myer, V. E., and I. A. Steitz. Isolation and characterization of a novel, low abundance hnRNP protein: AD. RNA 1: 171-182 (1995).
Hamilton, B. J., E. Nagy, J. S. Malter, B. A. Arrïck, and W. F. Rigby. Association of heteroeeneous nuclear nbonucleoprotein A 1 and C proteins with reiterated AULTUA sequences. Journal of Biological Chemistry 268: 8881-8887 (1993).
Nagy, E., and W. F. Rigby . Glyceraldehyde-3-phosphate dehy drogenase selectively binds AU-rich RNA in the NAD(+)-binding region (Rossmann fold). Jolrmd of Biological Chernistry 270: 2755-2763 ( 1995).
Nakagawa, J., H. Waldner, S. Meyer-Monard, J. Hofsteenage, P. Jeno, and C. Moroni. AUH? a gene encoding an AU-specific RNA binding protein with intrinsic enoyl-CoA hydratase activity. Proceedings of the National Acaderny of Sciences USA 92: 205 1- 2055 (1995).
Brewer, G. An A+U-rich element RNA-binding factor regulates c-mye mRNA stability in viiro. Molecthr und CeiItiI~~r Biology 1 1 : 2460-2466 (1 99 1).
Bohjanen, P. R, B. Petryniak, C. H. June, C. B. Thompson, and T. Lindsten. An inducible cytopiasmic factor (AU-B) binds selectively to AULnrA multimen in the 3'untranslated region of lymphokine mRNA. Molecular and CelZziIar Biology 11: 3288- 3295 (1991).
Myer, V. E., X. C. Fan, and J. A. Steitz Identification of Huit as a protein hplicated in AüüüA-mediated mRNA decay. EU30 Joznnd 16: 2 130-2 139 (1997).
Gillis, P., and J. S. Malter. The adenosine-uridine binding factor recognizes the AU-rich elements of cytokine, lymphokine and oncogene mRNAs. Joirmd of Biologicol Chemistry 266: 3 172-3 177 (199 1).
Rajagopalan, L. E., and J. S. Malter. Modulation of granulocyte-macrophage colony- stimulating factor mRNA stability in vdro by the adenosine-uridine binding factor. Journal of Biological Chemistry 269: 23 882-23888 ( 1994).
Nakagawa, J., and C. Moroni. A 20-amino-acid autonomous RNA-binding domain contained in an enoyl-CoA hydratase. Etrroprtln Jotrmrl of Biochernis1r-y 244: 890-899 ( 1997).
Kiledjian, M., C. DeMaria, G. Brewer, and K. Novick. Identification of AUFl (Heteropneous Nuclear Ribonuclaoprotein D) as a Cornponent of the a-globin mRNA stability complex. Molecdar and Cellular Biology 17: 48704876 (1997).
Katz, D. A., N. G. Theodorakis, D. W. Cleveland, T. Lindsten, and C. B. Thompson. AU-A. an RNA-buidhg activity distinct from hnRNP A l _ is selective for AUWUA repeats and shuttles between the nucleus and the cytoplasm. Nucleic Acidr Research 22: 238-246 ( 1994).
Bohjanen, P. R., B. Petryniak, C. H. June, C. B. Thompson, and T. Lindsten AU RNA- binding factors dSer in iheir binding specificities and affinities. Jo~rrnd of Bioi~yicxil Chernist?y 267: 6302-6309 (1992).
Port, J. D., L.-Y. Huang, and C. C. Malbon p-Adrenergic agonists that down-regdate receptor mRNA upre.gulate a M, 35,000 protein(s) that selectively binds to fl- adrenergic receptor mRNAs. Journal of Biological Chemistry 267: 24 103-24 108 (199Sj.
Zhang, W., B. J. Wagner, K. Ehrenrnan, A. W. Schaefer, C. T. DeMaria, D. Crater, K. Dehaven, L. Long, and G. Brewer. Purification. characterization, and cDNA cloning of an AU-nch element RNA-binding protein, AUF 1. Mdecular and L'eflufur Biology 13: 7652-7665 (t 993).
Gao, F. B., C. C. Carson, T. Levine, and J. D. Keene. Selection of a subset of rnRNAs from combinatorial 3'untranslated region libraries ushg neuronal RNA-binding protein Hel-NI . Proceedings of the Natzod Academy of Sciences USA 91 : 1 1207-1 12 1 1 (1994).
Good, P. J. A conserved family of Elav-like genes in vertebrates. Proceedings of the NdiondAcc~tieniy ofSciences CISA 92: 45574561 (1995).
Gao, F. B., and J. D. Keene. Hel-Nl/Hel-N2 proteins are bound to poly(~)+ mRNA in granular RNP structures and are hplicated in neuronal differentiation. Jot~rnol -Ce21 Science 109: 579-589 (1996).
Abe, R., E. Sakashita, K. Yamamoto, and H. Sakamoto. Two different RNA binding activities for the AU-rich element and the poly(A) sequence of the moue neuronal protein mHuC. Nucleic Acids Research 24: 4895-490 1 (1996).
Ma, W.-J., S. Chung, and H. Furneaux The Elav-like proteins bind to AU-rich elernents and to the polv(A) tail of mRNA. NzicIeic Acids Reseurch 25: 3564-3569 ( 1997).
lain, R. G., L. G. Andrews, K. M. McGowan, P. H. Pekala, and J. D. Keene. Ectopic expression of Hel-NI. an RNA-binding protein increases glucose tramporter (GLUTI) expression in 3T3-L 1 adipocytes. Moledur and Cellular Biology 17: 954-962 (1997).
Dreyfuss, G., M. J. Matunis, S. Pifioi-Roma, and C. G. Burd. hnRNP proteins and the biogenesis of rnRNA. Annlwi Rrvirw of Biochmisrn, 62: 289-32 1 ( 1993).
Swanson, M. S. Functions of nuclear pre-mRNA/mRNA binding proteins, in Pre-mRNA processing (A. Lamond. ed.). Springer-Verlag. Berlin. 17-33 ( 1995).
McAfee, J. G., M. Huang, S. Soltaninassab, J. E. Rech, S. Iyenger, and W. M. LeStourgeon. The packaging of pre-mRNA. in Etrkccqwric mRNA Processitg (A. R- Krainer, ed.). IRL press at Oxford University Press, Oxford, 68- 102 ( 1997).
Rajagopalan, L. E., C. J. Westmark, J. A. larzernbowski, and J. S. Malter. h n W C increases a m y loid precmor protein (APP) production by stabilizing APP mRNA. Nucleic Acids Research 26: 34 18-3423 (1998).
DeMaria, C. T., and G. Brewer. AUFI binding a f i i t y to A+U-rich elernents correlates with rapid mRNA depdation. Jutimcd of Biohgiccl Chemisfn, 271: 12 179- 12 184 ( 1996).
Shih, S.-C., and K. P. Claffey. Regulation of human vascular endothelial growth factor mRNA stability in hypoxia by heterogeneous nuclear ribonucleoprotein L. Jo~rrnd of Biologica/ Chemistry 274: 1359- 1365 (1 999).
Wagner, B. J., C. T. DeMaria, Y. Sun, G. M. Wilson, and G. Brewer. Structure and genomic organization of the human AUFl gene: alternative pre-mRNA splicing generates four protein isoforms. Genomics 48: 195-202 ( 1998).
Pende, A., K. D. Tremmel, C. T. DeMaria, B. C. Blaxail, W. A. Minobe, J. A. Sherman, J. D. Bisopano, M. R Bristow, G. Brewer, and J. D. Pon Regulation of the mRNA- binding protein AUF l by activation of the beta-adrenergic receptor signal transduction pthway . JozmnZ n/Biologicd C h islry 271 : 8493 -850 1 ( 1 996).
Bwby, I. S., S. Lee, P. van Winkie, C. T. DeMaria, G. Brewer, and M. S. Cairo. Increased granulocyte-macrohage colony-stimulating factor mRNA instability in cord versus adult mononuclear cells is translation-dependent and associated with increased levels of A+ U-rich binding factor. Blood 88: 2889-2897 ( 1996).
Sirenko, O. I., A. K. Lofquist, C. DeMaria, J. S. Moms, G. Brewer, and J. S. Haskill. Adhesion-dependent regulation of an AW-rich element-binding activity associated with AUF 1. Molecuiar and Cellular Bzology 17: 3 898-3906 (1 997).
Kellen, J. A. Mechanisms of multidnig resistance, in Alternative mechanism of rndfidrtrg resisftrncr in nrncer ( J . A. Kellen. ed.). Birkhauser. Bos ton 1-30 ( 1995).
Cole, S. P. C., L G. Bhardwa, J. H. Gerlach, J. E. Macke, C. E. Gmnt, K. C. Ahquisy, A. J. Stewart. U. Kurze. A. M. V. Duncan. and R. G. Dedey. Over-expression of a transporter gene in a multidmg-resistant human lung-cancer cd1 line. Science 258: 1650-1654 (1992).
Scheper, R. J., H. J. Broxterman, G. L. Scheffer, P. Kaajik, W. S. Dalton, T. H. M. van Heijningen C. K. van Kalken. M. L. Slovak. E. G. E. de Vries. P. van der Valk. C. J. L. M. Meijer, and H. M. Pinedo. Overexpression of a M, 1 10,000 vesicular protein in non- P-çlycoprotein-mediated multidmç resistance. (izncer Research 53: 1475- 1479 ( 1 993).
K~tner , N., J. R. Riordan, and V. Ling. Ce11 swfacr P-glycoprotrin associated with multidrug resistance in mammalian ce11 lines. Science 221: 1285- 1288 (1 983).
Juliano, R. L., and V. Ling. A surface glycoprotein moduiating dnig permeability in Chinese hamster o v q ce11 mutants. Biochimicw el Bioph-vsico Acrtr 455: 152-162 ( 1 976).
Ng, W. F., F. Sarangi, R L. Zastawny, D. L. Veinot, and V. Ling. Identification of memben of the P-glycoprotein multigene family. Molecmhr tind CriIuicw Biology 9: 1224-1232 (1989).
Gros, P., Y. Ben-Neriah, J. Croop, and D. E. Houseman. Isolation and expression of a complementary DNA that coafea multidrug resistance. N < r r m 323: 728-73 1 ( 1986).
Ueda, K., C. Cardarelli, M. M. Goaesman, and 1. Pastan. Expression of a full-length cDNA for the human "MDRl" gene coden resistance to colchicine. doxorubicin and vinblastine. Proceedings of the Niztional Academy of Sciences USA 84: 3004-3008 ( 1987).
Ueda, K., D. P. Clark, C. J. Chen, 1. B. Roninson, M. M. Gottesman, and 1. Pastan. The human rnuitidrug resistance (mdrl) gene. cDNA clonïng and transcription initiatioa Journal of Btological Chemishy 262: 505-508 (1987).
Gros, P., M. Raymond, and D. Housman. Cloning and characterization of mouse mdr genes, in Molocrldc~r and Celhhr Biology of lllii/idnrg resislcrnce in Tmor Ceils (J. B. Roninson, ed.). Plenum, New York, 73-89 (1991).
Juranka, P. F., R. L. Zastawny , and V. L hg. P-glycoprotein: Multidnig resistance and a superfamily of membrane-associated transport proteins. FASEB Jotrmzl 3: 2583-2592 (1989).
Van der Bliek, A. M., F. Baas, T. Ten houte de Lange, P. M. Kooiman, T. Van der VeldeKoerts. and P. Borst. The human mdr3 gene encodes a novel P-glycoprotein homologue and gives nse to alternatively spliced -As in liver. EMBO Journal 6: 3325-333 1 (1987).
Chin, J. E., R. Soffir, K. E. Noonan, K. Choi, and 1. B. Roninson. Structure and expression of the human MDR P-glycoprotein) gene family. .hhlenilur m i Celitriirr Biology 9: 3808-3820 ( 1989).
Sharom, F. J., G. DiDiodato, X. Yu, and K. J. D. Ashbourne. Interaction of the P- elvcoprotein multidmg transporter with peptides and ionophores. Jotrrnol cfBioiogicci1 &misny 270: 10334- 1034 1 ( 1995).
Ambudkar, S. V., 1. H. Lelong, J. Zhang, C. O. Cardarelli, M. M. Gonesrnan, and 1. Pastan. Partial purification and reconstitution of the human multidnig-resistance pump: Chantcterization of the dnig-stimulatable ATP hydrolysis. Proceedings of the National Aacde-, qfSciences C S ' 89: 8472-8476 ( 1992).
Gotîesman, M. M., and 1. Pastan. The multidmg transporter, a double-edged sword. Jotmrl of Biologicctl Chemisln 263: 12 163-12 166 (1988).
Gerlach, J. H., J. A. Endicott, P. F. Juranka, G. Henderson, F. S m g i , K. L. Deuchars, and V. Ling. Homology between P-glycoprotein and a bacterial haemolysin transport protein suggests a mode1 for multidmg resistance. Nature 324: 485-489 ( 1986).
Horio, M., M. M. Gottesman, and 1. Pastan. ATP-dependent transport of Wiblastine in vesicles fiom human rndtidmg-resis tant cells. Procecdings of lhe Nuliond Acmk my of Sciences USA 85: 3580-3584 (1988).
Horio, M., E. Lovelace, 1. Pastan, and M. M. Gottesman. Agents which reverse rnultidrug-resisîance are inhibitors of [3HJvinhlasti~te transport hy isolated vesicles. Biochimica et Biophysica Acta 1106 1: 106- 1 10 (199 1).
Lelong, 1. H., R Padmanabhan, E. Lovelace, 1. Pastan, and M. M. Gottesman ATP and GTP as alternative energy sources for vinblastine tramport by POL70 in KB-VI plasma membrane vesicles. FEBS Letters 304: 256-260 ( 1992).
Fojo, A. T., K. Ueda, D. I. Slamon, D. G. Poplack, M. M. Gottesman, and 1. Pastan. Expression of a multidrug-resistance gene in human tumors and tissues. Proceedings of the National Academy of Sciences USA 84: 265-269 (1987).
Meyers, M. B., B. A. Spengler, T. D. Chang, P. W. Melera, and J. L. Biedler. Gene amplification-associated cytogenetic aberrations and protein changes in vincristine- resistant Chinese hamster, mouse, and human cells. Journu& of Ceil Bioiogy 100: 588- 597 (1985).
Scotto, K. W., 5. L. Biedler, and P. W. Melera. Amplification and expression of genes associated with rnultidrug resistance in mammalian cells. Science 232: 751-755 (1988).
Shen, D. W., A. Fojo, J. E. Chin, 1. B. Roninson, N. Eüchert, 1. Pastan, and M. M. Gottesman. Human multidnig-resistant ce11 lines: increased mdrl expression cm precede gene amplification. Science 232: 643-645 ( 1986).
Chin, K. V., S. Tanaka, G. Darlington, 1. Pastan. and M. M. Gottesman. Heat shock and arsenite increase expression of the multidrug resistance (MDRI) gene in human rend carcinoma cells. Journal of Biologicd Chemisny 265: 22 1-226 ( IWO).
Burt, R. K., and S. S. Thorgeirsson. Coinduction of MDR-1 multidnig resistance and cytochrome P-450 genes in rat liver by xenobiotics. Ju~irnd qf rht. N'rriond Ctrncer Insritute 80: 1383- 1386 (1988).
Bradley, G., R. Sharma, S. Rajalakshrni, and V. Ling. P-glycoprotein expression during turnor progression in the rat liver. Cmcw Resetirch 52: 5 154-5 16 1 ( 1992).
Fairchild, C. R., S. P. Ivy, T. Rushmore, G. Lee, P. Koo, M. E. Goldsmith, C. E. Myers, E. Farber. and K. H. Cowan Carcinogen-induced mdr overexpression is associated with xenobiotic resistance in rat preneoplastic liver nodules and hepatocellular carcinomas. Proceedings of the Nttriontd Actzdemy q f Sciences CSA 84: 770 1 -7705 ( 1 9 87).
Fardel, O., V. Lecureur, A. Corlu, and A. Guillouzo. P-glycoprotein induction in rat livrr epithelial cells in response to acute 3-methylcholanthrene treatment. Binchemiccrl PharmacoZogy 51: 1427-1436 (1996).
Chaudhary, P. M., and 1. B. Roninson. Induction of mutlidrug resistance in human cells by transient exposure to different chemotherapeutic dmgs. Jot~rncd qfNdiunnl Ccmcer Institute 85: 632-639 (1993).
Chin, K. V., S. S. Chauhan, 1. Pastan, and M. M. Gottesman. Regulation of mdr RNA levels in response to cytotoxic dmgs in rodent cens. Cell Growh ïind Dr#benfi<rrion 1: 361-365 (1990).
Marino, P. A., M. M. Gottesman, and 1. Pastan. Regulation of the multidrug resistance gene in regenerating rat liver. Cd1 growih mi differenliot ion 1 : 57-62 ( IWO).
Mickley, L. A., S. E. Bates, N. D. Richert, S. Currier, S. Tanaka, F. Fos, N. Rosen, and A. T. Fojo. Modulation of the expression of a multidmg resistance gene (mdr-IR- glycoprotein) by differentiating agents. J o m d of Bidogicul Chemistry 264: 1803 1- 18040 (1989).
Thorgeirsson, S. S., B. E. Huber, S. Sorrel A. Fojo, 1. Pastan, and M. M. Gottesman. Expression of the multidrug-resistant gene in hepatocarcinogenesis and regenerating rat liver. Science 236: 1 120- 1 122 (1 987).
Uchiumi, T., K. Kohno, H. Tanimura, K. Matsuo, S. Sato, Y. Uchiàa, and M. Kuwano. Enhanced expression of the human multidrug resistance 1 gene in response to W light irradiation. Cell Growth and Diferentiaiion 4: 147- 157 (1993).
Parissenti, A. M., B. R. G a ~ o n , D. J. Villeneuve, A. F. Kirwan-Rhude, and A. Chadderton. Lack of modulation of I ~ D R I gene expression by dominant inhibition of CAMP-dependent protein kinase in doxorubicin-resistant MCR-7 breast cancer cells. In ferncr f km/ Jo~irncrl of C~trncer 82: 893-900 ( 1999).
Rothenberg, M. L., L. A. Mickley, D. E. Cole, F. M. Balis, T. Tsuruo, D. G. Poplack, and A. T. Fojo. Expression of the mdr-1.P-170 gene in patients with acute lymphoblastic leukemia. Blood 74: 1388- 1395 ( 1989).
Ueda, K., I. Pastan, and M. M. Gottesman. Isolation and sequence of the promoter region of the human multidrugresistance (P-glycoprotein) sene. Jozirnd qf Bidoginrl Chemistry 262: 17432-27436 ( 1987).
Silverman, J. A., and D. Schrenk. Hepatic canalicular membrane 4: expression of the multidrug resistance genes h the liver. FASEB Jozmd 1 1 : 308-3 13 ( 19971.
Maniatis, T., S. Goodbom, and I. A. Fischer. Regulation of inducible and tissue- specific gene expression Science 236: 123% 1245 ( 19 87).
Angel, P., M. Imagawa, R. Chiy B. Stein, R. J. Imbra, H. J. Rahmsdork, C. Jonat, P. Herrlich. and M. Karùi. Phorbol ester-inducible genes contain a common ois element recognized by a TPA-modulated trm-acting factor. Cefl49: 729-739 (1 987).
Chin, K. V., S. S. Chauhan, 1. Abraham, K. E. K. Sampson, A. J., M. Wong, B. Schimmer, 1. Pastaa and M. M. Gottesrnan. Reduced mRNA levels for the mutidrug- resistance genes in cAMP-dependent protein kinase mutant ce11 lines. Journal of CelIihr Physiolopy 152: 87-94 (1992).
Chin, K. V., K. Ueda, 1. Pastan, and M. M. Gottesman Modulation of activity of the promoter of the human MDRl gene by Ras and p53. Science 255: 459-462 ( 1992).
Zhou, G., and T. Kuo. Wild-type p53-mediated induction of rat mdrlb expression by the anticancer h g dauaorubicin Jozimzl of Biologicd Chemism 273: 15387-1 5394 (1998).
Comwell, M. M., and D. E. Smith. A signal transduction pathway for activation of the mdrl promoter involves the proto-oncogene c-rnf kinase. Jotrrmrl qf Biologicd Chemistry 268: 15347- 15350 (1993).
Cohen, D., R. L. Piekarz, S. 1. Hsu, R. A. DePinho, N. Carrasco, and S. B. Horwitz. Structural and functional analysis of the mouse mdrlb gene promoter. Joz~rnd qf Biological Chemistry 266: 2239-2244 ( 199 1).
Hsu, S. I., D. Cohen, L. S. Kirschner, L. Lothstein, M. Hartstein, and S. B. Korwitz. Structural analysis of the rnouse mdrla (P-glycoprotein) promoter reveals the basis for differential transcnpt heterogeneity in multidrug resistant 5774.2 cells. Molecular and Cellzilor Biohgv 10: 3 596-3606 ( 1990).
Ikeguchi, M., L. D. Teeter, T. Eckenberg, R. Ganapathi, and M. T. Kuo. Structural and functional analyses of the promoter of the murine rnultidnig resistance gene mdr3/mdrla reveal a negative element containhg the AP-1 binding site. DNA Cell Biologv 10: 639-649 ( 199 1).
Raymond, M., E. Rose, D. E. Housman, and P. Gros. Physical mapping, amplification, and overexpression of the mouse mdr gene family in multidrug-resistant cells. Molecufar onci Cellular Biology 10: 1642- 165 1 (1990).
Arceci, R. J., F. Baas, R Raponi, S. B. Horwitz, D. Housman, and J. M. Croop. Multidmg resistance gene expression is controlled by steroid hormones in the secretory epithelium of the utenis. Moiecuiur Reproduction and Development 25: 1 0 1 - 1 09 (1 990).
Arceci, R. J., J. M. Croop, S. B. HoMlitz, and d. Housman. The gene encoding multidnig resistance is induced and expresseci at hi& levels during pregnancy in the secretory epithelium of the utem. Proceedings of the National Academy of Sciences CISA 85: 43504354 (1988).
Cordon, C. C., J- P. O'Brien, J. P. Boccia, D. Casals, J. R. Bertino, and M. R Melarned. Expression of the multidnig resistance pne product (P-glycoprotein) in human normal and tumor tissues. Journal of Histochemistry and Cytochemistry 38: 1277-1287 (1990).
Baas, F., and P. Borst The tissue dependent expression of hamster P-glycoprotein gens. FEBsLe~ers 229: 329-332 (1988).
Cordon-Cardo, C., and J. P. O'Brien. The multidnig resistance phenotype in human cancer, in Irnpor/mf Ahtv<inces ln Oncologv (V. T . DeVita, S. Hellman and S. A. Rosenberg, eds.). Lippincott, Philadelphia, 19-38 (1 99 1).
Croop, J. M., M. Raymond, D. Haber, A. Devault, R J. Arceci, P. Gros, and D. E. Housman. The three mouse multidnig resistance (mdr) genes are expressed in in tissue- specific manner in normal mouse tissues. Molecuiar und Cellular Biology 9: 1346- 1350 (1 989).
Mukhopadhyay, T., J. G. Batsakis, and M. T. Kuo. Expression of the mdr (P- elycoprotein) sene in Chinese hamster digestive tracts. Jotrrncrl qf 1Vctiionctl Cmcer ?mitute 80: 269-275 (1988).
Ro, J., A. Sahin, J. Y. Ro, H. Fritsche, G. Hortobagyi, and M. Blick. Immunohistochemical anaiysis of P-glycoprotein expression correlated with c hemotherapy resistance in locally advanced breast cancer. Human Pathology 2 1 : 787- 791 (1990).
Sugawara, I., 1. Kataoka, Y. Morishita, H. Hamada, T. Tsunio, S. Itoyama, and S. Mori. Tissue distribution of P-glycoprotein encoded by a multidrug-resistant gene as revealed by a monoclonal antibody, MRK 16. Cancer Reseurch 48: 1926- 1929 (1988).
Thiebaut, F., T. Tsumo, H. Hamada, M. M. Gottesman, 1. Pastan, and M. C. Willingharn. Cellular localization of the multidrug-resistance gene product P- glycoprotein in normal human tissues. Proceedings of the National Academy of Sciences USA 84: 7735-7738 ( 1987).
Weinstein, R. S., T. M. Gmgan, J. R Kuszak, S. M. Jakate, L. F. Kluskens, and J. S. Coon. Multidmg resistance gene product (P-glycoprotein) in normal tissue and tumon. in Advcinces in Pathology and Laboratory bledcine (R. S . Weinstein, ed.). Mosby-Year Book. Chicago. 207-234 ( 199 1).
Cordon, C. C., J. P. O'Brien, D. Casals, G. L. Rittman, J. L. Biedler, M. R. Melameci, and J. R. Bartino. Multidrug-drug resistance gene (P-glycoprotein) is expressed by endothelid cells at blood-brain barrier sites. P roceedings of the National Academy of Sciences CISA 86: 695-698 (1989).
Thiebaut, F., T. T m o , H. Hamada, M. M. Gottesman, 1. Pastan, and M. C. Wihgham. Immunohistochemical locaikation in normal tissues of diffetent epitopes in the multidrug transport protein P 170: Evidence for localization in brain capillaries and cross-reactivity of one antibody with a muscle protein. Jotirnni qf flis/ochemisoy and Cytochemzstry 37: 159-164 (1989).
Klimecki, W., B. Futscher, T. M. Grogan, and W. S. Dalton. P-giycoprotein is expressed in normal circulating granulocytes without measurable function. Pruceedings of the Amerim Association of Cancer Research 34: 23 (1993).
201. Wilisch, A., A. Noller, R Handgretinger, S. Weger, V. Nussler, D. Niethammer, H. Probst, and V. Gekeler. Mdrl/P-glycoproteh expression in natural killer (MC) cells e ~ c h e d from peripheral or umbilicd cord blood Cancer Letters 69: 139-148 (1993).
202. Chaudhary, P. M., E. B. Mechetner, and 1. B. Roninson. Expression and activity of P- elycoprotein, a multi-drug efflux pump? in human hematopoietic stem cells. C d 66: u
85-94 ( 199 1).
203. Lee, C. H., G. Bradley, J.-T. Zhang, and V. Ling. Differential expression of P- glvcoprotein genes in primary rat hepatocyte culture. Joirrnd uf Cellzhr Ph-vs iob 157: 392-402 (1993).
204. Bradley, G., E. Georges, and V. Ling. Sex-dependent and independent expression of the P-glycoprotein isoforms in Chinese hamster. Joiimd ofCt.l[zhr Physblog 145: 398- 408 (1990).
205. Salphati, L ., and L. 2. Benet. Modulation of P-glycoprotein expression by cytochrome P450 3A inducers in male and female rat livers. Biochumicd Phtrrmrcologv 55: 387- 395 (1998).
206. Arias, 1. M. Multidmg resistance genes, P-Glycoprotein and the liver. Hepatdogy 12: 159-165 (1990).
207. Meschini, S., A. Calcabrini, E. Monti, D. Del Bufalo, A. Stringaro, E. Dolfini, and G. Arancia. Intracellular P-glycoprotein expression is associated with the intrinsic multidnig resistance phenotype in human colon adenocarcinorna cells. Internotionai Jotimiil ofCmcer 87: 6 15-628 (2000).
208. Goldstein, L. J., A. T. Fojo, K. Ueda, W. Crist, A. Green, G. Brodeur, 1. Pastan, and M. M. Gottesman. Expression of the multidrug resistance. MDRl. gene in neuroblastomas. J o d of Clînicaf Onco fogy 8: 128- 136 ( 1990).
209. Grogan, T. M., C. M. Spier, S. E. Salmon, M. Matzner, J. Rybski, R. S. Weinstein, R. J. Scheper, and W. S. Dalton. P-giycoprotein expression in human plasma ceIl myeloma: correlation with prior chernotherapy . Blood 81 : 490-495 ( 1993).
2 10. Marie, J. P., R Zittoun, and B. 1. Sikic. Multidnig resistance (mdr 1 ) gene expression in adult acute leukenias: Correlations with treatment outcome and in vi(ro sensitivity. BIood 78: 586-592 (199 1).
21 1. Pirker, R., L. I. Goldstein, H. Ludwig, W. Linkesch, C. Lechner, M. M. Gottesman, and 1. Pastan. Expression of a multidnig resistance gene in blast cnsk of chronic myelogenous leukemia Cancer Commmiccitions 1: 14 1- 144 ( 1989).
212. Weinstein, R S., S. M. Jakate, J. M. Dominguez, M. D. Lebovitz, G. K. Koukoulis, J. R Kuszak, L. F. Klusens, T. M. Grog- T. J. Saclarides, and 1. B. Roninson
Relationship of the expression of the multidmg resistance gene product (P-glycoprotein) in human colon carcinoma to local tumor aggressiveness and lymph node metastasis. Cancer Research 51 : 2720-2726 (199 1).
Schrenk, D., T. W. Gant, K.-H. Preisegger, I. A. Silverman, P. A. Marino, and S. S. Thorgieoson. Induction of multidrug resistance gene expression during cholestasis in rats and nonhuman primates. Hepatology 17: 854-860 ( 1993).
Teeter, L. D., M. Estes, J. Y. Chan, H. Atassi, S. Sell, F. F. Becker, and M. T. Kuo. Activation of distinct rnultidnig-resistance gcnes during rat liver regeneration and hepatocarcinogenesis. MolecuZar Carcinogenesis 8: 67-73 (1993).
Teeter, L. D., F. F. Becker, F. V. Chisari, D. Li, and M. T. Kuo. Overexpression of the rnultidrug resistance gene mdr3 in spontaneous and chemically-induced mouse hepatocellular carcinomas. Mo[ecuiar and CelIuiar Biology 10: 5 728-573 5 ( 1990).
Volm, M., H. Zerban, J. Mattem, and T. Efferth. Overexpression of P-glycoprotein in rat hepatocellular carcinomas induced with .N-nitrosomorpholine. C<ircinogenesis 11: 169- 172 ( 1990).
Schuetz, E. G., W. T. Beck, and J. D. Schuetz. Modulators and substrates of P- glycoprotein and cytochrome P4503A coordinately upregulate these proteins in human colon carcinoma cells. Moiecular Pharmacology 49: 3 1 1-3 18 ( 1996).
Tien Kuo, M. Expression of rnultidrug-resistance (P-glycoprotein) genes in liver cancers: A rnolecular example of the convergence theory of hepatocarcinogenesis? Molecukur Carcinogenesis 7: 73-75 (1993).
Nakatsukasa, H., R. P. Evarts, R. K. Burt, P. Nagy, and S. S. Thorgeirsson. Cellular pattern of rnultidrug resistance gene expression during chernical hepatocminogenesis in the rat. Moledar Carcinogenesis 6: 190-198 (1992).
Lee, C. H., G. Bradley, and V. Ling. Increased P-glycoprotein messenger RNA stability in rat liver tumors in vivo. Jo~rrncd of CeIliilta Physioku~ 177: 1 - 12 ( 199 8).
Muller, C., F. Goubin, E. Ferrandis, 1. Comil-Schamtz, J. D. Bailly, C. Bordier, J. Benad. B. 1. Sikic, and G. Laurent. Evidence for transcriptional control of human mdrl gene expression by verapamil in multidrug-resistant leukemic cells. Molecular P h ~ m c o l o g v 47: 5 1 -56 ! 1995).
Wilson, G. M., and G. Brewer. Identification and characterization of proteins binding A + U-nch elements. MEKYUDS: (7 cc~mpmion (O Mehds in E q m o l u g y 17: 74-83 (1999).
Ross, J. mRNA decay in cell-free systems, in Conhol of Messenger RNA stability ( J . Belasco and G. Braiverman, eds.). Academic Press, hc., San Diego, 417-448 (1993).
224. Gurevich, V. V., 1. D. Pokrovskaya, T. A. Obukhova, and S. A. Zozulya. Preparative in Vilro mRNA synthesis Using SP6 and T7 RNA Poly merases. Andykwi Biochem islry 195: 207-2 13 (199 1).
225. Mathews, D. H., J. Sabina, M. Zuker, and D. H. Turner. Expanded sequence dependence of thermodynamic parameters improves prediction of RNA secondary structure. Journal of Moledur Biology, 288: 9 1 1-940 ( 1999).
226. Mathews, D. H., A. R Banejee, D. D. Luan, T. H. Eickbush, and D. H. Turner. Secondary structure mode1 of the RNA recognized by the reverse transcriptase from the R2 retrotransposable elernent. RNA 3: 1- 16 (1997).
227. Sachs, A. B. Messenger RNA degradation in eukaryotes. Cell74: 413-42 1 (1993).
228. Ross, J. Messenger RNA turnover in cell-free extracts from higher eukaryotes, in RNA- profvin inlermfion profocois M t h o d s in mcilenii~ir biolo& ( S . R. Haynes. ed.). Humana Press Inc., New Jersey, 459-464 (1 999).
229. Ross, J., and G. Kobs. H4 Histone rnessenger mRNA decay in cell-free extracts initiates at or near the 3'teminus and proceeds 3' to 5'. Ju~rrntrl of Mcdecczdiu Biuiogy 188: 579- 593 (1986).
230. Mathews, D. H., M. E. Burkard, S. M. Freier, J. R. Wyac and D. H. Tumer. Predicting oligonucleotide atrinity to nucleic acid targets. RWA 5: 1458- 1469 ( 1999).
23 1. Fan, X. C., and J. A. Steitz. ûverexpression of HuR, a nuclear-cytoplasmic shuttling protein. increases the in vive) stability of ARE-containhg mRNAs. The EM30 Jotmri 17: 3448-3460 (1998).
232. Bhattacharya, S., T. Giordano, G. Brewer, and I. S. Malter. Identification of AUF-l ligands reveals vast diversity of early response gene mRNAs. Nzicieic Aciils Resairch 27: 1464- 1472 (1999).
233. Wilson, G., Y. Sun, H. Lu, and G. Brewer. Assembly of AUF1 oligomers on U-nch RNA targets by sequentiai dimer association. J o ~ i m ~ l of Biologicd Chvmislry 274: 33374-33381 (1999).
234. Haeussler, I., A. M. Striebel, G. Assum, W. Vogel, H. Fumeaux, and W. Krone. Tumor antigen HuR bhds specifically to one of five protein-binding segments in the 3'- untnnslated region of the neurofibromin messenger RNA. Biochemzcal and Biophysical Resetrrch Commmiccrfions 267; 726-732 (2000).
235. You, Y., C.-Y. A. Chen, and A.B. Shyu. U-rich sequence-binding proteins interacting with a 20-nucleotide U-rich sequence in the 3' untranslated regioo of c-/os mRNA degradation. MoZecuZarr and CelZuZar Biology 12: 293 1-2940 (1992).
236. Varani, G., and A. Pardi. Structure of RNA, in RNA-Protein Interactions (K. Nagai and 1. W. Mattaj, eds.). Oxford University Press, hc., New York 1-20 (1994).
237. Antson, A. A. Single-stranded-RNA binding proteins. Current Opinion in Structuraf Sioiogy 10: 87-94 (2000).
238. Pesole, G., S. Liuni, G. Grillo, F. Licciulli, A. Lariua, W. Makalowski, and C. Saccone. UTRdb and UTRsite: specialized databases of sequences and functional elements of 5' and 3' uatranslated regions of eukaryotic mRNAs. N d e i c Acih Resecirch 28: 193-196 (2000).
239. Williams, A. S., and W. F. Marzluff'. The sequence of the stem and flanking sequences at the 3'end of histone mRNA are cntical determinants for the binding of the stem-loop binding protein. Nucleic Acids Reseurch 23: 654-662 (1995).
240. Zehner, 2. E., R. K. Shepherd, J. Gabryszuk, T.-F. Fu, M. Al-Ali, and W. M. Holmes. RNA-protein interactions within the 3'untranslated region of vimentin mRNA. N~ickic Acids Reseurch 25: 3362-3370 (1997).
241. Bruice, T. W., and W. F. Lima Control of complexity constraints on combinatorid screening for preferred oligonucleotide hybridization sites on structured RNA. Biochemistry 36: 5004-50 19 ( 1997).
242. Bevilacqua, P. C., C. X. George, C. E. Samuel, and T. R. Cech. Binding of the protein kinase PKR to RNAs with secondary structure defects: role of the tandem A-G misrnatch and noncontiguous helixes. Biochemisny 37: 6303-63 16 (1998).
243. Gewirtz, A. M. Oligonucleotide dmgs from bench to bedside. FASEB Journal 14: A 1309 (2000).
244. Kash, J. C., and K. M. J. Menon. Sequence-specific binding of a hormonally regulated mRNA bWng protein to cytidine-nch sequences in the lutropin receptor open reading fnune. Biochemisny 38: 1688% 16897 (1999).
245. Grange, T., E. Bertrand, M. L. Espimis, M. Fromont-Racine, G. Rigaud, J. Roux, and R. Pictet. In vn>u footp~ting of the interaction of proteins with DNA and RNA. M e h d s : A cornpanion to Methods in En=ymofogy 11: 15 1- 163 (1997).
APPENDIX 1.0: WORK IN PROGRESS
Part 3.
MUTATIONAL ANALYSIS: CONFIRMATION OF PROTEIN BNDING SITES
3.3 OVERALL 0mcTTVE:
In part 2 of this study, the sites on the MDRB RNA which are responsible for protein
bindùig were locaiized to regions 4470406 (ODN6 target site) and 453 1-4548 (ODN 13 target
site). These two regions showed an inhibition of the 80 kDa protein signal. In addition, the
regions 4489-4506 (ODN7 target site) appeared to play a role in the enhancernent of protein
binding to MDRB which may involve effects on the secondary structure of the MDRB. To
cofirm that the protein binding sites encompass these regions, mutational analysis of these
sites on the MDRB RNA were carried out.
This section will help to answer the question whether a specific core sequence, a
pamcular motif or RNA structure of the binding site, or both is the requirement for protein
contact to these sites. In addition, a cornparison of these sequences and structures with the
known sequences or structures bound by RNA-binding proteins of the c-myc 3'UTR as well as
other post-transcriptionally-regulated mRNAs will help in identiQing candidate proteins that
can bind these sites.
MATERIAlLS AND METaODS
Preparation of Mutant RN&
Tempiates for the mutant RNAs were prepared using PCR with T7 prornoter sequences
incorporateci into the 5' primer ( 10 1, 102) and using single stranded 1 10 nt-length (Sigma
Genosys, Texasj DKA bearing the desired mutarions within MDW3 sequences 2i- 130 as
starting DNA templates. These sequences include the target sites for the MDRB ODNs: 6, 7
and 13 in the MDRB sequence (See Figure Al, Appendix). Figure A2 shows the sequences of
RNA probes bearing the different mutations and Table AL0 shows the fonvard and revene
primers used to generate them. The same fonvard primers were used to generate al1 T7 mutated
DNA templates for in vitro transcription: forward primer: T7 promoter + nt 21-40 of MDRB
sequence. The revene primer: MDRB UTRrev 130: nt 1 10- 130 of MDRB was used for the
MDRBwt2 1- 130 and mutated DNA templates, except for the generation of T7MDRB 13mutl
and T7MDRB 13rnut2 which used 13mut 1 rev and 13mut2rev as revene primers, respectively.
The PCR conditions used to generate the double stranded DNA templates was: 94°C (2min),
94"C/55"C/72"C (30 cycles of 30 sec each), 72°C (4 min), 4°C in 10 X PCR buffer (10 mM
TrisCl pH 8.3, 50 mM K I ) , 1.5 mM MgC12, 0.4 rnM dNTPs, 5 units/reachon of Taq DNA
polymerase (Gibco BRL, Burlington, ON) set up as LOO pl reactions. After the PCR reaction,
an aliquot (5 pl) of each sample was ran in a 2% agarose gel. To the rernaining samples, an
quai volume of chloroform was added. Each sample was vortexed and centrifuged at 12,000 x
g for 2 min at 4°C. The supernatant was transferred to a new tube and two volumes of ethanol
were then added. Samples were vortexed and incubated at room temperature for 2 min followed
by centrifugation at 12.000 x g for 5 min at 4°C. Following centrifbgation, the ethanol was
removed and the pelleted DNA allowed to dry for 10 min. The pellet was then washed with 1
rnL cold 75% ethanol and the ethanol completely removed. The pellet was allowed to air dry
and was subsequently resuspended in 400 pl of double-distilled filtered water. The sample was
transferred onto a Micrown-100 (Amicon, Beverly, MA) cartridge and centrifuged at 2,300
rpm for 15 min at room temperature for two washes with ddHIO water. This procedure
removes the pnmers and excess nucleondes, and "pnmerdimer" side-products. The cartndge
was then inverted and transferred ont0 a new collecting tube and 40 p1 of 0.1 X TE was added
to elute the DNA h m the membrane. Figure A3 shows the PCR products observed before
clean up. Figure A4 shows the unlabeled RNAs hanscribed by the method of Gurevitch er al.
(224) fiom the T7 DNA templates. Imegrity and size of transcripts were venfied on a 6Yd7 M
urea gel following the protocol in Section 2.3.2. For reference, the cold MDRB RNA was also
loaded. Al1 samples ioaded were at I vg/pl concentrations. Except for ODN7, mutations of
bases on the target MDRB were based on RNA sites known to be bound by the rnost effective
inhibitory ODNs namely : 0DN6 and ODN 13. For reference, the wild type MDRB and MDRB
nt 2 1- 130 sequences are also shown.
TABLE A1-0: PRIMERS AND TEMPLATES USED TO GENERATE T7 DNA TEMPLATES FOR WTRO TRANSCRIPTION OF RNAs USED IN THE
MUTATIONAL ANALYSIS
MDRBW21-130, MDRBT7 MDRB UTR MDRMmutl , for21 revl30 MDRB6mut2, MDRB7mut MDRB7mut3
MDRBI 3mutl
I 1 I
* T i pnimoter sequenœs
'Sequences from 21 to 40 of MDRB (original sequenœ) b~equences 1 10-1 30 of MDRB Forward: same as above Reverse: CCGAGTGGAGGGGCGGGGGCAAA ATTACAC Forward: same as above Reverse: CCAAGCAAGAGAACACAAACAAAA ITACAC
MDRl 8UTR
MDRA
MDRB
Mutational analysis: controls
4421 MDRB
Mutated riboprobes:
MDRB 6muti Mutations through 1 ODN6 target site
MDRB 6rnut2 J to disrupt protein binding
MDRB 7mutl Mutations which en hance accessibility to
MDRB 7mut2 ODN6 target site
MDRB 13mut2 J target site to disrupt protein bindina
Figure A t Schematics of the riboprobes used in pait 3: mutational analysb section. Solid boxeci regions represent mutations which disrupt the secondary structure of the entire RNA shown while the hatched ragions represent mutations which do not affect the RNA secondary structure.
CONTROL 1 IO-nt MDRB RNA: 1. MDRBwt 21 -1 30: 5'-CAUCAAGUGG - AGAGAAAUCA - UAGUUUAAAC - UGCAUUAUAA - AUUUUAUAAC - AGAAUUAAAG - UAGAUUUUAA - AAGAUAAAAU GUGUAAUUUU - GUUUAUAUUU - UCCCAUUUGG-3'
MUTANT MDRB RNAs: 1. MDRB-6mutl 5'-CAUCAAGUGG - AGAGAAAUCA - UAGUUUAAAC - UGCccccacc - CCCCCCCAAC - AGAAUUAAAG - UAGAUUUUAA - AAGAUAAAAU GUGUAAUUUU - GUUUAUAUUU - UCCCAUUUGG-3'
MDRB-6mut2 5'-CAUCAAGUGG - AGAGAAAUCA - UAGU UUAAAC - UGCACCACAA- AggggAUAAC - AGAAUUAAAG - UAGAUUUUAA - AAGAUAAAAU GUGUAAUU UU - GUUUAUAUUU - UCCCAUUUGG-3'
4. MDRB-7mut 5'-CAUCAAGUGG - AGAGAAAUCA - UAGUUUAAAC - UGCAUUAUAA- AUUUUAUAAC - AGAAUUAAAG - UAGAUUUUcc - cc~ccccccc- GCCCCCCCCC - CUUUAUAUUU - UCCCAUUUGG-3'
5. MDRB-7mut3 5'-CAUCAAGUGG - AGAGAAAUCA - UAGUUUAAAC - UGCAUUAUAA- AUUUUAUAAC - cccccccccc - aAGAccUUcc - cCcccccccc- GcccccUUUU - GccccccUUU - UCCCAUUUGG-3'
6. MDRB-13rnutl 5'-CAUCAAGUGG - AGAGAAAUCA - UAGUUUAAAC - UGCAUUAUAA- AUUUUAUAAC - AGAAUUAAAG - UAGAUUUUAA - AAGAUAAAAU GUGUAAUUUU - Gcccccgccc - cuCCAcUcGG-3'
7. MDRB-13mut2 5'4AUCAAGUGG - AGAGAAAUCA - UAGUUUAAAC - UGCAUUAUAA- AUUUUAUAAC - AGAAUUAAAG - UAGAUUUUAA - AAGAUAAAAU GUGUAAUUUU - GUUUgUgUUc - UCUU~CUUGG-3'
FIGURE A2: SEQUENCES OF THE MUTANT MDRB RNAs. RNAs were generated from IlO-nt single-stranded DNA with the above sequences (except U is changed to a T). Sequences in bold refer to partiwlar ODN target sequences on the MDRB RNA Mutated sequences are shown in bold and lowercase letters. Mutants (except for 0DN7 target site mutations) are designated as follows: MDRB- XmutN: where X- refers to the specified oligo target MDRB site, and N- refers to the type of mutation rendered (1- mutations disrupting RNA secondary structure or 2- mutations which preserve secondary structure). Note that a truncated MDRB version (1 10 nt) MDRW1-130, spanning sequences 21 through 130 of the MDRB was used as additional control,
FIGURE A3: GENERATION OF T7 DNA TEMPLATES FOR THE MDRB MUTANT AND CONTROL (MDRBW 21-130) RNAS FOR IN W R O TRANSCRIPTION.
Five microlitres of each PCR-generated fragment was nin on a 2% agarose gel at 70 V. To check the sizes, a 100 bp ladder (Gibco BRL) was useci. Sizes are shown on the the left. Arrows indicate the desired product.
FIGURE A4: GENERATION OF IN VrrROITRANSCRlBED UNLABELED MDRB MUTANT RNAs. in vifmtranscribed unlabeled transcripts of the truncated (1 10 nt) MDRBwt 21-130 (lane 3) along with the different MDRB mutant RNAs: MDRB6mutl (lane 4), MDRBGmut2 (fanes), MDRB7mut (lane 6). MDRB7mut3 (lane 7), MDRB13mutl (lane 8). MDRB13mut2 (lane 9). For reference, unlabeled MDRB RNA was also loaded. The ptotocol followed was as previously described (see Figure 6). One microgram of RNA sample was loaded in each lane on a 6% acrylamide (30:1)/ 7M urea gel, stained in 1 X TBE (with 2.5 pglmL final ethidium bromide wnœntraton) for 40 minutes and destained with two change washes of ddH,O for 30 minutes. Bands were visualized under UV Iight and photographed using a Polaroid camera.
PRELIM3NARY RESULTS
Results from the fint and second screening revealed that ODN7, 0DN6 and ODN13
consistently showed the greatest effect, either by enhancement (as in the case for ODN7) or by
inhibition (as in the case for 0DN6 and ODN13) of the 80 kDa protein signal. Therefore these
sites may be the binding sites for the protein detected. To test this hypothesis, mutations were
designed on the MDRB RNA where these ODNs bmd. To determine what plays a key role
(sequence or structure or both) in the binding process, two types of mutations were designed.
The schematic of Our strategy is outlined in Figure Al . The fint type of mutation consists of
rnutating the A or U bases on the target sequences of either ODN6 or ODN13 (as designated by
the number d e r the mutant RNA narne (e.g. MDRB6mut 1 refers to mutations on the MDRB
RNA targeted by ODN6) which causes disruption of the original secondary structure. The
second type of mutation (e.g. MDRB 6mut2 refen to mutations on the 0DN6 target sites on
the MDRB RNA) consists of mutating the target sequences on the MDRB which preserves its
secondary structure. Mutations of the ODN7 target site designated 7mut and 7mut3 represent
mutations which renders i) the site opposite sequences 4 4 7 0 4 8 7 (ODN6 target site) ii)
sequences 489-4506 (ODN7 mget site) to be single strandeâ, respectively. These mutations
will help to elucidate the role of the secondary structure effects on the MDRB RNA by ODN7.
These were done with the aid of the FOLD module of the RNAstructure3.5 program (224,229).
Because the mutant RNAs used in this part of the project were 1 10 nucleotides in length, an
additionai control for the change in Length was chosen. This was done by choosing a specific
110-nt segment of the MDRB RNA which, when folded by RNAstnicture3.5, conserved the
original MDRB secondary structure. Preliminary experiments with the truncated version,
termed MDRBwt21-130 in gel shift analysis are shown in Figure A5. It shows a cornparison
RNA- p rotein } ,*pl,
FIGURE A5: CONFIRMATION OF THE PREDJCTED SECONDARY STRUCTURE SlMlLARlTY OF MDRBWTZI-130 TO THE ORIGINAL MDRB RNA. Binding reactions were camed out as previously descnbed using radiolabeled probes of the MDRB RNA and the tnincated (1 10 nt) MDRBwt21-130. Complexes were resolved on a 4% nondenaturing polyacrylarnide gel. Amws indicate the characteristic doublet seen in free MDRB RNA.
between the original MDRB RNA probe and the MDRBwt2 1- 130 (1 10-nt truncated control) in
the absence or presence of HepG? RSW. Lanes 1 and 2 show a simila. doublet for MDRl3 and
MDRBwt21-130 RNAs, a characteristic of the free (wild type) MDRB RNA. Lanes 3 and 4
show the same gel-shifted pattern for both in the presence of RSW proteins. Our next step is to
determine the contribution of either sequence or secondary structure to protein binding; in
particuiar, the eRecs of the mutation to the 80 kDa protein binding. Our hypothesis is bat if
these sites are indeed the protein binding sites, then cornpetition with the radiolabeled MDRB
RNA with the cold cornpetitor mutant MDRB RNAs, will determine which sitds isjare more
important for binding. To test Our hypothesis, W cross-linking assays were carried out with
radiolabeled MDRB and MDRBwt7 1-130 RNA in the absence or presence of 250 and 500 ng
of cold MDRB mutant RNAs. These concentrations were arbitrarily chosen as starting
concentrations. As shown in a representative UV cross-linking experiment in Figure A6, cold
MDRBl3mutl was able to compete 50 % of the 80 kDa protein signal with the MDRB in
concentrations of about 200 ng. MDRB6mutl was able to compete at about 250 ng. The
rank order of cornpetition (at concentrations less than or equal to 500 ng) for the 80 kDa protein
was determined to be as follows: MDRBI3mutl > MDRB6mutl > MDRE313mut3 =
MDRB7mut3 while MDRB7mut and MDRB6mut2 were very weak cornpetitors, competing at
concentrations greater than 500 ng. As shown in Figure A7, except for 13mut1, none of the
mutant EWAs were effective in competing off the 42 kDa protein signal. Interestingly, we have
detected proteins of different molecular masses that bind to the radiolabeled MDRBwt2 1 - 130
and this binding is also more intense than the binding pattern seen in wild type MDRB (Fig. A6
and A7).
Percent of control80 kDa protein signal
O 100 200 300 400 500 600
Concentration of unlabeled competitor RNA (ng)
FIGURE A6 : EFFECT ON THE 80 kDa PROTEIN BlNDlNG BY MUTATIONS OF THE BlNDiNG SITES OF 0DN6,ODN7 AND ODN13 ON THE MDRB RNA.
A./ Binding reactions were camed out as for RNA gel shift analysis, followed by UV exposure to cavalently bind the radiolabeled MDRB probe to proteins in the presence of 250 and 500 ng of unlabeled mutant MDRB cornpetitor RNAs. After digestion with RNases A and Tl. complexes were resolved on a 10% SDS-PAGE. Sires of Coornassie blue-stained markers are indicated at the left in kDa.
8.1 Quantitation was done using a Phosphorlmager as described previously. Radiolabeled proteins were quantitateci and expressed as a percent of the binding seen in the absence of any competitor RNA.
Percent of 60 control42 kDa protein signal
40
Concentration of unlabeled cornpetitor RNA (ng)
FIGURE A7 : EFFECT ON THE 42 kDa PROTEIN BINDING BY MUTATIONS OF THE BINDING SITES OF ODN6,ODNf AND ODN13 ON THE MDRB RNA.
A./ Binding reacüons were canied out as described previously for UV cross-linking analysis in the presenœ of 250 and 500 ng of unlabeled mutant MDRB cornpetitor RNAs. ARer digestion with RNases A and Tl, complexes were resolved on a 10% SOS-PAGE. Sizes of Coomassie blue-stained markers are indicated at the lefi in kDa.
BJ Quantitation was done using a Phosphorlmager as described previously. Radiolabeled proteins were quantitated and exprwsed as a ~ercent of the binding seen in the absence of any mmpetitor RNA.
APPENDIX 1.1: PREDICTED SECONDARY STRUCTURES OF
THE MDRB MUTANT RNAs
Structure: MDRBwt2 1 - L 30
Energy = - 19.4 kcdmol
Structure: MDRl36mut 1
Energy = -16.9 kcaVmol
Structure: MDEU36mut2
Energy = -19.9 kcaVrnol
4 /'=u 4$*.
@+--O Structure: MDRB 7mut
Structure: MDRB7mut3
Structure: MDRB 13mut2
Energy = -2 1.3 kcal/mol