molecular dissection of g-protein coupled receptor ...€¦ · figure ii.1: sequence weighting...
TRANSCRIPT
![Page 1: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/1.jpg)
MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR SIGNALING AND OLIGOMERIZATION
BY
MICHAEL RIZZO
A Dissertation Submitted to the Graduate Faculty of
WAKE FOREST UNIVERSITY GRADUATE SCHOOL OF ARTS AND SCIENCES
in Partial Fulfillment of the Requirements
for the Degree of
DOCTOR OF PHILOSOPHY
Biology
December, 2019
Winston-Salem, North Carolina
Approved By:
Erik C. Johnson, Ph.D. Advisor
Wayne E. Pratt, Ph.D. Chair
Pat C. Lord, Ph.D.
Gloria K. Muday, Ph.D.
Ke Zhang, Ph.D.
![Page 2: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/2.jpg)
ii
ACKNOWLEDGEMENTS
I would first like to thank my advisor, Dr. Erik Johnson, for his support, expertise,
and leadership during my time in his lab. Without him, the work herein would not be
possible. I would also like to thank the members of my committee, Dr. Gloria Muday, Dr.
Ke Zhang, Dr. Wayne Pratt, and Dr. Pat Lord, for their guidance and advice that helped
improve the quality of the research presented here.
I would also like to thank members of the Johnson lab, both past and present, for
being valuable colleagues and friends. I would especially like to thank Dr. Jason Braco,
Dr. Jon Fisher, Dr. Jake Saunders, and Becky Perry, all of whom spent a great deal of
time offering me advice, proofreading grants and manuscripts, and overall supporting me
through the ups and downs of the research process.
Finally, I would like to thank my family, both for instilling in me a passion for
knowledge and education, and for their continued support. In particular, I would like to
thank my wife Emerald – I am forever indebted to you for your support throughout this
process, and I will never forget the sacrifices you made to help me get to where I am
today.
![Page 3: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/3.jpg)
iii
TABLE OF CONTENTS
ACKNOWLEDGEMENTS………………………………………………………………ii
TABLE OF CONTENTS………………………………………………………………...iii
LIST OF ABBREVIATIONS…………………………………………………………….v
LIST OF TABLES………………………………………………………………………..x
LIST OF FIGURES………………………………………………………………………xi
ABSTRACT……………………………………………………………………………..xii
CHAPTER I: G-protein coupled receptors– A review of structure-function relationships
critical for receptor signaling ……………………………………..………………………1
REFERENCES…………………………………………………………………..37
CHAPTER II: Unexpected role of a conserved domain in extracellular loop 1 in G
protein coupled receptor trafficking……………………………………………………...56
ABSTRACT……………………………………………………………………...57
INTRODUCTION……………………………………………………………….58
METHODS………………………………………………………………………60
RESULTS………………………………………………………………………..63
DISCUSSION……………………………………………………………………68
REFERENCES…………………………………………………………………..72
![Page 4: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/4.jpg)
iv
CHAPTER III: Homodimerization of Drosophila Class A neuropeptide GPCRs:
Evidence for conservation of GPCR dimerization throughout metazoan evolution…….89
ABSTRACT……………………………………………………………………..90
INTRODUCTION……………………………………………………………….91
METHODS………………………………………………………………………97
RESULTS………………………………………………………………………100
DISCUSSION…………………………………………………………………..104
REFERENCES…………………………………………………………………108
CHAPTER IV: Conclusions and future directions……………….…………………….125
REFERENCES…………………………………………………………………129
CURRICULUM VITAE………………………………………………………………..130
![Page 5: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/5.jpg)
v
LIST OF ABBREVIATIONS
5HT 5 Hydroxytryptophan
A2A Adenosine receptor 2A
A3 Adenosine Adenosine receptor 3
AC Adenylyl cyclase
AKHR AKH receptor
AM Adrenomedullin
AMP Adenosine monophosphate
ANOVA Analysis of variance statistical models
AOI Area of interest
AstCR2 Drosophila allatostatin C receptor 2
AT1R Angiotensin 1 receptor
B1AR Adrenergic receptor beta 1
B2AR Adrenergic receptor beta 2
BiFC Biomolecular fluorescence complementation
BK2R Bradykinin receptor 2
BLAST Basic local alignment search tool
BN-PAGE Blue native polyacrylamide gel electrophoresis
BRET Bioluminescent resonance energy transfer
C5aR Complement component 5a receptor
cAMP Cyclic adenosine monophosphate
CCR2b Chemokine receptor type 2b
CCR5 Chemokine receptor type 5
![Page 6: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/6.jpg)
vi
CFP Cyan flourescent protein
cGMP Cyclic guanosine monophosphate
CGRP Calcitonin gene-related peptide
CHO Chinese hamster ovary cells
CLR Calcitonin-like receptor
Co-IP Co-immunoprecipitation
CPS Counts per second
CRD Cysteine-rich domain
CRE cAMP response elements
CREB cAMP response element-binding protein
CRZR Corazonin receptor
CXCR4 C-X-C chemokine receptor type 4
D2R Dopamine receptor D2
DAF Abnormal Dauer formation
DAG Diacylglycerol
DMEM Dulbecco’s modified Eagle medium
EL Extracellular loop
EPAC Exchange protein activated by cyclic-AMP
ER Endoplasmic reticulum
FRET Fluorescent resonance energy transfer
FSHR Follicle stimulating hormone receptor
GABA Gamma aminobutyric acid
GALR1 Galanin receptor
![Page 7: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/7.jpg)
vii
GPCR G protein-coupled receptor
GDP Guanosine diphosphate
GEF Guanine nucleotide exchange factor
GFP Green fluorescent protein
GIPs GPCR interacting protein
GIRK G protein-gated inwardly rectifying potassium
GMP Guanosine monophosphate
GnRH Gonadotropin releasing hormone
GRKs G protein-coupled receptor kinases
GRP Gastrin-releasing peptide
GTP Guanosine triphosphate
H1R Histamine receptor 1
H2R Histamine receptor 2
HA Hemaglutinin
HEK Human embryonic kidney cells
IP3 Inositol triphosphate
LH Luteinizing hormone
LK Leucokinin
M1R Muscarinic acetylcholine receptor 1
M3R Muscarinic acetylcholine receptor 3
MAPK Mitogen activated protein kinase
mGlu2R Metabotropic glutamate receptor 2
NFkB Nuclear factor kappa-light-chain-enhancer of B cells
![Page 8: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/8.jpg)
viii
NK1R Neurokinin 1 Receptor
NK2R Neurokinin 2 Receptor
NKA Neurokinin A
NMU Neuromedin U
NPFR Drosophila NPF receptor
NPY Neuropeptide Y
ORF Open reading frame
OX1 Orexin receptor 1
PCR Polymerase chain reaction
PIP2 Phosphatidylinositol 4,5-bisphosphate
PK1R Drosophila pyrokinin receptor 1
PKA Protein kinase A
PKC Protein kinase C
PLC Phospholipase C
ProcR Proctolin receptor
PSD-95 Postsynaptic density protein 95
RAMPs Receptor-activity modifying proteins
RCP Receptor component protein
RGS Regulators of G-protein signaling
SpIDA Spatial intensity distribution analysis
SPRINP Single primer reactions in parallel
SRE-Luc Serum response element
SSTR2 Somatostatin receptor 2
![Page 9: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/9.jpg)
ix
T1R1 Taste receptor type 1 receptor 1
T1R3 Taste receptor type 1 receptor 3
T2R Taste receptor type 2
TKR86C Tachykinin receptor at 86C
TM Transmembrane domain
TR-FRET Time-resolved fluorescence resonance energy transfer
TRH Thyrotropin-releasing hormone
TSHR Thyroid stimulating hormone receptor
VFT Venus fly trap domain
WGA Wheat germ agglutinin
YFP Yellow fluorescent protein
α2b-AR Alpha-2B adrenergic receptor
β2AR Beta-2 adrenergic receptor
![Page 10: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/10.jpg)
x
LIST OF TABLES
Table II.1: Comparison of representative extracellular loop 1 sequences across Class A
GPCR subfamilies………………………………………………………………………77
Table III.1: Receptors utilized in FRET dimer screen………………………………...122
Table III.2: List of primers used for directional cloning of receptor cDNA into pcDNA3
CFP or pcDNA3 YFP expression vectors………………………………………………123
![Page 11: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/11.jpg)
xi
LIST OF FIGURES
FIGURE I.1: Two-state model of GPCR activation……………………………………54
FIGURE I.2: Functional importance of GPCR heterodimerization…………………….55
FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan
residue exhibits high conservation in Class A GPCR receptor subfamilies…………….79
FIGURE II.2: Mutagenesis of conserved tryptophan residue in LKR ECL1 ablates
receptor signaling………………………………………………………………………..80
FIGURE II.3: Leucine substitution for the conserved tryptophan residue in extracellular
loop 1 leads to a loss of function in multiple receptor types…………………………….82
FIGURE II.4: Substitution of the conserved tryptophan residue to leucine ablates
constitutive activity in a constitutively active AKHR mutant…………………………...84
FIGURE II.5: The WxFG motif is critical for proper receptor trafficking..……………85
FIGURE II.6: Putative tertiary structures of wild type LKR and mutant W101L are
superimposed to identify gross changes in receptor topology…………………………...88
FIGURE III.1: Demonstration of acceptor-photobleaching FRET assay……………..116
FIGURE III.2: Verification of experimental system………………………………….117
FIGURE III.3: Multiple Drosophila Class A neuropeptide receptors exhibit FRET
responses consistent with homodimerization…………………………………………...119
FIGURE III.S1: Verification of signaling in fluorophore tagged receptors..................124
![Page 12: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/12.jpg)
xii
ABSTRACT
G protein coupled receptors (GPCRs) are a superfamily of transmembrane
proteins responsible for transducing extracellular stimuli into intracellular responses.
GPCRs are indispensable to a vast variety of distinct physiologies and behaviors and
represent approximately 50% of all human drug targets. However, considerable debate
exists as to the structural basis for GPCR activation, with a classical monomeric (two
state model) conflicting with a growing number of reports indicating that these receptors
form higher order functional oligomers. These receptor-receptor interactions can impact
receptor trafficking, ligand sensitivity, desensitization, and strength of effector response.
As such, an understanding of GPCR oligomerization is indispensable to our overall
understanding of receptor dynamics. Additionally, the specific molecular events
underlying receptor activation and signaling remain incompletely understood. Since the
initial discovery of the GPCR receptor family, a number of conserved amino acid motifs
have been identified that have been shown to play specific and critical roles in GPCR
activation, intracellular G-protein coupling, and receptor desensitization. Still, many of
these motifs remain incompletely described, with some motifs having only been
evaluated in a small subset of receptors, and experimental evidence suggests that in some
cases, these conserved motifs may have divergent roles in specific receptor subfamilies.
As such, the conservation of these motifs throughout GPCR evolution represents and
interesting and unresolved aspect of GPCR function.
The goal of this research was two-fold. In one study, I utilized a combination of
bioinformatics, site-directed mutagenesis, signaling assays, and fluorescent microscopy
techniques to evaluate the functional role and evolutionary conservation of a specific
![Page 13: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/13.jpg)
xiii
amino acid motif, the WxFG motif, which is present in approximately 90% of all Class A
receptors. Our investigation showed that, in contrast to previous studies of this motif,
disruption of the WxFG motif results in trafficking defects across a range of GPCRs
representing multiple Class A GPCR subfamilies, regardless of taxa. A second study
evaluated whether Drosophila GPCRs, specifically a subset of neuropeptide receptors,
assembled as higher order structures at the plasma membrane. While there have been
many receptors shown to assemble as dimers or oligomers at the plasma membrane since
the phenomenon was first recognized over two decades ago, the majority of these studies
focused on vertebrate GPCRs, and the question of whether invertebrate GPCRs show
similar phenotypes has been poorly evaluated, and to date, no Drosophila GPCR has
been empirically demonstrated to assemble as a dimer. To gain a deeper understanding of
GPCR molecular assembly, I evaluated multiple Drosophila receptors utilizing FRET
microscopy to determine both the prevalence of GPCR dimerization among Drosophila
neuropeptide receptors, and determine whether dimerization is conserved across taxa in
specific receptor subfamilies. This investigation showed that all Drosophila GPCRs
tested were able to assemble as homodimers when expressed in a heterologous expression
system, suggesting that not only do Drosophila GPCRs likely assemble as higher order
structures at the plasma membrane, but also that the phenomenon of receptor
dimerization is an ancient property of the receptor superfamily that has been conserved
throughout GPCR evolution. Taken together, these investigations further our
understanding of the molecular events underlying GPCR signaling, and suggest that
many aspects of receptor function are not taxa specific, and are likely fundamental
![Page 14: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/14.jpg)
xiv
features of GPCR function that have been conserved throughout the evolution of this
receptor superfamily.
![Page 15: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/15.jpg)
1
CHAPTER I: G protein-coupled receptors– A review of structure-function
relationships critical for receptor signaling.
G protein-coupled receptors, or GPCRs, are the largest cell surface receptor
superfamily in humans1. They are characterized by a conserved molecular structure, with
seven transmembrane domains, an extracellular N terminus, and an intracellular C
terminus. Their primary function is to transduce a variety of extracellular stimuli,
including but not limited to light, ions, small molecules, steroids, and peptides, into
appropriate intracellular responses2. These receptors play a critical role in a variety of
physiologies and behaviors including but not limited to vision, gustation, olfaction, stress
response, cellular communication, reproduction, and development. GPCRs are further
classified based on structural and sequence homology into one of six classes: the Class A,
rhodopsin-like receptors, which represent the largest and most diverse class of GPCRs,
the Class B, secretin-like receptors, the Class C, metabotropic glutamate-like receptors,
the Class D, fungal mating type receptors, the Class E, cyclic AMP receptors found in
Dictostelium slime molds, and the Class F, Frizzled/Smoothened receptors3. Given the
extent that GPCRs mediate cellular communication and function across an incredible
range of biological systems, as well as their therapeutic importance, as approximately
50% of all drugs on market target a GPCR, it is unsurprising that they have been a
significant research focus since the first GPCR was molecularly cloned in 19864,5. This
research, along with the sequencing of multiple genomes , has led to number of
individual GPCRs being identified, with the human genome alone encoding
approximately 800 different receptors1. Despite this, the mechanisms associated with
GPCR activation and signaling remain incompletely understood., Accumulating evidence
![Page 16: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/16.jpg)
2
shows that many GPCRs exhibit the ability to form dimeric or oligomeric structures with
other GPCRs. Oligomeric association results in a variety of impacts on trafficking,
signaling, and overall function. This observation suggests that GPCRs themselves may
represent allosteric regulators of other GPCRs, and that the functional unit for many
GPCRs may be two receptors assembled as a dimer, rather than individual receptor
monomers6. This phenomenon is further complicated by the fact that a single receptor
may form dimers with either other identical receptors (homodimers) or unrelated GPCRs
(heterodimers), complicating issues such as ligand selectivity and intracellular receptor
coupling. This chapter will serve to review the events associated with GPCR signaling
and common intracellular GPCR pathways, as well as specific amino acid motifs that
have been identified as playing critical roles in GPCR activation and signaling. I will also
review allosteric modulation of GPCRs and GPCR dimerization, as well as discuss the
impact of these phenomena on GPCR function. We will begin with an overview of the
molecular events associated with GPCR activity.
Classical Model of GPCR Activation
The receptor superfamily is named for the intracellular machinery they couple to
– a heterotrimeric G-protein consisting of α and βγ subunits. In the inactive receptor state,
the α subunit of the heterotrimeric G-protein is bound to a GDP molecule, and the α and
βγ remain together in complex with one another. Receptor activation, either through
ligand binding to the extracellular surface of the receptor or other noncanonical
mechanisms (e.g., light, mechanical stimuli) induces a conformational change in the
receptor7. This event allows the receptor to function as a guanine-nucleotide exchange
factor (GEF), removing the GDP bound to the α subunit and replacing it with a GTP.
![Page 17: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/17.jpg)
3
This GTP binding event activates the α subunit, allowing it to dissociate from the GPCR
and βγ subunits and translocate within the cell to elicit a variety of second messenger
responses8. GPCRs are generally characterized by the α subunit they interact with, the
three most common being Gαs, Gαi/o, and Gαq, which activate different intracellular
signaling pathways.
Signaling through Gα subunits – types and cellular functions
Stimulated Gαs subunits increase the activity of adenylate cyclase (AC), a
membrane bound enzyme responsible for the production of cAMP9. This, in turn,
increases the activity of cAMP-dependent protein kinase (PKA), which phosphorylates a
number of different intracellular targets to elicit a variety of cellular responses, one of the
most notable is the activation of CREB, a transcription factor which binds to cyclic AMP
response elements (CRE) to modulate the transcription of various genes. As such, CREB
activity is a key regulator in a variety of physiologies, such as the suppression of the
oncogene c-fos and the maintenance of circadian rhythms through changes in expression
of timeless and period genes10,11. Changes in intracellular cAMP concentrations also act
to modulate the activity of ion channels, leading to changes in membrane potential and
cell excitability. Cyclic AMP levels also contribute to a number of physiological effects,
such as the mobilization of energy stores through the breakdown of glycogen, stress
response, modulation of heart rate, insect diuresis, and the formation and maintenance of
memory12–16. Cyclic AMP levels also modulate the activity of intracellular exchange
proteins, such as exchange protein activated by cAMP (EPAC), which translocates to the
plasma membrane following activation and produces a range of cell specific responses17.
![Page 18: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/18.jpg)
4
Taken together, the activation of AC by GPCRs has significant impacts on many aspects
of cell physiology and function.
In contrast to the Gαs subunit, another subset of Gα subunits, Gαi/o, act as an
antagonist to AC, inhibiting the production of cAMP and in turn downregulating PKA
and CREB activity18. Downregulation of cyclic AMP is a hallmark of many inhibitory
neurotransmitters, such as GABA19, and as such serves to regulate a variety of
physiologies and behaviors, including organismal stress responses and sleep onset20. The
combination of both Gαi and Gαs coupled GPCRs in a single cell affords the ability to
precisely regulate intracellular cAMP levels and mediate subsequent downstream effects
through the additive effects of these receptor types.
Another major subset of heterotrimeric G-proteins is the Gαq subunit family. Gαq
subunits function by acting on phospholipase C (PLC), a membrane bound enzyme
responsible for the cleavage of phosphatidylinositol 4,5-bisphosphate (PIP2) into inositol
triphosphate (IP3) and diacylglycerol (DAG)21. IP3 acts on the endoplasmic reticulum,
causing it to release calcium into the cytoplasm, increasing the intracellular concentration
of calcium and in turn increasing the activity of protein kinase C (PKC)22. DAG remains
within the plasma membrane but is a direct activator of PKC and also facilitates PKC’s
translocation to the plasma membrane. PKC phosphorylates a variety of intracellular
targets, leading to significant changes in cellular physiology. These events include
activation of MAPK/ERK pathway, which in turn leads to significant changes in gene
expression and regulation of the cell cycle and cellular proliferation23. Additionally,
many cellular secretion events are calcium dependent, and as such the release of
sequestered calcium ions from the endoplasmic reticulum can lead to the secretion of
![Page 19: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/19.jpg)
5
neuropeptides and other molecules involved in cellular communication24. PKC also
activates the NFkB protein complex, a key regulator of gene expression with myriad cell-
specific effects, including the suppression of anti-apoptotic genes and the activation of
pro-inflammatory genes25.
Other Gα subunits fulfill cell-specific functions. For example, the activation of
Rhodopsin by light activates the α subunit transducin, which is responsible for the
breakdown of cyclic GMP (cGMP) through modulation of phosphodiesterase activity in
photoreceptor-expressing cells 26. This change in cGMP levels is critical for the
processing of visual stimuli. Similarly, stimulation of gustatory GPCRs activate the Gα
subunit gustducin, a transducin homolog, which increases cGMP degradation. This
signaling is interpreted by the brain as specific tastes, and depends upon cell type27.
Gustducin removes the inhibition of cAMP phosphodiesterase, reducing cAMP
concentrations in taste receptor-expressing cells. The modulation of cAMP and cGMP in
these cells is responsible for the processing and interpretation of taste stimuli, a critical
function which allows organisms to discriminate between palatable and potentially
harmful foods27.
Signaling through Gβγ subunits – types and cellular functions
In addition to Gα subunit dependent signaling, the β and γ subunits also contribute
to GPCR mediated intracellular effects following receptor activation. Unlike the Gα
subunit, which translocates to various intracellular targets in the cytoplasm, the β and γ
subunits remained tethered to the plasma membrane in both their inactive and active
states. Additionally, the β and γ subunits do not dissociate from one another, and as such,
the heterodimer of the two subunits represents the functional unit involved in signaling.
![Page 20: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/20.jpg)
6
Following receptor activation and the dissociation of the activated Gα subunit of the
heterotrimeric G-protein, the βγ subunit acts on different membrane-bound targets to
elicit cell- and receptor- specific responses. Some of these actions involve the modulation
of a family of G-protein-activated inwardly rectifying potassium (K+) channels, or
GIRKs. The βγ subunits bind directly to intracellular residues on GIRKs, as resolved by
FRET analysis, which in turn activates the ion channel28. This regulation in turn impacts
cell excitability and alters the function of neurons and cardiac muscle29. These
interactions are also facilitated by a family of proteins, the regulators of G-protein
signaling (RGS). RGS proteins are GTPase activating proteins which facilitate GTP
hydrolysis in the Gα subunit and are critical for controlling GPCR signal termination.
Many RGS proteins exhibit significant homology to the γ subunit of the βγ complex and
research has shown that RGS proteins can directly interact with the β subunit of the
heterotrimeric G-protein, forming a β-RGS complex, and potentially replacing the γ
subunit30. Additionally, recent work has shown that RGS-insensitive mice display
significantly reduced GIRK activity when the μ-opioid receptor was activated, further
indicating a functional association of these proteins and inhibition of βγ dependent
signaling31. βγ subunits inhibit the actions of multiple voltage-gated calcium (Ca2+)
channels in a voltage independent manner28. As these channels are primarily expressed in
neurons, this inhibition can prevent the occurrence of action potentials in these cells, and
in turn modulate the activity of various neural circuits and their corresponding behavioral
and physiological outputs.
βγ subunits have also been shown to directly interact with second-messenger
producing molecules such as PLC and adenylate cyclase (AC) to modulate second
![Page 21: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/21.jpg)
7
messenger production in a similar manner to Gα subunits. βγ subunits act directly on AC
to activate or inhibit the production of intracellular cAMP both in concert with or
opposing the actions of corresponding Gα subunits32, which can in turn modulate cAMP
dependent signaling pathways described previously such as CREB activated gene
transcription. In a similar manner, βγ subunits also bind directly to phospholipase C
isoforms to both activate and inhibit PLC activity 33,34. This in turn modulates IP3 and
DAG production, and subsequent calcium release from intracellular endoplasmic
reticulum stores. Taken together, βγ subunits play a major role in regulating cell-
excitability and physiological changes stemming from GPCR activation.
GPCR signal termination and endosomal signaling
GPCR signal termination involves both the sequestration of the receptor-ligand
complex from the cell surface and the termination of G-protein signaling. G-protein
signaling is terminated through the innate GTPase activity which Gα subunits possess35.
As such, the bound GTP molecule is hydrolyzed following activation and the molecule
loses its enzymatic activity and returns to an inactive state upon GTP hydrolysis. This
facilitates the re-association of the Gα and Gβγ subunits of the heterotrimeric G protein
complex. Next, sequestration of the activated G-protein coupled receptor is facilitated by
phosphorylation events following the dissociation of the heterotrimeric G-protein
complex and the recruitment of arrestins, a family of cytoplasmic proteins responsible for
targeting GPCRs to early endosomes35. Specifically, following the dissociation of the
heterotrimeric G-protein complex, phosphorylation sites on the intracellular face of the
GPCR are exposed. These sites are phosphorylated by a family of serine/threonine
kinases known as G-protein coupled receptor kinases (GRKs). Phosphorylation of the
![Page 22: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/22.jpg)
8
receptor causes the recruitment of arrestins to the GPCR. Arrestins act to block GPCR
signal transduction in two major ways: first, by physically obstructing the association of
heterotrimeric G-proteins with the activated GPCRs, and second, targeting the arrestin-
GPCR complex to clathrin-coated pits for eventual removal of the GPCR from the
plasma membrane35. The GPCR is encapsulated into an endosome and the fate of the
GPCR is either to be recycled back to the plasma membrane following receptor-ligand
dissociation, or ultimately targeted for degradation via lysosomes. These internalization
events alter the overall sensitivity of the cell to the specific GPCR ligand by decreasing
the number of receptor molecules present at the plasma membrane, a process known as
desensitization, although it should be noted that visual rhodopsin undergoes
desensitization through a different mechanism36. Additionally, recent evidence suggests
that some GPCRs signal directly through the arrestin-endosome complex, indicating that
arrestins may serve in both GPCR signal termination as well as signal transduction, with
specific roles including the activation of the MAPK/ERK pathway, and the inhibition of
nF-kB activity37. Specifically, the β-arrestin 1 subunit regulates the thyrotropin-
stimulating hormone receptor’s (TSHR) downstream effects on cholesterol metabolism38.
Additionally, recruitment of arrestin to the D2 dopamine receptor (D2R) is responsible for
cocaine-induced hyperlocomotion, but not incentive motivation in this experimental
paradigm39. Taken together, this suggests that the arrestin-endosome complex may
function along with canonical cAMP/Ca2+ pathways to mediate the full array of GPCR
dependent intracellular signaling.
![Page 23: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/23.jpg)
9
The “two-state” model and its shortcomings
The predominant mechanism used to describe GPCR activation is the “two-state
model”, wherein the receptor occupies two distinct states, R(inactive) and R*(active)
(Figure 1). In this model, the inactive receptor exists at the plasma membrane coupled to
intracellular heterotrimeric G-proteins. Ligand binding to the extracellular face of the
receptor induces conformational changes throughout the receptor, allowing it to act as a
guanine-nucleotide exchange factor (GEF) and in turn facilitate the “swapping” of a
bound GDP molecule for a GTP molecule from the alpha subunit of the heterotrimeric G
protein associated with the receptor. This event activates the heterotrimeric G-protein
complex, allowing it to dissociate from the receptor and act on myriad intracellular
targets to transduce the extracellular signal generated by the ligand into an appropriate
cellular response. Signal termination results from the innate GTPase activity of the Gα
subunit, as it eventually hydrolyzes GTP to GDP and returns to an inactive state. While
this model accounts for the basics of GPCR activation and signal transduction, it has
become clear that the two-state model first proposed for GPCR activation fails to account
for a great deal of reported results since its first proposal8.
GPCRs exhibit a classic sigmoidal dose-response curve for both ligand binding
and receptor activity, which suggests allosteric modulation of receptor signaling and
cooperativity. If, in fact, GPCRs only occupied two conformational states – ligand-bound
and ligand-unbound, dose response curves for ligand binding and receptor activity should
be hyperbolic, rather than sigmoidal. Indeed, many allosteric modulators of GPCR
signaling have been identified in the past three decades, collectively referred to as GPCR
interacting proteins (GIPs) that in many cases are critical for proper receptor function40.
![Page 24: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/24.jpg)
10
For example, the human calcitonin-like receptor (CLR) requires the interactions of
multiple GIPs to appropriately transduce signals from its endogenous ligands
adrenomedullin (AM) and calcitonin gene-related peptide (CGRP)41. First, the receptor
must associate with receptor activity modulating proteins (RAMPs) to efficiently traffic
to the plasma membrane. Coupling to RAMP1 confers greater receptor specificity to
CGRP, while coupling to RAMP2 or RAMP3 confers greater receptor specificity to AM,
suggesting that these allosteric interactions are capable of modifying the CLR ligand-
binding site to alter specificity to these disparate ligands42. Additionally, CLR must
interact with a second allosteric modulator, receptor component protein (RCP), to
transduce signals from either ligand. Thus, the receptor not only requires allosteric
interactions for proper signal transduction, but is also able to change its conformational
state to selectively bind one ligand over another, and must therefore exhibit multiple
active states.
Another shortcoming of the two-state model is its presupposition that, in a ligand-
unbound state, the receptor exists in an “off” conformation incapable of activating an
associated heterotrimeric G-protein. In reality, many GPCRs exhibit constitutive activity
even in the absence of ligand, suggesting that many GPCRs do not exist in a truly “off”
state when expressed43,44. This has led to speculation that GPCRs act as “rheostats” rather
than simple on-off switches45. Under this paradigm, GPCRs can exist in multiple
conformational states with multiple intermediate states between “inactive” and “active”.
The exact state then would result from intramolecular interactions within the receptor,
allosteric interactions with other proteins, ligand binding, and ligand identity45. Some
GPCRs have also been shown to activate multiple intracellular G protein pathways, an
![Page 25: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/25.jpg)
11
example of this being the gonadotropin releasing hormone (GnRH) receptor, which
potentiates both cyclic AMP and Ca2+ signaling when activated, suggesting that the
receptor is capable of adopting multiple conformations to specifically accommodate
multiple G proteins and intracellular signaling pathways46. This selectivity in G protein
recruitment can also be controlled by ligand identity, as is the case with the neurokinin 2
(NK2) receptor. NK2 endogenously binds to neurokinin A (NKA), a gene product of the
preprotachykinin gene that also gives rise to substance P47. Full length NKA elicits both
calcium and cAMP responses from NK2 receptor activation, yet a C-terminally truncated
form of NKA (NKA4-10) only elicits calcium responses upon binding to NK2,
suggesting that this receptor is also capable of adopting multiple active conformations in
a ligand-dependent manner48. Indeed, the idea of a GPCR occupying multiple “activated”
conformations has gained considerable traction and is supported by structural modeling,
however no GPCR crystal structures for a single receptor bound independently to
multiple ligands have yet been determined49.
Conserved Amino Acid Motifs in Class A GPCRs
As our understanding of GPCRs has grown, a number of conserved amino acid
motifs have been identified which are critical for discrete aspects of receptor function.
Amino acid motifs are sequences of amino acids that exhibit both high sequence
conservation within a specific protein family, and generally participate in a common
function. For GPCRs, the majority of these motifs have been identified and described for
Class A GPCRs, which is not unsurprising given that Class A GPCRs are the largest
GPCR subclass. For Class A GPCRs, conserved amino acid motifs identified and
described to date include the E/DRY motif located at the base of TM3, the WxFG motif
![Page 26: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/26.jpg)
12
located in EL1, the CWxP motif located in TM6, and the NPxxY motif located on TM7.
Much of our understanding of the function of these motifs is derived from mutagenesis
studies, wherein conserved amino acid residues are mutated and resulting changes in
receptor function are documented. These approaches, coupled with GPCR crystal
structure analysis, have led to each of these conserved amino acid motifs being associated
with specific aspects of receptor function. In this section, I will briefly review common
aspects of receptor function associated with these specific motifs.
E/DRY motif – The Ionic lock
The E/DRY motif, located at the base of TM3, was first identified in Rhodopsin
and later functionally characterized through investigations of the β2 adrenergic receptor
(β2AR)50. The most critical role for this motif is stabilizing the inactive conformation of
Class A receptors through interactions between the positively charged arginine residue
(conserved in 96% of Class A GPCRs) in the DRY motif in TM3 and a conserved,
negatively charged amino acid (usually glutamate or aspartate) in TM651. This interaction
forms an “ionic lock” which keeps TM3 and TM6 in close proximity to one another when
the receptor is not bound to ligand. Ligand binding is thought to break this lock through
conformational changes in the receptor, leading to TM6 moving away from TM3 and
forming an intracellular pocket through which the GPCR can interact with and activate
heterotrimeric G proteins52. This hypothesis is supported by multiple lines of evidence.
First, increased distance between TM3 and TM6 is correlated with higher constitutive
receptor activity in β adrenergic receptors53. Additionally, multiple studies have shown
that disruption of the ionic lock through mutagenesis leads to an increase in constitutive
activity, lending further support to the notion that this motif serves to stabilize the
![Page 27: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/27.jpg)
13
inactive receptor state54–56. A salt bridge formed between the aspartate and arginine
residues in the DRY motif has been identified in crystal structures of inactive GPCRs,
and disruption of this interaction is a critical event related to receptor activation,
implicating this motif in multiple receptor-stabilizing interactions57. In addition to its
apparent role in stabilizing the inactive receptor state, it has been reported that the
conserved arginine in the DRY motif is responsible for coupling the receptor to
intracellular G-proteins, with a naturally occurring mutation (Arg � His) in the human
vasopressin type two receptor giving rise to a receptor incapable of stimulating adenylate
cyclase, resulting in persistent nephrogenic diabetes insipidus in individuals bearing this
mutation58. A similar Arg � His mutation in the human gonadotropin releasing hormone
(GnRH) receptor leads to hypogonadotropic hypogonadism, but in contrast to the
vasopressin receptor, this mutant receptor is unable to bind ligand, suggesting that this
motif may exhibit receptor specific functions beyond stabilization of the inactive receptor
state59.
WxFG motif – an extracellular domain critical to receptor trafficking
Another amino acid motif that has been shown to play a critical role in overall
receptor function is the WxFG motif found on extracellular loop 1 (EL1)60. This motif,
initially described by Klco et al. in 2006, is relatively understudied in comparison to the
extensive literature exploring the DRY motif, but appears to play a critical role in proper
trafficking of the receptor from the ER-Golgi complex to the plasma membrane60,61.
Present in approximately 90% of Class A GPCRs, the WxFG motif was originally
reported to play a critical role in ligand-mediated activation of the C5a complement
component receptor. Mutagenesis of the conserved tryptophan residue in this domain
![Page 28: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/28.jpg)
14
yielded a nonfunctional C5a receptor unable to respond to ligand, but apparently did not
impact ligand binding, as purified membranes containing W102A mutant C5a receptor
variants were still capable of binding ligand (although only at ~20% of wild type receptor
maximal occupancy), but did not transduce ligand binding into an appropriate
intracellular response61. A W102F C5a receptor variant was capable of binding both
ligand and activating intracellular responses at levels nearly indistinguishable from wild
type, prompting the hypothesis that an aromatic, bulky amino acid at the “W” position
was necessary for wild type receptor function61.
A subsequent study by our laboratory of eight Class A GPCRs from disparate
subfamilies by our laboratory instead showed that this motif was critical for wild type
receptor trafficking60. Using a comparison of wild type and WxxxL mutant receptors
fused to a C-terminal YFP molecule, we showed that not only were WxxxL mutants
incapable of responding to ligand, but that these receptors remained trapped in the ER-
Golgi complex and were not appropriately trafficked to the cell surface if an aromatic
amino acid was not present at the “W” position60. These findings, while seemingly in
conflict with the original report on C5aR receptor function, can be reconciled through a
comparison of the methodologies used in these two studies. While Klco et al. showed that
the W102A mutant C5a receptor did not signal in response to ligand, ligand binding to
the receptor was performed on purified cell membranes, which would have captured
receptors trapped in the ER-Golgi complex as well as the plasma membrane. Thus, the
ability of the receptor to still bind ligand is largely unimportant as it appears mutant
receptors do not reach their appropriate intracellular target (the plasma membrane) in
order to respond to extracellular ligand presentation. A possible mechanism for this
![Page 29: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/29.jpg)
15
trafficking defect was suggested by our research, as computer modeling of wild type and
WxxxL mutant receptors showed distortion of the receptor’s natural conformation, with
the N terminus apparently “pushed” further away from the body of the receptor. Other
reports suggest that this particular conserved tryptophan residue in EL1 interacts with and
potentially stabilizes a cysteine mediated disulfide bridge between EL1 and EL2 in
crystal structures of the β2AR, and thus receptor mutants may exhibit overall instability
compared to wild type62. It is also important to note that a conserved cysteine residue in
EL1 downstream from the WxFG motif has been previously shown to form a disulfide
bond with another conserved cysteine residue helps maintain receptor architecture, and it
could be the case that mutagenesis of the WxFG motif interferes with this disulfide bond
formation63. Taken together, these reports suggest that this motif plays a critical role in
GPCR function through appropriate trafficking of the receptor to the plasma membrane,
while further research is necessary to fully determine the molecular mechanisms involved
with this process.
CWxP motif – “rotamer toggle switch”
A third amino acid motif critical to GPCR function is the CWxP motif, present on
TM6. This motif is highly conserved amongst class A GPCRs, with cysteine and
tryptophan conserved in over 70% of Class A, non-olfactory GPCRs, while proline is
conserved in a remarkable 98% of non-olfactory receptors64. Crystal structure and
molecular modeling studies have shown that this conserved proline residue induces a
large bend in TM6, whose outward motion during receptor activation contributes to the
formation of the G-protein binding pocket on the intracellular face of the receptor65,66.
Mutagenesis studies on the β2AR revealed that this outward motion away from TM3 is
![Page 30: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/30.jpg)
16
also associated with a change in the rotamer state of the conserved cysteine and
tryptophan residues in this motif, giving rise to its classification as a “rotamer toggle
switch”66. This change in side chain orientation is hypothesized to stabilize the receptor
in an active conformation. The functional role of this motif in receptor activation is
further supported by studies of the thyrotropin stimulating hormone receptor, where
substitution of arginine for the conserved cysteine residue in this motif was associated
with increased constitutive receptor activity67.
Still, the function of this motif does not appear to be universal amongst class A
GPCRs. While crystal structure studies of the β2AR indicate that the conserved
tryptophan residue in this motif does adopt different side chain orientations in active
receptor conformations compared to inactive states, the crystal structure of a
constitutively active rhodopsin receptor did not find a similar correlation with the rotamer
position of the conserved tryptophan residue and active or inactive receptor
conformations68,69. This, along with the absence of this conserved tryptophan residue in
~30% of Class A GPCRs, suggests that this rotamer switch model of receptor activation
may not be uniform amongst Class A GPCRs, and other mechanisms must therefore
stabilize the transition between active and inactive receptor states. The dearth of
available GPCR crystal structures of receptors in an active conformation further
complicates this, as it is currently impossible to determine the prevalence of rotamer
rearrangements of CWxP motif residues amongst all class A GPCRs. Still, the high
degree of conservation exhibited by this motif and experimental evidence from β2AR
investigations suggest that it does play a critical role in GPCR function in at least a subset
of Class A GPCRs.
![Page 31: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/31.jpg)
17
NPXXY – a conserved motif with multiple functional roles
Another conserved amino acid motif that has been shown to play a significant role
in GPCR function is the NPXXY motif found on the base of TM7. This motif exhibits
remarkable conservation amongst GPCRs, with the conserved tyrosine residue being
present in 92% of all class A receptors70. Early studies on the β2AR identified that the
conserved tyrosine in this motif was necessary for agonist-induced receptor
desensitization, with Tyr�Ala mutant receptors exhibiting no internalization in response
to prolonged agonist exposure71. This mutant receptor exhibited no significant defects in
ligand binding or adenylate cyclase activation, suggesting a singular role for this motif in
arrestin-mediated desensitization. Interestingly, mutations of the conserved asparagine
and proline residues to alanine in the same β2AR resulted in a significant reduction in
ligand sensitivity, suggesting that this motif may stabilize the inactive receptor state to
facilitate ligand binding in addition to its role in receptor desensitization72. However,
further studies of disparate GPCRs indicated that this motif did not play a universal role
in GPCR desensitization. Substitutions of the conserved tyrosine residue in the B2
Bradykinin receptor resulted in constitutive internalization of the receptor, along with a
loss of signaling capabilities73. Additionally, the gastrin-releasing peptide (GRP) receptor
showed no significant defects in receptor internalization following a similar Tyr�Ala
substitution, indicating that the conserved tyrosine residue in this motif is unlikely to
mediate receptor desensitization in all class A GPCRs74.
More recent reports suggest that, similar to the CWXP motif, the conserved
tyrosine residue in this motif may function as a “toggle switch” contributing to the
receptor adopting an active conformation following ligand binding70. Specifically, crystal
![Page 32: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/32.jpg)
18
structure studies of opsin molecules thought to mimic the active state of rhodopsin have
indicated that, in the active state of the receptor, the conserved tyrosine residue changes
its rotamer configuration and inserts into the space occupied by TM6 in the inactive
receptor conformation. This conformational change is believed to stabilize the active
conformation of the receptor75. This hypothesis is further supported by a recent
investigation of the α1b and β2 adrenergic receptors that demonstrated reduced signaling
through targeted mutagenesis, and is consistent with a stabilization of the inactive state of
these receptors76. It is important to note that previous studies of the β2AR showed that
mutagenesis of this conserved tyrosine residue to alanine resulted in desensitization
defects, suggesting that amino acid identity at this position plays a critical role in wild
type receptor function. Given the distinct functional roles of this motif in different
receptor backgrounds, further investigation is necessary to determine whether the
NPXXY motif exhibits a conserved functional role in all class A GPCRs, or whether its
function is receptor-specific.
GPCR dimerization – allosteric modulation of GPCR signaling through receptor-
receptor interactions.
Efforts to fully elucidate GPCR function are complicated by the property of many
receptors in this family to form higher order structures: dimers and oligomers, with other
GPCR members. Since the first GPCR dimer was reported in 1998, multiple studies
describe that many GPCRs exhibit extensive dimerization, at times with multiple GPCR
subtypes, and these events lead to alteration in signaling, ligand selectivity, receptor
desensitization, and other aspects of receptor physiology. This section will review GPCR
![Page 33: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/33.jpg)
19
oligomerization and discuss the functional consequences of these interactions in overall
GPCR function.
The earliest functional characterization of GPCR dimerization was described in
GABAB receptors. Specifically, the GABABR1 gene product, when heterologously
expressed in HEK293T cells, remained trapped in the endoplasmic reticulum. However,
when GABABR1 was coexpressed with the GABABR2 receptor encoded by a different
gene, GABABR1 cell surface expression was observed77. Subsequent work. revealed the
mechanism for this phenomenon – dimerization between GABABR1 and GABABR2
masked a C-terminal RXR ER retention motif present on the GABABR1 receptor78. Thus,
the functional receptor for the GABAB receptor subclass was revealed to be a heterodimer
of two related receptors, rather than a receptor protomer, providing the first evidence for
a functional role of dimerization in GPCR signaling.
Since these initial studies, a wealth of data has supported the capacity of multiple
GPCRs to assemble as dimers and higher order oligomers. This section will expound on
the mechanisms of dimerization and the functional implications of this phenomenon.
Mechanisms of GPCR dimerization
The molecular mechanisms underlying GPCR dimerization differ by receptor
class, the most well characterized of which is the Class C, metabotropic glutamate-like
receptors. These receptors contain an extended N-terminal domain known as a Venus
flytrap (VFT) module, which is unique amongst GPCR subclasses and serves a number of
different functions for Class C receptors. In contrast to Class A receptors, where TM
domains contribute to ligand recognition, Class C GPCRs ligand binding occurs solely
![Page 34: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/34.jpg)
20
through this extended N-terminal VFT domain79. Interestingly, this same VFT domain is
responsible for forming the dimerization interface for most Class C receptors, which
function as obligate dimers 80. Most Class C GPCR N-termini contain multiple cysteine-
rich domains (CRDs), located between the VFT and TM1, which are able to crosslink the
receptor to its dimeric partner through interactions between these extended N-termini,
leading to the formation of stable receptor dimers81. Exceptions to this disulfide-linkage
mechanism do exist, most notably exemplified by the GABAB receptors. The N-termini
of these receptors, while involved in ligand binding similar to other Class C receptors,
lack CRDs. As a result, dimerization for these receptors cannot involve N-terminal
disulfide linkages, rather, dimerization occurs through interactions between the C-
terminal tails of GABAB receptors. The RXR ER-retention motif found on GABABR1
binds to an unrelated coiled-coil domain found on the C-terminus of GABABR2, masking
this domain and allowing for the functional expression of the GABAB heterodimer at the
cell surface81.
In contrast to the rather uniform mechanisms underlying Class C GPCR
dimerization, our understanding of the interfaces underlying Class A and B receptor
dimerization remains incomplete. Dimerization between receptors of these two classes
does not involve covalent linkages between dimer partners, as is often found in Class C
receptors, and as such, these receptors often exist as transient, rather than stable, dimers
at the cell surface82. Dimerization of Class A GPCRs often relies on interactions between
TM domains of the receptors involved, with multiple interactions between disparate TM
regions having been reported. Crystal structure analysis of the chemokine receptor
CXCR4 showed that the receptor assembles as homodimer with an interface involving
![Page 35: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/35.jpg)
21
both TM5 and TM6 from each receptor subunit83. Here, dimer stabilization is mediated
primarily through hydrophobic interactions between residues in these domains83. In
contrast, disulfide-trapping experiments on the unrelated 5HT2c receptor also showed a
homodimeric interface involving TM5 of each protomer, but rather than TM6 also
contributing to dimerization as seen with the CXCR4 receptor, the 5HT2c homodimer
involves interactions between TM4 domains in each dimeric counterpart, constituting an
overall TM4/TM5 dimeric interface between the receptors84. Recent work on the
adenosine A2A receptor and D2 dopamine receptor heterodimer suggests that a similar
interaction between TM4 and TM5 on these receptors stabilizes the heterodimer85.
Additionally, atomic force microscopy investigations of mouse rhodopsin also suggested
that the receptor dimerized through TM4-TM5 interactions between receptor protomers86.
Interestingly, crystal structure analysis of the human Class F smoothened receptor also
showed that the receptor formed a homodimer similarly stabilized by interactions
between TM4 and TM5, indicating that this interface may be common to multiple GPCR
homo- and heterodimers, regardless of class87. Such an interaction likely arose early in
GPCR evolution, given the significant evolutionary distance between Class A and Class
F GPCRs88. Beyond the TM5-TM6 and TM4-TM5 interfaces described above, additional
Class A GPCR dimeric interfaces have been identified. Crystal structure analysis of the
B1 adrenergic receptor (B1AR) revealed a TM1-TM2-C terminus interface responsible
for stabilizing the B1AR homodimer, along with the previously described TM4-TM5
interface89. Taken together, these findings suggest that Class A GPCRs dimerize through
a variety of dimerization interfaces, with the specific receptor regions involved likely
varying greatly amongst the superfamily.
![Page 36: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/36.jpg)
22
In contrast to Class A and Class C GPCRs, limited evidence exists regarding
mechanisms underlying Class B GPCR dimerization. A study utilizing spatial intensity
distribution analysis (SpIDA) on the human secretin receptor revealed a critical role for
TM4-TM4 interactions in stabilizing secretin receptor dimers, with mutagenesis of amino
acid residues within this domain significantly reducing receptor dimerization90.
Interestingly, a similar role for TM4-TM4 interactions in stabilizing Class B receptor
dimerization was found in an investigation of rabbit calcitonin receptor homodimers, a
related Class B receptor91. These findings suggest that a common TM4-TM4 dimeric
interface may unify Class B GPCR dimerization, though this hypothesis requires
evaluation in a greater diversity of Class B receptors before it can be fully supported. It is
interesting to note that, for each receptor subclass, disparate receptor domains seem to
contribute to higher order assembly, and as such, it is unlikely a unifying mechanism of
dimerization exists for GPCRs. Additionally, in contrast to Class A, B, and C GPCRs,
putative dimerization domains for Class D, E, and F GPCRs, beyond the smoothened
receptor, have not been explored, and as such, models for dimerization amongst these
receptor types remains incomplete.
Impacts of GPCR dimerization on receptor function
Many reports have shown that GPCR dimerization impacts receptor function and
signaling, highlighting the necessity of identifying homo- and heterodimer GPCR
complexes. The nature in which oligomerization impacts function exhibits incredible
diversity, particularly amongst heterodimeric complexes, which will be discussed herein.
![Page 37: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/37.jpg)
23
Allosteric modulation through homodimerization
Many of the effects associated with GPCR dimerization, including receptor trans-
activation and trans-desensitization, are absent in GPCR homodimers as a result of
identical protomers constituting the dimeric unit. Still, evidence suggests that
homodimeric GPCRs do not signal similarly to monomeric counterparts, and
homodimeric assembly impacts overall receptor function. The strongest evidence for this
supports homodimeric GPCRs functioning as negative allosteric modulators to their
protomeric counterpart. In this model, ligand binding to one of the two protomers in a
GPCR homodimer decreases the likelihood of a second ligand binding. This phenomenon
has been shown in multiple GPCRs, including the human thyrotropin (TSH) and
luteinizing hormone (LH) receptors, as well as the A3 adenosine receptor92,93. This
phenomenon of negative cooperativity among dimer partners is not limited to
homodimers, and has been observed in chemokine receptor heterodimers involving the
CCR5 and CCR2b receptors, suggesting that allosteric modulation of dimer partners is a
hallmark of GPCR dimerization in general94. These findings are interesting as they
suggest that dimerization may explain, at least in part, the sigmoidal dose-response
curves associated with GPCR ligand binding and signaling. Negative cooperativity
among dimer partners has been demonstrated in native tissues, in addition to the cell
culture systems commonly used. A study of oxytocin receptors in rat mammary glands
utilizing time-resolved (TR) FRET indicated that not only did these receptors assemble as
homodimers in vivo, but additionally that agonist-binding to a homodimer decreased
overall receptor affinity for agonist, suggesting that, once a receptor dimer has bound a
ligand molecule, its affinity for binding an additional ligand molecule is significantly
![Page 38: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/38.jpg)
24
decreased95. This phenomenon of negative cooperativity has interesting implications for
GPCR signaling and function. Negative cooperativity amongst GPCR homodimers could
serve to buffer cells against abrupt increases in extracellular ligand concentration96. This
would effectively alter a cell’s affinity for ligand in a concentration-dependent manner,
preventing overstimulation in response to excessive ligand presentation, although this has
never been empirically demonstrated. It is interesting to note that, while theoretically
possible, no instance of positive cooperativity, which could potentially intensify cellular
responses to extracellular ligands, has been demonstrated for any GPCR dimers to date.
Trafficking
GPCR dimerization has also been shown to play a significant role in receptor
trafficking and cell-surface targeting in multiple receptors. The best example of this
phenomenon is the previously mentioned GABAB receptor heterodimer, wherein
dimerization is required for cell-surface expression of the mature receptor77,78. The
necessity of receptor dimerization for wild-type receptor function has since been
demonstrated in multiple additional Class C GPCRs, including the T1R taste receptor and
metabotropic glutamate 2 (mGlu2) receptors, suggesting that this is a hallmark of the
receptor subfamily97–99. In contrast, numerous studies of Class A and B GPCRs, when
forcibly expressed as monomers in detergent micelles or reconstituted nanodiscs, are still
capable of both ligand binding and receptor activation, suggesting that dimerization as a
requirement for receptor trafficking and function may be limited to Class C
receptors97,100. This is likely explained by the mechanical differences that distinguish
Class C receptor dimer formation from other GPCR subclasses. Class C receptor dimers
are stabilized by disulfide bonds between individual protomer molecules, which are
![Page 39: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/39.jpg)
25
formed during receptor maturation in the ER101. In contrast, Class A receptors, largely
stabilized by hydrophobic interactions between residues found in TM regions of the
receptor, likely exist as a dynamic population of monomers, dimers, and higher order
oligomers at the cell surface, with relatively short half-lives in each structure, and as such
it seems less likely that receptors would co-traffic as dimers during maturation102.
Interestingly, dimerization of the Class A 5HT2c receptor was observed in both the ER
and Golgi complexes during receptor maturation when expressed in HEK-293 cells,
suggesting a possible role for receptor dimerization in trafficking of Class A receptors,
but additional study is necessary to determine whether this is required for cell-surface
expression of a functional receptor103. Still, the available evidence suggests that the
necessity of GPCR dimerization for proper GPCR trafficking is limited to Class C
receptors.
Receptor transactivation
A particularly interesting phenomenon related to GPCR heterodimers is receptor
transactivation. In this scenario, ligand binding to one protomer in a GPCR heterodimer
can lead to signaling through the other protomer (Figure 2). One exemplar of this
phenomenon is the human bradykinin receptor 2 (BK2R) – B2AR heterodimer. When
expressed independently, BK2R signals through the Gαq intracellular pathway, while
B2AR acts through the Gαs signaling pathway104,105. However, when these receptors are
coexpressed, bradykinin stimulation results in signaling through both Gαq and Gαs
intracellular pathways in a B2AR dependent manner, suggesting that Gαs stimulation
results from transactivation of the B2AR protomer106. Interestingly, isoproterenol
stimulation of cells co-expressing these two receptors did not result in activation of the
![Page 40: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/40.jpg)
26
Gαq, suggesting that transactivation of this receptor pair exhibits asymmetry. The
phenomenon of transactivation is also demonstrated in the GABABR1/GABABR2
receptor heterodimer, where ligand binding to GABABR1 stimulates intracellular
signaling through its partner, GABABR277. Similar transactivation was identified in an
investigation of the luteinizing hormone receptor (LHR). Specifically, ligand-binding
deficient and signaling deficient variants of LHR were co-expressed in populations of
HEK-293 cells. When these variants were co-expressed, wild type luteinizing hormone
signaling was restored, whereas no LH signaling was observed in cell populations
expressing a single mutant receptor variant107. These findings suggest that the LHR
homodimer exhibits transactivation following ligand binding to a single protomer. The
possibility of transactivation between individual protomers of a GPCR heterodimer
potentially complicate assigning a canonical signaling pathway to an individual GPCR, as
non-canonical signaling through transactivation could result in cell- and tissue- specific
responses to particular ligands.
Transdesensitization
In addition to transactivation, GPCR dimerization has also been implicated in
receptor transdesensitization, wherein ligand binding to one receptor in a heterodimer
facilitates the internalization of its heterodimeric partner (Figure 2). This phenomenon is
best exemplified by the μ-opioid receptor/CCR5 chemokine receptor heterodimer pair.
When these receptors are co-expressed in CHO cells, bidirectional transdesensitization
was observed, with μ-opioid receptor pre-stimulation ablating CCR5-dependent
chemotaxis responses, and similar μ-opioid receptor mediated chemotaxis ablated in cells
pre-treated with CCR5 agonists. Interestingly, receptor desensitization was not mediated
![Page 41: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/41.jpg)
27
through receptor internalization, as CCR5 ligand stimulation did not significantly impact
μ-opioid receptor internalization and vice versa. The phenomenon of trans-desensitization
is also exemplified by the H1 and H2 histamine receptor heterodimer. Upon expression of
these two receptors in CHO cells, pre-incubation with the H1R ligand 2,3-
trifluoromethylphenylhistamine abolished the subsequent H2R responses to amthamine,
an H2R agonist108. Similar to the phenomenon of trans-activation, trans-desensitization
provides non-canonical regulatory mechanisms for the cell to fine tune cellular responses
to extracellular signals.
Ligand sensitivity and biased signaling
In addition to intracellular signaling, dimerization can also differentially impact
ligand selectivity. In mammals, specific combinations of GPCRs homo- or heterodimers
are responsible for detecting bitter, umami, and sweet taste sensations 98. Homodimers of
one of the two main families of GPCR gustatory receptors, Tas2Rs or T2Rs, are
responsible for transducing bitter taste sensation. In the other family of mammalian
gustatory GPCRs heterodimers formed between T1R family members are responsible for
transducing sweet (T1R2-T1R3 heterodimer) and umami (T1R1-T1R3) tastes. This example
indicates how dimerization amongst these receptors can play a critical role in determining
ligand sensitivity. GPCR dimerization has also been shown to impact intracellular
signaling. In the case of the Ciona intestinalis GnRH receptors, heterodimerization
between GnRH receptors significantly alters second messenger production following
ligand challenge109.
Heterodimerization of GPCRs has also been implicated in neuronal signaling and
mood disorders, particularly schizophrenia, as in the case of the 5HT2AR-mGlu2R
![Page 42: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/42.jpg)
28
heterodimer110. Researchers found that disruption of the 5HT2AR-mGlu2R heterodimer
through knocking out the mGlu2R receptor in mice led to a loss of 5-HT induced
behaviors when challenged with hallucinogenic 5-HT receptor agonists111. This particular
heterodimer is significantly upregulated in post-mortem brain tissue from schizophrenic
patients when compared to normal brains, further suggesting a critical physiological role
for this heterodimer in mood management and sensory perception110.
Methods to detect GPCR dimers and oligomers
A multitude of experimental approaches have been developed or adapted to detect
GPCR dimerization in living cells. These methods include biochemical approaches, such
as co-immunoprecipitation (Co-IP), and microscopy analysis, such as Fluorescent
Resonance Energy Transfer (FRET), Bioluminescent Resonance Energy Transfer
(BRET), and Biomolecular Fluorescent Complementation (BiFC). In most cases, a
combination of methodologies is employed to diminish the likelihood of false positive
reports of dimerization amongst GPCRs. These approaches, and their respective benefits
and pitfalls, will be explored in the following section.
Biochemical resolution of GPCR dimers.
Since their initial discovery, the most common biochemical approach to detect
GPCR dimers and higher order oligomers has been co-immunoprecipitation analysis112.
Co-immunoprecipitation involves epitope tagging one or both GPCRs suspected of
forming a dimer, with the most commonly utilized epitopes for this approach being HA,
FLAG, and Myc. Receptors are then expressed in heterologous cell systems or transgenic
organisms. Tissue is then harvested and placed in a column containing an antibody
![Page 43: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/43.jpg)
29
against one of the epitope tags found on the modified receptors. Following pull-down, the
bound protein fraction is then eluted and resolved through Western blot analysis, where
the second receptor in the suspected dimer is probed with an epitope or receptor-specific
antibody. Positive results indicate association between the two receptors within the cell.
There are multiple potential pitfalls regarding a Co-IP approach to resolve GPCR
dimers. A positive result is not a definitive indication that the receptors
involved directly interact with one another – the possibility exists that these receptors are
integrated in a larger complex by other proteins. Additionally, GPCRs are transmembrane
receptors, and are notoriously difficult to work with through Western blot analysis. Also,
receptor expression in native tissue may be too low to resolve through Co-IP and Western
Blot analysis, and as such, this approach is best suited to cell-culture systems where
receptor overexpression may occur, thus opening the possibility that assays may capture
interactions that do not occur when receptors are expressed at physiological levels in
native tissues. As such, Co-IP approaches are often complemented by other
methodologies, such as FRET, to increase confidence in findings from such studies.
In addition to co-immunoprecipitation, a less common biochemical approach used
to resolve GPCR dimers is blue native polyacrylamide gel electrophoresis (BN-PAGE).
This methodology utilizes weak detergents, unlike SDS commonly utilized in
conventional Western blot analysis, to preserve protein complexes in their native state,
eliminating the need for a co-immunoprecipitation column113. Coomassie blue dye is also
added to samples in BN-PAGE to confer a negative charge to proteins, as this dye does
not disrupt multiprotein complexes, allowing for their resolution through gel
electrophoresis. This methodology has been successfully utilized in studies of the M1
![Page 44: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/44.jpg)
30
muscarinic receptor114 and the OX1 orexin receptor115, among others, to probe the
oligomeric states of these GPCRs, as the minimal disruption of multiprotein complexes
with this approach allows for visualization of the fraction of receptors that exist as
monomers vs dimers and higher order oligomers, a distinct advantage over conventional
Co-IP approaches. Additionally, the individual components of the multiprotein
complexes visualized through this approach can be subsequently dissected through
conventional SDS-PAGE, revealing the constituent proteins of a putative oligomer116.
This approach, similar to Co-IP, still requires receptors be engineered to possess an
epitope tag, and cannot be utilized to assess dynamic aspects of GPCR dimerization, such
as dimer half-life and ontogeny. Still, BN-PAGE utilizes a more streamlined
methodology than Co-IP analysis and it remains a valuable tool in probing GPCR dimers
and oligomers.
There are significant drawbacks for each of the approaches listed above. First,
both methodologies require cells to be lysed and harvested, and thus cannot be employed
for investigations of GPCR dimerization dynamics in living cells. Additionally, in many
cases, receptors must be overexpressed in order to be appropriately resolved through
Western blot analysis, raising the possibility that these assays detect interactions between
receptors that are not physiologically relevant112. Also, as these methodologies do not
distinguish between direct receptor-receptor interactions and their incorporation in larger
protein complexes, these methodologies are often complemented by microscopy-based
approaches to further verify their findings.
![Page 45: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/45.jpg)
31
Microscopy-based approaches to resolve GPCR dimerization
A number of microscopic techniques have been adapted to probe the existence
and organization of putative GPCR oligomers. Historically, the most common technique
utilized in this regard has been Fluorescent Resonance Energy Transfer (FRET). This
methodology, first proposed by Theodor Förster in 1948, involves energy transfer
between complementary fluorophores through dipole-dipole interactions, with one
fluorophore acting as an energy donor and another acting as an energy acceptor117. For
this energy transfer to occur, both fluorophores must be in close proximity to one another,
with the upper limit for detection of FRET being ~100 Å distance between the two
fluorophores involved. Additionally, the excitation spectrum for the acceptor fluorophore
must overlap with the emission spectrum for the donor fluorophore, even though the
energy transfer between molecules does not rely on emitted photons from the donor
fluorophore118. Furthermore, while not a specific requirement for FRET, the emission
spectra of the fluorophores utilized must have sufficient separation to allow for the
resolution of one fluorophore from the other when visualized. Common fluorophore pairs
utilized in FRET analysis (listed as donor/acceptor) are Cyan Fluorescent Protein (CFP)/
Yellow Fluorescent Protein (YFP), Cerulean/Venus, and Cy3/Cy5119. Multiple methods
to determine FRET efficiency, or the fraction of donor fluorophores that transfer energy
to acceptor molecules, exist, including time resolved FRET (TR-FRET), acceptor
photobleaching, and sensitized emission120. Sensitized emission FRET, perhaps the
simplest of these methodologies, involves co-expressing donor and acceptor-tagged
proteins in the same cell and exciting only the donor fluorophore. Under ideal conditions
(no cross-talk between fluorescent proteins), any subsequent emission from the acceptor
![Page 46: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/46.jpg)
32
fluorophore would be the direct result of non-radiative energy transfer from the donor to
the acceptor molecule. FRET efficiency can be determined by comparing acceptor
fluorescence in co-transfected cells with the fluorescent spectra of cells expressing only
the donor or acceptor tagged molecule. This method, while straightforward, suffers from
complications due to the significant cross-talk exhibited by most FRET pair fluorescent
proteins, and as such, requires multiple filter combinations and post-processing
corrections to be employed to accurately analyze FRET efficiencies.
A more robust quantitative FRET methodology is acceptor photobleaching FRET.
This methodology relies on the fact that, if a FRET response is occurring between a
donor and acceptor fluorophore, the donor emission spectra is “quenched” by non-
radiative energy transfer to the acceptor fluorophore. Following initial image acquisition,
the acceptor fluorophore is photobleached by high intensity laser pulses, eliminating
energy transfer between the donor and acceptor fluorophores, which can be visualized as
an increase in donor fluorescence following acceptor photobleaching120. This
methodology eliminates many issues involving cross talk between fluorophores, as long
as the donor fluorophore is not bleached by the acceptor photobleaching pulse, as the
increase in donor fluorescence is directly proportional to the fraction of donor molecules
transferring energy to acceptor fluorophores, which is useful when quantifying
differential FRET responses.
Time resolved FRET (TR-FRET) is another methodology that seeks to maximize
signal to noise ratios by using lanthanide fluorophores for both donor and acceptor
molecules121. In contrast to GFP derived fluorophores, which possess fluorescent
lifetimes ranging from approximately 2-4 nanoseconds, lanthanide fluorophores possess
![Page 47: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/47.jpg)
33
much longer fluorescent lifetimes (~1 millisecond), which allows for a delay of
approximately 50 microseconds to be added between donor excitation and emission
signal acquisition121. During this delay, any background autofluorescence from tissue will
dissipate, resulting in increased signal to noise ratios in TR-FRET data when compared to
other FRET methodologies. The large distances between peak excitation and emission
wavelengths in the lanthanide fluorophores used in TR-FRET studies also minimizes
cross-talk and bleedthrough between the donor and acceptor fluorophores, further
increasing signal to noise ratios with this methodology122. As such, TR-FRET remains a
useful and robust methodology for determining the oligomeric state of GPCRs.
All FRET methodologies suffer from inherent and methodological pitfalls. For
example, intermolecular FRET efficiency is directly dependent on the stoichiometry of
the donor and acceptor-tagged proteins of interest. As such, many FRET studies bias the
likelihood of donor-acceptor interactions by transfecting a greater ratio of acceptor-
tagged receptors than donor-tagged receptors. This increases the likelihood of donor-
tagged proteins interacting with acceptor tagged proteins at the cell surface, increasing
observed FRET efficiencies. However, the stochastic incorporation of plasmids inherent
to transient transfections can lead to large cell to cell variance in observed FRET
efficiencies. Additionally, FRET relies on the three-dimensional positioning and
orientation of the fluorophores involved, and as such, the location of the fluorophore
fusion with the receptor molecule, and any interactions, such as ligand binding, that
impact the conformation of the receptor can potentially influence observed FRET
efficiencies without reflecting a change in receptor-receptor interactions. FRET
efficiencies are also impacted by membrane curvature and overall receptor density,
![Page 48: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/48.jpg)
34
calling into question the results of FRET studies which rely on overexpression of tagged
receptors in a heterologous expression system123. As such, FRET studies are often paired
with biochemical assays, such as Co-IP, to increase confidence in their findings.
A similar methodology to FRET commonly used to probe the oligomeric states of
various GPCRs is bioluminescent resonance energy transfer (BRET). This methodology
involves tagging of the donor molecule with a luciferase variant, which will typically
emit ~480nm photons following addition of a luciferin substrate. This emitted photon is
capable of exciting a fluorophore on the acceptor molecule, typically a GFP or YFP
variant, resulting in subsequent photon emission between 510-530nm depending on the
acceptor fluorophore used124. Similar to FRET, the donor luciferase molecule must be
within 100 Å of the acceptor fluorophore for BRET interactions to occur. One specific
advantage of this methodology over conventional FRET methods is the separation of
emission spectra between donor and acceptor molecules, increasing signal to noise
ratio125. Additionally, BRET does not rely on laser stimulation of a donor fluorophore
molecule, greatly reducing background autofluorescence and further enhancing signal
acquisition125. However, BRET suffers from similar complications as FRET analysis,
being highly dependent on receptor density, with receptor overexpression capable of
greatly increasing observed BRET responses121. Also, BRET signals are difficult to
detect at low receptor expression levels, limiting its value in studying receptor-receptor
interactions in native tissues121.
An additional microscopy-based approach to resolve GPCR-GPCR interactions is
biomolecular fluorescent complementation, or BiFC. This methodology involves the
generation of tagged acceptor and donor receptors with complementary fragments of a
![Page 49: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/49.jpg)
35
fluorophore molecule, most commonly a GFP-derived fluorophore126. When expressed
alone, the fluorophore fragments attached to either the donor or acceptor receptor are
unable to adopt a conformation capable of producing fluorescence. However, co-
localization of the complementary fluorophore fragments within approximately 7 nm
leads to a functional reconstitution of the split fluorophore molecule, which can be
visualized through fluorescent microscopy127. A specific advantage of this methodology
over both BRET and FRET approaches in the ability to resolve BiFC interactions at low
receptor densities that may more accurately reflect physiological expression levels than
receptor overexpression commonly seen in both BRET and FRET investigations128.
Additionally, BiFC does not suffer from issues such as crosstalk or bleedthrough between
acceptor and donor fluorophores, as is common with FRET investigations. This does not
mean that BiFC is without its flaws. One major issue regarding BiFC analysis of
receptor-receptor interactions is that fluorescent complementation of acceptor and donor
fragments may occur as a result of “kiss and run” interactions between donor and
acceptor molecules, rather than reflecting stable interactions between the receptors
involved. This also renders this methodology incapable of studying dynamic protein-
protein interactions, as fluorescent complementation is a largely irreversible event129.
These concerns, similar to BRET and FRET based investigations, result in receptor-
receptor interactions suggested by BiFC being further verified by additional
methodologies, such as Co-IP, to increase confidence in BiFC results129. Thus, similar to
other microscopy-based approaches, BiFC offers specific advantages and disadvantages
to resolving GPCR-GPCR interactions within the cell. Altogether, multiple microscopy-
based methodologies to resolve GPCR dimers exist, each of which offering specific
![Page 50: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/50.jpg)
36
benefits and tradeoffs in contrast to others, leading to complementary methodologies such
as co-immunoprecipitation to be utilized to increase confidence in FRET, BRET, and
BiFC studies.
Conclusion
Since the initial cloning of the β2AR nearly four decades ago, much progress has
been made towards a comprehensive understanding of GPCR function. It is now clear
that this receptor superfamily exhibits greater complexity in activation and signaling than
can be predicted by the classical two-state model. Additionally, as the number of
annotated GPCR dimers and oligomers continues to grow, the question of whether a
monomer or higher order structure represents the functional receptor unit for many
GPCRs remains the subject of much debate. Furthermore, receptor-receptor interactions
within a dimer can giving lead to transactivation or transdesensitization, which can
complicate efforts to assign specific downstream signaling pathways to individual
GPCRs. As such, continued investigation of conserved GPCR sequence motifs, as well as
allosteric modulators of GPCR signaling, may elucidate fundamental molecular
interactions and events underlying GPCR function and activity and further our
understanding of this protein superfamily.
![Page 51: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/51.jpg)
37
REFERENCES
1. Krishnan, A., Almén, M. S., Fredriksson, R. & Schiöth, H. B. The Origin of
GPCRs: Identification of Mammalian like Rhodopsin, Adhesion, Glutamate and
Frizzled GPCRs in Fungi. PLoS One 7, e29817 (2012).
2. Hanlon, C. D. & Andrew, D. J. Outside-in signaling – a brief review of GPCR
signaling with a focus on the Drosophila GPCR family. J Cell Sci 128, 3533–3542
(2015).
3. Hu, G.-M., Mai, T.-L. & Chen, C.-M. Visualizing the GPCR Network:
Classification and Evolution. Sci. Rep. 7, 15495 (2017).
4. Dixon, R. A. F. et al. Cloning of the gene and cDNA for mammalian β-adrenergic
receptor and homology with rhodopsin. Nature 321, 75–79 (1986).
5. Thomsen, W., Frazer, J. & Unett, D. Functional assays for screening GPCR
targets. Curr. Opin. Biotechnol. 16, 655–665 (2005).
6. Ferré, S. et al. G Protein-Coupled Receptor Oligomerization Revisited: Functional
and Pharmacological Perspectives. doi:10.1124/pr.113.008052.
7. Xu, J. et al. GPR68 Senses Flow and Is Essential for Vascular Physiology Article
GPR68 Senses Flow and Is Essential for Vascular Physiology. Cell 173, 762-
767.e16 (2018).
8. S-H Park, P., Lodowski, D. T. & Palczewski, K. Activation of G Protein-Coupled
Receptors: Beyond Two-State Models and Tertiary Conformational Changes
OVERVIEW OF G PROTEIN-COUPLED RECEPTOR STRUCTURE.
![Page 52: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/52.jpg)
38
doi:10.1146/annurev.pharmtox.48.113006.094630.
9. Bray, P. et al. Human cDNA clones for four species of G alpha s signal
transduction protein. Proc. Natl. Acad. Sci. U. S. A. 83, 8893–7 (1986).
10. Ahn, S. et al. A dominant-negative inhibitor of CREB reveals that it is a general
mediator of stimulus-dependent transcription of c-fos. Mol. Cell. Biol. 18, 967–77
(1998).
11. Lim, C. et al. Functional role of CREB-binding protein in the circadian clock
system of Drosophila melanogaster. Mol. Cell. Biol. 27, 4876–90 (2007).
12. Obel, L. F. et al. Brain glycogen—new perspectives on its metabolic function and
regulation at the subcellular level. Front. Neuroenergetics 4, 3 (2012).
13. Ichiki, T. Role of cAMP Response Element Binding Protein in Cardiovascular
Remodeling Good, Bad, or Both? (2006)
doi:10.1161/01.ATV.0000196747.79349.d1.
14. Alig, J. et al. Control of heart rate by cAMP sensitivity of HCN channels. Proc.
Natl. Acad. Sci. 106, 12189–12194 (2009).
15. Morgan, P. J. & Mordue, W. Cyclic AMP and locust diuretic hormone action.
Hormone induced changes in cAMP levels offers a novel method for detecting
biological activity of uncharacterized peptide. Insect Biochem. 15, 247–257
(1985).
16. Kandel, E. R. The molecular biology of memory: cAMP, PKA, CRE, CREB-1,
CREB-2, and CPEB. http://www.molecularbrain.com/content/5/1/14 (2012)
![Page 53: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/53.jpg)
39
doi:10.1186/1756-6606-5-14.
17. Sands, W. A., Woolson, H. D., Milne, G. R., Rutherford, C. & Palmer, T. M.
Exchange protein activated by cyclic AMP (Epac)-mediated induction of
suppressor of cytokine signaling 3 (SOCS-3) in vascular endothelial cells. Mol.
Cell. Biol. 26, 6333–46 (2006).
18. Taussig, R. & Gilman, A. G. Mammalian membrane-bound adenylyl cyclases. J.
Biol. Chem. 270, 1–4 (1995).
19. Padgett, C. L. & Slesinger, P. A. GABAB Receptor Coupling to G-proteins and
Ion Channels. Adv. Pharmacol. 58, 123–147 (2010).
20. Iannacone, M. J. et al. The RFamide receptor DMSR-1 regulates stress-induced
sleep in C. elegans. Elife 6, (2017).
21. Harden, T. K., Waldo, G. L., Hicks, S. N. & Sondek, J. Mechanism of activation
and inactivation of Gq/phospholipase C-β signaling nodes. Chem. Rev. 111, 6120–
9 (2011).
22. Heydorn, A. et al. Identification of a novel site within G protein alpha subunits
important for specificity of receptor-G protein interaction. Mol. Pharmacol. 66,
250–9 (2004).
23. Goldsmith, Z. G. & Dhanasekaran, D. N. G Protein regulation of MAPK networks.
Oncogene vol. 26 3122–3142 (2007).
24. Liu, K. peing et al. Calcium receptor-induced serotonin secretion by parafollicular
cells: Role of phosphatidylinositol 3-kinase-dependent signal transduction
![Page 54: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/54.jpg)
40
pathways. J. Neurosci. 23, 2049–2057 (2003).
25. Gough, N. R. Connecting GPCRs to NF-κB. Sci. STKE 2007, tw12–tw12 (2007).
26. K-K Fung, B. Characterization of Transducin from Bovine Retinal Rod Outer
Segments I. SEPARATION AND RECONSTITUTION OF THE SUBUNITS*. THE
JOURNAL OF BIOLOGICAL CHEMISTRY Printed in U.S.A vol. 258
http://www.jbc.org/.
27. Spielman, A. I. Gustducin and its Role in Taste. J. Dent. Res. 77, 539–544 (1998).
28. Dascal, N. Ion-channel regulation by G proteins. Trends in Endocrinology and
Metabolism vol. 12 391–398 (2001).
29. Walsh, K. B. Targeting GIRK channels for the development of new therapeutic
agents. Front. Pharmacol. OCT, 64 (2011).
30. Snow, B. E. et al. A G protein γ subunit-like domain shared between RGS11 and
other RGS proteins specifies binding to Gβ5 subunits. Proc. Natl. Acad. Sci. 95,
13307–13312 (1998).
31. McPherson, K. B. et al. Regulators of G-Protein Signaling (RGS) Proteins
Promote Receptor Coupling to G-Protein-Coupled Inwardly Rectifying Potassium
(GIRK) Channels. J. Neurosci. 38, 8737–8744 (2018).
32. Taussig, R., Quarmby, L. M. & Gilman, A. G. THE JOURNAL OF BIOLOGICAL
CHEMISTRY Regulation of Purified Type I and Type I1 Adenylylcyclases by G
Protein Br Subunits* Plasmid Construction-To facilitate purification of type I
adeny-lylcyclase, we constructed a recombinant baculovims encoding a type. vol.
![Page 55: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/55.jpg)
41
268 http://www.jbc.org/content/268/1/9.full.pdf (1993).
33. Litosch, I. G-protein inhibition of phospholipase C-beta 1 in membranes: role of
G-protein beta gamma subunits. Biochem. J. 319 ( Pt 1), 173–8 (1996).
34. Wu, D., Katz, A. & Simon, M. I. Activation of phospholipase C beta 2 by the
alpha and beta gamma subunits of trimeric GTP-binding protein. Proc. Natl. Acad.
Sci. U. S. A. 90, 5297–301 (1993).
35. Gurevich, V. V & Gurevich, E. V. GPCR Signaling Regulation: The Role of
GRKs and Arrestins. Front. Pharmacol. 10, 125 (2019).
36. Palczewski, K. & Saari, J. C. Activation and inactivation steps in the visual
transduction pathway. Curr. Opin. Neurobiol. 7, 500–504 (1997).
37. Smith, J. S. & Rajagopal, S. The β-Arrestins: Multifunctional Regulators of G
Protein-coupled Receptors. J. Biol. Chem. 291, 8969–77 (2016).
38. Niu, S. et al. Beta-Arrestin 1 Mediates Liver Thyrotropin Regulation of
Cholesterol Conversion Metabolism via the Akt-Dependent Pathway. Int. J.
Endocrinol. 2018, 1–12 (2018).
39. Donthamsetti, P. et al. Arrestin recruitment to dopamine D2 receptor mediates
locomotion but not incentive motivation. Mol. Psychiatry 1 (2018)
doi:10.1038/s41380-018-0212-4.
40. Bockaert, J., Fagni, L., Dumuis, A. & Marin, P. GPCR interacting proteins (GIP).
Pharmacol. Ther. 103, 203–221 (2004).
41. Dickerson, I. M. Role of CGRP-receptor component protein (RCP) in CLR/RAMP
![Page 56: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/56.jpg)
42
function. Curr. Protein Pept. Sci. 14, 407–15 (2013).
42. McLatchie, L. M. et al. RAMPs regulate the transport and ligand specificity of the
calcitonin-receptor-like receptor. Nature 393, 333–339 (1998).
43. Martin, A. L., Steurer, M. A. & Aronstam, R. S. Constitutive Activity among
Orphan Class-A G Protein Coupled Receptors. PLoS One 10, e0138463 (2015).
44. Seifert, R. & Wenzel-Seifert, K. Constitutive activity of G-protein-coupled
receptors: cause of disease and common property of wild-type receptors. Naunyn.
Schmiedebergs. Arch. Pharmacol. 366, 381–416 (2002).
45. Kobilka, B. K. & Deupi, X. Conformational complexity of G-protein-coupled
receptors. Trends Pharmacol. Sci. 28, 397–406 (2007).
46. Liu, F. et al. Involvement of both G(q/11) and G(s) proteins in gonadotropin-
releasing hormone receptor-mediated signaling in L beta T2 cells. J. Biol. Chem.
277, 32099–108 (2002).
47. Harmar, A. J. et al. cDNA sequence of human β-preprotachykinin, the common
precursor to substance P and neurokinin A. FEBS Lett. 208, 67–72 (1986).
48. Palanche, T. et al. The Neurokinin A Receptor Activates Calcium and cAMP
Responses through Distinct Conformational States. J. Biol. Chem. 276, 34853–
34861 (2001).
49. Wacker, D., Stevens, R. C. & Roth, B. L. How Ligands Illuminate GPCR
Molecular Pharmacology. Cell vol. 170 414–427 (2017).
50. Ballesteros, J. A. et al. Activation of the β2-Adrenergic Receptor Involves
![Page 57: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/57.jpg)
43
Disruption of an Ionic Lock between the Cytoplasmic Ends of Transmembrane
Segments 3 and 6. J. Biol. Chem. 276, 29171–29177 (2001).
51. Pruitt, M. M., Lamm, M. H. & Coffman, C. R. Molecular dynamics simulations on
the Tre1 G protein-coupled receptor: exploring the role of the arginine of the NRY
motif in Tre1 structure. BMC Struct. Biol. 13, 15 (2013).
52. Ballesteros, J. A. et al. Activation of the beta 2-adrenergic receptor involves
disruption of an ionic lock between the cytoplasmic ends of transmembrane
segments 3 and 6. J. Biol. Chem. 276, 29171–7 (2001).
53. Bhattacharya, S., Salomon-Ferrer, R., Lee, S. & Vaidehi, N. Conserved
Mechanism of Conformational Stability and Dynamics in G-Protein-Coupled
Receptors. J. Chem. Theory Comput. 12, 5575–5584 (2016).
54. Rovati, G. E., Rie Capra, V. & Neubig, R. R. The Highly Conserved DRY Motif
of Class A G Protein-Coupled Receptors: Beyond the Ground State. Mol.
Pharmacol. 71, 959–964 (2007).
55. Rasmussen, S. G. F. et al. Mutation of a Highly Conserved Aspartic Acid in the β
2 Adrenergic Receptor: Constitutive Activation, Structural Instability, and
Conformational Rearrangement of Transmembrane Segment 6. Mol. Pharmacol.
56, 175–184 (2018).
56. Alewijnse, A. E. et al. The effect of mutations in the DRY motif on the
constitutive activity and structural instability of the histamine H(2) receptor. Mol.
Pharmacol. 57, 890–898 (2000).
![Page 58: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/58.jpg)
44
57. Vogel, R. et al. Functional Role of the “Ionic Lock”—An Interhelical Hydrogen-
Bond Network in Family A Heptahelical Receptors. J. Mol. Biol. 380, 648–655
(2008).
58. Rosenthal, W., Antaramian, A., Gilbert, S. & Birnbaumer, M. Nephrogenic
diabetes insipidus. A V2 vasopressin receptor unable to stimulate adenylyl cyclase.
Journal of Biological Chemistry vol. 268
http://www.jbc.org/content/268/18/13030.full.pdf (1993).
59. Costa, E. M. F. et al. Two Novel Mutations in the Gonadotropin-Releasing
Hormone Receptor Gene in Brazilian Patients with Hypogonadotropic
Hypogonadism and Normal Olfaction 1. J. Clin. Endocrinol. Metab. 86, 2680–
2686 (2001).
60. Rizzo, M. J., Evans, J. P., Burt, M., Saunders, C. J. & Johnson, E. C. Unexpected
role of a conserved domain in the first extracellular loop in G protein-coupled
receptor trafficking. Biochem. Biophys. Res. Commun. 503, 1919–1926 (2018).
61. Klco, J. M., Nikiforovich, G. V & Baranski, T. J. Genetic Analysis of the First and
Third Extracellular Loops of the C5a Receptor Reveals an Essential WXFG Motif
in the First Loop. J. Biol. Chem. 281, 12010–12019 (2006).
62. Hulme, E. C. GPCR activation: a mutagenic spotlight on crystal structures. Trends
Pharmacol. Sci. 34, 67–84 (2013).
63. De Filippo, E. et al. Role of extracellular cysteine residues in the adenosine A2A
receptor. Purinergic Signal. 12, 313–329 (2016).
![Page 59: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/59.jpg)
45
64. Olivella, M., Caltabiano, G. & Cordomí, A. The role of Cysteine 6.47 in class A
GPCRs. BMC Struct. Biol. 13, 3 (2013).
65. Weis, W. I. & Kobilka, B. K. The Molecular Basis of G Protein–Coupled Receptor
Activation. Annu. Rev. Biochem. 87, 897–919 (2018).
66. Shi, L. et al. Modulation of the proline kink in transmembrane 6 by a rotamer
toggle switch. J. Biol. Chem. 277, 40989–96 (2002).
67. Biebermann, H. et al. New Pathogenic Thyrotropin Receptor Mutations Decipher
Differentiated Activity Switching at a Conserved Helix 6 Motif of Family A
GPCR. J. Clin. Endocrinol. Metab. 97, E228–E232 (2012).
68. Standfuss, J. et al. The structural basis of agonist-induced activation in
constitutively active rhodopsin. Nature 471, 656–60 (2011).
69. Cherezov, V. et al. High-resolution crystal structure of an engineered human
beta2-adrenergic G protein-coupled receptor. Science 318, 1258–65 (2007).
70. Katritch, V., Cherezov, V. & Stevens, R. C. Structure-Function of the G Protein–
Coupled Receptor Superfamily. Annu. Rev. Pharmacol. Toxicol. 53, 531–556
(2013).
71. Barak, L. S. et al. A highly conserved tyrosine residue in G protein-coupled
receptors is required for agonist-mediated β2-adrenergic receptor sequestration. J.
Biol. Chem. 269, 2790–2795 (1994).
72. Barak, L. S., Ménard, L., Ferguson, S. S. G., Colapietro, A. M. & Caron, M. G.
The Conserved Seven-Transmembrane Sequence NP(X)2,3Y of the G-Protein-
![Page 60: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/60.jpg)
46
Coupled Receptor Superfamily Regulates Multiple Properties of the β2-Adrenergic
Receptor. Biochemistry 34, 15407–15414 (1995).
73. Kalatskaya, I. et al. Mutation of tyrosine in the conserved NPXXY sequence leads
to constitutive phosphorylation and internalization, but not signaling, of the human
B2 bradykinin receptor. J. Biol. Chem. 279, 31268–76 (2004).
74. Slice, L. W. et al. The conserved NPX(n)Y motif present in the gastrin-releasing
peptide receptor is not a general sequestration sequence. J. Biol. Chem. 269,
21755–21761 (1994).
75. Rosenbaum, D. M., Rasmussen, S. G. F. & Kobilka, B. K. The structure and
function of G-protein-coupled receptors. Nature 459, 356–363 (2009).
76. Ragnarsson, L., Andersson, Å., Thomas, W. G. & Lewis, R. J. Mutations in the
NPxxY motif stabilize pharmacologically distinct conformational states of the
α1B- and β2-adrenoceptors. Sci. Signal. 12, eaas9485 (2019).
77. White, J. H. et al. Heterodimerization is required for the formation of a functional
GABA(B) receptor. Nature 396, 679–682 (1998).
78. Margeta-Mitrovic, M., Jan, Y. N. & Jan, L. Y. A Trafficking Checkpoint Controls
GABAB Receptor Heterodimerization. Neuron 27, 97–106 (2000).
79. Chun, L., Zhang, W. & Liu, J. Structure and ligand recognition of class C GPCRs.
Acta Pharmacol. Sin. 33, 312–323 (2012).
80. Grushevskyi, E. O. et al. Stepwise activation of a class C GPCR begins with
millisecond dimer rearrangement. Proc. Natl. Acad. Sci. U. S. A. 116, 10150–
![Page 61: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/61.jpg)
47
10155 (2019).
81. Møller, T. C., Moreno-Delgado, D., Pin, J.-P. & Kniazeff, J. Class C G protein-
coupled receptors: reviving old couples with new partners. Biophys. Reports 3, 57–
63 (2017).
82. Milligan, G., Ward, R. J. & Marsango, S. GPCR homo-oligomerization. Current
Opinion in Cell Biology vol. 57 40–47 (2019).
83. Wu, B. et al. Structures of the CXCR4 chemokine GPCR with small-molecule and
cyclic peptide antagonists. Science 330, 1066–71 (2010).
84. Mancia, F., Assur, Z., Herman, A. G., Siegel, R. & Hendrickson, W. A. Ligand
sensitivity in dimeric associations of the serotonin 5HT2c receptor. EMBO Rep.
(2008) doi:10.1038/embor.2008.27.
85. Borroto-Escuela, D. O. et al. Mapping the interface of a GPCR Dimer: A structural
model of the A2A Adenosine and D2 dopamine receptor heteromer. Front.
Pharmacol. (2018) doi:10.3389/fphar.2018.00829.
86. Fotiadis, D. et al. The G protein-coupled receptor rhodopsin in the native
membrane. FEBS Lett. 564, 281–288 (2004).
87. Petersen, J. et al. Agonist-induced dimer dissociation as a macromolecular step in
G protein-coupled receptor signaling. Nat. Commun. 8, 226 (2017).
88. Wolf, S. & Grünewald, S. Sequence, Structure and Ligand Binding Evolution of
Rhodopsin-Like G Protein-Coupled Receptors: A Crystal Structure-Based
Phylogenetic Analysis. PLoS One 10, e0123533 (2015).
![Page 62: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/62.jpg)
48
89. Huang, J., Chen, S., Zhang, J. J. & Huang, X. Y. Crystal structure of oligomeric β
1-adrenergic G protein-coupled receptors in ligand-free basal state. Nat. Struct.
Mol. Biol. (2013) doi:10.1038/nsmb.2504.
90. Ward, R. J., Pediani, J. D., Harikumar, K. G., Miller, L. J. & Milligan, G. Spatial
intensity distribution analysis quantifies the extent and regulation of
homodimerization of the secretin receptor. Biochem. J. 474, 1879–1895 (2017).
91. Harikumar, K. G., Ball, A. M., Sexton, P. M. & Miller, L. J. Importance of lipid-
exposed residues in transmembrane segment four for family B calcitonin receptor
homo-dimerization. Regul. Pept. 164, 113–119 (2010).
92. May, L. T., Bridge, L. J., Stoddart, L. A., Briddon, S. J. & Hill, S. J. Allosteric
interactions across native adenosine-A 3 receptor homodimers: Quantification
using single-cell ligand-binding kinetics. FASEB J. 25, 3465–3476 (2011).
93. Urizar, E. et al. Glycoprotein hormone receptors: Link between receptor
homodimerization and negative cooperativity. EMBO J. 24, 1954–1964 (2005).
94. El-Asmar, L. et al. Evidence for negative binding cooperativity within CCR5-
CCR2b heterodimers. Mol. Pharmacol. 67, 460–9 (2005).
95. Albizu, L. et al. Time-resolved FRET between GPCR ligands reveals oligomers in
native tissues. Nat. Chem. Biol. 6, 587–594 (2010).
96. Ferré, S. et al. G Protein–Coupled Receptor Oligomerization Revisited: Functional
and Pharmacological Perspectives. Pharmacol. Rev. 66, 413 LP – 434 (2014).
97. Vischer, H. F., Castro, M. & Pin, J. P. G protein-coupled receptor multimers: A
![Page 63: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/63.jpg)
49
question still open despite the use of novel approaches. Mol. Pharmacol. (2015)
doi:10.1124/mol.115.099440.
98. Zhao, G. Q. et al. The Receptors for Mammalian Sweet and Umami Taste. Cell
115, 255–266 (2003).
99. El Moustaine, D. et al. Distinct roles of metabotropic glutamate receptor
dimerization in agonist activation and G-protein coupling. Proc. Natl. Acad. Sci.
U. S. A. 109, 16342–7 (2012).
100. Pioszak, A. A., Harikumar, K. G., Parker, N. R., Miller, L. J. & Xu, H. E. Dimeric
arrangement of the parathyroid hormone receptor and a structural mechanism for
ligand-induced dissociation. J. Biol. Chem. 285, 12435–44 (2010).
101. Robinson, P. J., Pringle, M. A., Woolhead, C. A. & Bulleid, N. J. Folding of a
single domain protein entering the endoplasmic reticulum precedes disulfide
formation. J. Biol. Chem. (2017) doi:10.1074/jbc.M117.780742.
102. Dijkman, P. M. et al. Dynamic tuneable G protein-coupled receptor monomer-
dimer populations. Nat. Commun. (2018) doi:10.1038/s41467-018-03727-6.
103. Herrick-Davis, K., Weaver, B. A., Grinde, E. & Mazurkiewicz, J. E. Serotonin 5-
HT2C receptor homodimer biogenesis in the endoplasmic reticulum: real-time
visualization with confocal fluorescence resonance energy transfer. J. Biol. Chem.
281, 27109–16 (2006).
104. King, K., Dohlman, H. G., Thorner, J., Caron, M. G. & Lefkowitz, R. J. Control of
yeast mating signal transduction by a mammalian beta 2-adrenergic receptor and
![Page 64: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/64.jpg)
50
Gs alpha subunit. Science 250, 121–3 (1990).
105. Tamma, G., Carmosino, M., Svelto, M. & Valenti, G. Bradykinin signaling
counteracts cAMP-elicited aquaporin 2 translocation in renal cells. J. Am. Soc.
Nephrol. (2005) doi:10.1681/ASN.2005020190.
106. Haack, K. K. V et al. A novel bioassay for detecting GPCR heterodimerization:
Transactivation of beta 2 adrenergic receptor by bradykinin receptor. J. Biomol.
Screen. (2010) doi:10.1177/1087057109360254.
107. Rivero-Müller, A. et al. Rescue of defective G protein - Coupled receptor function
in vivo by intermolecular cooperation. Proc. Natl. Acad. Sci. U. S. A. (2010)
doi:10.1073/pnas.0906695106.
108. Alonso, N. et al. Cross-desensitization and cointernalization of H1 and H2
histamine receptors reveal new insights into histamine signal integration. Mol.
Pharmacol. (2013) doi:10.1124/mol.112.083394.
109. Sakai, T. et al. Evidence for differential regulation of GnRH signaling via
heterodimerization among GnRH receptor paralogs in the protochordate, Ciona
intestinalis. Endocrinology 153, 1841–1849 (2012).
110. González-Maeso, J. et al. Identification of a serotonin/glutamate receptor complex
implicated in psychosis. Nature 452, 93–97 (2008).
111. Moreno, J. L., Holloway, T., Albizu, L., Sealfon, S. C. & González-Maeso, J.
Metabotropic glutamate mGlu2 receptor is necessary for the pharmacological and
behavioral effects induced by hallucinogenic 5-HT2A receptor agonists. Neurosci.
![Page 65: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/65.jpg)
51
Lett. 493, 76–9 (2011).
112. Szidonya, L., Cserzo, M. & Hunyady, L. Dimerization and oligomerization of G-
protein-coupled receptors: Debated structures with established and emerging
functions. Journal of Endocrinology (2008) doi:10.1677/JOE-07-0573.
113. Schägger, H. & von Jagow, G. Blue native electrophoresis for isolation of
membrane protein complexes in enzymatically active form. Anal. Biochem. 199,
223–231 (1991).
114. Marquer, C. et al. Influence of MT7 toxin on the oligomerization state of the M1
muscarinic receptor1. Biol. Cell (2010) doi:10.1042/bc20090171.
115. Xu, T. R., Ward, R. J., Pediani, J. D. & Milligan, G. The orexin OX 1 receptor
exists predominantly as a homodimer in the basal state: Potential regulation of
receptor organization by both agonist and antagonist ligands. Biochem. J. (2011)
doi:10.1042/BJ20110230.
116. Fiala, G. J., Schamel, W. W. A. & Blumenthal, B. Blue native polyacrylamide gel
electrophoresis (BN-PAGE) for analysis of multiprotein complexes from cellular
lysates. J. Vis. Exp. (2010) doi:10.3791/2164.
117. Förster, T. Zwischenmolekulare Energiewanderung und Fluoreszenz. Ann. Phys.
437, 55–75 (1948).
118. Sekar, R. B. & Periasamy, A. Fluorescence resonance energy transfer (FRET)
microscopy imaging of live cell protein localizations. J. Cell Biol. 160, 629–33
(2003).
![Page 66: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/66.jpg)
52
119. Shrestha, D., Jenei, A., Nagy, P., Vereb, G. & Szöllősi, J. Understanding FRET as
a Research Tool for Cellular Studies. Int. J. Mol. Sci. 16, 6718 (2015).
120. Piston, D. W. & Kremers, G.-J. Fluorescent protein FRET: the good, the bad and
the ugly. Trends Biochem. Sci. 32, 407–414 (2007).
121. Cottet, M. et al. BRET and Time-resolved FRET strategy to study GPCR
oligomerization: from cell lines toward native tissues. Front. Endocrinol.
(Lausanne). 3, 92 (2012).
122. Bazin, H., Trinquet, E. & Mathis, G. Time resolved amplification of cryptate
emission: a versatile technology to trace biomolecular interactions. Rev. Mol.
Biotechnol. 82, 233–250 (2002).
123. Walsh, S. M. et al. Single Proteoliposome High-Content Analysis Reveals
Differences in the Homo-Oligomerization of GPCRs. Biophys. J. 115, 300–312
(2018).
124. Kocan, M. & Pfleger, K. D. G. Study of GPCR-protein interactions by BRET.
Methods Mol. Biol. 746, 357–371 (2011).
125. Salahpour, A. et al. BRET biosensors to study GPCR biology, pharmacology, and
signal transduction. Front. Endocrinol. (Lausanne). 3, 105 (2012).
126. Vidi, P.-A., Przybyla, J. A., Hu, C.-D. & Watts, V. J. Visualization of G protein-
coupled receptor (GPCR) interactions in living cells using bimolecular
fluorescence complementation (BiFC). Curr. Protoc. Neurosci. Chapter 5, Unit
5.29 (2010).
![Page 67: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/67.jpg)
53
127. Berendzen, K. et al. Screening for in planta protein-protein interactions combining
bimolecular fluorescence complementation with flow cytometry. Plant Methods 8,
25 (2012).
128. Kerppola, T. K. Bimolecular Fluorescence Complementation (BiFC) Analysis as a
Probe of Protein Interactions in Living Cells. Annu. Rev. Biophys. 37, 465–487
(2008).
129. Miller, K. E., Kim, Y., Huh, W.-K. & Park, H.-O. Bimolecular Fluorescence
Complementation (BiFC) Analysis: Advances and Recent Applications for
Genome-Wide Interaction Studies. J. Mol. Biol. 427, 2039–2055 (2015).
![Page 68: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/68.jpg)
54
Figure 1: Two-state model of GPCR activation. In the inactive receptor state (Fig. 1A),
in the absence of ligand, the receptor remains bound to an intracellular heterotrimeric G
protein. The α subunit in the heterotrimeric G protein is bound to GDP and is inactive.
Upon ligand binding (Fig. 1B), the receptor undergoes a conformational change, allowing
it to function as a guanine nucleotide exchange factor (GEF), facilitating the association
of a GTP molecule with the associated α subunit. This event activates the α subunit and
associated βγ subunits, leading to the dissociation of the heterotrimeric G protein from
the activated receptor, where they can then signal through a variety of intracellular
pathways.
![Page 69: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/69.jpg)
55
Figure 2: Functional importance of GPCR heterodimerization. In a classical,
monomeric receptor model of GPCR function, receptor A and receptor B signal through
disparate pathways independent of one another (Fig. 2A). In the case of
heterodimerization, ligand binding to receptor B can lead to intracellular signaling
through receptor A, a phenomenon referred to as transactivation (Fig. 2B).
Heterodimerization can also lead to transdesensitization (Fig. 2C), where ligand binding
to receptor B leads to β-arrestin association and subsequent internalization of the AB
receptor complex. This causes desensitization of receptor A in the absence of ligand
binding to this receptor.
![Page 70: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/70.jpg)
56
CHAPTER II: Unexpected role of a conserved domain in extracellular loop 1 in G
protein coupled receptor trafficking
Michael J. Rizzo1, Jack P. Evans1, Morgan Burt1, Erik C. Johnson1,2*
1 Department of Biology, Wake Forest University, Winston-Salem, NC 27109
2 and Center for Molecular Signaling
*Author for Correspondence: [email protected]
Keywords: G protein-coupled receptor (GPCR), membrane trafficking, signaling,
membrane transport, mutagenesis
The work contained in this chapter was initially published in the journal Biochemical and
Biophysical Research Communications. M.J. Rizzo, J.P. Evans, M. Burt, C.J. Saunders,
E.C. Johnson, “Unexpected role of a conserved domain in the first extracellular loop in G
protein-coupled receptor trafficking”, Biochem. Biophys. Res. Commun. 503 (2018).
Experiments were conceived by MJ Rizzo and EC Johnson. Reagents were generated and
experiments were performed by MJ Rizzo, JP Evans, and M Burt. Data were analyzed by
MJ Rizzo and EC Johnson. The manuscript was drafted by MJ Rizzo and edited by EC
Johnson.
![Page 71: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/71.jpg)
57
ABSTRACT
G protein coupled receptors are the largest superfamily of cell surface receptors in
the metazoa and play critical roles in transducing extracellular signals into intracellular
responses. This action is mediated through a conformational change in the receptor
following ligand binding. A number of conserved motifs play critical roles in GPCR
function and stability, but a particular, highly conserved motif in extracellular loop
one (EL1) remains under investigated. This WxFG motif is present in ~90% of Class A
GPCRs and is prevalent in 17 of the 19 Class A GPCR subfamilies, yet its function
remains incompletely elucidated. Using site-directed mutagenesis, we mutagenized a
conserved tryptophan residue in the highly conserved WxFG motif in EL1 in eight
receptors from disparate class A GPCR subfamilies. We first targeted the Drosophila
leucokinin receptor and found that substitution of any non-aromatic amino acid for the
conserved tryptophan ablated receptor function. Additionally, tryptophan to leucine
substitutions in the follicle stimulating hormone receptor (FSHR), Galanin receptor
(GALR1), AKH receptor (AKHR), corazonin receptor (CRZR), and muscarinic
acetylcholine receptor (mACHR1) lead to a loss of signaling response in each receptor.
We then utilized YFP tagged wild-type and mutant LKR, CRZR, and 5HT2cR receptors
to visualize these receptors in the cell and show that mutant receptor variants exhibited a
severe reduction in plasma membrane expression, indicating aberrant trafficking in these
receptors. Taken together, these results suggest a novel role for the WxFG motif in GPCR
trafficking and overall receptor function.
![Page 72: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/72.jpg)
58
INTRODUCTION
G protein coupled receptors (GPCRs) are the largest receptor superfamily present
throughout the metazoa1. Approximately 5% of all human genes encode these receptors
and these molecules are a target for approximately 50% of all extant drugs2. GPCRs play
a major role in myriad physiologies, including vision, taste, neurotransmission, hormonal
communication, and reproduction3. GPCRs transduce multiple disparate extracellular
signals into specific intracellular responses, most commonly increasing or inhibiting
intracellular calcium and cAMP and modulating gene expression4. Specifically, a
conformational change induced by ligand binding enables activation of intracellular
heterotrimeric G protein complexes, which in turn modulate disparate second
messengers.
Given the fundamental importance of GPCRs in a wide variety of behaviors and
physiologies, many structural-functional studies have aimed to understand the molecular
dynamics of receptor activity. Additionally, the crystal structure of rhodopsin has helped
identify a number of highly conserved motifs that have critical roles in wild type GPCR
function5. For example, various motifs have been implicated in activation (e.g., DRY,
CWxP), signal termination and receptor endocytosis (e.g., NPxxY), and endoplasmic
reticulum to cell surface trafficking (e.g., FX6LL)6–8. A particular motif that remains
relatively unexplored is the WxFG motif in extracellular loop one (EL1). This motif had
been initially described in the C5a receptor, wherein mutagenesis of the highly conserved
tryptophan residue led to a loss of signaling, presumably through a disruption of receptor
signaling downstream of ligand binding9. Subsequent studies suggested that this
tryptophan residue coevolved with proline residues on transmembrane domain 2 (TM2)
![Page 73: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/73.jpg)
59
and/or TM5, presumably to stabilize receptor conformation10. In this study, we first
investigated the prevalence of the WxFG motif in different receptor subfamilies and in
multiple taxa and established that this domain is widespread throughout Class A GPCRs.
We then assessed the functional roles of the tryptophan residue and found a critical role
for this residue for normal receptor function. We also found that this mutation ablated
constitutive signaling from a modified receptor. Evaluation of receptor distribution using
fluorescently tagged receptors revealed aberrant cellular localization, with the majority of
the mutant receptors restricted to internal membrane compartments. Structural modeling
of these receptor variants suggests this residue is critical for overall receptor topology.
Collectively, our results implicate that the WxFG motif plays a critical role in appropriate
GPCR cell surface trafficking and function.
![Page 74: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/74.jpg)
60
METHODS
Receptor sequence alignment:
We adopted the receptor subfamily A classification according to the phylogenetic
analysis of Joost and Methner to identify human receptors for each receptor subfamily11.
For a phylogenetic analysis, we used BLAST to search for homologous receptors to the
human subfamily receptors in Mus musculus, Gallus gallus, Xenopus laevis, Danio rerio,
Ciona intestinalis, Drosophila melanogaster, and Caenorhabditis elegans. Only
identified and validated receptor types were included in further analysis. Receptor
sequences were then entered into TMHMM server to identify sequences corresponding to
the first extracellular loop and consensus motifs for receptor subfamilies were generated
using the Seq2LOGO webserver.
GPCR cloning and mutagenesis:
All GPCRs were cloned into a pcDNA3 expression vector. The Drosophila receptors
originated from amplification from cDNA libraries and mammalian receptors were
obtained from Addgene and cdna.org libraries. The human 5HT2c receptor was
generously donated by Dr. Katherine Herrick-Davis. Mutagenic primers were designed
targeting the tryptophan residue to alter it to a leucine or other amino acid. Site-directed
PCR mutagenesis was performed using both classical PCR mutagenesis or single primer
reactions in parallel (SPRINP) 12,13. The restriction enzyme, DpnI, was utilized to remove
template receptor molecules following PCR mutagenesis. All receptor sequences were
verified through ABI 3730XL sequencing through Eton Bioscience INC (Research
Triangle Park, NC).
![Page 75: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/75.jpg)
61
GPCR Signaling Assays:
Galanin, somatostatin, and FSH were purchased from Phoenix Pharmaceticals
(Burlingame, CA). Leukokinin and adipokinetic hormone peptides from Drosophila
were synthesized by Multiple Peptide Systems (San Diego, CA). Acetylcholine and
corazonin were purchased from Sigma Chemicals (St. Louis, MO). HEK-293T cells were
transfected with GPCR recombinant DNA and either a CRE-luciferase or SRE-luciferase
reporter DNA at a 5:1 ratio of receptor: reporter construct as previously described14. For
assessing signaling emanating from Gi coupled receptors, the Gα16 was transfected at a
2:1 ratio to receptor construct15. Following transfection, 96 well plates were seeded with
cells and incubated with vehicle (MEM) or ligand for four hours (100,000 cells per well,
3 wells per independent transfection, 9 wells per condition). Following incubation,
luciferase activity was assessed using the Steadylite plus Reporter Gene Assay System
and Victor3 1420 multilabel plate reader. Luminescence was determined through counts
per second (CPS) output and receptor activity was normalized to vehicle responses for
each condition and reported as % basal activation.
GPCR Receptor trafficking assays:
Wild type and mutagenized receptors were cloned in frame into pcDNA3 CFP or
pcDNA3 YFP vectors and transfected into HEK-293T cells. Following transfection,
~100,000 cells were transferred to a glass cover slip and fixed with 2%
paraformaldehyde. Plasma membranes were then stained with 5mg/mL Wheat Germ
Agglutinin (WGA-594) and imaged on Zeiss 710 LSM confocal microscope. Receptor
localization and trafficking was compared between 5-10 independent cells from three
independent transfections expressing YFP tagged wild-type or mutagenized receptors.
![Page 76: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/76.jpg)
62
Colocalization of the receptor and plasma membrane was determined through Pearson’s
coefficient, calculated in FIJI software using the coloc2 plugin as previously described16.
Pearson colocalization coefficients of WGA and YFP were obtained for each condition,
and values were Fisher transformed prior to statistical analysis.
RAPTORX Receptor Modeling:
Receptor structures were predicted using full length ORF sequences from wild-type and
mutant leucokinin receptors modeled using the RAPTORX prediction server17 .
Prediction quality was assessed through the computed P value for fit (P<.001), using a
NK1R receptor as a template for prediction, a member of the same receptor subfamily as
the leucokinin receptor. Structural predictions were visualized using PyMol software
suite and the specific tryptophan (WT) or leucine (mutant) was highlighted, as well as N
and C termini.
![Page 77: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/77.jpg)
63
RESULTS
The WxFG domain is present in disparate receptors from multiple taxa:
The initial description of the WxFG receptor motif focused on the functional roles
of this domain in the human complement C5a receptor9. We sought to systematically
evaluate the prevalence of the WxFG motif among different Class A GPCRs, as the
original description of this motif suggested a high degree of conservation. Subsequently,
we performed a bioinformatic analysis across all 19 Class A receptor subfamilies
focusing on human receptor sequences11. We found that the motif is present in multiple
members of 17 different receptor subfamilies (Table 1). We did find a substitution in two
different peptide receptor subfamilies, A6 and A7, the neuromedin U and cholecystokinin
receptor subtypes respectively, in which a phenylalanine (F) residue has replaced the
tryptophan (W) position. Notably, this motif is completely absent in subfamilies A13 and
A14. Both of these receptor subfamilies have nucleotide/lipid ligands and suggest a
secondary loss of this motif in these related receptor subtypes.
Having established that this motif is present in multiple receptor subtypes, we
next evaluated whether this motif was a common feature of each receptor family across a
number of different taxa. We extended our analysis focusing on receptor sequences from
established vertebrate and invertebrate model organisms: Homo sapiens, Mus musculus,
Gallus gallus, Xenopus laevis, Danio rerio, Ciona intestinalis, Drosophila melanogaster,
and Caenorhabditis elegans. We aligned the sequence corresponding to the extracellular
loop for all clear members of a receptor family for each of taxa. Notably, in 15 of the 17
receptor subfamilies, the W position exhibited the least identity variance across all
![Page 78: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/78.jpg)
64
sequences as indicated by seq2logo bitscore (Figure 1). As noted previously, the
Cholecystokinin and Neuromedin U receptor subfamilies show a common F substitution.
The W residue is critical for GPCR signaling:
Alteration of the W residue in the WxFG motif causes a loss of receptor signaling
in the human complement 5a factor receptor, C5aR 9. Given the widespread prevalence
of this motif, we next examined whether the functional aspects of this motif were similar.
We first focused on the effects of different amino acid substitutions on receptor signaling
using the leucokinin receptor (LKR) from Drosophila, a receptor with critical roles in
meal size discretion and diuresis 18,19. We made different amino acid substitutions
representing changes to non-polar, charged, and aromatic subclasses: W101A, W101L,
W101K, W101E, and W101F. Each of these receptor variants, with the exception of the
W101F, were insensitive to ligand presentation. Specifically, while wild type LKR
exhibited dose dependent responses to ligand, the W101L, W101K, W101A, and W101E
variants exhibited no significant response to ligand presentation (Figure 2). In contrast,
the W101F substitution showed wild-type responses to ligand presentation, indicating
that this variant encodes a functional leucokinin receptor. Collectively, these data suggest
that amino acid identity at the W position in the WxFG motif is critically important for
receptor function.
We next extended our observations to include receptors from several different
subfamilies, and that differ in their signaling properties. We targeted six additional
receptors representing Class A GPCR subfamilies A4, A5, A6, A10, and A16.
Additionally, these receptors couple to distinct intracellular heterotrimeric G proteins,
with the corazonin receptor (CRZR) and follicle-stimulating hormone receptor (FSHR)
![Page 79: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/79.jpg)
65
coupling to Gs 20,21, the adipokinetic hormone receptor (AKHR), muscarinic
acetylcholine receptor (mACHR1), and leucokinin receptor (LKR) coupling to Gq 22–24,
and GALR1 and SSTR2 coupling to Gi 25,26. The promiscuous Gα16 subunit was
included in GALR1 and SSTR2 transfections to promote coupling of these receptors to
elevated calcium levels for ease of monitoring. All SSTR2, GALR1, mACHR1, and
FSHR mutant variants exhibited a significant loss of function compared to their wild type
counterparts. Additionally, the Drosophila AKH and corazonin receptors (AKHR,
CRZR), exhibited a similar loss of function when mutagenized (Figure 3).
Tryptophan variants impair constitutive signaling:
As previous studies suggested that WxFG domain mutant receptors bind ligand,
but lack signaling responses9, we tested whether the loss of signaling phenotypes could
be rescued by simultaneously conferring constitutive activity in a mutagenized receptor
background. Many GPCRs exhibit constitutive activity and constitutive activity can be
experimentally induced through targeted mutagenesis of the DRY motif 18,19. To induce
constitutive activity, we mutagenized the aspartate residue in the DRY motif of
the Drosophila AKHR receptor (D136A), which conferred significantly elevated basal
signaling compared to wild type AKHR (Figure 4A), whereas the W105L variant showed
no signaling response (Figure 4B). In contrast, a W105L, D136A double mutant receptor
showed no signaling activity in response to ligand or in the basal state, indicating a loss
of both ligand responsiveness and constitutive activity for that receptor (Figure 4C).
![Page 80: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/80.jpg)
66
Variants in the W residue impairs receptor trafficking:
Given that substitutions in the WxFG domain cause a reduction in signaling
independent of receptor type and ablate constitutive activity, we reasoned that abnormal
receptor expression could potentially explain the loss of function phenotypes. To
determine the impact of the tryptophan substitution in the WxFG motif on receptor
expression, we incorporated a C-terminal fluorescent tag. We targeted three different
receptors that differ in their signaling properties and are members of different receptor
subfamilies. Specifically, we added a yellow fluorescent protein (YFP) to the Drosophila
CRZR, and LKR and used a previously generated human 5HT2c-YFP receptor in both
wild-type and W�L substitution variants. While we observed strong fluorescent signals
in both wild-type and mutant receptors, however, the patterns of fluorescence were very
different. Specifically, we observed strong YFP signal limited to the plasma membrane
in wild-type receptors. In each of the W�L receptor variants, we found a dramatic
reduction in YFP signal at the plasma membrane, with an increased amount of
intracellular YFP expression (Figure 5). These results suggest that the WxFG motif plays
a critical role in receptor trafficking and provide a mechanism to explain the loss of
function receptor phenotypes.
Structural modeling suggests the W stabilizes receptor architecture:
Based on the confluence of our trafficking and signaling data, we hypothesized
that mutagenesis of the conserved W in WxFG must be significantly altering receptor
conformation and folding. To assess the impact of these substitutions, we initially
modeled the leucokinin receptor and a variant (W101L) using the RAPTORX protein
structural modeling program. The models suggest that substitutions of the tryptophan
![Page 81: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/81.jpg)
67
residue result in displacement of the N and C terminal regions of the receptor (Figure 6).
This distortion in overall receptor conformation suggests receptor instability may explain
the aberrant trafficking of mutant receptors.
![Page 82: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/82.jpg)
68
DISCUSSION
In this study, we extended a phylogenetic analysis of the presence of the WxFG
domain and found that this domain is highly conserved throughout different Class A
GPCRs. Specifically, this domain is present in seventeen of the nineteen Class A
subfamilies and is a prominent feature of these receptors independent of taxa. We also
evaluated the functional contributions of the largely invariant tryptophan reside and
found that an aromatic residue in this position is required for receptor function,
independent of receptor type or specific downstream effector. Furthermore, we find that
that this domain functions in GPCR trafficking and propose a structural model in which
the tryptophan stabilizes overall receptor architecture.
In the initial investigation of WxFG motif in the C5a receptor, Klco et al. noted
that a tryptophan was present in the first extracellular loop in 80% of human peptide-
binding GPCRs, and that a phenylalanine was present in 10 % of these receptors,
indicating high conservation of an aromatic residue at this position9. Here we performed a
comprehensive analysis of the presence of the WxFG motif in each Class A GPCR
subfamilies and showed that the motif is largely present in all subfamilies, with the
exception of A13 and A14 subfamilies. The loss of this domain in these subfamilies is
interesting, as it suggests that A13 and A14 receptor subfamilies may utilize different
strategies to adopt stable conformations. This hypothesis is supported by a
multidimensional scaling analysis by Pele et al. which suggests that the WxFG motif co-
evolved with proline residues on TM2 and TM5, presumably stabilizing overall receptor
structure 10. Notably, these proline residues are absent in A13 GPCRs, while the TM5
proline is absent in A14 members, both of which lack the WxFG motif. Additionally, the
![Page 83: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/83.jpg)
69
motif does not appear to be conserved in any other GPCR subfamily, suggesting it arose
during the expansion of Class A GPCRs27.
Multiple previous studies have investigated the WxFG motif in individual
receptors 9,28–30, and we have furthered these initial descriptions and suggest a novel
mechanism for the role of this motif in GPCR function. The initial investigation of the
C5a receptor showed that mutations at the tryptophan residue generated receptors that
bind ligand but are unable to transduce a signaling response9. Our data suggests that
modified receptors show an aberrant distribution within the cell, meaning that even if
these receptors are able to bind ligand, they are not present at the plasma membrane.
Given that these previous ligand binding studies were performed on isolated membrane
preparations, we suspect that modified receptors are localized to intracellular membrane
compartments. In support of this, A W99C substitution in the NK2R receptor exhibited
no ligand binding when assayed on whole cells31. The totality of these studies suggests an
aromatic amino acid at the W position is critical for wild type receptor function, and
modification of this position causes abnormal GPCR localization.
The aberrant localization of WxFG mutants might stem from defects in receptor
folding. Many conserved GPCR motifs play roles in stabilizing the receptor’s active and
inactive states, such as the ionic lock/DRY motif 32 and NPxxY motif 33, or act as
microswitches gating receptor activation, such as the CWxP motif 10. As previous studies
have shown that WxFG mutants are able to bind ligand, our data therefore suggest that
the WxFG motif plays an unexpected role in appropriate receptor trafficking. It is
presently unclear if this motif is involved in trafficking to the plasma membrane, or
alternatively, has other unexpected receptor phenotypes that could explain its intracellular
![Page 84: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/84.jpg)
70
distribution, such as constitutive desensitization of the receptor 34. Many GPCRs require
interactions with accessory proteins for appropriate cell surface trafficking, with the
Calcitonin receptors requiring interaction with RAMPs35, while the β1AR is stabilized at
the cell surface by interactions with PSD-95, a PDZ domain containing chaperone36. The
5HT2c receptor possesses a C-terminal PDZ-binding domain which plays a critical role
in the synaptic localization of this receptor37. Disruption of the WxFG motif may
interfere with receptor-chaperone interactions, leading to the aberrant receptor
localization that we observed. It is possible that the WxFG motif acts as a microswitch,
and its modification interferes with the transition between inactive and active receptor
conformations. We consider this unlikely, as we would predict that a constitutively
active, internalized receptor should still show evidence of increased basal activity.
Alternatively, the c-terminal F(X)6LL domain is critical for α2B-AR and AT1R exit from
the ER8, and WxFG may play a similar role in ensuring appropriate receptor localization.
Furthermore, the cysteine residue downstream of WxFG at the top of TM3 forms a
disulfide bond with a cysteine residue on EL238, and this disulfide bond is required for
appropriate trafficking of M3 receptor to the cell surface. Thus, the WxFG motif may be
important for allowing the interactions between these two extracellular loops in
establishing the appropriate receptor topology.
This study represents the most comprehensive investigation of the WxFG motif
across multiple Class A GPCR subfamilies to date. We have shown that this motif is
heavily conserved across Class A GPCRs, and substitution of the W with a nonaromatic
amino acid yields a nonfunctional receptor with impaired plasma membrane localization.
We suggest a novel mechanism by which that the WxFG motif plays a critical role in
![Page 85: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/85.jpg)
71
wild type GPCR trafficking to the plasma membrane, and likely functions in concert with
other conserved GPCR motifs to stabilize the receptor in an appropriate conformation.
Further investigation is necessary to determine whether these mutant receptors ever reach
the cell surface and are retained in the ER-Golgi complex, or that receptor instability
causes rapid internalization of the receptor.
ACKNOWLEDGEMENTS
We acknowledge Dr. Glen Marrs for microscopy assistance, Dr. Cecil Saunders and Jon
Nelson for manuscript editing, Dr. T. Michael Anderson for statistical analysis, and Dr.
Katherine Herrick-Davis for reagents. This work was funded by NSF IOS1355097 to
ECJ, and the WFU Center for Molecular Signaling (CMCS).
CONFLICTS OF INTEREST
The authors declare that they have no conflicts of interest with the contents of this
manuscript.
AUTHOR CONTRIBUTIONS
MJR and ECJ designed experiments, MJR, JPE, MB performed experiments. MJR and
ECJ analyzed results. MJR and ECJ wrote manuscript, all authors contributed edits.
![Page 86: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/86.jpg)
72
REFERENCES
1. Whitehead, I. P., Zohn, I. E. & Der, C. J. Rho GTPase-dependent transformation
by G protein-coupled receptors. Oncogene 20, 1547–1555 (2001).
2. Overington, J. P., Al-Lazikani, B. & Hopkins, A. L. How many drug targets are
there? Nat. Rev. Drug Discov. 5, 993–996 (2006).
3. Lefkowitz, R. J. A Brief History of G-Protein Coupled Receptors (Nobel Lecture).
Angew. Chemie Int. Ed. 52, 6366–6378 (2013).
4. Hanlon, C. D. & Andrew, D. J. Outside-in signaling – a brief review of GPCR
signaling with a focus on the Drosophila GPCR family. J Cell Sci 128, 3533–3542
(2015).
5. Palczewski, K. et al. Crystal structure of rhodopsin: A G protein-coupled receptor.
Science (80-. ). 289, 739–745 (2000).
6. Olivella, M., Caltabiano, G. & Cordomí, A. The role of Cysteine 6.47 in class A
GPCRs. BMC Struct. Biol. 13, 3 (2013).
7. Chen, W. J., Goldstein, J. L. & Brown, M. S. NPXY, a sequence often found in
cytoplasmic tails, is required for coated pit-mediated internalization of the low
density lipoprotein receptor. J. Biol. Chem. 265, 3116–3123 (1990).
8. Duvernay, M. T., Zhou, F. & Wu, G. A Conserved Motif for the Transport of G
Protein-coupled Receptors from the Endoplasmic Reticulum to the Cell Surface. J.
Biol. Chem. 279, 30741–30750 (2004).
9. Klco, J. M., Nikiforovich, G. V & Baranski, T. J. Genetic Analysis of the First and
![Page 87: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/87.jpg)
73
Third Extracellular Loops of the C5a Receptor Reveals an Essential WXFG Motif
in the First Loop. J. Biol. Chem. 281, 12010–12019 (2006).
10. Pelé, J., Abdi, H., Moreau, M., Thybert, D. & Chabbert, M. Multidimensional
Scaling Reveals the Main Evolutionary Pathways of Class A G-Protein-Coupled
Receptors. PLoS One 6, e19094 (2011).
11. Joost, P. & Methner, A. Phylogenetic analysis of 277 human G-protein-coupled
receptors as a tool for the prediction of orphan receptor ligands. Genome Biol. 3,
RESEARCH0063 (2002).
12. Weiner, M. P. et al. Site-directed mutagenesis of double-stranded DNA by the
polymerase chain reaction. Gene 151, 119–123 (1994).
13. Edelheit, O., Hanukoglu, A. & Hanukoglu, I. Simple and efficient site-directed
mutagenesis using two single-primer reactions in parallel to generate mutants for
protein structure-function studies. BMC Biotechnol. 9, 61 (2009).
14. Johnson, E. C. et al. Identification of Drosophila neuropeptide receptors by G
protein-coupled receptors-beta-arrestin2 interactions. J. Biol. Chem. 278, 52172–8
(2003).
15. Offermanns, S. & Simon, M. I. Gα15 and Gα16 Couple a Wide Variety of
Receptors to Phospholipase C. J. Biol. Chem. 270, 15175–15180 (1995).
16. Irannejad, R. et al. Functional selectivity of GPCR-directed drug action through
location bias. Nat. Chem. Biol. 13, 799–806 (2017).
17. Källberg, M. et al. Template-based protein structure modeling using the RaptorX
![Page 88: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/88.jpg)
74
web server. Nat. Protoc. 7, 1511–1522 (2012).
18. Al-Anzi, B. et al. The leucokinin pathway and its neurons regulate meal size in
Drosophila. Curr. Biol. 20, 969–978 (2010).
19. Yang, M. Y., Wang, Z., MacPherson, M., Dow, J. A. T. & Kaiser, K. A novel
Drosophila alkaline phosphatase specific to the ellipsoid body of the adult brain
and the lower Malpighian (renal) tubule. Genetics 154, 285–297 (2000).
20. Sha, K. et al. Regulation of ethanol-related behavior and ethanol metabolism by
the corazonin neurons and corazonin receptor in Drosophila melanogaster. PLoS
One 9, (2014).
21. Costagliola, S. et al. Tyrosine sulfation is required for agonist recognition by
glycoprotein hormone receptors. EMBO J. 21, 504–513 (2002).
22. Baumbach, J., Xu, Y., Hehlert, P. & Kühnlein, R. P. Gαq, Gγ1 and Plc21C Control
Drosophila Body Fat Storage. J. Genet. Genomics 41, 283–292 (2014).
23. Biddlecome, G. H., Berstein, G. & Ross, E. M. Regulation of Phospholipase C-1
by G and m1 Muscarinic Cholinergic Receptor. Steady-state balance of receptor-
mediated activation and GTPase-activating protein-promoted deactivation. J. Biol.
Chem. 271bara, 7999–8007 (1996).
24. Terhzaz, S. et al. Isolation and characterization of a leucokinin-like peptide of
Drosophila melanogaster. J. Exp. Biol. 202, 3667–3676 (1999).
25. Kagimoto, S. et al. Human somatostatin receptor, SSTR2, is coupled to adenylyl
cyclase in the presence of Gi alpha 1 protein. Biochem. Biophys. Res. Commun.
![Page 89: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/89.jpg)
75
202, 1188–1195 (1994).
26. Habert-Ortoli, E., Amiranoff, B., Loquet, I., Laburthe, M. & Mayaux, J. F.
Molecular cloning of a functional human galanin receptor. Proc. Natl. Acad. Sci.
U. S. A. 91, 9780–9783 (1994).
27. Nordström, K. J. V, Sällman Almén, M., Edstam, M. M., Fredriksson, R. &
Schiöth, H. B. Independent HHsearch, Needleman–Wunsch-Based, and Motif
Analyses Reveal the Overall Hierarchy for Most of the G Protein-Coupled
Receptor Families. Mol. Biol. Evol. 28, 2471–2480 (2011).
28. Peeters, M. C. et al. GPCR structure and activation: an essential role for the first
extracellular loop in activating the adenosine A2B receptor. FASEB J. 25, 632–643
(2010).
29. Ragnarsson, L., Andersson, Å., Thomas, W. G. & Lewis, R. J. Extracellular
Surface Residues of the α1B-Adrenoceptor Critical for G Protein–Coupled
Receptor Function. Mol. Pharmacol. 87, 121–129 (2015).
30. Ragnarsson, L. et al. Conopeptide ρ-TIA Defines a New Allosteric Site on the
Extracellular Surface of the α1B-Adrenoceptor. J. Biol. Chem. 288, 1814–1827
(2013).
31. Labrou, N. E., Bhogal, N., Hurrell, C. R. & Findlay, J. B. C. Interaction of Met297
in the Seventh Transmembrane Segment of the Tachykinin NK2 Receptor with
Neurokinin A. J. Biol. Chem. 276, 37944–37949 (2001).
32. Audet, M. & Bouvier, M. Restructuring G-Protein- Coupled Receptor Activation.
![Page 90: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/90.jpg)
76
Cell 151, 14–23 (2012).
33. Fritze, O. et al. Role of the conserved NPxxY(x)5,6F motif in the rhodopsin
ground state and during activation. Proc. Natl. Acad. Sci. U. S. A. 100, 2290–2295
(2003).
34. Barak, L. S., Oakley, R. H., Laporte, S. A. & Caron, M. G. Constitutive arrestin-
mediated desensitization of a human vasopressin receptor mutant associated with
nephrogenic diabetes insipidus. Proc. Natl. Acad. Sci. U. S. A. 98, 93–98 (2001).
35. McLatchie, L. M. et al. RAMPs regulate the transport and ligand specificity of the
calcitonin-receptor-like receptor. Nature 393, 333–339 (1998).
36. Dunn, H. A. & Ferguson, S. S. G. PDZ Protein Regulation of G Protein–Coupled
Receptor Trafficking and Signaling Pathways. Mol. Pharmacol. 88, 624–639
(2015).
37. Bécamel, C. et al. Synaptic multiprotein complexes associated with 5‐HT2C
receptors: a proteomic approach. EMBO J. 21, 2332–2342 (2002).
38. Zeng, F.-Y., Soldner, A., Schöneberg, T. & Wess, J. Conserved Extracellular
Cysteine Pair in the M3 Muscarinic Acetylcholine Receptor Is Essential for Proper
Receptor Cell Surface Localization but Not for G Protein Coupling. J. Neurochem.
72, 2404–2414 (1999).
![Page 91: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/91.jpg)
77
Sub-
family Subfamily Subtype Human
Gene ECL 1 sequence UniProt entry
A1 Chemokine CCR1 DYKLKDDWVFGDAMCK P32246[92-107]
A2 Chemokine CXCR3 VDAAVQWVFGSGLCK P49682[111-125]
A3 Angiotensin AGTR1 TAMEYRWPFGNYLCK P30556[88-102]
Bradykinin B1 NQFNWPFGALLCR P46663[99-111]
A4 Somatostatin SSTR1 RHWPFGALLCR P30872[121-131]
Opioid OPRD1 METWPFGELLCK P41143[111-122]
A5 Galanin GALR1 QATVYALPTWVLGAFICK P47211[92-109]
A6 Cholecystokinin** CCK KDFIFGSAVCK P32238[105-115]
Neuropeptide FF NPFFR1 VDNLITGWPFDNATCK Q9GZQ6[102-117]
GnRH GNRHR DGMWNITVQWYAGELLCK P30968[98-115]
Orexin HCRTR1 SLLVDITESWLFGHALC O43613[103-119]
A7 Bombesin BRS3 DATHYLAEGWLFGRIGCK P32247[104-121]
TRH* TRHR TDSIYGSWVYGYVGCL P34981[84-99]
Neuromedin U* NMUR1 YEMWHNYPFLLGVGGCYFRT Q9HB89[119-138]
A8 Formyl peptide receptor fMLPR RKAMGGHWPFGWFLCKF P21462[84-100]
Anaphylatoxin C3A HLALQGQWPYGRFLCK Q16581[81-96]
A9 Melatonin MTNR1A LMSIFNNGWNLGYLHCQV P48039[85-102]
Tachykinin TAC1R VVNFTYAVHNEWYYGLFYCK P25103[87-106]
NPY NPY1R FVYTLMDHWVFGEAMCKLN P25929[98-116]
A10 FSH FSHR DIHTKSQYHNYAIDWQTGAGCD P23945[422-443]
A11 Purinergic P2Y1R YYFNKTDWIFGDAMCKL P47900[110-126]
Free Fatty Acid FFAR2 PFKIIEAASNFRWYLPKVVCAL O15552[63-84]
A12 P2 purinoreceptor* P2RY13 KILSDSHLAPWQLRAFVCR Q9BPV8[99-117]
A13 Cannaboid** CNR2 NFHVFHGVDSKA P34972[93-104]
Lysophospatidic acid LPAR1 NTRRLTVSTWLLRQ Q92633[112-125]
Syphingophospate* S1PR2 VTLRLTPVQWFARE O95136[96-109]
Melanocortin** MC1R ETAVILLLEAGALVARAAVLQQLD Q01726[94-118]
A14 Prostoglandins* PTGER3 VYLSKQRWEHIDPSGRLCT P43115[113-131]
A15 Proteases* F2RL1 KIAYHIHGNNWIYGEALCN P55085[131-149]
A16 Opsins* OPN4 TSSLYKQWLFGETGCE Q9UHM6[129-144]
A17 Serotonin HTR2A LTILYGYRWPLPSKLC P28223[133-148]
Dopamine DRD1 GFWPFGSFC P21728[88-96]
Adrenergic ADRA1A LGYWAFGRVFC P35348[89-99]
Trace Amine TAAR1 MVRSAEHCWYFGEVFCKI Q96RJ0[81-98]
A18 Histamine HRH1 NILYLLMSKWSLGRPLCL P35367[84-101]
Adenosine** ADORA1 NIGPQTYFHTC P30542[70-80]
Muscarinic ACh CHRM1 TTYLLMGHWALGTLACD P11229[83-99]
A19 Serotonin HTR1A LNKWTLGQVTCD P08908[99-110]
![Page 92: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/92.jpg)
78
Table 1: Comparison of representative extracellular loop 1 sequences across Class A
GPCR subfamilies. Human GPCR sequences were obtained from NCBI databases and
extracellular loop 1 sequences were predicted using the TMHMM server. The presence of
the WxFG motif tryptophan residue is highlighted in red, whereas a phenylalanine
residue at this position is highlighted in yellow. A tryptophan is present at the
appropriate position in 15 of the 19 subfamilies, and a tryptophan or phenylalanine is
present in 17 of the 19 subfamilies, indicating a high level of conservation of this motif
amongst class A GPCRs.
![Page 93: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/93.jpg)
79
Figure 1: Sequence weighting analysis shows that the WxFG motif’s tryptophan
residue exhibits high conservation in Class A GPCR receptor subfamilies.
Extracellular loop 1 sequences from Homo sapiens, Drosophila melanogaster, Danio
rerio, Mus musculus, Caenorhabditis elegans, Xenopus laevis, and Gallus gallus were
obtained using the NCBI database and TMHMM web server, and positional weight
scores were generated using the Seq2Logo application. Heavy conservation of the
tryptophan residue in the WxFG motif is seen in all but family A6, which exhibits greater
conservation of a phenylalanine residue at that position.
![Page 94: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/94.jpg)
80
Figure 2: Mutagenesis of conserved tryptophan residue in LKR ECL1 ablates
receptor signaling. A. W101L substitution in the WXFG motif of the leucokinin receptor
ablates receptor function. Site-directed mutagenesis of the conserved tryptophan residue
in EL1 yields a receptor which is unresponsive to leucokinin stimulation at all
concentrations. The wild type LKR exhibited a maximal response at 10-6 M ligand
application. B. Substitution of the conserved tryptophan residue in EL1 of the leucokinin
receptor leads to a loss of function when an aromatic residue is not present at that
position. 5 mutagenized variants of LKR were generated and tested using a SRE-luc
signaling assay. Receptor responses were quantified as % basal activity following 10-6 M
ligand presentation. Both WT LKR and the W101F variant exhibited significantly
elevated activity following ligand addition, while variants W101E, W101A, W101K, and
![Page 95: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/95.jpg)
81
W101L exhibited no significant increase in signaling from baseline (P<.003). W101F
exhibited no significant difference in signaling response when compared to wild type.
![Page 96: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/96.jpg)
82
Figure 3: Leucine substitution for the conserved tryptophan residue in extracellular
loop 1 leads to a loss of function in multiple receptor types. Receptor constructs were
obtained from multiple repositories and mutagenized as previously described. These
receptor constructs couple to Gs (AKHR, FSHR, white bars), Gq (CRZR, mACHR1,
black bars), or Gi (SSTR2, GALR1, black bars), and the promiscuous Gα16 subunit was
included in transfections of Gi coupled receptors. In each case, leucine substitution at the
W position in the WxFG motif led to a loss of signaling response to 10-6 M ligand
presentation (P<.003), suggesting a conservation of WxFG domain function across taxa.
Specifically, SSTR2, GALR1, FSHR, mACHR1, AKHR, and CRZR wild type receptors
![Page 97: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/97.jpg)
83
exhibited 246.42%, 210.90%, 764.85%, 231.26%, 845.72%, and 290.66% of basal signal
at 10-6M ligand application, while their respective mutants exhibited a near complete
loss of function (SSTR2 mutant:94.73%, GALR1 mutant:127.29%, FSHR
mutant:123.21%, mACHR1 mutant:138.17%, AKHR mutant: 115.75%, and CRZR
mutant: 104.40% respectively, P<.003, hatched bars).
![Page 98: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/98.jpg)
84
Figure 4: Substitution of the conserved tryptophan residue to leucine ablates
constitutive activity in a constitutively active AKHR mutant. A. A constitutively
active AKHR receptor was generated by mutagenizing the conserved aspartate residue in
the DRY motif to alanine (D136A). D136A exhibits significantly greater activity at
baseline than the wild-type AKHR receptor, while still remaining responsive to ligand
presentation. B. The W105L substitution eliminates AKHR signaling response following
10-6M ligand presentation. C. The W105L substitution, when incorporated into the
D136A variant, ablated both ligand responsiveness and constitutive activity associated
with the receptor.
![Page 99: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/99.jpg)
85
![Page 100: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/100.jpg)
86
Figure 5: The WxFG is critical for proper receptor trafficking. YFP tagged
leucokinin, corazonin, and 5HT2c receptors were mutagenized as previously described
(W�L). Receptor localization was compared between wild type and mutant receptor
variants, using the plasma membrane marker WGA-594 colocalization with YFP signal
to approximate receptor expression at the cell surface. In each case, receptor localization
within the cell was dramatically altered in mutant receptor variants. All wild type
receptors exhibited high levels of colocalization with WGA-594, an expected result given
their function as cell-surface receptors, while each mutant exhibited no significant
colocalization with WGA-594. Taken together, these results suggest impaired receptor
trafficking in WxxL mutants, regardless of receptor background. Wild type 5HT2c
(Fig.5 A-C), (R=.66±.08), LKR (Fig.5 G-I), (R=.78±.07), and CRZR (Fig.5 M-O),
![Page 101: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/101.jpg)
87
(R=.72±.04), and exhibited strong colocalization with the plasma membrane (black bars),
while their corresponding mutants, 5HT2c W120L (Fig. 5 E-F), (R= -.02±.05), LKR
W101L (Fig. 5 J-L), (R=.05±.10), and CRZR W191L (Fig. 5 P-R), (R= -.11±.12), and
exhibited a dramatic reduction in plasma membrane localization (white bars), with
P<.001 for all wild type – mutant comparisons (Fig. 5 S).
![Page 102: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/102.jpg)
88
Figure 6: Putative tertiary structures of wild type LKR and mutant W101L are
superimposed to identify gross changes in receptor topology. A. Mutant structures are
modeled in red, and wild type structures are modeled in blue. The superimposed
structures display perfect alignment of the TMs, but a significant distortion of the N-
terminus when a leucine residue is added in place of W101 (B). Thus, LKR may not be
able to tolerate substitutions at W101 due to tryptophan’s stabilization of ECL1 geometry
in relation to the N-terminus and adjacent TMs.
![Page 103: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/103.jpg)
89
CHAPTER III: Homodimerization of Drosophila Class A Neuropeptide GPCRs:
Evidence for conservation of GPCR dimerization throughout metazoan evolution.
Michael J. Rizzo, Erik C. Johnson
The work in this chapter will be submitted to the journal Biochemical and
Biophysical Research Communications. Experiments were conceived by MJ Rizzo and
EC Johnson. Reagents were generated and experiments were performed by MJ Rizzo.
Data were analyzed by MJ Rizzo and EC Johnson. The manuscript was drafted by MJ
Rizzo and edited by EC Johnson. This study was funded by NSF and WFU CMS.
![Page 104: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/104.jpg)
90
ABSTRACT
While many instances of GPCR dimerization have been reported for vertebrate
receptors, GPCR dimerization amongst invertebrates remains poorly investigated, with
few invertebrate GPCRs having been shown to assemble as dimers. To date, no
Drosophila GPCRs have been shown to assemble as dimers. Furthermore, dimerization
studies are largely confined to vertebrate organisms, and the extent of GPCR
dimerization amongst invertebrates remains largely overlooked. To explore the
evolutionary conservation of GPCR dimerization, we employed an acceptor-
photobleaching FRET methodology to evaluate whether multiple subclasses of
Drosophila GPCRs assembled as homodimers when heterologously expressed in HEK-
293T cells. We C-terminally tagged multiple Drosophila neuropeptide GPCRs that
exhibited structural homology with a vertebrate GPCR family member previously shown
to assemble as a dimer with CFP and YFP fluorophores and visualized these receptors
through confocal microscopy. FRET responses were determined based on the increase in
CFP emission intensity following YFP photobleaching for each receptor pair tested. For
each receptor expressed as a homodimer pair, a significant FRET response was seen,
while non-significant FRET responses were displayed by both cytosolic CFP and YFP
expressed alone, and a heterodimeric pair of receptors from unrelated families,
suggesting that receptors exhibiting positive FRET responses assemble as homodimers at
the plasma membrane. These results are the first to suggest that Drosophila GPCRs
assemble as homodimeric complexes, and suggest that GPCR dimerization arose early in
metazoan evolution and likely plays an important and underappreciated role in the
cellular signaling of all animals.
![Page 105: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/105.jpg)
91
INTRODUCTION
G-protein coupled receptors (GPCRs) are the largest superfamily of metazoan cell
surface receptors and are responsible for transducing a wide range of extracellular stimuli
into cellular responses1. These receptors possess a characteristic seven-transmembrane
architecture, with an extracellular N terminus and intracellular C terminus. GPCRs are
essential for a variety of behaviors and physiologies, including vision, taste, homeostatic
regulation, and reproduction2. Given their diverse roles in physiology and behavior, it is
unsurprising that GPCRs are the molecular targets of approximately 50% of
pharmaceuticals3. As a consequence of GPCRs importance in a diverse set of
physiologies and behaviors and their constituting the pharmacological targets of many
drugs, specific determination of their mechanism of actions and signaling pathways are
active areas of research and of widespread biological interest. One phenomenon that has
engendered significant interest is determination of the exact molecular organization of
GPCRs. The first evidence of higher order GPCR structures stemmed from the
identification that functional GABAB receptors consist of two distinct subunits.
Specifically, the GABABR1 and GABABR2 subunits are required to construct the
functional receptor, as the latter subunit is required for trafficking of the GABABR1
subunit to the plasma membrane4. The necessity of dimerization for receptor function is
now recognized as a hallmark of Class C GPCRs5.
Subsequent to the discovery of GABA receptor dimerization, many other
unrelated GPCR dimers have been identified, with a diverse array of phenotypes
attributable to this molecular organization6. While there is clear evidence that GPCRs
can assemble as dimers, the prevalence of GPCR dimerization as it pertains to phylogeny
![Page 106: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/106.jpg)
92
as well as receptor type remains unresolved. It is clear that GPCR dimerization frequency
varies by receptor class. Class C GPCRs, which include GABAB and metabotropic
glutamate receptors, function as obligatory dimers as previously discussed5. However,
the question of the whether other GPCR subtypes assemble as dimers is the subject of
much debate. Multiple Class A and Class B GPCRs have been shown to assemble as
homo- and/or heterodimers. Dimerization is especially common amongst biogenic amine
receptors, as all 5HT receptors and multiple dopamine receptors have been
experimentally shown to assemble as homo- or heterodimers at the plasma membrane7–9.
Dimerization has also been demonstrated in a number of peptide receptor family
members, including somatostatin receptors, bradykinin receptors, and multiple opioid
receptors, among others, further suggesting oligomeric assembly may be a common
feature of GPCR biology10–12. A difficulty in determining the extent to which Class A and
B form dimers is that these receptors structures may not be as stable as the Class C
GPCRs, and in fact these higher order structures may be transient or dynamically
regulated for receptors in these classes, which thus reduces the probability of finding
GPCR oligomers13. Thus, the possibility exists that the pool of GPCRs at the cell surface
may in fact be a heterogeneous mixture of monomeric, dimeric and higher order
oligomeric structures 13–15.
One example of dimerization imparting differential receptor function are the
gonadotropin releasing hormone (GnRH) receptors in Ciona intestinalis, where variance
in receptor dimerization influences intracellular cAMP and Ca2+ signaling 16. Specifically,
Ciona expresses four specific variants of GnRH receptors, GnRHR1-GnRHR4, which
have been shown to form both homo-and heterodimers when these receptors are
![Page 107: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/107.jpg)
93
coexpressed. Intriguingly, GnRHR1 homodimers elicit a ten-fold reduced response
compared to the heterodimer, but homodimers of GnRHR1 were able to signal through
both cAMP and Ca2+. Conversely, the GNRHR1-4 heterodimer signaled through only
Ca2+, suggesting that receptor dimerization is responsible for fine tuning cellular
responses to GnRH signaling in this species.
Furthermore, a growing body of evidence supports the notion that a dimeric
GPCR functions as the fundamental signaling unit for many receptors17. Perhaps the best
example of this phenomenon stems from investigations of the human 5HT2c receptor
homodimer. Multiple studies have confirmed that the 5HT2c receptor assembles as a
homodimer, and that this dimerization occurs prior to the mature receptor expression at
the plasma membrane, suggesting that dimerization may be necessary for appropriate
receptor trafficking to the cell surface18–20. To determine whether a homodimer
represented the functional receptor molecule for this receptor, Herrick-Davis et al.
generated a ligand-binding and signaling deficient mutant 5HT2c resulting from a single
amino acid substitution (S138R)21. They then co-expressed these mutant receptors with
wild type 5HT2c receptors in HEK293 cells. Remarkably, the group found that not only
did the mutant S138R 5HT2c variant retain its ability to homodimerize with wild-type
5HT2c receptors (as resolved by both FRET and Co-IP interactions), but additionally that
5HT signaling through this receptor complex was significantly impaired when these
receptors were co-expressed when compared to cells expressing wild type copies of the
5HT2c receptor alone. These experiments provide perhaps the strongest evidence that, at
least for some Class A GPCRs, homodimerization is fundamental to their ability to bind
ligands and transduce this event into appropriate cellular responses.
![Page 108: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/108.jpg)
94
Studies of GPCR dimerization have largely been limited to investigations of
vertebrate receptors, notably those from humans, rats, and mice7. In contrast, there is a
dearth of reports on invertebrate GPCR dimerization, and little is known as to the
function and frequency of GPCR dimerization amongst invertebrates. The previously
discussed study on Ciona intestinalis demonstrated that dimerization amongst Class A
GPCRs (GnRH receptors) not only occurred, but acted as a significant modulator of
GnRH signaling in the ascidian16. Still, no further studies on Ciona have indicated any
additional species-specific GPCRs in dimerization. Additionally, studies on
Caenorhabditis elegans, despite an estimated 1000 GPCRs present in their genome, have
revealed only a single putative GPCR dimer pair – a heterodimer between the receptors
DAF-37 and DAF-3822. This dimer also plays a significant functional role in the
organism, as it is necessary for proper dauer formation during C. elegans development.
Drosophila melanogaster, another popular invertebrate model organism, has yet to have
GPCR dimerization demonstrated amongst any receptors present in its genome, although
it should be noted that Drosophila GABAB receptors, similar to their mammalian
counterparts, require co-expression of R1 and R2 subunits to confer proper GABA
responsiveness23. While this finding is consistent with heterodimerization between these
two receptors, no FRET, Co-IP, or other dimerization-specific methodology was
employed to verify that such an interaction did in fact occur. Overall, the lack of
investigation of GPCR dimerization in invertebrates obfuscates our understanding of the
function of these receptors in their respective organisms, and also hinders efforts to
explore the evolution of GPCR dimerization with appropriate rigor.
![Page 109: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/109.jpg)
95
As previously noted, to date, no Drosophila GPCR’s have been demonstrated to
assemble as dimers. In this study, rather than focus on a singular receptor, as is a
common approach in the extant literature, we chose to adopt a systematic approach
informed by evolutionary homology to other GPCRs previously shown to dimerize in
other taxa in order to identify whether Class A (Rhodopsin-like) Drosophila GPCRs,
specifically those involved in neuropeptide signaling, assembled as dimers. We chose to
evaluate seven different Drosophila neuropeptide GPCRs that belong to six Class A
receptor subfamilies that have been previously been shown to assemble as dimers in other
species, to determine whether these Drosophila receptors formed higher order structural
ensembles at the plasma membrane. To this aim, we employed a Fluorescence Resonant
Energy Transfer (FRET) based approach, as this is a standard assay to investigate
intermolecular interactions. Specifically, FRET assays rely on the transfer of energy
from one fluorescent donor to an acceptor molecule and are predicated on short
intermolecular distances between the two fluorophores24.
In this study, prospective dimeric pairs of both CFP and YFP tagged Drosophila
GPCRs were transiently expressed in HEK-293T cells and assessed for FRET responses.
Significant FRET efficiencies were observed for each receptor homodimer pair when
compared to controls, as well as cells expressing donor and acceptor receptors from
unrelated receptor families, suggesting that the receptors studied assemble as
homodimers at the cell surface. These results are the first evidence for GPCR
dimerization amongst Class A Drosophila neuropeptide receptors, and the prevalence of
homodimerization across multiple receptor subtypes suggests that GPCR dimerization
![Page 110: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/110.jpg)
96
has been conserved throughout metazoan evolution and is a feature of the receptor
superfamily.
![Page 111: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/111.jpg)
97
METHODS
GPCR cloning and fusion protein generation.
All GPCRs used in this study were previously subcloned into pcDNA3 or
pcDNA5 expression vectors (Table 1), with the exception of the 5HT2c-CFP and 5HT2c-
YFP pair, which were generously donated by Dr. Katharine Herrick-Davis. PCR primers
were designed to add N and C terminal restriction sites to facilitate directional cloning
into the pcDNA3 CFP and pcDNA3 YFP expression vectors (Table 2). Likewise, PCR
products were designed to eliminate the stop codon and make sure that the resulting
receptor reading frame would be continuous with the CFP or YFP reading frames. All
resulting plasmids were sequence verified and plasma membrane expression was verified
for each receptor prior to FRET analysis.
Cell culture and transfection
HEK-293T cells were grown in a standard growth medium of Dulbecco’s
modified Eagle medium (DMEM) supplemented with fetal bovine serum,
antibiotic/antimycotic, and 2mM L-glutamine. Prior to transfection, cells were split and
seeded into 24 well dishes. Transfections were performed using Lipofectamine 2000
transfection reagent in serum free Opti-MEM media when cell density reached ~0.2*106
cells/mL in each well. For all co-expression experiments, receptor cDNAs were
transfected at a 1:2 CFP/YFP ratio to bias CFP tagged receptors to dimerize with YFP
tagged receptors. Transfected cells were split into glass bottom dishes and allowed to
recover for 24 hours in standard growth media following transfection, at which point
![Page 112: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/112.jpg)
98
media was switched to clear, modified Eagle medium (MEM) for imaging analysis. All
imaging experiments were performed 48 hours following transfection.
Signaling assays
To assess receptor function in tagged receptor variants, we performed signaling
assays on two of the seven modified receptors. YFP tagged variants of the LKR and
CRZR receptors, as well as wild type variants for each receptor for each receptor25, were
transfected along with the SRE-luciferase reporter construct at a 5:1 ratio into HEK-293T
cells using Lipofectamine 2000. Following transfection, cells were split into 96 well
plates and given an additional 24 hours to recover in standard growth media. Following
recovery, media was replaced with clear MEM containing either 10-6M ligand or vehicle
for each condition and left to incubate for four hours. Luciferase activity was assessed
using the SteadyLite Plus Reporter Gene Assay System according to manufacturer’s
protocol and luminescence levels were measured using a Victor3 1420 multilabel plate
reader.
Microscopy and FRET Imaging analysis
For each condition tested, between 4 and 30 cells were visualized using a Zeiss
710 scanning confocal microscope and images were subsequently analyzed using Zen
software. All imaging was performed under identical conditions for quantification
purposes and to facilitate statistical analysis across conditions. Initial fluorescent levels
were determined to gauge CFP and YFP-tagged receptor expression. These values were
used to determine donor and acceptor intensities that were used for subsequent analysis.
Prior to evaluating FRET efficiencies, we imaged cells expressing only cytosolically
![Page 113: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/113.jpg)
99
expressed CFP and YFP to generate a characteristic emission spectrum for each
fluorophore to be used for linear unmixing analysis. Following an initial imaging
protocol, acceptor photobleaching experiments were performed by defining an area of
interest (AOI) around a region of the cell membrane and applying high intensity, 514nm
laser pulses to photobleach YFP (Figure 1). Time-lapsed images underwent image
analysis to measure the intensity of both CFP and YFP emission both pre and post
photobleaching. Any image where CFP or YFP intensities fell below the intensity of the
residuals channel following linear unmixing was not analyzed. FRET efficiency was
subsequently determined based on the increase of CFP emission intensity following YFP
photobleaching using the formula: FE%=(Dpost-Dpre)/Dpost. FRET efficiencies were
compared across conditions using a one-way ANOVA and a Tukey post-hoc test.
![Page 114: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/114.jpg)
100
RESULTS
Drosophila receptors were chosen for analysis based on sequence homology to
mammalian receptors previously shown to form dimers (Table 1). We chose seven
receptors that are members of six different Class A receptor subfamilies and that signal
through disparate mechanisms and participate in a diverse set of behaviors and
physiologies. Specifically, the Drosophila corazonin receptor (CRZR) is a member of
the Gonadotropin Releasing Hormone (GnRH) receptor subfamily and is involved in
mediating multiple behaviors in insects, including cardioactivity, gregarious
pigmentation, circadian rhythms, and stress 26–28. GnRH receptors have previously been
shown to dimerize in multiple organisms, including rats, wallabies, and the tunicate
Ciona intestinalis16,29,30. In mammals, neurokinin receptors fulfill an array of functions
ranging from pain perception to vasodilation, and have been show to assemble as dimers,
and we chose to examine two Drosophila receptors related to mammalian neurokinin
receptors, the leucokinin receptor (LKR) and tachykinin receptor at 86C (TAKR86C)31,32.
In mammals, the NPY receptor regulates feeding behaviors, and has been shown to form
higher order structures, thus we chose to evaluate the Drosophila NPF receptor (NPFR),
which like its mammalian homolog impacts feeding behaviors in the fly, for dimer
formation analysis33,34. The proctolin receptor (ProcR) is a member of the thyrotropin-
releasing hormone (TRH) receptor superfamily, whose hormone serves as a master
regulator for pituitary hormone release, and was chosen for analysis as human TRH
receptors receptor have been previously shown to dimerize in heterologous expression
systems33,35,36. We also evaluated the Drosophila allatostatin C receptor 2 (AstC-R2), as
it is a member of the somatostatin family and, in the rat, somatostatin receptors been
![Page 115: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/115.jpg)
101
shown to form both homo- and heterodimers, with the receptor subclass functioning in
multiple physiologies ranging from sleep regulation to regulation of motor activity 11.
Lastly, we evaluated dimerization in the Drosophila pyrokinin receptor 1 (PK1R), which
is a neuromedin U receptor family member, another receptor family shown to assemble
as homodimers in humans that also functions in a diverse array of physiological
responses, including but not limited to blood pressure regulation, feeding behavior, and
immune system function11,37,38.
Following fluorophore-tagging these receptors, we sought to determine whether
the fluorescent tag interfered with receptor function. We used two parameters to assess
receptor function, the first was an evaluation of plasma membrane expression of the
tagged receptors. First, we only analyzed receptors that showed high levels of expression
at the plasma membrane. Additionally, we evaluated receptor signaling from the LKR-
YFP and CRZR-CFP tagged variants. In both cases, a robust signaling response was
observed at 10-6M ligand concentrations for each tagged receptor that was not
significantly different from the signaling responses exhibited by their respective wild
type receptors (Figure S1). Collectively, these results indicate that fluorophore addition
does not interfere with receptor function for these receptors.
Next, we tested the FRET signatures from cells transfected with both CFP and
YFP tagged receptors. To establish a baseline for non-FRET, we introduced a
cytoplasmic CFP and YFP construct and subjected those cells to the acceptor
photobleaching protocol (Fig. 1). There were minimal FRET signatures observed and we
interpret these as random interactions coincident with localized expression of both
fluorophores. We then compared FRET efficiencies between the 5HT2c receptor and the
![Page 116: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/116.jpg)
102
cytoplasmic introduction of both fluorophores. The 5HT2c receptor has been shown to
dimerize extensively and serves as a hallmark for the phenomena18–21. Specifically,
cytoplasmic CFP and YFP exhibited a negligible average FRET efficiency of
4.92%±1.28 (Fig. 2 A-F, Fig. 3Q), while the 5HT2c CFP/YFP pair exhibited a statistically
significant higher average FRET efficiency of 15.65%±1.72 (Fig. 2G-L, Fig. 3Q) (P
<0.05 ANOVA). These results indicate that our experimental system is able to accurately
identify bona fide receptor dimers.
Next, we tested the seven Drosophila Class A GPCRs previously described under
the same experimental conditions. Each receptor tested showed FRET efficiencies
significantly different from CFP and YFP alone, but not significantly different from the
5HT2c positive control (Fig. 3). Specifically, the corazonin receptor (CRZR) exhibited the
highest FRET efficiency of all receptors tested at 21.77%±3.07. This was followed by
AstC-R2, which displayed a 21.38%±2.49 FRET efficiency. The NPF receptor, the lone
Gαi-coupled receptor tested in this study, showed a FRET efficiency of 15.77%±0.80.
The two Drosophila tachykinin receptors tested, LKR and TKR86C, showed robust
FRET efficiencies of 10.52%±1.57 and 12.20%±1.85, respectively. Finally, the proctolin
and pyrokinin 1 receptors exhibited the lowest FRET responses of all homodimers tested,
with FRET efficiencies of 9.96%±1.75 and 7.79%±1.30, respectively, although it is
important to note that both receptors FRET responses were significantly higher than
cytosolically expressed CFP and YFP (P<.05), and thus represent strong evidence for
homodimerization amongst these receptors. In contrast, when we introduced a heterotypic
pair of NPFR-CFP and TKR86C-YFP constructs, we observed a FRET response of
5.80%±1.81 that was not significantly different than the CFP/YFP negative control. This
![Page 117: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/117.jpg)
103
finding is significant as it rules out the alternative interpretation that FRET responses are
a simply a consequence of coexpression of fluorophore-tagged receptors at the plasma
membrane.
![Page 118: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/118.jpg)
104
DISCUSSION
The results of this investigation provide the first experimental evidence that
multiple Drosophila Class A GPCRs assemble as homodimers at the plasma membrane.
Rather than focus on a singular receptor, we undertook a systematic approach informed
by evolutionary homology to identify seven candidate neuropeptide receptors from six
GPCR families. Notably, for each receptor studied, significant FRET responses
consistent with homodimerization were detected. This suggests that GPCR dimerization
both occurs in Drosophila and is itself a conserved feature of specific GPCR families and
that has been conserved throughout metazoan evolution. Additionally, this investigation
adds to the relatively understudied literature regarding invertebrate GPCR dimerization,
as dimerization had been previously observed only in tunicates and C. elegans, and has
now been demonstrated in dipterans as well.
The receptors examined in this study fulfill diverse physiological roles within the
organism. The corazonin receptor, a member of the GnRH receptor subfamily, is critical
to Drosophila response to myriad stressors, including starvation and desiccation, while
also fulfilling a major role in ethanol metabolism26,27. The tachykinin-related receptors,
TKR86C and LKR, have been implicated in a range of functional roles including
regulation of meal size, sexual activity and fecundity, and the integration of metabolic
state and sleep39–41. The somatostatin family member AstC-R2, while named for its
inhibitory effects on juvenile hormone secretion from the corpora allata, is a key
regulator of multiple physiologies, ranging from circadian rhythm regulation to
nociception and innate immunity, while also serving as a cardioinhibitory peptide in the
fly42–44. The NPF receptor has been shown to mediate physiologies ranging from feeding
![Page 119: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/119.jpg)
105
and foraging behavior to alcohol sensitivity as well as sleep-wake behaviors45–48. The
proctolin receptor serves as a key regulator of cardioactivity, and has also been shown to
regulate both locomotor activity and thermal preference in Drosophila larvae49,50. Finally,
the pyrokinin-1 receptor, a member of the neuromedin U (NMU) superfamily, has been
implicated in both pheromone biosynthesis as well as the suppression of insulin
production in Drosophila51,52. The diversity of functional roles these receptors fulfill,
coupled with the knowledge that these receptors assemble as higher order structures at
the plasma membrane, suggest that further investigation of the oligomeric assembly of
these receptors within the fly may be critical to dissecting discrete functional roles for
each of the receptors studied.
While there was a significant range of FRET efficiencies reported across the
receptors tested, it is important to consider that FRET efficiency is dependent on a
number of factors beyond whether the two molecules assemble as a dimer, including the
length and orientation of each receptor’s C-terminus (which impacts the distance between
fluorophores), variations in donor/acceptor ratios, and membrane curvature 24,53. As such,
absolute comparisons of FRET efficiencies across receptors do not necessarily reflect
differences in dimerization frequency or the percentage of receptors which assemble as
dimers at the cell surface. Still, this only increases our confidence in our results, as our
measurements of FRET efficiencies for many of the homodimeric pairs investigated were
larger than the 5HT2c receptor pair, and in all cases were significantly higher than
cytosolically expressed CFP and YFP, suggesting that indeed dimerization appears to be
a common phenomenon that is widespread throughout both Drosophila GPCRs and
likely the GPCR superfamily itself, and is not specific to a particular taxon.
![Page 120: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/120.jpg)
106
We limited our investigation of receptor dimerization only at the plasma
membrane. Therefore, we cannot conclude that dimerization is specific to this cellular
compartment or whether these receptor interactions are exhibited elsewhere in the cell.
Some studies suggest dimerization occurs co-translationally and can be observed in both
the ER and Golgi, as has been shown with the 5HT2c receptor utilized in this study18.
However, other reports suggest that dimerization, especially amongst class A GPCRs, are
transient phenomena and therefore may assemble spontaneously at the plasma membrane,
leading to a dynamic population of monomeric and higher order oligomeric states13. It
would be interesting to see if similar FRET efficiencies for each homodimer pair studied
could be recorded from CFP and YFP tagged receptors as they move through the ER and
Golgi, which would shed light on the biogenesis of Drosophila GPCR dimers.
One aspect of dimerization that was not tested in this study was the impact of
ligand introduction on FRET efficiency between homodimeric receptor pairs. Previous
studies have shown that ligand binding can lead to increased, decreased, or unchanged
FRET responses. This, likely, is the result of the conformational changes which take
place in the receptor molecule following ligand binding and receptor activation54–56.
Future studies should investigate whether ligand introduction alters FRET response
through either promoting or inhibiting dimerization in each of the receptors tested.
Taken together, the results of this study suggest that homodimerization of
Drosophila Class A neuropeptide GPCRs may represent a common feature of G protein-
coupled receptors. This study represents the first step towards a comprehensive analysis
of homodimerization amongst all Drosophila class A GPCRs. It is important to note that
these receptors still represent a fraction of the total neuropeptide receptor GPCRs present
![Page 121: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/121.jpg)
107
in the Drosophila genome, which contains 44 Class A and Class B GPCRs from 15
distinct neuropeptide GPCR subfamilies57,58. As such, further investigation of these and
other potential GPCR dimer pairs in the Drosophila genome is necessary to determine the
prevalence of dimerization amongst these receptors. Still, given the findings of this study,
along with the wide array of genetic tools available for cell and tissue-specific
manipulation of receptor expression, Drosophila represent an attractive model organism
to investigate the functional roles that GPCR dimerization impacts in multiple
physiologies, and affords the potential to ascribe specific in vivo functional roles to
GPCR oligomeric states and further our understanding of the evolution of GPCR
dimerization amongst the receptor superfamily.
![Page 122: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/122.jpg)
108
REFERENCES
1. Whitehead, I. P., Zohn, I. E. & Der, C. J. Rho GTPase-dependent transformation
by G protein-coupled receptors. Oncogene 20, 1547–1555 (2001).
2. Hanlon, C. D. & Andrew, D. J. Outside-in signaling – a brief review of GPCR
signaling with a focus on the Drosophila GPCR family. J Cell Sci 128, 3533–3542
(2015).
3. Tautermann, C. S. GPCR structures in drug design, emerging opportunities with
new structures. Bioorg. Med. Chem. Lett. 24, 4073–4079 (2014).
4. White, J. H. et al. Heterodimerization is required for the formation of a functional
GABA(B) receptor. Nature 396, 679–682 (1998).
5. Zhang, X. C., Liu, J. & Jiang, D. Why is dimerization essential for class-C GPCR
function? New insights from mGluR1 crystal structure analysis. Protein Cell 5,
492–5 (2014).
6. Terrillon, S. & Bouvier, M. Roles of G-protein-coupled receptor dimerization
From ontogeny to signalling regulation. EMBO Rep. 5, 30–34 (2004).
7. Franco, R., Martínez-Pinilla, E., Lanciego, J. L. & Navarro, G. Basic
pharmacological and structural evidence for class A G-protein-coupled receptor
heteromerization. Frontiers in Pharmacology vol. 7 (2016).
8. Herrick-Davis, K. Functional significance of serotonin receptor dimerization. Exp.
Brain Res. 230, 375–386 (2013).
9. Tabor, A. et al. Visualization and ligand-induced modulation of dopamine receptor
![Page 123: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/123.jpg)
109
dimerization at the single molecule level. Sci. Rep. 6, (2016).
10. Portoghese, P. S. From models to molecules: Opioid receptor dimers, bivalent
ligands, and selective opioid receptor probes. J. Med. Chem. 44, 2259–2269
(2001).
11. Pfeiffer, M. et al. Homo- and heterodimerization of somatostatin receptor
subtypes. Inactivation of sst(3) receptor function by heterodimerization with
sst(2A). J. Biol. Chem. 276, 14027–36 (2001).
12. Michineau, S., Alhenc-Gelas, F. & Rajerison, R. M. Human bradykinin B2
receptor sialylation and N-glycosylation participate with bisulfide bonding in
surface receptor dimerization. Biochemistry 45, 2699–2707 (2006).
13. Milligan, G., Ward, R. J. & Marsango, S. GPCR homo-oligomerization. Current
Opinion in Cell Biology vol. 57 40–47 (2019).
14. Meral, D. et al. Molecular details of dimerization kinetics reveal negligible
populations of transient µ-opioid receptor homodimers at physiological
concentrations. Sci. Rep. 8, 7705 (2018).
15. Vischer, H. F., Castro, M. & Pin, J.-P. G Protein-Coupled Receptor Multimers: A
Question Still Open Despite the Use of Novel Approaches. Mol. Pharmacol. Mol
Pharmacol 88, 561–571 (2015).
16. Sakai, T. et al. Evidence for differential regulation of GnRH signaling via
heterodimerization among GnRH receptor paralogs in the protochordate, Ciona
intestinalis. Endocrinology 153, 1841–1849 (2012).
![Page 124: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/124.jpg)
110
17. Ferré, S. et al. G Protein–Coupled Receptor Oligomerization Revisited: Functional
and Pharmacological Perspectives. Pharmacol. Rev. 66, 413 LP – 434 (2014).
18. Herrick-Davis, K., Weaver, B. A., Grinde, E. & Mazurkiewicz, J. E. Serotonin 5-
HT2C receptor homodimer biogenesis in the endoplasmic reticulum: real-time
visualization with confocal fluorescence resonance energy transfer. J. Biol. Chem.
281, 27109–16 (2006).
19. Herrick-Davis, K. et al. Native Serotonin 5-HT 2C Receptors Are Expressed as
Homodimers on the Apical Surface of Choroid Plexus Epithelial Cells. Mol.
Pharmacol. Mol Pharmacol 87, 660–673 (2015).
20. Herrick-Davis, K., Grinde, E. & Mazurkiewicz, J. E. Biochemical and biophysical
characterization of serotonin 5-HT2C receptor homodimers on the plasma
membrane of living cells. Biochemistry 43, 13963–13971 (2004).
21. Herrick-Davis, K., Grinde, E., Harrigan, T. J. & Mazurkiewicz, J. E. Inhibition of
serotonin 5-hydroxytryptamine2c receptor function through heterodimerization:
receptor dimers bind two molecules of ligand and one G-protein. J. Biol. Chem.
280, 40144–51 (2005).
22. Park, D. et al. Interaction of structure-specific and promiscuous G-protein-coupled
receptors mediates small-molecule signaling in Caenorhabditis elegans. Proc. Natl.
Acad. Sci. U. S. A. 109, 9917–9922 (2012).
23. Mezler, M., Müller, T. & Raming, K. Cloning and functional expression of
GABAB receptors from Drosophila. Eur. J. Neurosci. 13, 477–486 (2001).
![Page 125: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/125.jpg)
111
24. Busnelli, M., Mauri, M., Parenti, M. & Chini, B. Analysis of GPCR Dimerization
Using Acceptor Photobleaching Resonance Energy Transfer Techniques. Methods
Enzymol. 521, 311–327 (2013).
25. Rizzo, M. J., Evans, J. P., Burt, M., Saunders, C. J. & Johnson, E. C. Unexpected
role of a conserved domain in the first extracellular loop in G protein-coupled
receptor trafficking. Biochem. Biophys. Res. Commun. 503, 1919–1926 (2018).
26. Kubrak, O. I., Lushchak, O. V., Zandawala, M. & Nässel, D. R. Systemic
corazonin signalling modulates stress responses and metabolism in Drosophila.
Open Biol. 6, 160152 (2016).
27. Sha, K. et al. Regulation of ethanol-related behavior and ethanol metabolism by
the corazonin neurons and corazonin receptor in Drosophila melanogaster. PLoS
One 9, (2014).
28. Johnson, E. C. et al. A novel diuretic hormone receptor in Drosophila: evidence
forconservation of CGRP signaling. J. Exp. Biol. 208, 1239–1246 (2005).
29. Cornea, A. & Michael Conn, P. Measurement of changes in fluorescence
resonance energy transfer between gonadotropin-releasing hormone receptors in
response to agonists. Methods 27, 333–339 (2002).
30. Cheung, T. C. & Hearn, J. P. Dimerizations of the wallaby gonadotropin-releasing
hormone receptor and its splice variants. Gen. Comp. Endocrinol. 144, 280–288
(2005).
31. Pfeiffer, M. et al. Heterodimerization of substance P and mu-opioid receptors
![Page 126: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/126.jpg)
112
regulates receptor trafficking and resensitization. J. Biol. Chem. 278, 51630–7
(2003).
32. Garcia-Recio, S. & Gascón, P. Biological and Pharmacological Aspects of the
NK1-Receptor. BioMed Research International vol. 2015 (2015).
33. Dinger, M. C., Bader, J. E., Kobor, A. D., Kretzschmar, A. K. & Beck-Sickinger,
A. G. Homodimerization of neuropeptide y receptors investigated by fluorescence
resonance energy transfer in living cells. J. Biol. Chem. 278, 10562–71 (2003).
34. Luquet, S., Perez, F. A., Hnasko, T. S. & Palmiter, R. D. NPY/AgRP neurons are
essentials for feeding in adult mice but can be ablated in neonates. Science (80-. ).
310, 683–685 (2005).
35. Song, G. J., Jones, B. W. & Hinkle, P. M. Dimerization of the thyrotropin-
releasing hormone receptor potentiates hormone-dependent receptor
phosphorylation. Proc. Natl. Acad. Sci. U. S. A. 104, 18303–8 (2007).
36. Hanyaloglu, A. C., Seeber, R. M., Kohout, T. A., Lefkowitz, R. J. & Eidne, K. A.
Homo- and hetero-oligomerization of thyrotropin-releasing hormone (TRH)
receptor subtypes: Differential regulation of β-arrestins 1 and 2. J. Biol. Chem.
277, 50422–50430 (2002).
37. Lin, T.-Y., Huang, W.-L., Lee, W.-Y. & Luo, C.-W. Identifying a Neuromedin U
Receptor 2 Splice Variant and Determining Its Roles in the Regulation of
Signaling and Tumorigenesis In Vitro. PLoS One 10, e0136836 (2015).
38. Brighton, P. J., Szekeres, P. G. & Willars, G. B. Neuromedin U and its receptors:
![Page 127: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/127.jpg)
113
Structure, function, and physiological roles. Pharmacological Reviews vol. 56
231–248 (2004).
39. Yurgel, M. E. et al. A single pair of leucokinin neurons are modulated by feeding
state and regulate sleep–metabolism interactions. PLoS Biol. 17, (2019).
40. Al-Anzi, B. et al. The leucokinin pathway and its neurons regulate meal size in
Drosophila. Curr. Biol. 20, 969–978 (2010).
41. Jiang, H. et al. Natalisin, a tachykinin-like signaling system, regulates sexual
activity and fecundity in insects. (2013) doi:10.1073/pnas.1310676110.
42. Bachtel, N. D., Hovsepian, G. A., Nixon, D. F. & Eleftherianos, I. Allatostatin C
modulates nociception and immunity in Drosophila. Sci. Rep. 8, 7501 (2018).
43. Díaz, M. M., Schlichting, M., Abruzzi, K. C., Long, X. & Rosbash, M.
Allatostatin-C/AstC-R2 Is a Novel Pathway to Modulate the Circadian Activity
Pattern in Drosophila. Curr. Biol. 29, 13-22.e3 (2019).
44. Price, M. D. et al. Drosophila melanogaster flatline encodes a myotropin
orthologue to Manduca sexta allatostatin. in Peptides vol. 23 787–794 (2002).
45. Brown, M. R. et al. Identification of a Drosophila brain-gut peptide related to the
neuropeptide Y family. Peptides 20, 1035–1042 (1999).
46. Lee, G., Bahn, J. H. & Park, J. H. Sex- and clock-controlled expression of the
neuropeptide F gene in Drosophila. Proc. Natl. Acad. Sci. 103, 12580–12585
(2006).
47. Chung, B. Y. et al. Drosophila Neuropeptide F Signaling Independently Regulates
![Page 128: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/128.jpg)
114
Feeding and Sleep-Wake Behavior. Cell Rep. 19, 2441–2450 (2017).
48. Wen, T., Parrish, C. A., Xu, D., Wu, Q. & Shen, P. Drosophila neuropeptide F and
its receptor, NPFR1, define a signalling pathway that acutely modulates alcohol
sensitivity. Proc. Natl. Acad. Sci. U. S. A. 102, 2141–2146 (2005).
49. Zornik, E., Paisley, K. & Nichols, R. Neural transmitters and a peptide modulate
Drosophila heart rate. Peptides 20, 45–51 (1999).
50. Ormerod, K. G. et al. Characterizing the physiological and behavioral roles of
proctolin in Drosophila melanogaster. J. Neurophysiol. 115, 568 (2016).
51. Stern, P. S. et al. Molecular modeling of the binding of pheromone biosynthesis
activating neuropeptide to its receptor. J. Insect Physiol. 53, 803–818 (2007).
52. Alfa, R. W. et al. Suppression of Insulin Production and Secretion by a Decretin
Hormone. Cell Metab. 21, 323–334 (2015).
53. Walsh, S. M. et al. Single Proteoliposome High-Content Analysis Reveals
Differences in the Homo-Oligomerization of GPCRs. Biophys. J. 115, 300–312
(2018).
54. Pioszak, A. A., Harikumar, K. G., Parker, N. R., Miller, L. J. & Xu, H. E. Dimeric
arrangement of the parathyroid hormone receptor and a structural mechanism for
ligand-induced dissociation. J. Biol. Chem. 285, 12435–44 (2010).
55. Hiller, C., Kühhorn, J. & Gmeiner, P. Class A G-Protein-Coupled Receptor
(GPCR) Dimers and Bivalent Ligands. J. Med. Chem. 56, 6542–6559 (2013).
56. Furness, S. G. B. et al. Ligand-Dependent Modulation of G Protein Conformation
![Page 129: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/129.jpg)
115
Alters Drug Efficacy. Cell 167, 739-749.e11 (2016).
57. Hewes, R. S. & Taghert, P. H. Neuropeptides and neuropeptide receptors in the
Drosophila melanogaster genome. Genome Res. 11, 1126–42 (2001).
58. Johnson, E. C. et al. Identification of Drosophila neuropeptide receptors by G
protein-coupled receptors-beta-arrestin2 interactions. J. Biol. Chem. 278, 52172–8
(2003).
59. Cazzamali, G., Saxild, N. P. E. & Grimmelikhuijzen, C. J. P. Molecular cloning
and functional expression of a Drosophila corazonin receptor. Biochem. Biophys.
Res. Commun. 298, 31–36 (2002).
60. Radford, J. C., Davies, S. A. & Dow, J. A. T. Systematic G-protein-coupled
receptor analysis in Drosophila melanogaster identifies a leucokinin receptor with
novel roles. J. Biol. Chem. 277, 38810–7 (2002).
61. Park, Y., Kim, Y.-J. & Adams, M. E. Identification of G protein-coupled receptors
for Drosophila PRXamide peptides, CCAP, corazonin, and AKH supports a theory
of ligand-receptor coevolution. Proc. Natl. Acad. Sci. 99, 11423–11428 (2002).
62. Garczynski, S. F., Brown, M. R., Shen, P., Murray, T. F. & Crim, J. W.
Characterization of a functional neuropeptide F receptor from Drosophila
melanogaster. Peptides 23, 773–780 (2002).
63. Kreienkamp, H.-J. et al. Functional annotation of two orphan G-protein-coupled
receptors, Drostar1 and -2, from Drosophila melanogaster and their ligands by
reverse pharmacology. J. Biol. Chem. 277, 39937–43 (2002).
![Page 130: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/130.jpg)
116
Figure 1: Demonstration of acceptor-photobleaching FRET assay. GPCRs with C-
terminal CFP and YFP fluorophore tags are co-expressed at the plasma membrane of
HEK-293T cells. If the receptors do not form a dimeric complex, the CFP and YFP
fluorophores are separated by greater than 100 angstroms, and no FRET response occurs
(Fig. 1A). If the two receptors assemble as a dimer, CFP and YFP should be located
within 100 angstroms of one another, and thus a FRET response occurs, with some
energy from the excited CFP fluorophore being transferred to the acceptor YFP molecule,
resulting in YFP emission at ~527nm (Fig. 1B). Positive results can be confirmed
through photobleaching the acceptor YFP molecule (Fig. 1C), which ablates the acceptor
YFP fluorophore and “dequenches” the CFP molecule, resulting in an increase in CFP
emission following YFP photobleaching.
![Page 131: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/131.jpg)
117
Figure 2: Verification of experimental system. Empty pcDNA3 CFP and YFP vectors,
along with C-terminally CFP and YFP tagged 5HT2c receptors, were utilized as negative
and positive controls, respectively. Negligible FRET was observed following acceptor
photobleaching when empty CFP and YFP vectors were coexpressed (4.92%±1.28) (Fig.
![Page 132: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/132.jpg)
118
2A-F), while the 5HT2c-CFP and 5HT2c-YFP receptor pair exhibited robust FRET
(15.65%±1.72) (Fig. 2G-L) consistent with previous studies. These results suggest the
experimental setup utilized herein accurately differentiates both positive and negative
FRET responses.
![Page 133: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/133.jpg)
119
![Page 134: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/134.jpg)
120
Figure 3: Multiple Drosophila Class A neuropeptide receptors exhibit FRET
responses consistent with homodimerization. Seven Drosophila neuropeptide
receptors, AstC-R2 (Fig. 3A-B), CRZR (Fig. 3C-D), LKR (Fig. 3E-F), TKR86C (Fig.
3G-H), NPFR (Fig. 3I-J), PK1R (Fig. 3M-N), and ProcR (Fig. 3O-P) were C-terminally
tagged with CFP or YFP fluorophores and co-expressed in HEK293T cells to evaluate
potential homodimer pairs. Significant increases in CFP intensity following acceptor
photobleaching, indicative of FRET, were observed for each homodimer pair tested (Fig.
3Q) Co-expression of NPFR-CFP and TKR86C-YFP as donor and acceptor, respectively,
![Page 135: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/135.jpg)
121
exhibited negligible FRET (Fig. 3K-L), (5.80%±1.81, n=10) that was not significantly
different from the CFP-YFP negative control (Fig. 2A-F; P<.05), indicating negligible
protein-protein interactions between these two distantly related receptors. These results
suggest that the receptors assayed in this study assemble as homodimers when expressed
in living cells. Black bars represent data that were significantly different from the CFP-
YFP negative control (P<.05).
![Page 136: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/136.jpg)
122
Receptor Family Accession# Reference
ProcR TRH CG6986 Johnson et al., 200358
CrzR GnRH CG10698
Cazzamali et al., 2002; Johnson et al.,
200358,59
LKR Tachykinin CG10626 Radford et al., 200260
PK1R NMU CG9918 Park et al., 200261
NPFR NPY CG1147 Garczynski et al., 200262
AstC-R2 Somatostatin CG13702
Kreienkamp et al., 2002; Johnson et
al., 200358,63
TKR86C Tachykinin CG6515 Johnson et al., 200358
Table 1: Receptors utilized in FRET dimer screen. Each of the above receptors had
been previously characterized and cloned into pcDNA3 or pcDNA5 expression vectors.
Family assignments were based on receptor homology to vertebrate GPCRs. Vertebrate
homologs of each Drosophila receptor listed have previously been reported to form either
homo- or heterodimers when expressed in a heterologous system.
![Page 137: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/137.jpg)
123
Receptor Forward Primer Reverse Primer
Forward
Restriction Site
Reverse
Restriction
Site
LKR GCAAGCTTATGGCAATGGACTTAATCGAGCAG CTCGAGAAGTGGTTGCCACAAGGACTTGCC HindIII XhoI
CRZR GCAAGCTTATGGAGGACGAGTGGGGCTCCTTT CTCGAGCTGCACTGGAAGCACTTGGAGCTC HindIII XhoI
ProcR GCAAGCTTATGACAATGTCCTCGACGTCGACA CTCGAGCGCTATCAGGCGACCCGTATTACG HindIII XhoI
TKR86C GCAAGCTTATGTCGGAGATTGTCGACACCGAG GCGGCCGCAACATCTGCTTGGGACTGAGCT HindIII NotI
PK1R GCAAGCTTATGTCCGCTGGCAATATGAGCCAT CTCGAGGTTGACTTGGACACCGATCATGGC HindIII XhoI
NPFR GCAAGCTTATGATAATCAGCATGAATCAGACG CTCGAGCCGCGGCATCAGCTTGGTGACCTC HindIII XhoI
AstC-R2 GCAAGCTTATGGAAGGTGGATGGTGGCGAGGA CTCGAGTAAGTCCGTGTGGAGCACGGGCGG HindIII XhoI
Table 2: List of primers used for directional cloning of receptor cDNA into pcDNA3
CFP or pcDNA3 YFP expression vectors. For each receptor, stop codons were removed
from reverse primers to allow for expression of YFP and CFP C-terminally tagged
receptors. Sequences for the restriction sites HindIII and XhoI were added via PCR to
facilitate directional cloning into final expression vectors for each receptor used except
for TKR86C, where sequences for HindIII and NotI were added due to an internal XhoI
recognition sequence present in the cDNA for this receptor.
![Page 138: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/138.jpg)
124
Figure S1: Verification of signaling in fluorophore tagged receptors. YFP tagged
receptors for which peptides were readily available (LKR and CRZR) were assayed to
determine whether the addition of a C-terminal fluorophore tag impacted receptor
signaling. YFP tagged receptors were compared against wild type variants of each
receptor. Each receptor variant was challenged with either 10-6 M ligand or vehicle (n=3)
and signaling was measured through luciferase activity generated by the SRE-luc
reporter. No significant differences were seen across all receptors tested, with LKR-YFP
showing 3.13-fold induction over vehicle and CRZR-YFP showing 2.90-fold induction
over vehicle, while their respective wild type receptors exhibited 3.41-fold induction over
vehicle (LKR WT) and 3.11-fold induction over vehicle (CRZR WT). These data show
that the addition of a C-terminal fluorophore tag to these receptors does not compromise
receptor function.
0
0.5
1
1.5
2
2.5
3
3.5
4
LKR WT LKR YFP CRZR WT CRZR YFP
Fo
ld i
nd
uct
ion
ov
er
ve
hic
le
Receptor
![Page 139: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/139.jpg)
125
CHAPTER IV: Conclusions and future directions
The goal of this dissertation was to elucidate specific mechanisms underlying
GPCR signaling and function. Using a combination of approaches, I have uncovered a
novel role for a highly conserved amino acid motif in GPCR function, as well as
expanded our knowledge of GPCR dimerization by providing the first evidence of such
an event occurring in Drosophila. The combination of these findings also extends our
knowledge of GPCR evolution, and suggests that many aspects of receptor function arose
early in the evolution of the receptor family.
The second chapter of this dissertation specifically explored the prevalence and
functional role of an amino acid motif present on the vast majority of Class A GPCRs
first extracellular loop, the WxFG motif. While this motif had been previously identified,
a full exploration of the conservation of this motif across Class A GPCR subfamilies had
not been performed prior to our research. Our bioinformatics analysis showed that this
motif is conserved in 17 of the 19 Class A GPCR subfamilies, in addition to being
present in ~90% of all Class A GPCRs1. By generating mutant receptor variants for
multiple Class A subfamily members, sourced from a variety of vertebrate and
invertebrate taxa, we showed that the presence of an aromatic amino acid at the W
position in the WxFG motif is necessary for wild type receptor signaling. Additionally,
we suggest an alternative mechanism for the loss of receptor function following
mutagenesis of this residue than had been previously put forward. Previous work on this
amino acid motif by Klco et al suggested that mutagenesis of the conserved tryptophan
residue generated receptor mutants which were able to bind ligand, but unable to
appropriately translate ligand binding into specific cellular responses2. Our findings
![Page 140: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/140.jpg)
126
suggest that, instead, such receptor manipulations lead to defective GPCR trafficking,
resulting in these receptors not reaching the cell surface and instead being retained in the
ER-Golgi complex. The findings of previous investigations can be reconciled with our
novel mechanism through a comparison of the methods used in the respective studies –
Klco et al performed ligand binding assays on membrane preparations of cells expressing
both wild type and mutant receptors. Such preparations would have captured not only
receptors present at the plasma membrane, but also receptors retained in the ER-Golgi
complex. As such, even though their group found that mutant receptors were able to bind
ligand, we suggest that, in the actual environment of the cell, these receptors never reach
the cell surface, and are thus unable to interact with their specific ligands, resulting in the
lack of signaling responses noted in all studies of this amino acid motif. As such, our
findings offer a novel mechanism by which this motif contributes to GPCR function.
The third chapter of this dissertation investigated whether Drosophila GPCRs,
specifically those involved in neuropeptide recognition and signaling, assembled as
dimers at the plasma membrane. While GPCR dimerization has been widely explored
over the past two decades, with a multitude of GPCR homo- and heterodimeric entities
identified and described, the vast majority of these studies looked specifically at
vertebrate GPCRs, while invertebrate GPCR dimerization remains a neglected field of
study3,4. Through C-terminal tagging of Drosophila neuropeptide GPCRs with CFP and
YFP fluorophores, we were able to utilize an acceptor-photobleaching FRET
methodology to show that multiple Drosophila receptors assemble as homodimers at the
plasma membrane. These findings are significant, as they are the first to identify any
GPCR dimerization in Drosophila. Additionally, by focusing on receptors previously
![Page 141: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/141.jpg)
127
shown to assemble as higher order structures in other taxa, our results suggest that
receptor dimerization has been conserved throughout the evolution of specific receptor
subtypes, rather than being a taxa-specific phenomenon. It is therefore likely that
dimerization arose early in the evolution of the receptor superfamily, and is likely
critically important for wild-type receptor function in many GPCRs.
Although this work has shed light on mechanisms underlying GPCR function and
assembly, there is much left that could be explored. I have clearly shown that the WxFG
motif plays a critical role in the appropriate cell surface trafficking of a multitude of
Class A GPCRs. However, as this was explored using a heterologous expression system,
the question as to whether similar phenotypes occur in vivo, where other cellular
machinery such as chaperone proteins may assist in GPCR trafficking, remains
unresolved. As such, a logical next step would be to perform these same mutagenic
manipulations via CRISPR or similar methodology in the genome to determine whether a
similar trafficking defect occurs. Such an effort would be best focused on the subset of
Drosophila receptors studied, given the genetic tools available in this model organism.
These manipulations could also be used as loss of function alleles to further study the
roles of these receptors in a multitude of behaviors and physiologies.
Additionally, my work on dimerization of Drosophila GPCRs suggests that many
neuropeptide receptors in the fly are capable of assembling as homodimers, however, this
was verified solely using FRET microscopy. To increase confidence in my findings, a
logical next step would be to utilize another method to detect GPCR dimers, such as Co-
IP or BiFC, and see if similar results were obtained. Additionally, generating UAS
constructs of CFP and YFP tagged receptors used in this study, or simply generating CFP
![Page 142: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/142.jpg)
128
and YFP fusion proteins in the genome through CRISPR, would allow one to assess
whether dimerization of these receptors occurs in vivo. Such a finding would add to the
dearth of in vivo dimerization studies in the extant literature. Also, my work focused
solely on establishing homodimerization of Drosophila GPCRs, it would be interesting to
further screen receptors to determine whether disparate GPCRs were capable of
assembling as heterodimers, and if so, what impact heterodimerization has on receptor
function. These experiments would provide valuable information regarding both the
extent and conservation of dimerization across taxa, as well as further elucidating the
functional roles of dimerization in receptor signaling in an in vivo setting.
In conclusion, my work has furthered our fundamental understanding of multiple
aspects of GPCR function. I have presented evidence supporting a novel mechanism for a
highly conserved amino acid motif in receptor trafficking to the cell membrane.
Additionally, I have shown that multiple Drosophila GPCRs from disparate receptor
subfamilies are capable of dimeric assembly at the plasma membrane, adding to our
limited knowledge of invertebrate GPCR dimerization, while also furthering our
understanding of the conservation of dimerization throughout the evolution of the
receptor superfamily. Together, these investigations provide valuable insight into
multiple aspects of GPCR function, while also offering additional evidence to support the
obsolescence of the classical two-state model.
![Page 143: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/143.jpg)
129
REFERENCES
1. Rizzo, M. J., Evans, J. P., Burt, M., Saunders, C. J. & Johnson, E. C. Unexpected
role of a conserved domain in the first extracellular loop in G protein-coupled
receptor trafficking. Biochem. Biophys. Res. Commun. 503, 1919–1926 (2018).
2. Klco, J. M., Nikiforovich, G. V & Baranski, T. J. Genetic Analysis of the First and
Third Extracellular Loops of the C5a Receptor Reveals an Essential WXFG Motif
in the First Loop. J. Biol. Chem. 281, 12010–12019 (2006).
3. Sakai, T. et al. Evidence for differential regulation of GnRH signaling via
heterodimerization among GnRH receptor paralogs in the protochordate, Ciona
intestinalis. Endocrinology 153, 1841–1849 (2012).
4. Park, D. et al. Interaction of structure-specific and promiscuous G-protein-coupled
receptors mediates small-molecule signaling in Caenorhabditis elegans. Proc. Natl.
Acad. Sci. U. S. A. 109, 9917–9922 (2012).
![Page 144: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/144.jpg)
130
Michael J. Rizzo [email protected]
EDUCATION
Wake Forest University, Winston-Salem, NC August 2011 – Present Ph.D. Candidate in Biology; GPA: 3.75
University of Pittsburgh School of Medicine, Pittsburgh, PA July 2009 – June 2010 Ph.D. Student in Biomedical Sciences; GPA: 3.64 University of Virginia, Charlottesville, VA August 2004 – May 2008 B.A. in Biology, Minor in Philosophy; GPA: 3.34
• Phi Eta Sigma National Honor Society (2005) • Dean’s List (2005)
PROFESSIONAL EXPERIENCE
High Point University, Department of Biology, High Point, NC August 2018 – Present Instructor of Biology
• Taught multiple lecture and laboratory courses. • Helped develop new syllabus and course objectives for non-majors course • Served in multiple department community outreach events
Wake Forest University, Department of Biology, Winston-Salem, NC August 2011 – Present Graduate Research and Teaching Assistant
• Taught laboratory courses in a variety of biological subdisciplines. • Undertook research on G-protein coupled receptors (GPCRs) exploring various aspects of their biology, examining receptors from both Drosophila and humans. • Served as Graduate representative to University Honor Council. • Presented posters and talks at multiple institutional meetings, as well as Genetics Society of America and Cold Spring Harbor Laboratories international conferences. • Mentored a variety of undergraduate students in molecular biology and genetic techniques. • Wrote and edited multiple grant applications, secured independent funding for research. • Served as reviewer for multiple publications in scientific journals.
Galax City Public Schools, Galax, VA November 2010 – April 2011 Substitute Teacher
• Performed teaching duties as needed for a variety of ages. Classes included science, reading, and special education.
Darden/Curry Partnership for Leaders in Education, Charlottesville, VA October 2010 – April 2011 Lead Editor
• Edited collection of case studies for publication, “District Case Studies and Individual Lessons in Leadership,” Dan Duke, Eleanor Smalley.
Cardiovascular Research Center, University of Virginia, Charlottesville, VA October 2007 – June 2009 Research Assistant
• Performed an array of laboratory related techniques, including western blots and survival and non- survival surgery on mice.
![Page 145: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/145.jpg)
131
• Actively involved in research pertaining to connexin isoforms found in the vasculature, including editing potential publications and creating presentations on the subject matter. • Performed cell culture work and sterile procedure. • Designed and maintained laboratory website
General Clinical Research Center, UVA Hospital, Charlottesville, VA April 2006 – August 2006 Computer Technician
• Performed multiple and complex IT support, including detecting bugs and general compatibility issues. • Implemented state of the art software and hardware applications. • Accountable for general computer maintenance.
SKILLS
Photoshop, Graphpad Prism, Microsoft Office, ImageJ, Carl Zeiss Zen, Tissue Culture, Drosophila and mouse husbandry/dissections, Molecular Cloning, Bioinformatic Sequence Analysis, PCR, RNA and DNA Isolation, Plasmid Prep, Western Blot, DNA Transfection, Phenol-Chloroform Extraction, rudimentary Java
GRANTS AND AWARDS
Center for Molecular and Cell Signaling graduate fellowship – $25,000 2013 – 2014
TEACHING EXPERIENCE
Principles of Cell Biology – BIO1500/BIO1501 2018 – 2019 Biology: A Human Perspective – BIO1100 2018 – 2019 Molecular Biology and Genetics Lab – BIOL213 2014 – 2018 Cell Biology Lab – BIOL214 2012 – 2013 Comparative Physiology Lab – BIOL114 2011 – 2012
UNDERGRADUATE STUDENTS MENTORED
Kandis McNeil 2017 – 2018 Jack Evans; Undergraduate Honors Award 2017 – 2018 Karleigh Smith 2017 – 2018 Harriet Hall 2016 – 2018 Kevin Robinson 2016 Morgan Burt; Undergraduate Honors Award, Carolina Biological Outstanding 2012 – 2015
Undergraduate Research Award Donika Hasanaj 2014 Cole Crowson; Undergraduate Honors Award 2012 – 2014 Rebecca Perry; Undergraduate Honors Award, Carolina Biological Outstanding 2011 – 2013
Undergraduate Research Award, Cocke Outstanding Student Scholar Award. Brian Vega 2012
![Page 146: MOLECULAR DISSECTION OF G-PROTEIN COUPLED RECEPTOR ...€¦ · FIGURE II.1: Sequence weighting analysis shows that the WxFG motif’s tryptophan ... microscopy to determine both the](https://reader034.vdocuments.mx/reader034/viewer/2022052100/603a923543a6ac2ae4159133/html5/thumbnails/146.jpg)
132
PUBLICATIONS
Rizzo, M. J., Evans, J. P., Burt, M., Saunders, C. J. & Johnson, E. C. (2018) Unexpected role of a conserved domain in the first extracellular loop in G protein-coupled receptor trafficking. Biochem. Biophys. Res. Commun. 503, 1919–1926
Miller, M.R., Mandell, J.B., Beatty, K.M., Harvey, S.A.K., Rizzo, M.J., Previte, D.M., Thorne, S.H., and McKenna, K.C. (2014). Splenectomy promotes indirect elimination of intraocular tumors by CD8+ T cells that is associated with IFNγ- and Fas/FasL-dependent activation of intratumoral macrophages. Cancer Immunol Res 2, 1175–1185.
Straub, A.C., Johnstone, S.R., Heberlein, K.R., Rizzo, M.J., Best, A.K., Boitano, S., and Isakson, B.E. (2010). Site-specific connexin phosphorylation is associated with reduced heterocellular communication between smooth muscle and endothelium. J. Vasc. Res. 47, 277–286.
Johnstone, S.R., Ross, J., Rizzo, M.J., Straub, A.C., Lampe, P.D., Leitinger, N., and Isakson, B.E. (2009). Oxidized phospholipid species promote in vivo differential cx43 phosphorylation and vascular smooth muscle cell proliferation. Am. J. Pathol. 175, 916–924.
POSTERS AND PRESENTATIONS
Poster: Molecular dissection of Drosophila G protein-coupled receptor oligomerization Michael Rizzo, Erik Johnson Neurobiology of Drosophila, Cold Spring Harbor Laboratories (2015) Presentation: Molecular dissection of Drosophila G protein-coupled receptor oligomerization Michael Rizzo Wake Forest University Center for Molecular Communication and Signaling (2015) Poster: Elucidation of Drosophila melanogaster G protein-coupled receptor interactions through heterodimerization and chimeric receptor studies. Michael Rizzo, Erik Johnson Genetics Society of America (2013)