APPLIED AND ENVIRONMENTAL MICROBIOLOGY, July 2009, p. 4539–4549 Vol. 75, No. 130099-2240/09/$08.00�0 doi:10.1128/AEM.01336-08Copyright © 2009, American Society for Microbiology. All Rights Reserved.

Phylogeny and Virulence of Naturally Occurring Type III SecretionSystem-Deficient Pectobacterium Strains�

Hye-Sook Kim,1 Bing Ma,2 Nicole T. Perna,3 and Amy O. Charkowski1*Department of Plant Pathology,1 Genome Center,2 and Department of Genetics,3 University of Wisconsin—Madison,

Madison, Wisconsin

Received 3 July 2008/Accepted 26 April 2009

Pectobacterium species are enterobacterial plant-pathogenic bacteria that cause soft rot disease in diverseplant species. Previous epidemiological studies of Pectobacterium species have suffered from an inability toidentify most isolates to the species or subspecies level. We used three previously described DNA-basedmethods, 16S-23S intergenic transcribed spacer PCR–restriction fragment length polymorphism analysis,multilocus sequence analysis (MLSA), and pulsed-field gel electrophoresis, to examine isolates from diseasedstems and tubers and found that MLSA provided the most reliable classification of isolates. We found thatstrains belonging to at least two Pectobacterium clades were present in each field examined, although repre-sentatives of only three of five Pectobacterium clades were isolated. Hypersensitive response and DNA hybrid-ization assays revealed that strains of both Pectobacterium carotovorum and Pectobacterium wasabiae lack a typeIII secretion system (T3SS). Two of the T3SS-deficient strains assayed lack genes adjacent to the T3SS genecluster, suggesting that multiple deletions occurred in Pectobacterium strains in this locus, and all strainsappear to have only six rRNA operons instead of the seven operons typically found in Pectobacterium strains.The virulence of most of the T3SS-deficient strains was similar to that of T3SS-encoding strains in stems andtubers.

The genus Pectobacterium (formerly Erwinia) contains bothnarrow- and broad-host-range bacterial plant pathogens thatcause soft rot, stem rot, wilt, and blackleg in species belongingto over 35% of plant orders (20). Four Pectobacterium specieshave been described: Pectobacterium atrosepticum, Pectobacte-rium betavasculorum, Pectobacterium carotovorum, and Pecto-bacterium wasabiae (9). The recently described organism P.carotovorum subsp. brasiliensis is genetically distinct from pre-viously described Pectobacterium taxa; approximately 82% ofits genes are shared with P. atrosepticum, and 84% of its genesare shared with P. carotovorum subsp. carotovorum, while 13%of its genes are found in neither P. atrosepticum nor P. caro-tovorum subsp. carotovorum (7, 10, 20). To date, only P. caro-tovorum subsp. carotovorum and P. atrosepticum have beenreported to occur in the same field (14, 21). P. carotovorumsubsp. carotovorum is found worldwide, and P. atrosepticum isfound in cool climates; while P. carotovorum subsp. brasiliensishas been found only in Brazil, Israel, and the United States, itis likely to have a wider distribution (20). Compared to theecology and genetics of P. carotovorum subsp. carotovorum andP. atrosepticum, little is known about the ecology and geneticsof P. betavasculorum, P. wasabiae, or P. carotovorum subsp.brasiliensis.

Pectobacterium strains isolated from potato are diversebased on serology, genome structure, and fatty acid composi-tion (5, 35). Previous epidemiological studies of pectolytic En-terobacteriaceae were complicated by the diversity of this group

and the lack of tools capable of placing all isolates into clades.For example, Gross et al. (14) were unable to classify over 50%of Pectobacterium isolates obtained from potato, and Pitman etal. (23) were unable to type 13% of their isolates. Novel PCR-based methods potentially capable of classifying all Pectobac-terium isolates have been described, but they were developedprior to the recognition of P. carotovorum subsp. brasiliensis(1, 34).

The main virulence determinants of Pectobacterium are thepectolytic enzymes secreted through the type II secretion sys-tem. Although these enzymes are required for development ofsymptoms, many other virulence genes have been shown tocontribute to Pectobacterium pathogenicity, including the typeIII secretion system (T3SS) genes, the cfa gene cluster, and thetype IV secretion system genes (3, 15, 19). Recent genomicanalysis showed that some of these gene clusters, such as thecfa and type IV secretion system cluster genes, as well as genesimportant for interactions with insects, are present in onlysome Pectobacterium species (10). Thus, Pectobacterium spe-cies appear to use different genetic tools to overcome planthost barriers and to interact with insect vectors.

Many gram-negative pathogenic bacteria secrete virulenceproteins, known as effectors, through the T3SS into host cells.Once inside host cells, the effectors manipulate host defensesand promote bacterial growth (13). Unlike many other gram-negative plant pathogens, Pectobacterium does not require theT3SS for pathogenicity. Rather, this secretion system makes asmall, but measurable, contribution to the early stages of P.carotovorum growth in leaves of the model plant Arabidopsisthaliana (26) and contributes to the virulence of P. atrosepti-cum on potato (15). Recently, we isolated Pectobacteriumstrains that lack the T3SS from potatoes and also found P.wasabiae and P. carotovorum subsp. brasiliensis on potatoes in

* Corresponding author. Mailing address: Department of Plant Pa-thology, University of Wisconsin—Madison, Madison, WI 53706.Phone: (608) 262-7911. Fax: (606) 263-2626. E-mail: amyc@plantpath.wisc.edu.

� Published ahead of print on 1 May 2009.

4539

on March 4, 2021 by guest

http://aem.asm

.org/D

ownloaded from

Wisconsin (35). The first goal of this study was to determine ifP. wasabiae and P. carotovorum subsp. brasiliensis are commonin agricultural fields or if soft rot disease is typically caused byP. carotovorum subsp. carotovorum and P. atrosepticum, whichhave been the focus of nearly all previous studies of potato softrot, stem rot, and blackleg disease. Second, since we recentlyisolated a strain lacking the T3SS (35), we also aimed to de-termine if strains lacking the T3SS are common in infectedpotatoes and if these strains tend to be less virulent on potatostems and tubers than strains encoding a T3SS.

MATERIALS AND METHODS

Bacterial strains and growth media. Bacterial strains used in this study arelisted in Table 1. In 2001, we isolated Pectobacterium isolates from diseasedpotato tubers and stems from four different fields in Wisconsin (37). Additional

Pectobacterium isolates were obtained from diseased potato tubers collectedfrom three different fields in Wisconsin in 2004 (Table 1). The bacteria wereisolated by the methods described by Schaad et al. (29) and Yap et al. (35).Briefly, bacteria from decayed tubers were streaked either onto crystal violetpectate (CVP) medium prepared with either Bulmer or Slendid pectate (16) oronto a raffinose (RAF) medium modified from the medium described by Segall(30), and the cultures were incubated at room temperature for at least 3 days.The modified RAF medium consists of (per liter) 10 g of raffinose, 2 g ofK2HPO4, 5 g of ammonium sulfate, 0.4 g of eosin Y, 0.065 g of methylene blue,and 18 g of agar. Pectobacterium forms pits on CVP medium since it digests thepectate that is used to solidify this medium; thus, pit-forming colonies werepresumed to be colonies of Pectobacterium species. Isolates obtained from pit-forming colonies on CVP medium plates were streaked onto Luria-Bertani (LB)agar. On RAF medium, Pectobacterium forms either red colonies without halosor, occasionally, metallic green colonies without halos, depending on the batch ofmedium. Such colonies were streaked onto LB agar and were then tested for theability to form pits on CVP medium. All isolates were confirmed to be Pecto-bacterium sp. isolates using a 16S-23S intergenic transcribed spacer (ITS) PCR

TABLE 1. Strains and plasmids used in this study

Strain(s) or plasmid Relevant characteristics Reference(s)or source

Pectobacterium strains isolated in Wisconsina

P. carotovorum subsp. brasiliensis WPP1 andP. carotovorum subsp. carotovorumWPP12

Isolated from two diseased stems, Coloma, WI, 2001 20, 35

P. carotovorum subsp. carotovorum WPP2 andWPP14 and P. carotovorum subsp.brasiliensis WPP5

Isolated from three diseased stems, Coloma, WI, 2001 20, 35

P. wasabiae WPP19 and P. carotovorum subsp.brasiliensis WPP20

Isolated from two diseased tubers, Hancock, WI, 2001 20, 35

P. carotovorum subsp. carotovorum WPP16 andP. carotovorum subsp. brasiliensis WPP17

Isolated from an infected potato tuber, Antigo, WI, 2001 20, 35

P. carotovorum subsp. carotovorum WPP127through WPP138 and WPP153 throughWPP155 and P. wasabiae WPP139,WPP140, WPP145, WPP146, and WPP157through WPP163

Isolated from five infected potato tubers, Alsum, WI, 2004 This study

P. carotovorum subsp. brasiliensis WPP164through WPP167 and WPP169 andP. wasabiae WPP168

Isolated from an infected potato tuber, Coloma, WI, 2004 This study

P. wasabiae WPP170 through WPP174 andP. carotovorum subsp. carotovorumWPP175 through WPP181

Isolated from two infected potato tubers, Hancock, WI, 2004 This study

Pectobacterium strains isolated in other regionsATCC 15713 Type strain of P. carotovorum subsp. carotovorum; isolated

from potato in DenmarkATCC

ATCC 43762 Type strain of P. betavasculorum 33ATCC 43316 Type strain of P. wasabiae; isolated from Eutrema wasabi in

Nagano Prefecture, Japan11

ATCC 33260 Type strain of P. atrosepticum; isolated from potato in theUnited Kingdom in 1957

12

P. wasabiae SCRI488 Isolated from Wasabia japonica, Japan I. K. TothP. carotovorum subsp. brasiliensis 1692 Type strain of P. carotovorum subsp. brasiliensis; isolated

from potato in Brazil8

Dickeya sp. strain ATCC 11663 Type strain of Dickeya 4

E. coli DH5� supE44 �lacU169 (�80lacZ�M15) hsdR17 recA1 endA1gyrA96 thi-1 relA1

Clontech

PlasmidspGEM-T Easy Apr, lacZ�, cloning vector PromegapThrpDN(Ecc) Apr, 5.8-kb region containing hrpD, hrpE, hrpF, hrpG, hrcC,

hrpT, hrpB, and hrpN on pGEM-T Easy35

pThrpBC(Ecc) Apr, 3.5-kb region containing hrpB, hrcJ, hrpD, hrpE, hrpF,hrpG, and hrcC on pGEM-T Easy

35

a Species identity was determined by using a combination of MLSA, ITS-PCR–RFLP analysis, and PFGE.

4540 KIM ET AL. APPL. ENVIRON. MICROBIOL.

on March 4, 2021 by guest

http://aem.asm

.org/D

ownloaded from

assay described by Toth et al. (34). Pectobacterium strains were routinely grownin LB medium at either room temperature or 37°C. Although common in potato-growing regions in Europe, the related pathogen Dickeya has not been reportedon potato in Wisconsin yet, and no Dickeya isolates were obtained.

HR assay. Nicotiana tabacum L. cv. Xanthi NN plants used for hypersensitiveresponse (HR) assays were grown in a greenhouse. For HR elicitation assays,bacterial cells were grown overnight on LB medium and were then suspended insterile water to a concentration of 108 CFU/ml. The bacterial cell suspensionswere infiltrated into fully expanded leaves of 6- to 7-week-old N. tabacum L. cv.Xanthi NN with a needleless 1-ml syringe (2). Plants were examined for HRelicitation 24 h after infiltration. Each assay was performed in triplicate, andsterile distilled water was infiltrated into leaves as a negative control. All plantassays were repeated at least three times.

DNA hybridization and PCR analysis. Pectobacterium T3SS genes were de-tected by DNA hybridization and PCR amplification with T3SS-specific probesand primers for genes encoding regulatory, structural, and secreted proteins. ForDNA hybridization assays, chromosomal DNA was digested with EcoRI, elec-trophoresed through a 0.8% agarose gel, and transferred to a nylon membrane(Millipore Co., Billerica, MA). Probe DNA was either PCR amplified from P.carotovorum WPP14 genomic DNA (hrpL, hrpN, hrpW-dspE/F, hecB, and aregion upstream of hrcU) or amplified from plasmids containing DNA clonedfrom P. carotovorum WPP14 [a 5.8-kb PCR-amplified fragment containing hrpDthrough hrpN amplified from pThrpDN(Ecc) and a 3.5-kb PCR-amplified frag-ment containing hrpB through hrcC amplified from pThrpBC(Ecc)]. The primersand rregions used are described in Table 2. A PCR amplification programconsisting of 30 cycles of 94°C for 30 s, 54°C for 30 s, and 72°C for 30 s to 5 min,depending on the size of the amplified fragment, was used. The probes werelabeled with a Gene Images Alkphos direct labeling and detection system kit(GE Healthcare Bio-Sciences Corp., Piscataway, NJ). Hybridization results wererecorded on X-ray film (Kodak, Los Angeles, CA). Additionally, the presence ofhrcC, which encodes the T3SS porin, was detected with the primer set listed inTable 2. 16S-23S ITS-PCR and restriction fragment length polymorphism(RFLP) analyses were performed as described by Toth et al. (34). Briefly, therRNA intergenic spacer region was amplified with primers G1 and L1, theamplified DNA was digested with RsaI (New England Biolabs, Ipswich, MA),and the DNA was analyzed by gel electrophoresis on 3% GenePure HiResagarose gels (ISC Bioexpress, Kaysville, UT) in Tris-borate-EDTA buffer.

Phylogenetic analyses. Fragments of six conserved housekeeping genes, acnA(aconiate hydrase 1), gapA (glyceraldehyde-3-phosphate dehydrogenase A), icdA(isocitrate dehydrogenase), mdh (malate dehydrogenase), pgi (glucose-6-phos-phate isomerase), and proA (�-glutamylphosphate reductase), were PCR ampli-fied from the type strains of Pectobacterium sp. and Dickeya chrysanthemi and thestrains isolated in Wisconsin, including WPP2, WPP5, WPP12, WPP16, WPP20,

WPP127, and WPP156 (Table 1), as described previously (20). The sequencesof the PCR-amplified fragments were obtained with a BigDye Terminator kit(Perkin-Elmer). Sequence chromatogram output files were initially aligned andedited using SeqMan 5.08 (DNASTAR, Inc., Madison, WI). A phylogeneticanalysis of the sequences of 51 bacterial strains was conducted using PAUP*4.0b10 and the concatenated gene sequence data set. Yersinia sp. strains wereused as outgroups in all reconstructions. We used ModelTest 3.7 to select thestandard AIC model (TrN with a gamma correction for rate variation amongsites [32]) as the best-fitting model of evolution (24, 25). The correspondinglikelihood parameters were estimated and then applied in PAUP* 4.0b10. Twodifferent algorithms were then used, maximum likelihood-corrected neighborjoining (NJ) and weighted maximum parsimony (MP) with substitutionsweighted according to the instantaneous rate matrix or characters weightedaccording to their rescaled consistency index values. Bootstrap values were es-timated in order to evaluate the support for each clade (1,000 replicates formaximum likelihood-corrected NJ and MP heuristic search) with sampling lim-ited to parsimony-informative characters with a cutoff value of 50.

Pulsed-field gel electrophoresis (PFGE) analysis. Agarose plugs containingchromosomal DNA of each bacterial strain were prepared and digested withI-CeuI (New England Biolabs, Inc.) as described previously (27, 31, 35). Briefly,a Pulsaphor Plus system with a hexagonal electrode array (Pharmacia, Uppsala,Sweden) was used for electrophoresis by following the manufacturer’s instruc-tions. The digested genomic DNA was separated by electrophoresis on a 1%agarose gel at 12°C for 20 h at 5 V/cm with the switch time ramping from 25 to45 s. ProMega lambda ladder (Promega, Madison, WI) was used as the sizemarker, and the DNA was stained with ethidium bromide and visualized with aUV light transilluminator.

Virulence assays. Virulence assays were performed with potato tubers andstems (Solanum tuberosum cv. Atlantic) in the laboratory and field, respectively.The relative virulence of 10 Pectobacterium strains in potato tubers (cv. Atlantic)was determined by measuring the amount of macerated potato tissue (35). Tento 12 potato tubers were inoculated by placing 10 �l of a 108-CFU/ml bacterialsuspension into 1-cm-deep holes poked into the tubers with a pipette tip. Thetubers were placed in plastic bags and incubated for 2 days at 28°C. This inoc-ulum level was chosen because it was the lowest level at which the tubers reliablydeveloped symptoms within 2 days with the most virulent strains examined. After2 days the inoculated tubers were cut open, and the macerated tissue wasremoved and weighed. Five assays with P. carotovorum subsp. carotovorumWPP14, P. carotovorum subsp. brasiliensis WPP17, P. wasabiae WPP163, and P.carotovorum subsp. brasiliensis WPP165 were conducted in the summers of 2005and 2006 at the University of Wisconsin Hancock Agricultural Research Stationusing potato plants (S. tuberosum cv. Atlantic). S. tuberosum cv. Atlantic waschosen because it developed consistent and reliable symptoms in preliminary

TABLE 2. Oligonucleotides used in this study

Primer Sequence (5�33�) Amplified region Reference

P0437 CGGCGTCTCAACATTCCAGAAG 630 bp of hrpL This studyP0438 TTGGCAACAAGTGGCGTGAT

P0439 CAAGACTTCCGCCCTGCTCT 1.1 kb of hrpN This studyP0440 GCTGACCGCACATCATTGGC

P0434 GCTGAGCGGGCGTAATGTATCC 7.3 kb of hrpW, dspE/F This studyP0443 TCGACCAATAGCGTGCCGTGGCTC

P0467 CGTCAGTAATTGGTATATCGAGCGG 1.2 kb of hecB This studyP0468 TGATCCCCGGTCTTAATGAC

P0469 GCAAGGAAAGGCATGACCAACG 1.3 kb of ECA2075 This studyP0470 CGAAAACGTCATTAGGCAGCGAT

P0757 ACGCCGCCACGCCACCAGACT 2.1 kb of hrcC This studyP0758 CGCCGGGCCGCTACGCAAATC

hrcQRF CGGTGAACTGGTBGATGTGGAAGGNC 0.2 kb of hrcQR This studyhrcQRR TGNACSCCRAKSGCRTTGCG

G1 GAAGTCGTAACAAGG 16S-23S intergenic spacer region 34L1 CAAGGCATCCACCGT

VOL. 75, 2009 T3SS-DEFICIENT PECTOBACTERIUM STRAINS 4541

on March 4, 2021 by guest

http://aem.asm

.org/D

ownloaded from

greenhouse assays. Bacterial treatments were arranged in a randomized com-plete block design with three blocks. Each plot was 4.5 m (16 rows) by 16.7 m,and every two rows were separated by two boarder rows in which S. tuberosum cv.Red Norland was planted. Twenty potato tubers were planted for each bacterialtreatment on 23 April 2005 and 21 April 2006. In 2005 and 2006, 8 to 10 and 15to 20 potato stems per block, respectively, were inoculated with WPP14, WPP17,WPP163, and WPP165. Prior to inoculation, the Pectobacterium strains weregrown overnight on LB agar. The bacteria were scraped from the plates withsterile toothpicks, and then the plants were stab inoculated with the toothpicks.One stem per plant was inoculated with one strain, and a second stem wasstabbed with a sterile toothpick as a negative control. The toothpicks were left inthe stem wounds, and each wound was sealed with a strip of Parafilm, both toprotect the bacteria from desiccation and to mark the inoculated and controlstems. One week after inoculation, the stems were collected from the field. Thestems were sliced in half, and the length of the lesion in each stem was measured.

Statistical analysis. Statistical analysis of data was conducted using StatisticalAnalysis Systems (SAS Institute, Cary, NC). Analysis of variance was determinedusing the general linear model procedures, and means were separated with theleast significant difference.

Nucleotide sequence accession numbers. The GenBank accession numbers forthe sequences of six housekeeping genes of WPP2, WPP5, WPP12, WPP16,WPP20, WPP127, and WPP156 are EU684027 to EU684051 and EU250362 toEU250373. The GenBank accession numbers for the sequences of six house-keeping genes of the five type strains used are FJ895836 to FJ895865.

RESULTS

Pectobacterium strains lacking the T3SS were isolated frommultiple potato fields. In 2001, we isolated a strain whichlacked a T3SS, WPP17. To determine if this strain was ananomaly or if T3SS-deficient strains could be isolated from

additional field samples, we examined an additional 45 Pecto-bacterium isolates from potatoes with soft rot from three fieldsin Wisconsin in 2004. To determine which Pectobacterium iso-lates lacked a T3SS, we examined the abilities of the isolates toelicit the HR on tobacco plants (N. tabacum L. cv. Xanthi NN).With two exceptions, all strains isolated from the same tubershad the same HR phenotype (Tables 1 and 3 and Fig. 1). Eightrepresentative isolates from six tubers (WPP127, WPP156,WPP161, WPP163, WPP165, WPP168, WPP172, and WPP178)

TABLE 3. Description of Pectobacterium strains isolated from seven fields in Wisconsin in 2001 and 2004 based on PFGE and elicitation ofan HR on tobacco leaves (N. tabacum L. cv. Xanthi NN)

Field Plant part Tuber orstem no. No. of isolates (strain�s�) Selective

medium

PFGEHR

elicitationNo. of isolatestested Pulsotypea

A Tuber 1 2 (WPP127, WPP128) CVP 2 1 �2 8 (WPP129 to WPP136) CVP 7 2 �2 3 (WPP153 to WPP155) RAF 3 2 �3 2 (WPP137, WPP138) CVP 2 2 �4 4 (WPP139, WPP140, WPP145, WPP146) CVP 3 4 4 6 (WPP151 to WPP163) RAF 6 4 5 2 (WPP156, WPP157) CVP 2 2 �

B Tuber 1 5 (WPP164 to WPP167, WPP169) RAF 5 3 �1 1 (WPP168) RAF 1 NTb

C Tuber 1 5 (WPP170 to WPP174) RAF 5 4 2 7 (WPP175 to WPP181) RAF 7 1 �

D Tuber 1 2 (WPP16, WPP18) CVP 2 5 �1 1 (WPP17) CVP 1 6 �

E Tuber 1 1 (WPP19) CVP 1 7 2 2 (WPP20) CVP 2 NT �3 1 (WPP23) CVP 1 1 �4 1 (WPP24) CVP 1 1 �4 1 (WPP25) CVP 1 8 �

F Stem 1 1 (WPP1) CVP 1 8 �2 1 (WPP12) CVP 1 9 �

G Stem 1 1 (WPP2) CVP 1 10 �2 1 (WPP5) CVP 1 11 �3 1 (WPP14) CVP 1 12 �

a Examples of pulsotypes are shown in Fig. 7 and by Yap et al. (35).b NT, not tested.

FIG. 1. Sixteen of 45 Pectobacterium isolates obtained in 2004 andP. wasabiae SCRI488 were unable to elicit an HR on N. tabacum cv.Xanthi. Bacterial isolates were infiltrated into the leaves of 6- to7-week-old N. tabacum cv. Xanthi, and results were recorded thefollowing day. Leaf panels 1 through 8 were infiltrated with Pectobac-terium sp. strains WPP14, WPP17, WPP161, WPP163, WPP165, andWPP172, P. wasabiae SCRI488, and a water control, respectively.

4542 KIM ET AL. APPL. ENVIRON. MICROBIOL.

on March 4, 2021 by guest

http://aem.asm

.org/D

ownloaded from

were examined with DNA hybridization assays to determine ifthe isolates unable to elicit an HR encoded a T3SS (Fig. 2).DNA hybridization assays showed that the Pectobacterium iso-lates unable to elicit an HR, WPP161, WPP163, WPP168, andWPP172, did not contain the T3SS alternative sigma factorgene hrpL, the hrpN, hrpW, and dspE genes encoding T3SS-secreted proteins, or the gene encoding the DspE chaperone,dspF (Fig. 2). Additionally, DNA hybridization assays showedthat the strains unable to elicit an HR lacked the genes in theT3SS cluster from hrpD to hrpB (Fig. 2). We also attempted toPCR amplify conserved fragments of the region encoding theT3SS, including a region of hrcC and a fragment containinghrcQR, with primers based on conserved regions of thesegenes, but we were unable to amplify DNA from WPP161,WPP163, WPP168, or WPP172 (not shown). Thus, the strainsunable to elicit an HR lacked a key regulatory gene requiredfor a functional T3SS, the genes encoding the T3SS machinerystructure, and the genes encoding three proteins secreted viathe T3SS. Consistent with the results of Yap et al. (35), we

found that WPP17 genomic DNA did not hybridize to any ofT3SS genes.

Since most of the T3SS-deficient strains clustered with P.wasabiae in our phylogenetic analysis (see Fig. 5), we assayedP. wasabiae strain SCRI488 to determine if it also lacked aT3SS. We found that SCRI488 was unable to elicit an HR intobacco and that SCRI488 genomic DNA did not hybridize toDNA encoding the T3SS (Fig. 1 and 2). Thus, P. wasabiaeSCRI488 also lacks a T3SS entirely or encodes an atypicalT3SS. Since SCRI488 was isolated in Japan, T3SS-deficient P.wasabiae may be widespread.

Multiple deletions of genes in the T3SS locus have occurred.The flanking regions of the T3SS gene cluster are conserved inthe three sequenced Pectobacterium genomes (3, 10). To de-termine if the regions surrounding the T3SS gene cluster werepresent in the T3SS-deficient isolates, two genes flanking theT3SS gene cluster (hecB encoding a TpsB transporter homologand ECA2075 encoding a lysR homolog) were amplified fromP. carotovorum subsp. carotovorum WPP14 and were used as

FIG. 2. Pectobacterium isolates unable to elicit an HR did not contain the genes for the Pectobacterium T3SS. (A) The P. carotovorum WPP14T3SS is indicated by open arrows, and the border genes, hecB, and ECA2075 are indicated by filled arrows. (B) Genomic DNA from isolates unableto elicit an HR did not hybridize to DNA amplified from the P. carotovorum WPP14 T3SS gene cluster, including hrpL, hrpN, hrpW, dspE, dspF,hrpD, hrpE, hrpF, hrpG, hrcC, hrpT, hrpV, hrpB, and hrcJ.

VOL. 75, 2009 T3SS-DEFICIENT PECTOBACTERIUM STRAINS 4543

on March 4, 2021 by guest

http://aem.asm

.org/D

ownloaded from

probes in DNA hybridization assays (Fig. 3). Genomic DNAfrom most of the T3SS-deficient strains hybridized to bothprobes, suggesting that the T3SS genes, but not the surround-ing genes, were not present in these strains. However, WPP172and WPP17 lacked hecB and ECA2075, respectively; thus,additional genes are not present in these two T3SS-deficientstrains. We attempted to PCR amplify the DNA betweenECA2075 and hecB in the T3SS-deficient strains that containboth of these genes, but we were unable to amplify any frag-ments from this region.

T3SS-deficient P. wasabiae strains were capable of causingdisease in potato stems and tubers. The relative virulence of aPectobacterium strain was evaluated by inoculating it into po-tato tubers and stems and then weighing the amount of mac-erated tuber tissue or measuring the length of the stem lesion.The strains assayed could be grouped into three classes basedon their tuber maceration ability (Fig. 4). The tuber macera-tion amounts obtained for P. carotovorum subsp. brasiliensisWPP17 and P. wasabiae SCRI488 were significantly lower,while P. carotovorum subsp. carotovorum WPP14 and P. caro-tovorum subsp. brasiliensis WPP165 macerated tuber tissuemost efficiently. The abilities of rest of the strains to maceratepotato tubers were intermediate. No correlation between theaggressiveness of tuber maceration and the presence of theT3SS was observed.

To determine if the T3SS-deficient strains were capable ofcausing disease in stems, we inoculated field-grown potatostems (cv. Atlantic) with T3SS-encoding and T3SS-deficientstrains, including P. carotovorum subsp. carotovorum WPP14,P. carotovorum subsp. brasiliensis WPP165, P. carotovorumsubsp. brasiliensis WPP17, and P. wasabiae WPP163, and mea-sured lesion lengths 1 week after inoculation (Fig. 4). Thelesion lengths were similar for WPP14, WPP165, and the T3SS-deficient strain WPP163 (P 0.05), except for the second trialin 2005. In contrast, the ability of WPP17 to cause stem rot inpotato was significantly less than that of the other three Pec-tobacterium strains (P 0.05). In the negative controls, onlythe toothpick stab wounds were observed. Thus, these threeisolates of P. carotovorum subsp. carotovorum, P. carotovorumsubsp. brasiliensis, and P. wasabiae caused comparable levels oftuber and stem rot, and the T3SS is not required for Pectobac-terium to cause soft rot disease in tubers or stems.

Multiple Pectobacterium species were present in fields and,occasionally, in individual diseased tubers. Isolates obtainedin 2001 and 2004 were used to determine if infected plantsfrom individual fields were typically infected with one or mul-tiple species. Two previously described DNA-based methods,multilocus sequence analysis (MLSA) (20) and 16S-23S ITS-PCR–restriction fragment length polymorphism (RFLP) anal-ysis (34), were used to determine the species of the isolates(Fig. 5 and Fig. 6). Our MLSA relied on building phylogenetictrees from concatenated gene sequences of six housekeepinggenes, acnA, gapA, icdA, mdh, pgi, and proA, and it providedrobust support for clades corresponding to the four previouslydescribed Pectobacterium species (clades 2 through 5) and forP. carotovorum subsp. brasiliensis (clade 1) (20). Sequences ofseven new Pectobacterium isolates and five type strains (fourPectobacterium strains and one Dickeya strain) were added tothe MLSA developed by Ma et al. (20). The new isolates werechosen because they produced PFGE or 16S-23S ITS-PCR–RFLP patterns not produced by strains included in the previ-ously described phylogenetic tree and therefore could not eas-ily be identified to the species level. For example, WPP127 andWPP156, both of which were placed in the P. carotovorumsubsp. carotovorum clade (Fig. 5), produced a novel 16S-23SITS-PCR–RFLP pattern (Fig. 6), and their PFGE patternswere different from each other (Table 3 and Fig. 7). The treein Fig. 5 lacks sequences of 14 Pectobacterium isolates used byMa et al. (20); thus, approximately two-thirds of the Pectobac-terium data are shared by the two trees.

All of the isolates from Wisconsin potato fields were iden-tified as either P. carotovorum or P. wasabiae and are in clade1, 2, or 5. The 22 Pectobacterium isolates included in both thisanalysis and the analysis of Ma et al. (20) were placed in thesame clades in both trees. Pectobacterium species assignmentsfor strains are shown in Table 1 and are based on a combina-tion of MLSA and PFGE results. Some strains with identicalPFGE patterns from different sources were included in ourMLSA (such as WPP161 and WPP168) and previous MLSA(such as WPP14 and Ecc380) (20) and were found to havenearly identical DNA sequences; thus, strains with identicalPFGE patterns from the same tuber or stem were assumed tobe clonal. We found strains belonging to multiple clades in all

FIG. 3. Genomic DNA from WPP17 and WPP172 were unable to hybridize to two genes flanking the T3SS region, ECA2075 and hecB,respectively. Genomic DNA was digested with SacII and EcoRV and then hybridized with hecB or ECA2075 probes. The presence of T3SS andthe flanking regions is indicated on the right. Lane 1, WPP14; lane 2, WPP17; lane 3, WPP161; lane 4, WPP163; lane 5, WPP165; lane 6, WPP168;lane 7, WPP172; lane 8, WPP178.

4544 KIM ET AL. APPL. ENVIRON. MICROBIOL.

on March 4, 2021 by guest

http://aem.asm

.org/D

ownloaded from

seven fields, and twice we isolated strains belonging to multipleclades from single tubers (Table 1).

We examined the isolates using the 16S-23S ITS-PCR–RFLP method as described by Toth et al. (34) with the hopethat a method that is faster and simpler than MLSA could beused to reliably identify Pectobacterium species. We found twoITS-PCR–RFLP patterns for P. carotovorum subsp. carotovo-

rum strains, one of which was described previously (34) (Fig.6). Similarly, we found two patterns for P. carotovorum subsp.brasiliensis strains, one of which was described previously (34).The pattern for WPP17, which is at the base of the P. caroto-vorum subsp. brasiliensis clade and which lacks a T3SS, was yeta third pattern, which was identical to a pattern described byToth et al. (34). We also found two ITS-PCR–RFLP patterns

FIG. 4. Presence of the Pectobacterium T3SS was not correlated with the ability to macerate potato tubers (A) or cause disease in stems (B).For the inoculated tubers, the bars indicate the amounts of tissue macerated, and the error bars indicate the standard errors for 30 to 36 replicates.Bars with the same letter are not significantly different according to a least significant difference test at a P value of 0.05. Pc, Pw, and Pb indicatethat isolates were identified as P. carotovorum subsp. carotovorum, P. wasabiae, and P. carotovorum subsp. brasiliensis, respectively. For theinoculated stems, the bars indicate lesion lengths 7 days postinoculation, and the error bars indicate the standard errors for 14 to 20 replicates.Bars with the same letter were not significantly different according to a least significant difference test at a P value of 0.05. dH2O, distilled water;NC, control.

VOL. 75, 2009 T3SS-DEFICIENT PECTOBACTERIUM STRAINS 4545

on March 4, 2021 by guest

http://aem.asm

.org/D

ownloaded from

for P. wasabiae, one of which was described previously (34) andone of which was identical to the pattern obtained for some P.carotovorum subsp. carotovorum strains. WPP19, which is atthe base of the P. wasabiae clade, had a pattern similar to thatobtained for the majority of the P. wasabiae strains and alsosimilar to that of some of the P. carotovorum subsp. carotovo-rum strains. Since P. carotovorum subsp. carotovorum strains,such as WPP14, and P. wasabiae strains, such as WPP161, haveidentical ITS-PCR–RFLP patterns, the 16S-23S ITS-PCR–

RFLP method could not be used to reliably place Pectobacte-rium isolates into taxa.

To determine if Pectobacterium strains isolated from indi-vidual tubers were clonal and to determine if PFGE patternscould be correlated with Pectobacterium clades, genomic DNAwas digested with endonuclease I-CeuI and separated byPFGE (Fig. 7). I-CeuI specifically targets a 26-bp sequence on23S rRNA genes of bacterial rrn operons; thus, the number ofdigested fragments represents the number of rrn operons on

FIG. 5. Character and substitution weight parsimony phylogeny generated by using concatenated sequences of six housekeeping genes of 51isolates, including 4 Brenneria sp. isolates, 10 Dickeya sp. isolates, 4 Yersinia sp. isolates, and 33 Pectobacterium sp. isolates. The numbers forPectobacterium sp. indicate the clades, as follows; 1, P. carotovorum subsp. brasiliensis; 2, P. carotovorum subsp. carotovorum; 3, P. atrosepticum; 4,P. betavasculorum; and 5, P. wasabiae. The strains whose designations begin with ATCC are the type strains of species. Primer sets were designedto amplify fragments of six conserved housekeeping genes: acnA, gapA, icdA, mdh, pgi, and proA. Bootstrap values (expressed as percentages for1,000 replications) are indicated only for branches also retrieved by MP and NJ analyses. Yersinia sp. strains were used as an outgroup for theseanalyses. Details for strains used in a previous analysis were described by Ma et al. (20), and the new strains are described in Table 1.

4546 KIM ET AL. APPL. ENVIRON. MICROBIOL.

on March 4, 2021 by guest

http://aem.asm

.org/D

ownloaded from

the chromosome. PFGE profiles were obtained for 42 of the 45isolates obtained in 2004 examined (Table 3 and Fig. 7). Asexpected, digestion of all Pectobacterium isolates yielded five orsix fragments ranging from 50 to 1,000 kb long (Fig. 7) and alarge fragment over 3,000 kb long (not shown) (35). A total offour distinct I-CeuI PFGE pulsotypes were observed, and allisolates from each individual tuber had identical patterns. Un-fortunately, we were unable to obtain PFGE data for WPP168,which was a T3SS-deficient isolate obtained from a tuber alsocontaining T3SS-encoding isolates. Strains with identicalPFGE pulsotypes were also obtained from fields A and C; thus,isolates with the same pulsotype may be obtained from multi-ple locations. We gave the PFGE pulsotypes arbitrary num-bers, and only pulsotypes 1 and 8 were seen in 2001 and 2004.P. carotovorum Ecc71, a model strain used for many years tostudy P. carotovorum genetics, was also a pulsotype 1 strain(35). The P. wasabiae PFGE pattern differed from the other

patterns in that only five fragments smaller than 1,000 kb wereapparent, suggesting that strains in the P. wasabiae clade con-tain six rRNA operons rather than the seven operons found inthe other Pectobacterium species. WPP17, which is most closelyrelated to P. carotovorum subsp. brasiliensis and which alsolacks a T3SS, also appears to contain only six rRNA operons(35).

DISCUSSION

In this work we examined strains collected from seven dif-ferent fields in 2001 and/or 2004. We tested three methods fortyping the Pectobacterium isolates and found that MLSA pro-vided the most unambiguous species identification. ITS-PCR–RFLP analysis resulted in identical patterns for different spe-cies, while PFGE resulted in numerous patterns per species.We used a combination of these methods to demonstrate thatP. carotovorum subsp. brasiliensis, P. carotovorum subsp. caro-tovorum, and P. wasabiae can be found in single fields and thatthese taxa are sometimes present together in single infectedplants. Because multiple taxa were found in each field and insome individual samples, we decided to halt analysis of fieldsamples until a method that can differentiate strains in Pecto-bacterium clades directly from field samples can be developed.

We also found that Pectobacterium strains lacking the T3SScan be isolated from diseased tubers and that the T3SS-defi-cient strains are still virulent in potato tubers and stems. Arecent draft sequence of WPP163 shows that the T3SS is in-deed not present in this strain (N. T. Perna, unpublished data;NCBI Genome Project ID 31293). Since we used high inocu-lum levels, we cannot rule out the possibility that the T3SS-encoding Pectobacterium strains may be able to better colonizeplants or cause disease when bacteria are inoculated at lowerconcentrations, under environmental conditions, or into hostsor tissues that were not examined. It should not be assumedthe T3SS-deficient P. wasabiae isolates are secondary invaderssince P. wasabiae was the only species isolated from somesamples, and P. wasabiae is capable of causing disease in bothstems and tubers.

Recent genomic analyses of three Pectobacterium genomesrevealed that gene clusters identified as clusters important for

FIG. 6. 16S-23S ITS-PCR–RFLP patterns of Pectobacterium strains. The 16S-23S ITS region was amplified with primers L1 and G1, and theamplified DNA was digested with RsaI and then analyzed by gel electrophoresis. The strains used are indicated above the lanes, and strains aregrouped into the clades defined by the MLSA. dH2O, distilled water.

FIG. 7. Four representative I-CeuI patterns for the 42 Pectobacte-rium isolates obtained from diseased potato tubers in Wisconsin in2004. WPP14 was isolated in 2001 from a diseased potato plant withaerial stem rot. Fragments more than 1,000 kb long are not shown. Thefields from which the strains originated and the numbers of strains witheach pattern are indicated at the bottom. Lane M contained markers.

VOL. 75, 2009 T3SS-DEFICIENT PECTOBACTERIUM STRAINS 4547

on March 4, 2021 by guest

http://aem.asm

.org/D

ownloaded from

virulence in P. atrosepticum are not present in one or bothsequenced P. carotovorum genomes (10). Similarly, our resultsshow that Pectobacterium sp. strains lacking the T3SS, whichhas been reported to play a role in Pectobacterium virulence(15, 26), can be isolated from diseased tubers. The T3SS-deficient strains are likely to have lost a T3SS rather than tonever have had one since closely related T3SS genes arepresent in the same relative chromosomal position in bothDickeya and Pectobacterium, suggesting that the T3SS was ac-quired by the common ancestor of these two soft rot genera.The mosaic of the virulence genes present in these Pectobac-terium species suggests that different strains use different toolsto overcome plant barriers. P. wasabiae WPP172, but not theother P. wasabiase strains, also lacks at least one gene, hecB,that flanks the T3SS gene cluster in Pectobacterium and Dick-eya and that plays a role in Dickeya virulence (28). Finally, boththe T3SS-deficient strains in the P. wasabiae clade and P.carotovorum WPP17 appear to contain only six rRNA operons,rather than the seven rRNA operons found in all other Pecto-bacterium strains analyzed. Spontaneous deletion of rrn oper-ons has been reported for Yersinia species as well (6). It ap-pears that deletion of an rrn operon, as well as deletion of theT3SS, occurred at least twice in the genus Pectobacterium.

Strains lacking a functional T3SS have been reported for theplant pathogens Pseudomonas syringae (22) and Erwinia pyri-foliae (18). P. wasabiae differs from these plant pathogens sinceit lacks a T3SS, but it is still virulent. Also, in contrast toT3SS-deficient P. syringae strains, which are closely related toeach other and separate from pathogenic P. syringae (22),T3SS-deficient Pectobacterium strains fall into two species, P.carotovorum and P. wasabiae. The T3SS-deficient Pectobacte-rium strains may be most analogous to the animal pathogenPseudomonas aeruginosa. Strains of this human pathogen iso-lated from patients with chronic lung infections are typicallyT3SS deficient, even though 90% of environmental P. aerugi-nosa isolates encode a T3SS (17).

The reported host range of Pectobacterium expands regu-larly, but it is challenging to identify the Pectobacterium speciesisolated from newly identified hosts, as well as from commonlystudied hosts, such as potato. Of the three DNA-based meth-ods that we used to characterize isolates, MLSA provided themost unambiguous results and allowed us to place isolates intodefined clades with strong branch support (20), while the othertwo methods could not be used to unambiguously place iso-lates into taxa. All three methods tested suffer from the limi-tation that they can be used only with pure cultures. However,combination of the MLSA data with genome sequence datashould aid in the development of sensitive assays capable ofdetecting and classifying Pectobacterium strains directly fromfield samples, thereby allowing tracking of these taxa in theenvironment that is more efficient than the tracking that can bedone with currently available assays.

The MLSA method appears to be robust for classification ofPectobacterium. One-third of the Pectobacterium isolates in theMLSA tree differ from the isolates used previously (20), andthis did not change the clades into which the remaining Pec-tobacterium isolates were placed. We defined clade 2 as a cladethat includes both P. carotovorum subsp. carotovorum andP. carotovorum subsp. P. carotovorum subsp. odoriferum(SCRI482). P. carotovorum subsp. odoriferum was established

based on DNA hybridization with three P. carotovorum strains(8), one of which was later determined not to be a P. caroto-vorum strain (9). Further review of P. carotovorum phylogeny isneeded to determine if maintaining this subspecies designationis appropriate. As shown previously (20), Brenneria isolates didnot form a monophyletic clade. Sequence data for additionalBrenneria isolates are required to resolve how they are relatedto each other and to the soft rot enterobacteria.

ACKNOWLEDGMENTS

We thank Jane and Jeff Breuer for their invaluable assistance withour plant experiments. We also thank Ruth Genger, Courtney Jahn,Maria del Pilar Marquez Villavicencio, Mafmudije Selimi, Mee-NganYap, Ralph Reedy, Jennifer Apodaca, and Bryan Biehl for their as-sistance and suggestions.

This study was supported by National Science Foundation award0412599 (“BE/GenEn: Genome-Enabled Analyses of Natural Popula-tions of Pathogens on Natural Hosts”) and funds from the WisconsinPotato and Vegetable Growers.

REFERENCES

1. Avrova, A. O., L. J. Hyman, R. L. Toth, and I. K. Toth. 2002. Application ofamplified fragment length polymorphism fingerprinting for taxonomy andidentification of the soft rot bacteria Erwinia carotovora and Erwinia chry-santhemi. Appl. Environ. Microbiol. 68:1499–1508.

2. Bauer, D. W., A. J. Bogdanove, S. V. Beer, and A. Collmer. 1994. Erwiniachrysanthemi hrp genes, and their involvement in soft rot pathogenesis andelicitation of the hypersensitive response. Mol. Plant-Microbe Interact.7:573–581.

3. Bell, K. S., M. Sebaihia, L. Pritchard, M. T. G. Holden, L. J. Hyman, M. C.Holeva, N. R. Thomson, S. D. Bentley, L. J. C. Churcher, K. Mungall, R.Atkin, N. Bason, K. Brooks, T. Chillingworth, K. Clark, J. Doggett, A.Fraser, Z. Hance, H. Hauser, K. Jagels, S. Moule, H. Norbertczak, D.Ormond, C. Price, M. A. Quail, M. Sanders, D. Walker, S. Whitehead,G. P. C. Salmond, P. R. J. Birch, J. Parkhill, and I. K. Toth. 2004. Genomesequence of the enterobacterial phytopathogen Erwinia carotovora subsp.atroseptica and characterization of virulence factors. Proc. Natl. Acad. Sci.USA 101:11105–11110.

4. Burkholder, W. H., L. A. McFadden, and A. W. Dimock. 1953. A bacterialblight of chrysanthemums. Phytopathology 43:522–526.

5. De Boer, S. H., and M. Sasser. 1986. Differentiation of Erwinia carotovorasubsp. carotovora and E. carotovora subsp. atroseptica on the basis of cellularfatty acid composition. Can. J. Microbiol. 32:796–800.

6. Deng, W., V. Burland, G. I. Plunkett, A. Boutin, G. F. Mayhew, P. Liss, N. T.Perna, D. J. Rose, B. Mau, S. Zhou, D. C. Schwartz, J. D. Fetherston, L. E.Lindler, R. R. Brubaker, G. V. Plano, S. C. Straley, K. A. McDonough, M. L.Nilles, J. S. Matson, F. R. Blattner, and R. D. Perry. 2002. Genome sequenceof Yersinia pestis KIM. J. Bacteriol. 184:4601–4611.

7. Duarte, V., S. H. De Boer, L. J. Ward, and M. C. de Oliveira. 2004. Char-acterization of atypical Erwinia carotovora strains causing blackleg of potatoin Brazil. J. Appl. Microbiol. 96:535–545.

8. Gallois, A., R. Samson, E. Ageron, and P. A. D. Grimont. 1992. Erwiniacarotovora subsp. odorifera subsp. nov., associated with odorous soft rot ofchicory (Cichorium intybus L.). Int. J. Syst. Bacteriol. 42:582–588.

9. Gardan, L., C. Gouy, R. Christen, and R. Samson. 2003. Elevation of threesubspecies of Pectobacterium carotovorum to species level: Pectobacteriumatrosepticum sp. nov., Pectobacterium betavasculorum sp. nov. and Pectobac-terium wasabiae sp. nov. Int. J. Syst. Evol. Microbiol. 53:381–391.

10. Glasner, J. D., M. Marquez-Villavicencio, H.-S. Kim, C. E. Jahn, B. Ma,B. S. Biehl, A. I. Rissman, B. Mole, X. Yi, C.-H. Yang, J. L. Dangl, S. R.Grant, N. T. Perna, and A. O. Charkowski. 2008. Niche-specificity and thevariable fraction of the Pectobacterium pan-genome. Mol. Plant-MicrobeInteract. 21:1549–1560.

11. Goto, M., and K. Matsumoto. 1987. Erwinia carotovora subsp. wasabiaesubsp. nov. isolated from diseased rhizomes and fibrous roots of Japanesehorseradish (Eutrema wasabi Maxim.). Int. J. Syst. Bacteriol. 37:130–135.

12. Graham, D. C., and W. J. Dowson. 1960. The coliform bacteria associatedwith potato black-leg and other soft rots. I. Their pathogenicity in relation totemperature. Ann. Appl. Biol. 48:51–57.

13. Grant, S. R., E. J. Fisher, J. H. Chang, B. M. Mole, and J. L. Dangl. 2006.Subterfuge and manipulation: type III effector proteins of phytopathogenicbacteria. Annu. Rev. Microbiol. 60:425–449.

14. Gross, D. C., M. L. Powelson, K. M. Regner, and G. K. Radamaker. 1991. Abacteriophage-typing system for surveying the diversity and distribution ofstrains of Erwinia carotovora in potato fields. Phytopathology 81:220–226.

15. Holeva, M. C., K. S. Bell, L. J. Hyman, A. O. Avrova, S. C. Whisson, P. R. J.

4548 KIM ET AL. APPL. ENVIRON. MICROBIOL.

on March 4, 2021 by guest

http://aem.asm

.org/D

ownloaded from

Birch, and I. K. Toth. 2004. Use of a pooled transposon mutation grid todemonstrate roles in disease development for Erwinia carotovora subsp.atroseptica putative type III secreted effector (DspE/A) and helper (HrpN)proteins. Mol. Plant-Microbe Interact. 17:943–950.

16. Hyman, L. J., L. Sullivan, I. K. Toth, and M. C. M. Perombelon. 2001.Modified crystal violet pectate medium (CVP) based on a new polypectatesource (Slendid) for the detection and isolation of soft rot erwinias. PotatoRes. 44:265–270.

17. Jain, M., D. Ramirez, R. Seshadri, J. F. Cullina, C. A. Powers, G. S. Schulert,M. Bar-Meir, C. L. Sullivan, S. A. McColley, and A. R. Hauser. 2004. TypeIII secretion phenotypes of Pseudomonas aeruginosa strains change duringinfection of individuals with cystic fibrosis. J. Clin. Microbiol. 42:5229–5237.

18. Jock, S., W.-S. Kim, M.-A. Barny, and K. Geider. 2003. Molecular charac-terization of natural Erwinia pyrifoliae strains deficient in hypersensitiveresponse Appl. Environ. Microbiol. 69:679–682.

19. Lehtimaki, S., A. Rantakari, J. Routtu, A. Tuikkala, J. Li, O. Virtaharju,E. T. Palva, M. Romantschuk, and H. T. Saarilahti. 2003. Characterizationof the hrp pathogenicity cluster of Erwinia carotovora subsp. carotovora: highbasal level expression in a mutant is associated with reduced virulence. Mol.Genet. Genomics 270:263–272.

20. Ma, B., M. E. Hibbing, H.-S. Kim, R. M. Reedy, I. Yedidia, J. Breuer, J.Breuer, J. D. Glasner, N. T. Perna, A. Kelman, and A. O. Charkowski. 2007.The host range and molecular phylogenies of the soft rot enterobacterialgenera Pectobacterium and Dickeya. Phytopathology 97:1150–1163.

21. Maher, E. A., S. H. De Boer, and A. Kelman. 1986. Serogroups of Erwiniacarotovora involved in systemic infection of potato plants and infestation ofprogeny tubers. Am. Potato J. 63:1–11.

22. Mohr, T. J., H. Liu, S. Yan, C. E. Morris, J. A. Castillo, J. Jelenska, and B. A.Vinatzer. 2008. Naturally occurring nonpathogenic isolates of the plantpathogen Pseudomonas syringae lack a type III secretion system and effectorgene orthologues. J. Bacteriol. 190:2858–2870.

23. Pitman, A. R., P. J. Wright, M. D. Galbraith, and S. A. Harrow. 2008.Biochemical and genetic diversity of pectolytic enterobacteria causing softrot disease of potatoes in New Zealand. Aust. J. Plant Pathol. 37:559–568.

24. Posada, D., and T. R. Buckley. 2004. Model selection and model averagingin phylogenetics: advantages of akaike information criterion and bayesianapproaches over likelihood ratio tests. Syst. Biol. 53:793–808.

25. Posada, D., and K. A. Crandall. 1998. MODELTEST: testing the model ofDNA substitution. Bioinformatics 14:817–818.

26. Rantakari, A., O. Virtaharju, S. Vahamiko, S. Taira, E. T. Palva, H. T.Saarilahti, and M. Romantschuk. 2001. Type III secretion contributes to thepathogenesis of the soft-rot pathogen Erwinia carotovora: partial character-ization of the hrp gene cluster. Mol. Plant-Microbe Interact. 14:962–968.

27. Ribot, E. M., C. Fitzgerald, K. Kubota, B. Swaminathan, and T. J. Barret.2001. Rapid pulsed-field gel electrophoresis protocol for subtyping of Cam-plobacter jejuni. J. Clin. Microbiol. 39:1889–1894.

28. Rojas, C. M., J.-H. Ham, W.-L. Deng, J. J. Doyle, and A. Collmer. 2002.HecA is a member of a class of adhesins produced by diverse pathogenicbacteria and contributes to the attachment, aggregation, epidermal cell kill-ing, and virulence phenotypes of Erwinia chrysanthemi EC16 on Nicotianaclevelandii seedlings. Proc. Natl. Acad. Sci. USA 99:13142–13147.

29. Schaad, N. W., J. B. Jones, and W. Chun. 2001. Laboratory guide foridentification of plant pathogenic bacteria, 3rd ed. APS Press, St. Paul, MN.

30. Segall, R. H. 1971. Selective medium for enumerating Erwinia species com-monly found in vegetable packinghouse waters. Phytopathology 61:425–426.

31. Swaminathan, B., T. J. Barrett, S. B. Hunter, and R. V. Tauxe. 2001.PulseNet: the molecular subtyping network for foodborne bacterial diseasesurveillance, United States. Emerg. Infect. Dis. 7:382–389.

32. Tamura, K., and M. Nei. 1993. Estimation of the number of nucleotidesubstitutions in the control region of mitochondrial DNA in humans andchimpanzees. Mol. Biol. Evol. 10:512–526.

33. Thomson, S. V., D. C. Hildebrand, and M. N. Schroth. 1981. Identificationand nutritional differentiation of the Erwinia sugarbeet pathogen from mem-bers of Erwinia carotovora and Erwinia chrysanthemi. Phytopathology 71:1037–1042.

34. Toth, I. K., A. O. Avrova, and L. J. Hyman. 2001. Rapid identification anddifferentiation of the soft rot erwinias by 16S-23S intergenic transcribedspacer-PCR and restriction fragment length polymorphism analyses. Appl.Environ. Microbiol. 67:4070–4076.

35. Yap, M.-N., J. D. Barak, and A. O. Charkowski. 2004. Genomic diversity ofErwinia carotovora subsp. carotovora and its correlation with virulence. Appl.Environ. Microbiol. 70:3013–3023.

VOL. 75, 2009 T3SS-DEFICIENT PECTOBACTERIUM STRAINS 4549

on March 4, 2021 by guest

http://aem.asm

.org/D

ownloaded from