membrane-interactions of gpi-plc in vitro and in ... · membrane-interactions of gpi-plc in vitro...
TRANSCRIPT
MEMBRANE-INTERACTIONS OF GPI-PLC IN VITRO AND IN TRYPANOSOMA
BRUCEI
by
CLYDE FRANK HARDIN JR
(Under the direction of Kojo Mensa-Wilmot)
ABSTRACT
Trypanosoma brucei is the causative agent of human African sleeping
sickness. T. brucei is covered with a surface coat that primarily consists of
variant surface glycoprotein (VSG). A glycosyl phosphatidylinositol (GPI) anchors
the VSG protein to the extracellular surface of the plasma membrane.
T. brucei contains a GPI-specific phospholipase C (GPI-PLCp) that is
capable of cleaving GPI-anchors and GPI-intermediates. GPI-PLCp is an
integral membrane protein however, how the protein binds to membranes, and
where it localizes in the cell, is not known.
The purpose of this study is to identify regions of GPI-PLCp that bind to
membranes and to identify where the enzyme localizes in vivo. The enzyme
does not contain any transmembrane domains or sequences homologous to
characterized membrane-binding domains. Therefore, in an effort to identify the
membrane-binding regions of GPI-PLCp, amino and carboxyl-terminal
truncations of the enzyme were made. Constructs were assayed for their ability
to target a soluble reporter protein, green fluorescent protein (GFP), to T. brucei
microsomes in vitro. Amino acids 60-120 of GPI-PLCp targeted GFP to
microsomes.
In vivo experiments indicate that GPI-PLCp colocalizes with the
glycosomal protein, hypoxanthine-guanine phosphoribosyltransferase (HGPRT).
To further study where the enzyme localizes in vivo, T. brucei glycosomes were
isolated by 15-60 % sucrose-gradient sedimentation of microbodies isolated by
differential centrifugation. Fractions that contained GPI-PLCp activity, also
contained the glycosomal protein, aldolase. These results indicate that GPI-
PLCp localizes to the glycosome in T. brucei.
We propose that amino acids 60-120 contribute to the association of GPI-
PLCp with glycosomes.
INDEX WORDS: Trypanosoma brucei, African sleeping sickness, Variantsurface glycoprotein, Glycosylphosphatidylinositol, GPI-PLC,GFP, HGPRT, Microsome, Glycosome, Density-gradientcentrifugation, Membrane-binding domain, Transmembranedomain.
MEMBRANE-INTERACTIONS OF GPI-PLC IN VITRO AND IN TRYPANOSOMA
BRUCEI
by
CLYDE FRANK HARDIN JR
B.S., The University of Georgia, 1999
A Thesis Submitted to the Graduate Faculty of The University of Georgia in
Partial Fulfillment of the Requirements for the Degree
MASTER OF SCIENCE
ATHENS, GEORGIA
2003
© 2003
Clyde Frank Hardin Jr
All Rights Reserved
MEMBRANE-INTERACTIONS OF GPI-PLC IN VITRO AND IN TRYPANOSOMA
BRUCEI
by
CLYDE FRANK HARDIN JR
Major Professor: Kojo Mensa-Wilmot
Committee: Marcus Fechheimer Kelley Moremen
Electronic Version Approved:
Maureen GrassoDean of Graduate SchoolThe University of GeorgiaDecember 2003
iv
DEDICATION
I dedicate this thesis to my family for their unconditional love, support and
encouragement. I will love you always.
v
ACKNOWLEDGEMENTS
I am grateful to have the opportunity to formerly thank those who helped
make this possible. First and foremost, I would like to express my sincere
gratitude to my major professor, Dr. Kojo Mensa-Wilmot for all his help and
support over the last few years. I am privledged to have had the opportunity to
work with such a fine teacher, mentor and scientist.
I thank the members of my committee, Dr. Marcus Fechheimer and Dr.
Kelley Moremen, for their support and encouragement. I appreciate the
generosity of Drs. Michael Terns and Claiborne Glover for use of their
equipment. I thank Dr. Charlie Keith, Dr. Jacek Gaertig and Dr. Jason Brown for
sparking my interest in research and encouraging me to pursue a post-graduate
education.
I am thankful to have worked with the past and present members of the
lab. I learned a tremendous amout from these individuals, they are not only
excellent collegues but wonderful friends as well.
Finally, I am blessed to have such a fine family and network of friends.
They have unconditionally loved and supported me in every aspect of my life. I
would have never have accomplished so much had it not been for them, and for
them, I thank God.
vi
TABLE OF CONTENTS
Page
ACKNOWLEDGEMENTS ............................................................................................... v
CHAPTER I – INTRODUCTION AND LITERATURE REVIEW....................................... 1
CHAPTER II – MEMBRANE INTERACTIONS OF GPI-PLC IN VITRO AND IN
TRYPANOSOMA BRUCEI ...................................................................................... 34
CHAPTER III – DISCUSSION....................................................................................... 89
1
CHAPTER I
INTRODUCTION AND LITERATURE REVIEW
TRYPANOSOMA BRUCEI1 Trypanosomes
1.1 Trypanosomiasis
Trypanosoma brucei is a protozoan parasite that causes human African
trypanosomiasis (sleeping sickness). The parasite is transmitted to the
mammalian bloodstream through the bite of an infected tsetse fly from the genus
Glossina. The disease is thereby limited to the ecology of the insect vector, only
found in intertropical regions of Africa. Among the many species of
trypanosomes, only two, belonging to the group brucei, are infectious to humans.
T.b. gambiense is primarily found in West and Central Africa and causes a
chronic form of the disease. T. b. rhodesiense, found in East and Central Africa,
causes a more acute and virulent condition (for review [1, 2]).
Upon receiving a bite from a tsetse fly, a small nodule, called the
trypanosomal chancre, forms at the site. It is here that initial parasite
multiplication occurs. Anywhere from weeks to months after the onset of the
chancre, the trypanosomes invade the host's bloodstream leading to the
systemic or hemolymphatic stage of the disease [3, 4]. This stage is often
considered the early stage of the disease, defined as the period prior to
proliferation into the central nervous system (CNS). It is marked by general signs
2
of infection, including: moderate fever, intense itching, headache, swelling, and
ocular disturbances. The late stage or meningo-encephalitic phase is
characterized by the passing of the parasite across the blood-brain barrier, into
the CNS. At this stage, the infected individual may suffer from disturbances of
consciousness and circadian rhythm of sleep, sensory disturbances or
physiological symptoms such as memory loss, dementia, depression, agitation or
mania. Although the amount of time spent sleeping does not differ significantly
from that of an uninfected individual, the disease is named sleeping sickness due
to alterations in sleep patterns and profound lethargy seen in patients in the late
stage of the disease. Most of the infected individuals are not aware of their
disease until the onset of symptoms associated with the late-stage of the
infection [1].
1.2 Treatment
African sleeping sickness affects more than 300,000 people and
approximately 60 million people in 36 countries of sub-Saharan Africa are at risk.
Today, chemotherapy is the only method of treatment available. If the disease is
diagnosed early, the chances of cure are high. Treatment depends on the phase
of infection: early or late. The chance of cure in the latter phase depends on the
drugs ability to cross the blood-brain barrier in order to target the parasite. First
phase treatments include suramin and pentamidine; late phase treatments
include melarsoprol and eflornithine (the only currently available drug used to
treat the late phase of T.b. gambiense). In general, these drugs are toxic, difficult
to administer in poor, underdeveloped areas (due to financial and/or
3
geographical constraint), and not always successful. These considerations
aside, new strains of the parasite are beginning to emerge that exhibit resistance
to the drugs. Therefore, in order to develop new, safer, more effective drugs and
ultimately, eradicate the disease, research must be done to further understand
the biological and biochemical processes of the parasite (W.H.O.).
1.3 Life Cycle
Trypanosomes live in the circulatory systems of infected individuals and
are completely dependent on glycolysis for ATP production [5]. Bloodstream
form (BSF) trypanosomes are covered by a dense layer of variant surface
glycoproteins (VSG) that canopies underlying membrane proteins and prevents
lysis by host-mediated defenses [6-8]. Metacyclics that have just been
introduced into the mammalian bloodstream begin to differentiate into long
slender trypomastigotes and divide. At peak parasitemia, a proportion of the
parasites differentiate into short stumpies, pre-adapted for transmission into the
tsetse fly. After a tsetse fly ingests a blood meal, the short stumpy
trypomastigotes begin to differentiate into procyclics. At this stage, synthesis of
the VSG surface coat is suppressed [9], the coat is shed and replaced by an
invariant coat composed of procyclin [10, 11]. During differentiation, the
parasites begin their migration to the mid-gut of the fly. Here, they begin to
transform into epimastigotes and divide by longitudinal binary fission in the lumen
of the mid-gut. Upon differentiating into epimastigotes, the parasites continue
their migration to the salivary glands where they become attached to the
epithelium and develop into infective metacyclic trypomastigotes. At this stage,
4
procyclin expression is lost in the metacyclic forms and a specific subset of VSG
is expressed in preparation for infection in the mammalian host [6]. The entire
cycle of development in the fly takes approximately 3 weeks. Once infective, the
fly remains as such, due to the continual reproduction of metacyclics in the
salivary glands. The fly introduces trypanosomes into humans by injecting saliva
into the puncture wound produced during feeding [12] and the cycle continues
(Fig.1).
2 Antigenic Variation
Trypanosoma brucei is capable of establishing and maintaining an
infection in humans and animals. The parasite survives the host’s antibody-
mediated defenses by a process knows as “antigenic variation” [13, 14]. Each
bloodstream trypanosome expresses a single VSG gene from a repertoire of an
estimated 1000 genes [14, 15]. Upon establishing infection, the host develops
antibodies against the parasite's VSG coat and kills a large proportion of the
population. However, a small amount (10-5/generation, [14]) of the population
express an antigenically different VSG. This small population of trypanosomes
goes undetected by the hosts immune system, survives the immune response,
and proliferates [15, 16].
3 Glycosomes
When living in the mammalian bloodstream, Trypanosoma brucei is
completely dependent on glycolysis for ATP generation [5]. Glycosomes are
intracellular, membrane-bound, peroxisome-related microbodies found in all
kinetoplastids; they house the first 7-9 enzymes of the glycolytic pathway [17,
5
18]. The presence of these glycolytic enzymes for the conversion of glucose
into 3-phosphoglycerate is the hallmark that distinguishes glycosomes from
peroxisomes [18]. Glycosomes are essential for the survival of the parasite within
its mammalian host [17].
There is no net ATP production in the glycosome. Rather,
3-phosphoglycerate generated in the organelle is further metabolized in the
cytosol generating ATP via substrate-level phosphorylation. Under these
conditions, 2 molecules of ATP and 2 pyruvate are generated from each
molecule of glucose. Nicotinamide adenosine dinucleotide (NADH), produced in
the oxidation of glyceraldehyde 3-phosphate to 1,3-bisphosphoglycerate, is
reoxidized by conversion of dihydroxyacetone phosphate to a-glycerophosphate
(a-GP), in the glycosome. a-GP is then reoxidized by an a-glycerophosphate
oxidase system localized in the mitochondrion [19].
Glycosomes belong to the microbody family of organelles. They are
surrounded by a single phospholipid bilayer and do not contain DNA. This family
includes peroxisomes and glyoxysomes.
Glycosomes are related to peroxisomes of other eukaryotes. In
comparison to peroxisomes, the protein content is very high in glycosomes.
However, both organelles contain enzymes involved in fatty acid b-oxidation,
ether-lipid biosynthesis and pyrimidine biosynthesis. Catalase, the hallmark
enzyme of peroxisomes is not found in kinetoplastid glycosomes, but it is present
in glycosomes of related organisms Crithidia deanei and Phytomonas serpens
[20-23].
6
Biogenesis and protein import is similar. Most of their matrix proteins are
synthesized on free ribosomes in the cytosol and imported into or inserted into
the organelle membranes [20, 24-26]. It has also been shown that similar
sequences are used in routing polypeptides to these organelles [20, 27, 28].
Together, these studies suggest that both organelles may have been derived
from a single ancestral peroxisome-like organelle [29].
Peroxisomes, PEX genes and their products (peroxins) have been studied
much more extensively than have glycosomes. So far, approximately 25 PEX
genes, and their products have been identified and characterized (Fig. 2).
Because little is known about glycosome biogenesis, researchers typically use
peroxisomes as a model for studying the glycosome in trypanosomatids.
Therefore, peroxisomes, will be referenced extensively throughout this review.
3.1 Glycosomal Targeting Sequences
In order for proteins to become localized to glycosomes they must contain
a glycosomal targeting sequence. The nature of the targeting sequence dictates
whether the protein is imported into the glycosome lumen (matrix proteins) or
inserted into the glycosomal membrane (membrane proteins).
There are two types of peroxisome targeting signals (PTS) that direct
proteins into the lumen of peroxisomes, and there is evidence that a third exists.
Two of these signals, PTS1 and PTS2 function in T. brucei [27, 28, 30].
The most common of the three signals is PTS1, a C-terminal tripeptide: -
SKL (single letter amino acid code) or a variation thereof. The second and less
common type of signal sequence is PTS2. PTS2 is an N-terminal nonapeptide.
7
In peroxisomes, it has a loosely conserved sequence motif of RLXXXXX(Q/H)L
where x may be any amino acid (for review [19]). So far, the PTS2 signal has
only been observed in two glycosomal proteins, aldolase and hexokinase [30,
31].
The existence of a third type of glycosomal targeting sequence has been
postulated. Acyl-CoA oxidase in both Saccharomyces cerevisiae and Candida
tropicalis does not contain either PTS1 or PTS2 signal, yet it is imported into
peroxisomes. The enzyme contains two 120 amino acid segments that may
facilitate import of the protein into peroxisomes in vitro [32]. The peroxisomal
catalase A of S. cerevisiae and phosphoglycerate kinase A of T. brucei also
contain an ill-defined “internal signal sequence” [19, 33]. These data suggest
that there must be a third branch of matrix import in yeast and trypanosomes. It
has also been shown that some proteins may enter glycosomes by associating
with proteins that contain a PTS. This method is referred to as “piggyback
import” [34].
Membrane proteins are found in peroxisomes and glycosomes These
peroxisomal membrane proteins (PMPs) localize to the organelles independent
of PTS1 or PTS2 targeting sequences. Membrane peroxisomal targeting
sequences (mPTS) have been identified in several integral PMPs. The first
mPTS was identified as a hydrophilic loop in PMP47 of Candida boidinii [35].
The loop contains a central group of positively charged amino acids followed by a
group of diverse residues. A similar sequence was also found in PMP70 and
PEX3p that led to a consensus mPTS sequence of XX(K/R)(K/R)3-
8
7X(T/S)XX(D/E)X [36] (using a single letter amino acid code, where x is any
amino acid). Human PMP34 contains a similar mPTS but has the opposite
topology, both N and C-termini face the cytosol [37]. In Pichia pastoris, humans
and rat, the first 40 amino acids of PEX3p and the first 54 of Saccharomyces
cerevisiae PEX3p sufficiently target a soluble membrane polypeptide (GFP) to
peroxisomal membranes [38-41]. Each domain contains a conserved block of
positively charged amino acids (that resembles the center of the PMP47 loop)
followed by a stretch of hydrophobic amino acids that may serve as a membrane
anchor [34]. A comparison of yeast and mammalian PEX3p sequences led to a
consensus of RX(K/R)XK [42] (single amino acid code, x is any amino acid).
The mPTS of rat PMP22 is contained within the first 37 amino acids.
Orthologs of PMP22 have been characterized in mouse, Saccharomyces
cerevisiae and Arabidopsis thaliana. Alignment of their N-terminal sequences
revealed a conserved mPTS of YXXXLXXXPXXX(K/N) [43] (single amino acid
code, x is any amino acid). The three-dimensional structure of the N-termini is a-
helical as predicted by the secondary structure program GOR IV [43, 44].
3.2 Glycosomal Targeting Sequence Receptor Proteins
The mechanism of import of both peroxisomal and glycosomal proteins
share common features; glycosomal import is therefore modeled after
peroxisomal import. This hypothesis is strengthened by the identification of PTS-
2 in two glycosomal matrix proteins and of glycosomal proteins homologous to
PEX proteins.
9
Approximately 24 peroxins (PEX) have been identified in yeasts and
mammalian cells that are involved in peroxisomal biogenesis (for review see [34,
45]) (Fig. 2). Peroxisomal membrane and matrix proteins are synthesized on
free ribosomes in the cytosol and either inserted or imported into peroxisomes.
Peroxisomal proteins are recognized by one of three cytosolic receptors, PEX5p,
PEX7p or PEX19p.
PEX5p is the receptor for peroxisomal proteins bearing PTS1 and is
essential for the import of all proteins bearing this class of PTS. After binding,
the PEX5p/cargo complex migrates to the peroxisomes where cargo is imported
and PEX5p recycles to the cytosol for additional rounds of import. Studies using
human peroxisomes also show that PEX5p enters the peroxisome during normal
function and then reemerges to the cytosol to carry out additional rounds of
import [46]. These studies suggests the receptor-protein complex is imported
prior to dissociation, after which, PEX5p is exported out of the peroxisome and
recycled to the cytosol.
PEX7p is the import receptor for peroxisomal proteins that contain a
PTS2. PEX7p is required for the import of proteins bearing this class of targeting
sequence. Subcellular localization studies indicate that PEX7p is found in both
the cytosol and peroxisomes [34], suggesting that the receptor-protein complex is
imported, similar to PEX5p. PEX7p requires a species-specific auxiliary protein
for PTS2 import: PEX18p or PEX21p in S. cerevisiae [47] , PEX20p in Yarrowia
lipolytica [48] and Neurospora crassa [49] or the longer of two splice isoforms of
PEX5p of mammals [50].
10
Finally, PEX19p is thought to bind newly synthesized PMPs and facilitate
their insertion into the peroxisomal membrane [51, 52]. The molecular machinery
required for inserting PMPs is different from that which is required for import of
PTS1 or PTS2 proteins. Very little is know about this process. PEX19p has
been shown to interact with various PMPs and peroxins, including the docking
protein, PEX17p, [51, 53]. However, the mechanism by which it facilitates
insertion is relatively unknown.
3.3 Glycosomal Import and Insertion
The receptors and their cargo dock at the peroxisomal membrane to a
complex consisting of PEX13p, PEX14p and PEX17p and are subsequently
transported into or inserted into the membrane of the peroxisome. After docking,
PMPs interact with PEX3p and PEX16p. Both of these peroxins are integral
membrane proteins and are thought to facilitate the insertion of PMPs into the
membrane. The mechanism of insertion has yet to be discovered. The
molecular details of translocation and receptor recycling are also unknown.
However, several PEX proteins have been shown to be required for import (Fig.
2.1).
PEX2p is thought to work downstream of PEX10p/PEX12p [54] and is
required for PTS1 and PTS2 import. PEX4p belongs to a family of E2 ubiquitin-
conjugating enzymes and is anchored to the peroxisomal membrane by the
integral membrane protein PEX22p. Both of these proteins are required for
import and are thought to be involved in PEX5p recycling [55]. PEX1p and
PEX6p are ATPases that belong to the functionally diverse family of “ATPases
11
associated with various cellular activities” (AAA). ATP is required for
PEX1p/PEX6p interaction, however their function is unknown.
Other peroxins that may function in import, but may not be required, have
been identified. PEX10p and PEX12p are integral peroxisomal membrane
proteins that may be associated with translocation machinery [56]. PEX8 is
required for import, it localizes to the cytosolic side of peroxisomes and interacts
with PEX5p and PEX20p [57, 58]. PEX9p and PEX23p are integral membrane
proteins found only in Y. lipolytica [59]. PEX15p is a phosphorylated integral
membrane protein [53].
4 Trypanosomal Peroxins and Their Functions
Several glycosomal proteins have been found in Trypanosmes that are
homologous to peroxisomal proteins. PEX5p, the cytosolic receptor for proteins
bearing a PTS1 receptor was found in T. brucei [20]. T. brucei glycosomes
contain two predominant integral membrane proteins. One of them, a 24 kDa
protein, was found to be the functional homologue to PEX11. PEX11p is
required for peroxisome division in Saccharomyces cerevisiae and Candida
boidinii [60, 61]. Over-expression of PEX11 in T. brucei leads to growth arrest
and deformation of glycosomes; reduced expression leads to fewer, but larger
glycosomes [62]. A PEX14 homologue has also been found in T. brucei. In
peroxisomes, PEX14p is part of the peroxisomal docking complex. In T. brucei,
PEX14p interacts specifically with PEX5p and is essential in both bloodstream
form (BSF) and procyclics. RNAi of PEX14 resulted in the release of part of the
glycosomal proteins, proposed to be due to the inability to import newly
12
synthesized proteins [63]. Finally, the PEX2 gene has been found in T. brucei.
PEX2p is essential for the import of proteins into glycosomes [17]
5 Gycosyl phosphatidylinositol (GPI)
Glycosyl phosphatidylinositols (GPIs) contain a conserved structural
Mana1-4GlcNa1-6myo-phosphatidylinositol (PI) [64]. Protein-linked GPIs (type-
1 GPIs) are based on the Mana1-6Mana1-4GlcNa1-6PI motif and can have a
wide variety of modifications [65]. GPIs may also function to anchor
polysaccharides to the plasma membrane; these GPIs contain the motif Mana1-
3Mana1-4GlcNa1-6PI and are called type-2 GPIs [66]. The third type of GPI is
free GPIs or hybrid GPIs. These GPIs are based on the branched glycan
Mana1-6(Mana1-3)Mana1-4GlcNa1-6PI [67] (for review see [66]).
The cell surface of T. brucei is covered with GPI-anchored proteins during
all stages of their life cycle. Bloodstream form parasites are covered with 107
molecules of GPI-anchored VSG [68]. The VSG GPI was the first GPI structure
to be solved [69]. This glycolipid consists of EtN-P-Mana1-2Mana1-6Mana1-
4GlcNa1-6myo-Ins-P. This core motif is decorated at the first mannose from the
lipid end with galactose (Gal) residues in either a1-2, a1-3 or a1-6 linkages [69].
5.1 GPI Biosynthesis
GPI biosynthesis begins on the cytoplasmic face of the endoplasmic
reticulum [70]. It is a sequential process in which sugars and an EtN are added
to PI to generate a GPI precursor to which a protein can be added. Synthesis
initiates with the transfer of GlcNAc from UDP-GlcNAc to PI [71] to yield GlcNAc-
PI. This molecule is then deacetylated to give GlcN-PI. Following deacetylation,
13
mannose residues from the donor dolichol-phosphoryl-mannose (Dol-P-Man) are
added [72]. Following the addition of mannose residues, a phospho-EtN is
donated from phosphatidylethanolamine to Man3-GlcN-PI to yield glycolipid A’
(EtN-P-Man3-GlcN-Ins-P-diacylglycerol) [73]. T. brucei GPIs undergo fatty acid
remodeling; the fatty acids on glycolipid A’ are replaced with myristate to yield
glycolipid A, a T. brucei VSGp GPI anchor precursor.
Concomitant with the formation of glycolipid A, T. brucei also produces
glycolipid C, in which the inositol group of glycolipid A is palmitoylated [74].
While both glycolipid A and C have been shown to be competent for transfer to
VSG protein in a cell-free system [75], there is no evidence of VSG transfer to
glycolipid C in vivo [74]. Thus the role of glycolipid C in T. brucei is unknown.
The transfer of glycolipid A GPI precursor to VSG polypeptide is thought to
occur in the lumen of the ER [76, 77]. Two signals in the polypeptide sequence
are required in order for a GPI anchor to be added. The amino (N)-terminal
signal directs the nascent protein to the lumen of the ER [78]. The second signal
resides in the carboxy (C)-terminus. GPI transfer requires a hydrophobic
sequence of 10-20 amino acids at the C-terminus. It is the hydrophobicity, rather
than the specific sequence of this site that is important for GPI transfer [79].
There must also be a cleavage/attachment site (w), 5-12 residues (hydrophilic
spacer region) N-terminal to the hydrophobic region. A transamidation reaction
occurs between the w-site of the newly synthesized VSG and the amino group of
ethanolamine, yielding GPI-anchored VSG [80] (figure 3).
14
6 GPI-specific Phospholipase C (GPI-PLCp)
Trypanosoma brucei express a glycosyl phosphatidylinositol-specific
phospholipase C (GPI-PLCp) [81, 82] that is highly specific for GPIs [83, 84] and
requires a glucosaminylinositol for efficient substrate recognition [85]. GPI-PLCp
is an integral membrane protein [81-84, 86] that may associate with glycosomes
(Z. Zheng, unpublished). How the protein binds to membranes, its localization,
three-dimensional structure and function have yet to be solved. However, the
enzyme is a virulence factor. GPI-PLCp influences parasitemia in mice [87], and
may also regulate endocytosis (S. Subramanya, unpublished).
There are two potential substrates of GPI-PLCp in vivo: (i) GPI-anchored
proteins and (ii) GPI-intermediates. VSG is anchored to the exoplasmic leaflet of
the plasma membrane, whereas GPI-intermediates are synthesized on the
cytoplasmic side of the endoplasmic reticulum [70, 88]. GPI-PLCp is thought to
localize to the “cytoplasmic side of intracellular vesicles” [89] . Thus, the most
likely substrates of GPI-PLCp in intact cells are GPI-intermediates.
6.1 Regulation of GPI-PLCp: Lessons From a Leishmania Model
Leishmania major (L. major) is related to T. brucei but does not contain an
endogenous GPI-PLCp. It is, therefore commonly used to study in vivo
regulation of GPI-PLCp. In L. major cells that have been stably transfected with
a T. brucei GPI-PLC gene, the cells become GPI-deficient and constitutively
secrete gp63p, the major GPI-linked protein on the plasma membrane into the
culture medium [90]. If GPI-PLCp cleaved GPI-intermediates in T. brucei, one
would expect to see a GPI-deficiency and secretion of VSG into the culture
15
medium. However, this is not the case; little or no VSG is released from long
slender T. brucei [91]. Thus, GPI-PLCp does not easily cleave GPI-
intermediates. Given the topological constraint between GPI-anchored VSG and
GPI-PLCp, one could infer that GPI-PLCp does not cleave membrane-form VSG
(mfVSG) either. Therefore, the function of GPI-PLCp in vivo remains to be
defined. These data also indicate that T. brucei may have a way of suppressing
GPI-PLCp activity in vivo in order to avoid the deleterious effects that enzyme
activity could have on the GPI biosynthetic pathway. It is estimated that there
are approximately 2.4 x 104 molecules of glycolipid A [70] and 3.5 x 104
molecules GPI-PLCp per cell [92]. It is theorized that GPI-PLCp could cleave all
the glycolipid A within the cell in a matter of seconds [93]. However, VSG is still
added to GPI-anchors, implying that access of GPI-PLCp to GPIs in vivo is
limited.
There are two ways in which T. brucei may regulate GPI-PLCp activity: (i)
by suppression of enzyme activity or (ii) localizing the enzyme away from the GPI
biosynthetic pathway on the ER. It has been shown that the first possibility does
occur in T. brucei. GPI-PLCp is primarily monomeric. However, in L. major,
when GPI-PLCp is expressed and gp63 is constitutively secreted, it exists
predominantly as a tetramer [93]. This data suggests that oligomerization may
activate GPI-PLCp activity [93]. In parallel, GPI-PLCp is also reversibly
myristoylated in vivo [94]. In vitro studies indicate that deacylation decreases
enzyme activity up to 30-fold, indicating that myristoylation may also regulate the
activity of GPI-PLCp [94].
16
7 Primary Objectives
The biological function of GPI-PLCp in T. brucei is unknown.
Biochemically, GPI-PLCp is an integral membrane protein. However, how the
enzyme associates with membranes and where it localizes in the cell is
unknown. Therefore, the purpose of this study is to determine how GPI-PLCp
binds membranes and to identify where the enzyme localizes in the cell; in an
effort to better understand the function of GPI-PLCp in vivo.
17
Figure 1: Trypanosoma brucei life cycle (from [95]). During a blood meal, the
tsetse fly inoculates the mammalian host with metacyclic parasites. These
quickly differentiate into long slender bloodstream forms (BSF). At peak
parasitemia the slender BSF differentiate into the short stumpy non-dividing form,
pre-adapted for survival in the insect vector. Once the tsetse fly ingests the short
stumpies, they differentiate into the procyclic form and begin to divide and
migrate to the fly midgut. Here they begin to differentiate into epimastigotes,
divide and continue migration to the salivary glands. Finally, the epimastigotes
differentiate into the non-dividing infective metacyclic form, pre-adapted for
survival in the mammalian host. The life cycle is complete when the metacyclics
are reintroduced back into a mammalian host.
18
Figure 1
19
Figure 2: Role of peroxins in peroxisomal import, biogenesis and division
(from [52]). (a) Peroxisomal proteins are synthesized on free ribosomes in the
cytosol. PTS1 proteins are chaperoned to the peroxisome by PEX5p, and PTS2
proteins by PEX7p, PEX18p, PEX20p and PEX21p. (b) These proteins are then
imported into the peroxisome. (c) Those of which have an mPTS reach the
peroxisome by PEX19p and are inserted into the peroxisomal membrane. (d-h)
Identify peroxins that are thought to play a role in peroxisomal
division/proliferation (e), biogenesis (c, g, h) and maintenance of peroxisomes (d,
f).
20
Figure 2
21
Figure 2.1: Proposed peroxisomal matrix-protein import: (from [45]) (a)
Proteins with a PTS-1 bind the chaperone PEX5p. (b) PEX5p shuttles the matrix
protein to the peroxisome surface. (c) The matrix-protein then docks with
membrane proteins like PEX14p via protein-protein interactions. (d) The matrix-
protein translocates through the proteinaceous pore thought to consist of PEX8p,
PEX10p and PEX12p. (e) The PEX5p receptor is then recycled back into the
cytosol, which may involve PEX4p and PEX22p.
22
Figure 2.1
23
Figure 3: Biosynthesis of GPIs (from [96]). Biosynthesis takes place on the
cytosolic side of the ER, beginning with the addition of GlcNAc to
phosphatidylinositol ¨. GlcNAc-PI is deacetylated ! to GlcN-PI followed by the
addition of three mannose residues " - # and the donation of a phospho-EtN by
PE ¥. Once synthesized, glycolipid A is thought to be flipped into the lumen of
the ER where it is decorated with Gal residues and added to VSG or a
carbohydrate moiety (not shown). It is then targeted to the extracellular surface
of the parasite.
24
Figure 3
25
REFERENCES
1. Enanga, B., Burchmore, R. J., Stewart, M. L. & Barrett, M. P. (2002) Sleepingsickness and the brain, Cell Mol Life Sci. 59, 845-58.
2. Denise, H. & Barrett, M. P. (2001) Uptake and mode of action of drugs usedagainst sleeping sickness, Biochem Pharmacol. 61, 1-5.
3. Hajduk, S. L., Englund, P. T., Mahmoud, A. A. F. & Warren, K. S. (1984)African Trypanosomiasis in (Warren, K. S. & Mahmoud, A. F., eds) pp. 244-252,McGraw-Hill Book Company, New York.
4. Mahmoud, A. A. F. (1993) Tropical and geographical medicine, McGraw-Hill,New York.
5. Bakker, B. M., Mensonides, F. I., Teusink, B., van Hoek, P., Michels, P. A. &Westerhoff, H. V. (2000) Compartmentation protects trypanosomes from thedangerous design of glycolysis, Proc Natl Acad Sci U S A. 97, 2087-92.
6. Ruepp, S., Furger, A., Kurath, U., Renggli, C. K., Hemphill, A., Brun, R. &Roditi, I. (1997) Survival of Trypanosoma brucei in the tsetse fly is enhanced bythe expression of specific forms of procyclin, J.Cell Biol. 137, 1369-1379.
7. Bangs, J. D., Doering, T. L., Englund, P. T. & Hart, G. W. (1988) Biosynthesisof a Variant Surface Glycoprotein of Trypanosoma brucei, J.Biol.Chem. 263,17697-17705.
8. Carrington, M., Carnall, N., Crow, M. S., Gaud, A., Redpath, M. B., Wasunna,C. L. & Webb, H. (1998) The properties and function of theglycosylphosphatidylinositol-phospholipase C in Trypanosoma brucei,Mol.Biochem.Parasitol. 91, 153-164.
9. Overath, P., Czichos, J., Stock, U. & Nonnengaesser, C. (1983) Repression ofglycoprotein synthesis and release of surface coat during transformation ofTrypanosoma brucei, Embo J. 2, 1721-8.
10. Roditi, I., Schwarz, H., Pearson, T. W., Beecroft, R. P., Liu, M. K.,Richardson, J. P., Buhring, H. J., Pleiss, J., Bulow, R. & Williams, R. O. (1989)Procyclin gene expression and loss of the variant surface glycoprotein duringdifferentiation of Trypanosoma brucei., J Cell Biol. 108, 737-46.
11. Ziegelbauer, K., Quinten, M., Schwarz, H., Pearson, T. W. & Overath, P.(1990 Sep 11) Synchronous differentiation of Trypanosoma brucei frombloodstream to procyclic forms in vitro., Eur J Biochem. 192, 373-8.
12. Neva, F. A. & Brown, H. W. (1994) Basic clinical parasitology, 6th edn,Appleton & Lange, Norwalk, Conn.
26
13. Turner, C. M. (1999) Antigenic variation in Trypanosoma brucei infections:an holistic view., J Cell Sci. 112, 3187-3192.
14. Vanhamme, L., Pays, E., McCulloch, R. & Barry, J. D. (2001) An update onantigenic variation in African trypanosomes, Trends Parasitol. 17, 338-43.
15. Smith, D. F. & Parsons, M. (1996) Molecular biology of parasitic protozoa,IRL Press at Oxford University Press, Oxford ; New York.
16. Amorim, A. G., Cardoso-de-Almeida, M. L., Carrington, M., Morga, D. P.,Riezman, H., Zerbini, L. F., Piestun, V. S. & Castilho-Valavicius, B. A. (1994)Expression of Mycobacterium leprae 18-kDa antigen in yeast in a GPI-anchoredform, Braz.J.Med.Biol.Res. 27, 623-626.
17. Guerra-Giraldez, C., Quijada, L. & Clayton, C. E. (2002) Compartmentationof enzymes in a microbody, the glycosome, is essential in Trypanosoma brucei, JCell Sci. 115, 2651-8.
18. Opperdoes, F. R. & Borst, P. (1977) Localization of nine glycolytic enzymesin a microbody-like organelle in Trypanosoma brucei: the glycosome, FEBS Lett.80, 360-4.
19. Sommer, J. M. & Wang, C. C. (1994) Targeting proteins to the glycosomesof African trypanosomes, Annu Rev Microbiol. 48, 105-38.
20. de Walque, S., Kiel, J. A., Veenhuis, M., Opperdoes, F. R. & Michels, P. A.(1999) Cloning and analysis of the PTS-1 receptor in Trypanosoma brucei, MolBiochem Parasitol. 104, 106-19.
21. Motta, M. C., Soares, M. J., Attias, M., Morgado, J., Lemos, A. P., Saad-Nehme, J., Meyer-Fernandes, J. R. & De Souza, W. (1997) Ultrastructural andbiochemical analysis of the relationship of Crithidia deanei with its endosymbiont,Eur J Cell Biol. 72, 370-7.
22. Opperdoes, F. R., Borst, P., Bakker, S. & Leene, W. (1977) Localization ofglycerol-3-phosphate oxidase in the mitochondrion and particulate NAD+-linkedglycerol-3-phosphate dehydrogenase in the microbodies of the bloodstream formto Trypanosoma brucei, Eur J Biochem. 76, 29-39.
23. Sanchez-Moreno, M., Lasztity, D., Coppens, I. & Opperdoes, F. R. (1992)Characterization of carbohydrate metabolism and demonstration of glycosomesin a Phytomonas sp. isolated from Euphorbia characias, Mol Biochem Parasitol.54, 185-99.
24. Hart, D. T., Baudhuin, P., Opperdoes, F. R. & de Duve, C. (1987) Biogenesisof the glycosome in Trypanosoma brucei: the synthesis, translocation andturnover of glycosomal polypeptides, Embo J. 6, 1403-11.
27
25. Aman, R. A. & Wang, C. C. (1986) An improved purification of glycosomesfrom the procyclic trypomastigotes of Trypanosoma brucei, Mol BiochemParasitol. 21, 211-20.
26. Clayton, C., Hausler, T. & Blattner, J. (1995) Protein trafficking inkinetoplastid protozoa., Microbiol Rev. 59, 325-44.
27. Blattner, J., Swinkels, B., Dorsam, H., Prospero, T., Subramani, S. &Clayton, C. (1992) Glycosome assembly in trypanosomes: variations in theacceptable degeneracy of a COOH-terminal microbody targeting signal, J CellBiol. 119, 1129-36.
28. Sommer, J. M., Cheng, Q. L., Keller, G. A. & Wang, C. C. (1992) In vivoimport of firefly luciferase into the glycosomes of Trypanosoma brucei andmutational analysis of the C-terminal targeting signal, Mol Biol Cell. 3, 749-59.
29. Parsons, M., Furuya, T., Pal, S. & Kessler, P. (2001) Biogenesis andfunction of peroxisomes and glycosomes, Mol Biochem Parasitol. 115, 19-28.
30. Blattner, J., Dorsam, H. & Clatyon, C. E. (1995) Function of N-terminalimport signals in trypanosome microbodies, FEBS Lett. 360, 310-4.
31. Hammaert V, I. A., Lambeir A, Opperdoes FR, Michels PAM. (1999)Molecular and kinetic analysis of hexokinase from Trypanosoma brucei, ArchPhysiol Biochem. 107.
32. Small, G. M., Szabo, L. J. & Lazarow, P. B. (1988) Acyl-CoA oxidasecontains two targeting sequences each of which can mediate protein import intoperoxisomes, Embo J. 7, 1167-73.
33. Kragler, F., Langeder, A., Raupachova, J., Binder, M. & Hartig, A. (1993)Two independent peroxisomal targeting signals in catalase A of Saccharomycescerevisiae, J Cell Biol. 120, 665-73.
34. Purdue, P. E. & Lazarow, P. B. (2001) Peroxisome biogenesis, Annu RevCell Dev Biol. 17, 701-52.
35. Nakagawa, T., Imanaka, T., Morita, M., Ishiguro, K., Yurimoto, H.,Yamashita, A., Kato, N. & Sakai, Y. (2000) Peroxisomal membrane proteinPmp47 is essential in the metabolism of middle-chain fatty acid in yeastperoxisomes and Is associated with peroxisome proliferation, J Biol Chem. 275,3455-61.
36. Dyer, J. M., McNew, J. A. & Goodman, J. M. (1996) The sorting sequence ofthe peroxisomal integral membrane protein PMP47 is contained within a shorthydrophilic loop, J Cell Biol. 133, 269-80.
28
37. Honsho, M. & Fujiki, Y. (2001) Topogenesis of peroxisomal membraneprotein requires a short, positively charged intervening-loop sequence andflanking hydrophobic segments. study using human membrane protein PMP34, JBiol Chem. 276, 9375-82.
38. Wiemer, E. A., Luers, G. H., Faber, K. N., Wenzel, T., Veenhuis, M. &Subramani, S. (1996) Isolation and characterization of Pas2p, a peroxisomalmembrane protein essential for peroxisome biogenesis in the methylotrophicyeast Pichia pastoris, J Biol Chem. 271, 18973-80.
39. Kammerer, S., Holzinger, A., Welsch, U. & Roscher, A. A. (1998) Cloningand characterization of the gene encoding the human peroxisomal assemblyprotein Pex3p, FEBS Lett. 429, 53-60.
40. Ghaedi, K., Tamura, S., Okumoto, K., Matsuzono, Y. & Fujiki, Y. (2000) Theperoxin pex3p initiates membrane assembly in peroxisome biogenesis, Mol BiolCell. 11, 2085-102.
41. Huang, K., Lazarow, PB. (1996) Targeting of green fluorescent protein toperoxisomes and peroxisome membranes in S. cerevisiae, Mol. Biol. Cell. 7(Suppl.), 494a (Abstr.).
42. Baerends, R. J., Faber, K. N., Kram, A. M., Kiel, J. A., van der Klei, I. J. &Veenhuis, M. (2000) A stretch of positively charged amino acids at the Nterminus of Hansenula polymorpha Pex3p is involved in incorporation of theprotein into the peroxisomal membrane, J Biol Chem. 275, 9986-95.
43. Pause, B., Saffrich, R., Hunziker, A., Ansorge, W. & Just, W. W. (2000)Targeting of the 22 kDa integral peroxisomal membrane protein, FEBS Lett. 471,23-8.
44. Garnier, J., Gibrat, J. F. & Robson, B. (1996) GOR method for predictingprotein secondary structure from amino acid sequence, Methods Enzymol. 266,540-53.
45. Gould, S. J. & Collins, C. S. (2002) Opinion: peroxisomal-protein import: is itreally that complex?, Nat Rev Mol Cell Biol. 3, 382-9.
46. Dammai, V. & Subramani, S. (2001) The human peroxisomal targeting signalreceptor, Pex5p, is translocated into the peroxisomal matrix and recycled to thecytosol, Cell. 105, 187-96.
47. Purdue, P. E., Yang, X. & Lazarow, P. B. (1998) Pex18p and Pex21p, anovel pair of related peroxins essential for peroxisomal targeting by the PTS2pathway, J Cell Biol. 143, 1859-69.
48. Einwachter, H., Sowinski, S., Kunau, W. H. & Schliebs, W. (2001) Yarrowialipolytica Pex20p, Saccharomyces cerevisiae Pex18p/Pex21p and mammalian
29
Pex5pL fulfil a common function in the early steps of the peroxisomal PTS2import pathway, EMBO Rep. 2, 1035-9.
49. Sichting, M., Schell-Steven, A., Prokisch, H., Erdmann, R. & Rottensteiner,H. (2003) Pex7p and Pex20p of Neurospora crassa function together in PTS2-dependent protein import into peroxisomes, Mol Biol Cell. 14, 810-21.
50. Otera, H., Harano, T., Honsho, M., Ghaedi, K., Mukai, S., Tanaka, A., Kawai,A., Shimizu, N. & Fujiki, Y. (2000) The mammalian peroxin Pex5pL, the longerisoform of the mobile peroxisome targeting signal (PTS) type 1 transporter,translocates the Pex7p.PTS2 protein complex into peroxisomes via its initialdocking site, Pex14p, J Biol Chem. 275, 21703-14.
51. Sacksteder, K. A., Jones, J. M., South, S. T., Li, X., Liu, Y. & Gould, S. J.(2000) PEX19 binds multiple peroxisomal membrane proteins, is predominantlycytoplasmic, and is required for peroxisome membrane synthesis, J Cell Biol.148, 931-44.
52. Lazarow, P. B. (2003) Peroxisome biogenesis: advances and conundrums,Curr Opin Cell Biol. 15, 489-97.
53. Elgersma, Y., Kwast, L., van den Berg, M., Snyder, W. B., Distel, B.,Subramani, S. & Tabak, H. F. (1997) Overexpression of Pex15p, aphosphorylated peroxisomal integral membrane protein required for peroxisomeassembly in S.cerevisiae, causes proliferation of the endoplasmic reticulummembrane, Embo J. 16, 7326-41.
54. Okumoto, K., Abe, I. & Fujiki, Y. (2000) Molecular anatomy of the peroxinPex12p: ring finger domain is essential for Pex12p function and interacts with theperoxisome-targeting signal type 1-receptor Pex5p and a ring peroxin, Pex10p, JBiol Chem. 275, 25700-10.
55. van der Klei, I. J., Hilbrands, R. E., Kiel, J. A., Rasmussen, S. W., Cregg, J.M. & Veenhuis, M. (1998) The ubiquitin-conjugating enzyme Pex4p of Hansenulapolymorpha is required for efficient functioning of the PTS1 import machinery,Embo J. 17, 3608-18.
56. Chang, C. C., Warren, D. S., Sacksteder, K. A. & Gould, S. J. (1999) PEX12interacts with PEX5 and PEX10 and acts downstream of receptor docking inperoxisomal matrix protein import, J Cell Biol. 147, 761-74.
57. Rehling, P., Skaletz-Rorowski, A., Girzalsky, W., Voorn-Brouwer, T., Franse,M. M., Distel, B., Veenhuis, M., Kunau, W. H. & Erdmann, R. (2000) Pex8p, anintraperoxisomal peroxin of Saccharomyces cerevisiae required for proteintransport into peroxisomes binds the PTS1 receptor pex5p, J Biol Chem. 275,3593-602.
30
58. Smith, J. J. & Rachubinski, R. A. (2001) A role for the peroxin Pex8p inPex20p-dependent thiolase import into peroxisomes of the yeast Yarrowialipolytica, J Biol Chem. 276, 1618-25.
59. Brown, T. W., Titorenko, V. I. & Rachubinski, R. A. (2000) Mutants of theYarrowia lipolytica PEX23 gene encoding an integral peroxisomal membraneperoxin mislocalize matrix proteins and accumulate vesicles containingperoxisomal matrix and membrane proteins, Mol Biol Cell. 11, 141-52.
60. Erdmann, R. & Blobel, G. (1995) Giant peroxisomes in oleic acid-inducedSaccharomyces cerevisiae lacking the peroxisomal membrane protein Pmp27p,J Cell Biol. 128, 509-23.
61. Sakai, Y., Marshall, P. A., Saiganji, A., Takabe, K., Saiki, H., Kato, N. &Goodman, J. M. (1995) The Candida boidinii peroxisomal membrane proteinPmp30 has a role in peroxisomal proliferation and is functionally homologous toPmp27 from Saccharomyces cerevisiae, J Bacteriol. 177, 6773-81.
62. Lorenz, P., Maier, A. G., Baumgart, E., Erdmann, R. & Clayton, C. (1998)Elongation and clustering of glycosomes in Trypanosoma, EMBO J. 17, 3542-3555.
63. Moyersoen, J., Choe, J., Kumar, A., Voncken, F. G., Hol, W. G. & Michels,P. A. (2003) Characterization of Trypanosoma brucei PEX14 and its role in theimport of glycosomal matrix proteins, Eur J Biochem. 270, 2059-67.
64. Ferguson, M. A., Masterson, W. J., Homans, S. W. & McConville, M. J.(1991) Evolutionary aspects of GPI metabolism in kinetoplastid parasites, CellBiol Int Rep. 15, 991-1005.
65. Morita, Y., Acosta-Serrano, A., Englund, PT. (2000) The Biosynthesis of GPIAnchors in Oligosaccharides in Chemistry and Biology - A ComprehensiveHandbook (B. Ernst, P. S., and G. Hart, ed), Wiley - VCH, Weinheim, Germany.
66. Ferguson, M. A. (1999) The structure, biosynthesis and functions ofglycosylphosphatidylinositol anchors, and the contributions of trypanosomeresearch, J Cell Sci. 112 ( Pt 17), 2799-809.
67. McConville, M. J. & Ferguson, M. A. J. (1993) The structure, biosynthesisand function of glycosylated phosphatidylinositols in the parasitic protozoa andhigher eukaryotes, Biochem.J. 294, 305-324.
68. Cross, G. A. M. (1975) Identification, purification, and properties of clone-specific glycoprotein antigens constituting the surface coat of Trypanosomabrucei, Parasitology. 71, 393-417.
31
69. Ferguson, M. A. J., Homans, S. W., Dwek, R. A. & Rademacher, T. W.(1988) Glycosyl-phosphatidylinositol moiety that anchors Trypanosoma bruceivariant surface glycoprotein to the membrane, Science. 239, 753-759.
70. Vidugiriene, J. & Menon, A. K. (1994) The GPI anchor of cell-surfaceproteins is synthesized on the cytoplasmic face of the endoplasmic reticulum,J.Cell Biol. 127, 333-341.
71. Doering, T. L., Masterson, W. J., Englund, P. T. & Hart, G. W. (1989)Biosynthesis of the glycosyl phosphatidylinositol membrane anchor of thetrypanosome variant surface glycoprotein. Origin of the non-acetylatedglucosamine., J.Biol.Chem. 264, 11168-11173.
72. Schwarz, R. T., Mayor, S., Menon, A. K. & Cross, G. A. M. (1989)Biosynthesis of the glycolipid membrane anchor of Trypanosoma brucei variantsurface glycoproteins: involvement of Dol-P-Man, Biochem.Soc.Trans. 17, 746-748.
73. Menon, A. K., Eppinger, M., Mayor, S. & Schwarz, R. T. (1993)Phosphatidylethanolamine is the donor of the terminal phosphoethanolaminegroup in trypanosome glycosylphosphatidylinositols, Embo J. 12, 1907-14.
74. Guther, M. L. & Ferguson, M. A. J. (1995) The role of inositol acylation andinositol deacylation in GPI biosynthesis in Trypanosoma brucei, EMBO J. 14,3080-3093.
75. Mayor, S., Menon, A. K. & Cross, G. A. M. (1991) Transfer of glycosyl-phosphatidylinositol membrane anchors to polypeptide acceptors in a cell-freesystem, J.Cell Biol. 114, 61-71.
76. Bangs, J. D., Hereld, D., Krakow, J. L., Hart, G. W. & Englund, P. T. (1985)Rapid processing of the carboxyl terminus of a trypanosome variant surfaceglycoprotein, Proc.Natl.Acad.Sci.USA. 82, 3207-3211.
77. Ferguson, M. A., Duszenko, M., Lamont, G. S., Overath, P. & Cross, G. A.M. (1986) Biosynthesis of Trypanosoma brucei variant surface glycoproteins N-glycosylation and addition of a phosphatidylinositol membrane anchor,J.Biol.Chem. 261, 356-362.
78. Yan, W., Shen, F., Dillon, B. & Ratnam, M. (1998) The hydrophobic domainsin the carboxyl-terminal signal for GPI modification and in the amino-terminalleader peptide have similar structural requirements, J.Mol.Biol. 275, 25-33.
79. Bohme, U. & Cross, G. A. (2002) Mutational analysis of the variant surfaceglycoprotein GPI-anchor signal sequence in Trypanosoma brucei, J Cell Sci. 115,805-16.
32
80. Udenfriend, S. & Kodukula, K. (1995) How glycosylphosphatidylinositol-anchored membrane proteins are made, Annu.Rev.Biochem. 64, 563-591.
81. Bulow, R. & Overath, P. (1986) Purification and characterization of themembrane-form variant surface glycoprotein hydrolase of Trypanosoma brucei, JBiol Chem. 261, 11918-23.
82. Fox, J. A., Duszenko, M., Ferguson, M. A., Low, M. G. & Cross, G. A. M.(1986) Purification and characterization of a novel glycan-phosphatidylinositol-specific phospholipase C from Trypanosoma brucei, J.Biol.Chem. 261, 15767-15771.
83. Hereld, D., Krakow, J. L., Bangs, J. D., Hart, G. W. & Englund, P. T. (1986)A phospholipase C from Trypanosoma brucei which selectively cleaves theglycolipid on the variant surface glycoprotein, J.Biol.Chem. 261, 13813-13819.
84. Mensa-Wilmot, K., Morris, J. C., Al-Qahtani, A. & Englund, P. T. (1995)Purification and use of recombinant glycosylphosphatidylinositol phospholipaseC, Methods Enzymol. 250, 641-655.
85. Morris, J. C., Ping-Sheng, L., Shen, T. Y. & Mensa-Wilmot, K. (1995) Glycanrequirements of glycosylphosphatidylinositol phospholipase C from Trypanosomabrucei. Glucosaminylinositol derivatives inhibit phosphatidylinositolphospholipase C, J.Biol.Chem. 270, 2517-2524.
86. Mensa-Wilmot, K. & Englund, P. T. (1992) Glycosyl phosphatidylinositol-specific phospholipase C of Trypanosoma brucei: Expression in Escherichia coli,Mol.Biochem.Parasitol. 56, 311-322.
87. Webb, H., Carnall, N., Vanhamme, L., Rolin, S., Van den Abbeele, J.,Welburn, S., Pays, E. & Carrington, M. (1997) The GPI-phospholipase C ofTrypanosoma brucei is nonessential but influences parasitemia in mice, J.CellBiol. 139, 103-114.
88. Vidugiriene, J. & Menon, A. K. (1993) Early lipid intermediates in glycosyl-phosphatidylinositol anchor assembly are synthesized in the ER and located inthe cytoplasmic leaflet of the ER membrane bilayer, J.Cell Biol. 121, 987-996.
89. Bülow, R., Griffiths, G., Webster, P., Stierhof, Y.-D., Opperdoes, F. R. &Overath, P. (1989) Intracellular localization of the glycosyl-phosphatidylinositol-specific phospholipase C of Trypanosoma brucei, J.Cell.Sci. 93, 233-240.
90. Mensa-Wilmot, K., LeBowitz, J. H., Chang, K. P., Al-Qahtani, A., McGwire,B. S., Tucker, S. & Morris, J. C. (1994) A glycosylphosphatidylinositol (GPI)-negative phenotype produced in Leishmania major by GPI phospholipase C fromTrypanosoma brucei: Topography of two GPI pathways, J.Cell Biol. 124, 935-947.
33
91. Black, S. J., Hewett, R. S. & Sendashonga, C. N. (1982) Trypanosomabrucei variable surface antigen is released by degenerating parasites but not byactively dividing parasites, Parasite.Immunol. 4, 233-244.
92. Bülow, R. & Overath, P. (1986) Purification and characterization of themembrane-form variant surface glycoprotein hydrolase of Trypanosoma brucei,J.Biol.Chem. 261, 11918-11923.
93. Armah, D. A. & Mensa-Wilmot, K. (2000) Tetramerization ofglycosylphosphatidylinositol-specific phospholipase C from Trypanosoma brucei,J Biol Chem. 275, 19334-42.
94. Armah, D. A. & Mensa-Wilmot, K. (1999) S-Myristoylation of a GPI-Phospholipase C in Trypanosoma brucei, J Biol Chem. 274, 5931-5939.
95. El-Sayed, N. M., Hegde, P., Quackenbush, J., Melville, S. E. & Donelson, J.E. (2000) The African trypanosome genome., Int J Parasitol. 30, 329-45.
96. Kinoshita, T. & Inoue, N. (2000) Dissecting and manipulating the pathway forglycosylphos- phatidylinositol-anchor biosynthesis, Curr Opin Chem Biol. 4, 632-8.
34
CHAPTER II
MEMBRANE INTERACTIONS OF GPI-PLC IN VITRO AND IN
TRYPANOSOMA BRUCEI1
1 Hardin, Clyde, Kimberly Butler, Robyn Howard, Zhifeng Zheng andKojo Mensa-Wilmot. To be submitted to Journal of Biological Chemistry
35
ABSTRACT
Trypanosoma brucei expresses an endogenous glycosyl
phosphatidylinositol-specific phospholipase C (GPI-PLCp). Biochemical
evidence suggests the enzyme is an integral membrane protein. However,
methods used to predict membrane-binding domains do not identify any such
domains in GPI-PLCp. In an attempt to clarify the mechanism by which GPI-
PLCp binds to membranes, amino and carboxy terminal truncations of the protein
were fused to a soluble reporter protein, green fluorescent protein (GFP) and
assayed for their ability to bind T. brucei membranes post-translationally. These
experiments indirectly identified two potential regions of GPI-PLCp that may
target GFP to the membranes. In this study, these domains, membrane binding
regions (MBR1and MBR2, amino acids 60-120 and 238-298, respectively), were
fused to GFP and assayed for their ability to bind T. brucei membranes. Only
MBR1 sufficiently targeted GFP to T. brucei membranes. Helical wheel analysis
of MBR1 region suggests that it could contain a stretch of amino acids that may
form an amphipathtic a-helix. We propose that GPI-PLCp interacts with
membranes via the hydrophobic face of MBR1 and one leaflet a lipid bilayer.
GPI-PLCp is therefore a membrane associated protein without a transmembrane
domain.
In vivo, immunofluorescence data reveals that GPI-PLCp colocalizes with
hypoxanthine-guanine phosphribosyltransferase (HGPRT), a glycosomal protein.
This data suggests that the enzyme localizes to glycosomes in T. brucei. In a
36
second approach, T. brucei glycosomes were purified by velocity sedimentation
and sucrose density-gradient fractionation. The fractions were assayed for GPI-
PLCp activity and for the presence of a glycosomal enzyme, aldolase. GPI-PLCp
enzyme activity and aldolase cosedimented on sucrose gradients. These data
support the immunofluorescence data, confirming the localization of GPI-PLCp to
glycosomes in T. brucei.
We determined the topological orientation of GPI-PLCp on glycosomes.
Purified glycosomes were subjected to proteinase K digestion in the presence or
absence of NP-40 detergent. After treatment, the integrity of GPI-PLCp was
determined using enzyme assays. Glycosomal GPI-PLCp is fully active after
treatment with proteinase K. However, during protease treatment in detergent,
GPI-PLCp is digested. These data indicate that glycosomes protect GPI-PLCp
from proteolysis by proteinase K. We infer that GPI-PLCp is imported into the
lumen of the glycosomes.
We conclude that (i) GPI-PLCp is a glycosomal protein, (ii) GPI-PLCp
resides inside glycosomes, and that (iii) MBR1 may direct the association of GPI-
PLCp with membranes inside glycosomes.
37
INTRODUCTION
Glycosyl phosphatidylinositol-specific phospholipase C (GPI-PLCp) from
T. brucei is an integral membrane protein [1-5]. GPI-PLCp associates with the
pellet of a hypotonic cell lysate and cannot be extracted by reagents known to
solubilize peripheral membrane proteins (1M NaCl and 20 mM EDTA) or by low
concentrations of detergent (0.1% nonidet P-40). High concentrations of
detergent (1% NP-40), however, can solubilize the protein. The purified enzyme
is also found in the detergent fraction after Triton X-114 phase partitioning [4].
How GPI-PLCp binds to membranes is unknown. Kyte-Doolittle analysis
[6] and Pfam (Protein families database of alignment and hidden Markov models)
[7] analysis, are used to identify hydrophobic domains or peptide sequences
homologous to lipid-binding domains of other proteins, respectively. These
computational analyses do not provide clues about how GPI-PLCp associates
with membranes.
GPI-PLCp may associate with membranes by: (i) interaction with other
proteins; (ii) by lipid modification; or (iii) lipid-binding domains. Membrane
binding by the enzyme is not due to eukaryotic-specific modifications [4] or
protein-protein interactions [2]. Therefore, we investigated the possibility of
membrane binding via lipid-binding domains in T.brucei.
Conceding that GPI-PLCp does not have a transmembrane domain, a
search for short hydrophobic segments with a shorter window was performed
using Kyte-Doolittle analysis [6]. Five ‘domains’ of GPI-PLCp were predicted to
be hydrophobic enough to bind membranes (K. Butler, M.S. Thesis, UGA).
38
Protein truncations containing these domains were constructed and fused to
green fluorescent protein (GFP), a soluble reporter polypeptide. The fusion
proteins were assayed for their ability to target the reporter to T. brucei
membranes in vitro. From these experiments, two domains within GPI-PLCp,
amino acids 60-120 and 238-298 were proposed to be capable of targeting GFP
to microsomes and were named membrane-binding region (MBR)1 and MBR2,
respectively (K. Butler, M.S. Thesis, UGA). In this work we determined if these
domains are sufficient to target GFP to T. brucei microsomes. We found that
only MBR1 of GPI-PLCp could target GFP to microsomes, suggesting that this
region plays a role in membrane-binding by GPI-PLCp.
Attempts have been made in an effort to elucidate the intracellular location
of GPI-PLCp in T. brucei [8, 9]. The most recent attempt suggests that the
protein associates with the “cytoplasmic side of intracellular vesicles” and that the
function of these vesicles was not known [9]. Recently, however, it was shown
that GPI-PLCp colocalizes with a glycosomal protein, hypoxanthine-guanine
phosphoribosyltransferase (HGPRT) (Z. Zheng, unpublished).
To determine if GPI-PLCp localizes with glycosomes in vivo, we purified
glycosomes from T. brucei and assayed them for GPI-PLCp activity and for the
presence of aldolase (a glycosome marker). We show that GPI-PLCp and
aldolase cosedimented on sucrose gradients and conclude that GPI-PLCp binds
to T. brucei glycosomes in vivo. We also determined the topological orientation of
GPI-PLCp in glycosomes, by using protease protection assays. It was found that
glycosomes protected GPI-PLCp from digestion. Only after solubilization with
39
detergent was GPI-PLCp susceptible to digestion. These results indicate that
GPI-PLCp is imported into the lumen of glycosomes. We speculate on how GPI-
PLCp is targeted to glycosomes and how membrane binding regions may
mediate binding of GPI-PLCp to these membranes.
MATERIALS AND METHODS
Materials
Restriction enzymes Bam HI, Hind III and Xba I were from New England
Biolabs (Beverly, MA); nonidet P-40 was from Calbiochem (San Diego, CA);
sodium dodecyl sulfate (SDS), 5-bromo-4-chloro-indoyl phosphate (BCIP) and p-
nitroblue tetrazolium chloride (NBT) were from BioRad (Melville, NY); leupeptin
and DNase I were from Roche (Indianapolis, IN); butanol was from Fisher
Scientific (Norcross, GA); Immobilon P membrane was purchased from Millipore
(Bedford, MA); Redivue Promix was from Amersham Biosciences (Piscataway,
NJ); DE52 was from Whatman (Hillsboro, OR); Amplitaq DNA polymerase was
from Perkin Elmer (Boston, MA); T4 DNA ligase was from Promega (Madison,
WI); phenol/chloroform/isoamyl/alcohol and methanol were from Fisher
(Pittsburgh, PA); Ampliscribe T7 kit was from Epicentre (Madison, WI);
bicinchoninic acid assay kit was from Pierce (Rockford, IL); anti-aldolase
antibody was a gift from Dr. Christine Clayton (ZMBH, Heidelberg, Germany); all
other reagents were from Sigma (St. Louis, MO).
40
Cell Types / Strain
Monomorphic T. brucei strain 427 bloodstream form was used in this
work. Parasites were grown in rodents and harvested by chromatography on
DE52 [10].
Plasmids
The plasmids pCO64 and pCO59 were from Dr. George Cross
(Rockefeller University): they contain NH2- and COOH-terminal fusions,
respectively, of GPI-PLC to GFP. These vectors were used as templates to
produce various GPI-PLC:GFP fusions.
Generation of GPI-PLC and GFP DNA
Polymerase chain reaction (PCR) was used to amplify GPI-PLC and GFP
genes from pCO59 using forward and reverse primers. All forward primers
include a T7 promoter [11] for RNA synthesis in vitro and a short 5’ untranslated
region (UTR) to enhance translation [12]. All reverse primers introduced a stop
codon downstream of the coding region, unless noted otherwise.
PCR reactions were set up in Innis buffer (10 mM Tris-HCl pH 8, 2.5 mM
MgCl2, 0.05% Tween-20, 0.05% nonidet P-40, 50 mM KCl). To this buffer, 30 ng
pCO59 template, 0.25 mM of each deoxynucleotide, 20 mM of the indicated
primers, and 5U of Taq DNA polymerase were added [13]. Cycling conditions
were (i) denaturation at 95°C for 90 seconds, (ii) annealing at 56°C for 90
seconds, and, (iii) extension at 74°C for 2 min. Twenty-five cycles were
performed. Amplified products were purified using the Wizard PCR DNA
purification system (Promega) and resuspended in T10E1 (10 mM Tris-HCl pH 8,
41
1 mM EDTA) to a final concentration of 1 mg/ml as determined by OD260. Aliquots
(500 ng) were electrophoresed on a 1% agarose gel to verify product size and
concentration.
Generation of MBR1/MBR2 DNA by PCR
Production of MBR1:GFP and MBR2:GFP DNA required two PCR
reactions. The first reaction was used to synthesize the “megaprimer” [14], a
sense strand of 264 nucleotides containing (5’-3’) T7 promoter, Hind III restriction
site, 5’ untranslated region, and a segment of nucleotides encoding amino acids
60-120 (MBR1) or 238-298 (MBR2) of GPI-PLCp joined to a segment of
nucleotides that encodes amino acids 2-11 of GFP. The second reaction uses
the forward “megaprimer” and a reverse GFP primer to fuse the MBR1 or MBR2
coding region of GPI-PLC to GFP. The final product is flanked by 5’ Hind III and
3’ Bam HI restriction sites, generated from forward and reverse primers.
The first round of PCR was used to construct “megaprimers” that encoded
amino acids 60-120 or 238-358 of GPI-PLCp. To amplify the fragment encoding
residues 60-120 joined to amino acids 2-11 of GFP, forward primer fT7H3MBR1,
5’GGGTAATACGACTCACTATAGGGAGAAAGCTTGTAACACAGGAGGCAGAT
CATGCCATATGTGGACCTTTCTTTTA3’ and reverse primer rGFP-MBR1,
5’CCCGGTGAACAGCTCCTCGCCCTTGCTCACTGGAACAGAAATATGGAAAT
G3’ (restriction sites underlined) were used. To amplify the fragment encoding
residues 238-298 of GPI-PLCp joined to amino acids 2-11 of GFP, forward
primer fT7H3MBR2, 5’GGGTAATACGACTCACTATAGGGAGAAAGCTTGTA-
ACACAGGAGGCAGATCATGTTGGAAGATGTCAGTATTGGC3’ and reverse
42
primer 5’CCCGGTGAACAGCTCCTCGCCCTTGCTCACTAAATCATA-
AAACCACTTCAA 3’ were used. PCR was carried out as described using 50 ng
GPI-PLC amplified from pCO59 (K. Butler, M.S. Thesis, UGA) as the template.
Cycling conditions were (i) denaturation at 95°C for 90 seconds, (ii) annealing at
45°C for 90 seconds, and, (iii) extension at 74°C for 2 min. Twenty-five cycles
were performed. The second round of PCR contained using 50 ng GFP
template, 1.9 mg of the above “megaprimers” (forward primer), the reverse primer
(rGFP), 5’TGGCAGGATCCTATTTAACACCCGGGGTACAGCTCGTC3’ (Hind III)
restriction site underlined), and 45°C annealing temperature were used. The
rGFP reverse primer introduces a Bam HI restriction site N-terminal of the stop
codon.
PCR products were separated from templates by agarose gel
electrophoresis, and isolated from the agarose with homemade spin columns.
Columns were made by (i) piercing a hole in the bottom of a 0.8 ml Eppendorf
tube, (ii) stuffing the 0.8 ml tube with glass wool, and (iii) placing the 0.8 ml tube
in a 1.5 ml Eppendorf tube. Gel slices containing PCR products were placed in
the 0.8 ml tube and centrifuged twice for 15 min (8,000 x g, 25°C). DNA was
extracted from the eluate with phenol/chloroform/isoamyl alcohol (P/CIA) and
ethanol precipitation [13].
The second round of PCR produced a relatively low yield of the desired
1030 nucleotide fragment. After purification, the DNA was cloned into pBSKII
and transforming for amplification in Escherichia coli XL-10 cells as indicated
below.
43
Restriction Digest and Transformation
MBR-GFP DNA and pBSKII were digested with Bam HI and Hind III (NEB)
then ligated using 50 ng pBSKII and 25 ng MBR-GFP [15]. Five ml of each
ligation reaction was transformed into E. coli XL-10 cells [15]. Plasmid DNA was
extracted by mini alkaline lysis preparation [16]. The correct orientation of the
insert in the vector was determined by PCR using fT7H3MBR1/2 and rGFP
primers.
In Vitro Transcription of DNA
Plasmid DNA containing MBR1/2-GFP was linearized with Xba I and
concentrated to 1 mg/ml using ethanol precipitation [13]. Purified DNA fragments
were transcribed using the AmpliscribeTM T7 Kit (Epicentre Technologies). One
ml (1 MBU) of RNase-Free DNase I was added to the reaction and incubated for
15 min at 37°C. Twenty ml of 5 M ammonium acetate was added to the mixture
and incubated for 15 min. on ice. Precipitated RNA was pelleted (14, 000 x g, 15
min, 4°C) and washed in 70% ethanol. Purified RNA was resuspended in 10 ml
T10E1 (10 mM Tris, 1 mM EDTA pH 6.8) and concentration was determined by
absorbance at OD260. Samples were diluted to a concentration of 1 mg/ml with
T10E1. RNA concentration was verified by electrophoresing 1 mg on a 1%
agarose gel [16].
In Vitro Protein Synthesis
Reagents for in vitro translation reaction were added in the following order
on ice: 2 mg mRNA, 1 mM methionine/cysteine-free amino acid mixture
(Promega), 1.5 ml (21 mCi) [35S] Redivue Promix (Amersham Biosciences), 10.5
44
ml nuclease-free water, 15 ml rabbit reticulocyte lysate (Promega). Translation
was mixed thoroughly by pipetting and incubated at 30°C for 2 h. Translation
products were separated by SDS-PAGE (14% mini gel), and radiolabeled
proteins were visualized by phosphorimaging (Personal Molecular Imager FX,
BioRad).
Preparation of T. brucei Microsomes
A pellet of 2 x 109 bloodstream form T. brucei (BSF) was washed in PBS
and resuspended in 1 ml of homogenization buffer (HB) (250 mM sucrose, 50
mM KOAc, 6 mM Mg(OAc)2, 1 mM EDTA, 1 mM DTT) cells were lysed by
sonciation at 4°C (Vibra Cell Ultrasonicator model #VC-501: amplitude 20 for 4
min, cells were in a 1.5 ml microfuge tube and floated in an ice bath). The
mixture was centrifuged (2000 x g, 10 min., 4°C) to sediment large cellular
debris. The supernatant was centrifuged (12, 000 x g, 20 min., 4°C) and the
pellet was resuspended in 25 ml of rough microsome buffer (RMB) (250 mM
sucrose, 50 mM HEPES-KOH, pH 7.6, 50 mM KOAc, 1 mM DTT) supplemented
with1mg/ml TLCK, 5 mg/ml leupeptin. The OD260 of a 1:50 dilution of the
resuspended membranes in 0.5% SDS was determined. The
microbody/microsome stock was diluted with RMB to a final OD260 of 30,
aliquoted into 25 ml portions, quick frozen in liquid nitrogen, and stored at -80°C
(B. Patham, unpublished). Seven ml of these microsomes were used in binding
experiments (see below).
45
Post-Translational Binding of Proteins to T. brucei Membranes
Twenty microliters of an in vitro translation reaction was mixed with 37 ml
of RMB either with or without T. brucei microsomes (210 OD260 units). These
samples were incubated at 30°C for 10 min. to allow the protein to bind the
membranes. Next, 100 ml of dilution buffer (DB) (100 mM KOAc, 20 mM HEPES-
KOH pH 7.2, 2.5 mM Mg(OAc)2, 20 mM EDTA) was added and the samples were
incubated on ice for 15 min. This mixture was layered on top of a 70 ml sucrose
cushion (500 mM sucrose, 20 mM HEPES-KOH, pH 7.2) and centrifuged at
100,000 x g for 30 min. at 4°C (52,000 rpm in a TLA 100.3 rotor, Beckman
OptimaTM TL Ultracentrifuge). The supernatant was transferred to a fresh
microfuge tube. The pellet, containing membrane-bound protein was solubilized
by resuspending in 70 ml of pellet resuspension buffer (PRB) (500 mM Tris base,
5% SDS, 10 mM DTT) and heating at 55°C for 15 min [17]. Equivalent volumes
of each fraction (2 ml of the translation reaction, 22 ml of supernatant and 7 ml of
pellet) were separated by SDS-PAGE (14% mini gel), and radiolabeled proteins
were visualized by phosphorimaging (Personal Molecular Imager FX, BioRad).
QuantityOne software (BioRad) was used to detect the amount of signal in each
band (K. Butler, M.S. Thesis, UGA).
Purification of T. brucei Glycosomes
Isolation of glycosomes as follows was modified from [18]. T. brucei
(1010) were resuspended in 1 ml of HEDS buffer (50 mM HEPES-KOH pH 7.8, 1
mM EDTA, 1 mM DTT, 250 mM sucrose) plus 50 mM KOAc, 5% glucose)
supplemented with leupeptin (1 mg/ml). Cells were disrupted using 10 strokes
46
with a Dounce homogenizer (Kontes, 15 ml homogenizer, low clearance pestle),
and centrifuged at 1500 x g for 15 min at 4°C. Supernatant was collected into a
new microfuge tube. The pellet was resuspended in 1 ml HEDS buffer and
centrifuged as before, supernatant was collected. This process was repeated
again and all three supernatants were pooled and centrifuged at 33,000 x g
(25,000 rpm with Beckman TLA 100.3 rotor) for 30 min. The pellet (crude
microbodies) was resuspended in 3 ml HEDS buffer with 50 mM KOAc and 5 mM
MgCl2, and 0.25 mg/ml DNase I [18] (Roche) was added. The mixture was
incubated on ice for 30 min. One ml of the sample was added to a 12 ml,15-60%
continuous sucrose gradient (sucrose was dissolved in HEDS buffer with 1 mg/ml
leupeptin). The gradient was centrifuged overnight (36,000 rpm, 4°C) in an
SW41 Ti rotor. To fractionate the gradient, the bottom of the tube (Beckman
Ultra-Clear Tube #44059) was punctured by a Tube Piercer (ISCO) and 62%
sucrose was pumped into the bottom at 40% speed (1ml/min) (Tris-Pump,
ISCO). Eighteen 750 ml fractions were collected from the top of the gradient
using the Foxy Jr. Fraction Collector (ISCO). Total protein was determined with
a bicinchoninic acid assay kit (Pierce).
Cosedimentation Assays
Four ml of an in vitro translated reaction mixture was added to 3 ml (84
mg/ml) of enriched glycosomes. Briefly, glycosomes were purified as above
except they were layered on a 1-2 M (34-68%)sucrose gradient. The fractions
with peak GPI-PLCp activity were pooled (4 ml), diluted to 25 ml with HEDS
buffer and centrifuged at 22,000 x g for 30 min. at 4°C (Beckman 50.2 Ti rotor,
47
L7-55 centrifuge). Pellets were resuspended in 25 ml HEDS buffer with 50 mM
KOAc, 5 mM MgCl2. The reaction was incubated for 30°C for 30 min. to allow for
binding then cooled on ice for 1 hour. The mixture was centrifuged at 33,000 x g
for 30 min at 4°C (25,000 rpm TLA 100.3 rotor). Pellets were resuspended in 25
ml SDS-sample buffer. Ten ml of supernatant and pellet fraction were analyzed
by SDS-PAGE (14% mini gel, BioRad) as previously described.
TCA Precipitation
Microbodies were precipitated with TCA prior to Western analysis. Each
750 ml sample (from above) was raised to 1 ml with water, 500 ml were saved
prior to precipitation for GPI-PLCp activity assays (see below). The other 500 ml
was used as follows: to 500 ml (5 x 107 cell equivalents), 40 ml of water was
added followed by one ml 1% (w/v) sodium deoxycholate and for a final
concentration of 0.0015% [19]. The mixture was incubated on ice for 30 minutes.
Sixty ml trichloroacetic acid (TCA) was added yielding a final concentration of
10% TCA, and the reaction was mixed by vortexing. Fractions were incubated
on ice for 1 h and centrifuged for 10 min. at 14,000 x g, 4°C. Supernatant was
removed and the pellet was gently washed with 500 ml ice-cold acetone. Pellets
were allowed to air dry for 10 minutes, followed by exposure to ammonium
hydroxide (28-30%) vapor for 30 seconds per tube to neutralize the pH of the
pellet. Pellets were resuspended in 30 ml 5X SDS sample buffer, 5 ml was
heated for 5 min, and separated by SDS-PAGE (14% mini gel) (BioRad) [16].
Proteins were transferred to Immobilon P with a Trans-Blot semi-dry cell
(BioRad) [20].
48
Western Blots
The Immobilon P membrane was first blocked in PBS pH 7.5 solution
containing 3% (w/v) Carnation powdered milk, 1% (v/v) Tween 20) for 1 h at
room temperature. Aldolase was detected by Western blotting with anti-aldolase
antiserum (1:000) [20].
Assay of GPI-PLCp Enzyme Activity
All eighteen fractions (from above) were assayed for GPI-PLCp activity.
One ml of each fraction was added to 19 ml GPI-PLC assay buffer (50 mM Tris-
HCl, pH 8.0, 5 mM EDTA, 1.0% NP-40) and 2 mg [3H]myristate-labeled
membrane form variant surface glycoprotein dissolved in 10 ml GPI-PLC assay
buffer (30 µl final volume) [5]. The reaction was incubated at 37°C for 20 min,
and terminated by addition of 500 ml water-saturated n-butanol. Four hundred
microliters of the upper organic phase were retrieved for liquid scintillation
counting [5].
Proteinase Protection Assays
Fraction 14, the fraction that contained the highest GPI-PLCp activity, was
used for proteinase protection assays (fraction 14, Fig. 7). One microliter (28
mg/ml) of this fraction, or 1 ml (1.4U) purified GPI-PLCp [5], was added to 8 ml
HEDS buffer with or without proteinase K (300 ng/ml). The reaction was
incubated overnight at 15°C and quenched with 1 ml (20 mM) phenyl-methyl-
sulfonyl-fluoride (PMSF). When specified, HEDS buffer may be supplemented
to: 1% (v/v) nonidet P-40 detergent. After protease digestion, 5 ml of the reaction
was assayed for GPI-PLCp activity [5].
49
RESULTS
GPI-PLCp Is Not Predicted to Have Membrane-Spanning a-Helices
The biochemical properties of GPI-PLCp indicate that it is an integral
membrane protein. It cannot be extracted with high ionic solutions or by low
concentrations of detergents. High concentrations of detergent (1% NP-40)
solubilize GPI-PLCp. The purified enzyme is also found in the detergent fraction
after Triton X-114 phase partitioning [4].
To determine if GPI-PLCp contained transmembrane regions, Kyte-
Doolittle hydrophobicity analysis [6] was used, with a window of 19 amino acids,
the length required to span a lipid bilayer as an a-helix [6]. Typically, a value
greater than 1.6 correlates to a transmembrane domain. Figure 1 shows the
hydrophobicity plots of GPI-PLCp and Sec61p. Sec61p has 10 trans-membrane
domains which have been verified experimentally [21], as predicted by Kyte-
Doolittle hydrophobicity plots (Fig. 1B). GPI-PLCp does not contain a peak with
a hydrophobicity index of 1.6 (Fig. 1A). Computational analysis of GPI-PLCp
with Pfam [7] also yielded negative results for sequences homologous to known
membrane-binding domains (data not shown).
To resolve the discrepancy between the biochemical data [1-5] and the
predictions from the computational analysis, fragments of GPI-PLCp were fused
to GFP and assayed for their ability to target GFP to T. brucei microsomes
(K. Butler, M.S. Thesis, UGA).
50
GPI-PLCp Targets GFP to T. brucei Microsomes
To determine if GFP:GPI-PLCp could target GFP to microsomes, the
fusion protein and GFP were assayed by cosedimentation in the presence or
absence of T. brucei microsomes (Fig. 2). GFP is a soluble protein [21] and
does not pellet in either the presence or absence of T. brucei microsomes (Fig.
2A). GFP fused to the N-terminus of GPI-PLCp was also predominantly found in
the soluble fraction in the absence of membranes (Fig. 2A). To quantitate the
differences in the effectiveness of protein binding to microsomes, the amount of
signal in the pellet was compared to the total signal (sum of signal in supernatant
and pellet). The ratios obtained were plotted for each protein tested (indicated in
figures) in the presence or absence of T. brucei microsomes (Fig. 2B).
Approximately 2% of the total signal (translated protein) was found in the
pellet fraction in absence of microsomes. The amount of signal in the pellet
fraction was not affected upon the addition of microsomes (data not shown). For
GFP:GPI-PLC, there was an increase of signal found in the pellet fraction after
the addition of microsomes (Fig. 2B). Roughly 10% of the total signal was found
in the pellet fraction without microsomes. Addition of microsomes increased the
pelletable signal 4.6 fold (Fig. 2B).
These results indicate that GPI-PLCp can target a soluble reporter
polypeptide, GFP, to T. brucei microsomes.
Amino Acids 60-120 and 238-358 May Contribute to Membrane-Binding ofGPI-PLCp
To identify membrane binding regions in GPI-PLCp, truncations of the
protein were fused to GFP and assayed for the ability to bind T. brucei
51
microsomes using a cosedimentation assay (K. Butler, M.S. Thesis, UGA) (Fig.
3). Both full-length proteins with N- and C-terminal fusions of GFP to GPI-PLCp
showed increased binding to microsomes as compared to assays without
microsomes (Fig. 3A, E). Signal in the pellet fraction for N- and C-terminal
fusions were 27% and 23% (respectively) without microsomes. In the presence
of microsomes 63% of the proteins pelleted.
To identify membrane binding regions in the N-terminal half of GPI-PLCp,
truncations of residues 1-179 of the protein (1-60, 1-120 and 1-179) were fused
to the C-terminus of GFP (Fig. 3I) and assayed for the ability to bind T. brucei
microsomes using a cosedimentation assay (Fig. 3). Residues 1-120 and 1-179
of GPI-PLCp fused to GFP showed an increase in binding to microsomes as
compared to assays without microsomes (Fig. 3B, C). Signal in the pellet
fraction for residues 1-179 and 1-120 were approximately 38% without
microsomes. Addition of microsomes increased the amount of pelletable protein
to 76% (residues 1-179) and 88% (residues 1-120) (Fig. 3B, C). However, when
amino acids 1-60 were fused to GFP and assayed, there was no increase in the
amount of pelletable protein upon the addition of microsomes (Fig. 3D).
Therefore, amino acids 1-60 are not sufficient to target the reporter protein (GFP)
to microsomes.
Next, to identify membrane binding regions in the C-terminal half of GPI-
PLCp, truncations of residues 179-358 of GPI-PLCp (179-358, 238-358, 298-
358) were fused to the N-terminus of GFP, these constructs were assayed as for
binding as previously described. Residues 179-358 and 238-358 fused to GFP
52
showed an increase in pelleted fractions in the presence of microsomes as
compared to assays without microsomes (Fig. 3F, G). Approximately 35% of
signal (residues 179-358 and 238-358) was found in pellet fraction without
microsomes. Addition of microsomes increased these signals to 89% (179-358)
and 95% (238-358) (Fig. 3F, G). The presence of multiple bands in figure 3F
may be due to internal initiation of synthesis or perhaps due to proteolysis,
regardless, all signal was quantitated collectively. However, the last sixty amino
acids (residues 298-358) of GPI-PLCp do not significantly increase the fraction of
GFP that is pelleted upon the addition of T. brucei microsomes (Fig. 3H). Only a
10% increase in signal (from 32% to 42%) in the pellet fractions was observed,
(the top band was alone was quantitated in these experiments because the full-
length polypeptide signal was easily distinguished by size). Therefore, amino
acids 298-358 of GPI-PLCp are not sufficient to target the reporter protein (GFP)
to microsomes (Fig. 3H).
In summary, these results indirectly indicate residues 60-120 and 238-
298, termed membrane binding regions (MBR)1 and 2, respectively, may be
sufficient for binding GPI-PLCp to microsomes (Fig. 3I) (K. Butler, M.S. Thesis,
UGA).
Amino Acids 60-120 Is Sufficient to Target GFP to Microsomes
To determine if amino acids 60-120 (membrane binding region 1, MBR1)
or 238-358 (MBR2) from GPI-PLCp are capable of targeting GFP to T. brucei
microsomes, GFP was fused to the N-terminus of each region (Fig. 4A). Fusion
proteins were assayed for binding to microsomes from T. brucei. Without
53
microsomes, approximately 9% of the total signal of MBR1-GFP was found in the
pellet fraction (Fig. 4B, C). However, 25% of MBR1-GFP is found in the pellet
fraction after the addition of microsomes (Fig. 4B, C). Therefore, residues 60-120
is capable of directing GFP to T. brucei microsomes. In contrast, very little fusion
protein is found in the pellet fraction when MBR2-GFP was cosedimented with
microsomes (Fig 4B). Quantitation of the data indicates that with or without
microsomes, less than 5% of the fusion protein is pelleted (Fig. 4C). These data
indicate amino acids 238-358 (MBR2) of GPI-PLCp are not sufficient to target
GFP to T. brucei microsomes (Fig. 4B, C)
Together, these data suggest that residues MBR1 is capable of binding to
T. brucei microsomes. When comparing binding of MBR1-GFP to GPI-PLC:GFP
to T. brucei microsomes, there was a 3-fold increase and a 4.6-fold increase (Fig
2C, 4C). Therefore, the binding of MBR1:GFP was almost as efficient as GPI-
PLC:GFP, indicating that MBR1 may contribute to most of the membrane binding
activity of GPI-PLCp.
GPI-PLCp Binds To Glycosomes In T. brucei
Until recently, GPI-PLCp was thought to associate with the “cytoplasmic
side of intracellular vesicles” [9]; the identity of these vesicles was not known. In
order to better understand the function of GPI-PLCp in T. brucei, it was
imperative that the identity of these vesicles was resolved. In order to determine
the location of GPI-PLCp in T. brucei two approaches were used:
immunofluorescence and subcellular fractionation.
54
Bloodstream form T. brucei (Fig. 5A) were fixed, permeabilized and
incubated with anti-GPI-PLCp or anti-HGPRT (a glycosome marker [22])
antibodies. Anti-HGPRT was detected by Alexa Fluor 488 conjugated goat anti-
rabbit IgG (Fig. 5B, green). Anti-GPI-PLCp was detected using Alexa Fluor 594
goat anti-mouse IgG conjugate (Fig. 5C, red). The merge of images B and C is
shown in D. Colocalization of GPI-PLCp and glycosomes is evident (Z. Zheng,
unpublished).
In a second approach, intracellular location of GPI-PLCp was determined
by subcellular fractionation. T. brucei glycosomes were purified by velocity
sedimentation and sucrose density-gradient fractionation from homogenized
cells. Crude microbodies obtained by velocity sedimentation were separated
using sucrose density-gradient centrifugation [23]. The gradient was fractionated
into eighteen portions, each 0.75 ml portion was assayed for the presence of
GPI-PLCp by an enzyme assay and for aldolase (a marker of glycosomes [24])
by Western blotting (Fig. 6). Approximately 70% of GPI-PLCp activity was found
in samples 13-16 (Fig. 6). A small peak is also present in less dense fractions,
this may be newly synthesized, cytosolic GPI-PLCp not yet associated with
membranes. Aldolase was primarily found in samples 13-16 by Western
analysis; a small peak was also detected in fractions 3-5 (Fig. 6). The presence
of both GPI-PLCp and aldolase in fractions 13-16 indicate that the two
cosedimented on the sucrose gradient. These observations confirm the
immunofluorescence data that GPI-PLCp is a glycosome protein in vivo.
55
In the aforementioned experiments, as negative controls, we assayed
each fraction for the presence of the endoplasmic reticulum (ER) proteins, BiP
and Sec61 [25, 26] and lysosomal protein p67 [27]. The results of these
experiments were inconclusive, perhaps due to inappropriate assay conditions
(data not shown).
In vitro studies were performed to test whether GPI-PLCp binds to
glycosomes purified from T. brucei. For this purpose, GPI-PLCp was translated
in vitro and incubated with or without glycosomes (see Post-translational binding
of proteins to glycosomes and cosedimentation analysis). Samples were
separated into supernatant and pellet fractions and were analyzed by SDS-
PAGE/phosphorimaging. Figure 7A shows the distribution of GPI-PLCp in
supernatant and pellet fractions in the presence or absence of glycosomes (Fig.
7A). To quantitate the differences in the effectiveness of protein binding to
microsomes, the amount of signal in each pellet was compared to the total signal
(sum of signal in supernatant and pellet). The ratios obtained were plotted for
each protein tested in the presence or absence of T. brucei microsomes (Fig.
7B). In the absence of glycosomes, twenty one percent of GPI-PLCp pelleted.
Upon adding glycosomes, the protein signal in the pellet fraction increased to
51% of GPI-PLCp cosedimented with the organelle (Fig. 7B). This 2-fold
increase in sedimentation of GPI-PLCp in the presence of glycosomes indicates
that GPI-PLCp associates with glycosomes.
Titration analysis was also performed to determine if the amount of
glycosomes affected the binding of GPI-PLCp. To test this, in vitro translated
56
GPI-PLCp was incubated with different amounts of glycosomes (1, 3 and 5 ml);
the mixture was then sedimented and analyzed as above. From these
experiments we found 3 ml of glycosomes to be sufficient and there was no
difference in binding of GPI-PLCp when incubated with 5 ml of glycosomes (not
shown).
As shown (Fig. 7B), not all of the in vitro translated GPI-PLCp associates
with glycosomes. There are several reasons as to why this may occur. First,
endogenous GPI-PLCp may have saturated the T. brucei glycosomes.
Therefore, only a limited amount of the in vitro translated protein can bind.
Second, if GPI-PLCp is imported into glycosomes, the molecular machinery
required for import may not be present in the in vitro system. Third, there may be
an excess of in vitro translated GPI-PLCp as compared to glycosomes and not all
may be able to bind. Last, other proteins in the lysate used to translate GPI-PLC
mRNA may compete with GPI-PLCp in binding.
GPI-PLCp Is A Lumenal Protein of Glycosomes
Having identified glycosomes as the organelle that GPI-PLCp binds in T.
brucei, we wanted to determine the topological orientation of GPI-PLCp on
glycosomes since GPI-PLCp is a membrane protein [1-5]. To determine whether
GPI-PLCp associated with cytoplasmic membrane or lumenal membranes of
glycosomes, we used protease protection assays. In control studies, purified
GPI-PLCp [5] was incubated overnight with proteinase K; the phospholipase C
was digested by the protease (Fig. 8A).
57
Next, to determine whether glycosomal GPI-PLCp was susceptible to
protease digestion, purified glycosomes from T. brucei were incubated in the
presence or absence of proteinase K and/or NP-40 (a non-ionic detergent) (Fig.
8B). Purified glycosomes retain GPI-PLCp activity in the presence of proteinase
K or NP-40 alone. However, in the presence of both proteinase K and NP-40,
there is a dramatic loss of GPI-PLCp activity (Fig. 8B). These data indicate that
(i) glycosomes protect GPI-PLCp from proteinase K digestion, and (ii) detergent
permeabilization of glycosome membranes exposes GPI-PLCp to proteinase K
digestion. Based on these data we infer that GPI-PLCp is imported into
glycosomes of T. brucei.
DISCUSSION
Membrane Binding of GPI-PLCp
Biochemically, GPI-PLCp behaves in a mannar similar to an integral
membrane protein [1-5]. Integral membrane proteins are proteins that are not
released from the membrane by relatively gentle extraction procedures, such as
exposure to solutions of very high ionic strength or of extreme pH. Trans-
membrane proteins, and many proteins that are bound to the bilayer by lipids,
are integral membrane proteins [28]. Kyte-Doolittle analysis and Pfam analysis,
are used to identify hydrophobic domains or lipid-binding domains, respectively.
These computational approaches failed to recognize any such domains in GPI-
PLCp (Fig. 1A). Membrane binding of GPI-PLCp is not due to eukaryotic-specific
modifications [4] or protein-protein interactions [2, 29].
58
Cosedimentaton analysis of segments of GPI-PLCp fused to a soluble
reporter protein (GFP) indirectly revealed two potential membrane-binding
regions (MBRs) (Fig. 3), amino acids 60-120 (MBR1) and residues 238-298
(MBR2). These MBRs were fused to GFP in an effort to directly test a
hypothesis that either MBR1 or MBR2 was sufficient for membrane binding by
GPI-PLCp. Only MBR1 was capable of targeting GFP to microbodies (Fig. 4).
MBR1 of GPI-PLCp May Contain An Amphipathic a-Helix
MBR 1 does not have a 19 amino acid stretch that might span a lipid
bilayer (Fig. 1A). However, biochemical evidence indicates that GPI-PLCp is an
integral membrane. We therefore speculate that MBR1 had a hydrophobic patch
in its secondary structure that facilitated binding to membranes. To test this idea,
we analyzed GPI-PLCp by hydropathy analysis using an 8 amino acid window
(not shown). Alanine is the least aliphatic of the non-polar amino acids, a stretch
of 8 alanines has a hydrophobicity index of 1.8. Therefore, a value of 1.8 (Kyte-
Doolittle scale [6]) was used to identify potential hydrophobic regions within GPI-
PLCp. With these parameters, 5 peaks of at least 1.8 were found. Amino acids
60-74 of MBR1 contain a peak with a hydrophobicity index of 2.0 (Fig. 9A).
PSIPRED Protein Structure Prediction Server [30] predicted that these residues
have the potential to form an a-helix. Helical wheel analysis [31] of these amino
acids generated a possible amphipathic a-helix. Hydrophobic amino acids
(valine, leucine and phenylalanine) are on one side of the proposed a-helix in
MBR1 (Fig. 9B, black arch), forming a hydrophobic patch that may interact with a
59
lipid bilayer. Therefore, we propose that GPI-PLCp interacts with membranes by
a hydrophobic patch in MBR1 that has the potential to form an amphipathic a-
helix.
Amphipathic a-helices are used by other proteins to associate with
membranes. MinD binds to phospholipid vesicles with a single, short strech of
10 amino acids which have the potential to form an amphipathic helix [32].
Similarily, membrane binding of prostaglandin H2 synthase [33, 34] and
mammalian PI-PLCd [35] depend on amphipathic a-helices. Figure 9C illustrates
a model of prostaglandin H2 synthase associating with one leaflet of the plasma
membrane via 4 amphipathic a-helices.
Experimental data suggest that GPI-PLCp does not associate with
membranes by protein modification [4]. GPI-PLCp expressed in E. coli exhibits
the same tight association to membranes as it does in T. brucei [4]. However,
recombinant GPI-PLCp is extracted by 8M Urea whereas the native enzyme in T.
brucei cannot (R. Howard, unpublished). GPI-PLCp is myristoylated in T. brucei
[36]. This modification may contribute to the effectiveness of binding and explain
why native enzyme cannot be extracted by the chaotropic agent. Further
expermentation may be done to validate this hypothesis.
Glycosome Interactions
Glycosomes are peroxisome-like microbodies found in all kinetoplastids;
they contain the first 7-9 enzymes of glycolysis [24, 37]. Recent experiments
suggest GPI-PLCp localizes to glycosomes in vivo (Z. Zheng, unpublished). To
investigate this result further, T. brucei organelles were resolved by velocity
60
sedimentation and sucrose density-gradient centrifugation. The gradient was
fractionated into 18 portions, each of which was assayed for GPI-PLCp enzyme
activity and for the presence of aldolase (a glycosome marker) by Western
analysis. Aldolase and GPI-PLCp cosedimented on the sucrose gradient (Fig.
6), indicating that endogenous GPI-PLCp localizes to glycosomes in vivo. In
support of this result, we found that GPI-PLCp bound to purified glycosomes from
T. brucei (Fig. 7).
The topological orientation of GPI-PLCp on glycosomes was studied.
Here, glycosomes were subjected to proteinase K digestion in the presence or
absence of NP-40. Glycosomal GPI-PLCp is not susceptible to proteinase K
(Fig. 8B). However, when NP-40 detergent is added to the digestion reaction,
GPI-PLCp is digested by proteinase K digestion. Based on these results, we
surmise that GPI-PLCp resides within glycosomes of T. brucei. This result is
however, inconsistent with data that detected GPI-PLCp on the cytoplasmic side
of vesicles [9]. In this study, only a few gold particles (indicitative of GPI-PLCp)
were detected on vesicles, resulting in data that is relatively difficult to interpret.
We believe that this result was due to a loss of epitope signal that may have
been due to fixation of T. brucei cells prior to electron microscopy analysis [9].
Biochemical properties strongly suggest that GPI-PLCp is associated with
the glycosomal membranes. GPI-PLCp binds to T. brucei microbodies (Fig. 2)
and glycosomes (Fig. 8). The recombinant protein, expressed in Escherichia
coli, which lacks glycosomes, also strongly associates with membranes [4]. The
purified protein binds detergent micelles during Triton X-114 phase partitioning
61
[2]. Based on these observations, we propose that GPI-PLCp binds to
membranes non-specifically. This inference raises two questions: (i) how is GPI-
PLCp prevented from binding to local membranes after its synthesis in the
cytosol,and (ii) how does GPI-PLCp get specifically to glycosomal membranes?
Proposed Model for GPI-PLCp – Glycosome Interactions
We offer a hypothetical model based on peroxisomal import of matrix
proteins (Fig. 10). In this scheme, GPI-PLCp, synthesized in the cytosol, binds to
a cytosolic chaperone protein. Alternatively, GPI-PLCp may associate with a
protein containing a peroxisomal targeting sequence (PTS) that binds a PTS
receptor protein (“piggy-backing”). This initial complex formation could inhibit
non-specific interactions between GPI-PLCp and nearby membranes after
synthesis. We propose that the peroxin complex would then transport GPI-PLCp
to docking proteins. After docking, the complex could enter the glycosome.
Following import, the complex dissociates and the cytosolic chaperone is
recycled back to the cytosol. Released from the chaperone, GPI-PLCp
associates (non-specifically) with the lumenal leaflet of the glycosome inner
membrane [38, 39].
62
Figure 1: Kyte-Doolittle Hydropathy Analysis of GPI-PLCp and Sec61p. A)
Hydropathy analysis of GPI-PLCp from T. brucei using a 19 amino acid window.
B) Hydropathy analysis of Sec61p from S. cerevisiae using a 19 amino acid
window. The number ruler above each plot indicates amino acid number in each
peptide. Relative hydrophobicity is indicated by the scale to the left of each plot.
A hydrophobicity of 1.6 or greater predicts a potential transmembrane domain.
Nineteen is the minimum number of amino acids required to span a membrane
[16].
63
Figure 1
AGPI-PLCp (T. brucei)
Kyte-Doolittle Hydrophobicity Plot19 Amino Acid Window
BSec61p (S. cerevisiae)
Kyte-Doolittle Hydrophobicity Plot(19 Amino Acid Window)
64
Figure 2: GPI-PLCp targets a soluble reporter protein to T. brucei
microsomes. A) GFP and GFP:GPI-PLCp were translated in vitro as
described. Twenty ml of each reaction was incubated with (+) or without (-) T.
brucei rough microsomes (TbRM) (7 ml, 210U) in RMB. Reactions were
incubated for 10 min. at 30°C then 3-fold diluted with dilution buffer. Samples
were incubated on ice for 15 min, then layered on a sucrose cushion and
centrifuged at 52,000 rpm for 30 min. Supernatant was removed and pellet was
solubilized with 70 ml PRB. Five percent total volume of both supernatant (S) and
pellet (P) were analyzed by 14% SDS-PAGE and phosphorimaging. B) Graphs
indicate the ratio of signal in pellet to total signal in absence (-) or presence (+) of
T. brucei microsomes.
65
Rat
io o
f S
ign
al in
Pel
let
to T
ota
l Sig
nal
Figure 2
A
S P S P
- +GFP
S P S P
- +
GFP:GPI-PLC
TbRM
B
- +
GFP
- +
GFP:GPI-PLC
TbRM
66
Figure 3: Effect of NH2-terminal and COOH-terminal fragments of GPI-PLCp
on targeting a soluble reporter protein to T. brucei microsomes (K. Butler,
unpublished). Indicated fusion constructs were translated in vitro as described.
Twenty ml of Radiolabeled proteins were incubated in the absence (-) or
presence (+) of TbRM (210U) for 10 min. at 30°C. Twenty ml of each sample was
diluted 5-fold in DB and incubated for 10 min. on ice. Each fraction was layered
on a 500 mM sucrose cushion and centrifuged at 52,000 rpm for 30 min at 4°C.
Equivalent volumes of supernatant (s) and pellet (p) fractions were analyzed by
14% SDS-PAGE and phosphorimaging. Images were quantitated using
QuantityOne software (BioRad). (A-D) NH2-terminal fragments. (E-H) COOH-
terminal fragments. (I) is an illustration of each construct analyzed and indicates
which polypeptides were (3) or were not (7) capable of targeting GFP to T.
brucei rough microsomes.
67
GFP:GPI-PLC1-60
S P S P
- +GFP:GPI-PLC1-120
S P S P
- +
GFP:GPI-PLC1-179
S P S P
- +GFP:GPI-PLC1-358
S P S P
- +TbRM
TbRM
A B
C D
A
rbitr
ary
Phos
phor
imag
er U
nits
A
rbitr
ary
Phos
phor
imag
er U
nits
Arb
itrar
y Ph
osph
orim
ager
Uni
ts
A
rbitr
ary
Phos
phor
imag
er U
nits
Figure 3
68
GPI-PLC1-358:GFP
S P S P
- +GPI-PLC179-358:GFP
S P S P
- +
GPI-PLC238-358:GFP
S P S P
- +GPI-PLC298-358:GFP
S P S P
- +
TbRM
TbRM
E F
G H
A
rbitr
ary
Phos
phor
imag
er U
nits
Arb
itrar
y Ph
osph
orim
ager
Uni
ts
Arb
itrar
y Ph
osph
orim
ager
Uni
ts
A
rbitr
ary
Phos
phor
imag
er U
nits
Figure 3
69
Figure 3
I
70
Figure 4: Effect of putative membrane binding regions (MBR) of GPI-PLCp
on targeting a soluble reporter protein to T. brucei microsomes. A)
Membrane binding regions (MBR1), amino acids 60-120, and MBR2, amino
acids 238-298 of GPI-PLCp were fused to the soluble reporter polypeptide, green
fluorescent protein (GFP). Constructs were linked to GFP by megaprimer PCR
as described. DNA was transcribed and RNA translated, in vitro, as described.
B) Twenty ml of each radiolabeled polypeptide was added to RMB with (+) or
without (-) T. brucei rough microsomes (7 ml, 210U) and incubated at 30°C for 10
min. Each sample was diluted 3-fold and layered on a 500 mM sucrose cushion.
Samples were centrifuged at 52,000 rpm for 30 min at 4°C. Supernatant was
removed and the pellet fraction was solubilized in pellet resuspension buffer
(PRB). Equivalent volumes of supernatant (S) and pellet (P) fractions were
analyzed by 14% SDS-PAGE and phosphorimaging. QuantityOne software
(BioRad) was used to quantitate each fraction. C) Graphs indicate the ratio of
signal in pellet to the total signal in the absence (-) or presence (+) of
microsomes.
71
R
atio
of S
igna
l in
Pelle
t to
Tota
l Sig
nal
Figure 4
A
B
S P S P
- +
MBR1GPI-PLC:GFP
S P S P
- +
MBR2GPI-PLC:GFP
TbRM
C
- +MBR1GPI-PLC:GFP
- +
MBR2GPI-PLC:GFP
TbRM
72
Figure 5: GPI-PLCp colocalizes with a glycosomal protein, HGPRT, in T.
brucei. (A-D) T. brucei was fixed, permeablilized and incubated with anti-GPI-
PLCp and anti-HGPRT antibody. Anti-HGPRT was detected by Alexa Fluor 488
goat anti-rabbit IgG conjugate (B, green). Anti-GPI-PLCp was detected using
Alexa Fluor 594 goat anti-mouse IgG conjugate (C, red). The merge of images B
and C is shown in D [Z. Zheng, unpublished].
73
HGPRT
GPI-PLCp Merge
Figure 5
74
Figure 6: GPI-PLCp colocalizes with a glycosomal protein on a sucrose
gradient. T. brucei glycosomes were isolated by sucrose-gradient
sedimentation of microbodies obtained by differential centrifugation. The sucrose
gradient was fractionated into 18, 750 ml samples as described. One ml of each
sample was assayed for GPI-PLCp activity. The y-axis indicates the amount of
[3H] dimyristoylglycerol (DMG) released by GPI-PLCp. The x-axis denotes the
fraction number. Each of the 18 samples was precipitated using TCA. Pellets
were resuspended in 30 ml 5X SDS-sample buffer. Five ml of each sample was
analyzed by 14% SDS-PAGE followed by Western analysis using an anti-
aldolase antibody.
75
Figure 6
A
76
Figure 7: GPI-PLCp binds to glycosomes in vitro. GPI-PLC was translated in
vitro as described. Four ml of the translation mixture was incubated with (+) or
without (-) 3 ml purified glycosomes for 30 min. at 30°C then on ice for 1 hour.
Samples were centrifuged at 25,000 rpm for 30 min. Supernatants were
removed and pellets were resuspended in 25 ml 2.5X SDS-sample buffer. Ten ml
of supernatant (S) and pellet (P) were analyzed by 12% SDS-PAGE and
phosphorimaging. Quantitation was done using QuantityOne software (BioRad).
B) Graphs indicate the ratio of signal in pellet to total signal in arbitrary units.
77
Figure 7
A
S P S P
+-Glycosomes
GPI-PLCp
B
+-GPI-PLCp
Glycosomes
78
Figure 8: Glycosomal GPI-PLCp is protected from digestion by proteinase
K A) Effect of proteinase K on activity of purified GPI-PLCp. One ml (1.4U) of
purified GPI-PLCp was incubated with or without proteinase K (300 ng/ml)
overnight at 15°C. Reactions were quenched with 2mM PMSF and assayed for
GPI-PLCp activity as described. Released [3H]dimyristoylglycerol was quantified
by scintillation counting. B) Purified glycosomes (1 ml) containing endogenous
GPI-PLCp were incubated in the presence (+) or absence (-) of proteinase K
(300 ng/ml), 1% NP-40, or both, overnight at 15°C. Reactions were quenched
with 2mM PMSF and analyzed for GP-PLCp activity as described.
79
Figure 8
A
B
80
Figure 9: Hydropathy analysis of MBR1 and helical wheel analysis of
amino acids 60-74 of GPI-PLCp. A) Hydropathy plot of MBR1 of GPI-PLCp
using an 8 amino acid window. Numbers above the plot indicate amino acid
number of the polypeptide. Relative hydrophobicity is indicated to the left of the
plot. A hydrophobic patch is found within amino acids 60-74. B) Helical wheel
analysis predicts an amphipathic alpha-helix. Hydrophobic patch is indicated by
a solid line. C) Prostaglandin H2 Synthase binds membranes via four
amphipathic alpha-helices. Prostaglandin H2 Synthase is a peripheral-
membrane protein that binds to membranes by direct protein-lipid interactions.
The protein contains 4 alpha helices that have a series of hydrophobic residues
that are postulated to insert into the bilayer.
81
Figure 9
A GPI-PLCp (60-120)
Kyte-Doolittle Hydropathy Plot8 Amino Acid Window
B
82
Figure 9
CProstaglandin H2 Synthase
Plasma Membrane
Adapted from Theoretical Biophysics Group, University of Illinois at Urbana-Champaign
83
Figure 10: Hypothetical model of GPI-PLCp association with glycosomes.
GPI-PLCp is synthesized on free ribosomes in the cytosol. (a) After synthesis, it
may bind to a peroxin (PEX, green); (b) transport of the enzyme-receptor
complex to the glycosome surface; (c) the complex docks to a receptor complex
possibly including PEX17p (yellow) PEX14p (grey) and perhaps PEX13p (red).
GPI-PLCp-receptor complex enters through a proteinaceous pore that may
contain PEX8p, PEX10p and PEX12p (all shown in purple). After translocation,
the complex dissociates (e) and the receptor is recycled back to the cytosol
which may involve PEX4p and PEX22p (orange). Once GPI-PLCp is inside the
glycosome and has dissociated from the receptor, MBR1 may direct GPI-PLCp to
associate with the inner leaflet of the glycosome membrane. PEX, peroxin [27,
28, Figure is adapted from, 28].
84
Figure 10
85
REFERENCES
1. Bülow, R. & Overath, P. (1986) Purification and characterization of themembrane-form variant surface glycoprotein hydrolase of Trypanosoma brucei,J.Biol.Chem. 261, 11918-11923.
2. Fox, J. A., Duszenko, M., Ferguson, M. A., Low, M. G. & Cross, G. A. M.(1986) Purification and characterization of a novel glycan-phosphatidylinositol-specific phospholipase C from Trypanosoma brucei, J.Biol.Chem. 261, 15767-15771.
3. Hereld, D., Krakow, J. L., Bangs, J. D., Hart, G. W. & Englund, P. T. (1986) Aphospholipase C from Trypanosoma brucei which selectively cleaves theglycolipid on the variant surface glycoprotein, J.Biol.Chem. 261, 13813-13819.
4. Mensa-Wilmot, K. & Englund, P. T. (1992) Glycosyl phosphatidylinositol-specific phospholipase C of Trypanosoma brucei: Expression in Escherichia coli,Mol.Biochem.Parasitol. 56, 311-322.
5. Mensa-Wilmot, K., Morris, J. C., Al-Qahtani, A. & Englund, P. T. (1995)Purification and use of recombinant glycosylphosphatidylinositol phospholipaseC, Methods Enzymol. 250, 641-655.
6. Kyte, J. & Doolittle, R. F. (1982) A simple method for displaying thehydropathic character of a protein, J.Mol.Biol. 157, 105-132.
7. http://www.pfam.wustl.edu. in
8. Grab, D. J., Webster, P., Ito, S., Fish, W. R., Verjee, Y. & Lonsdale-Eccles, J.D. (1987) Subcellular localization of a variable surface glycoproteinphosphatidylinositol-specific phospholipase C in African trypanosomes,J.Cell.Biol. 105, 737-746.
9. Bülow, R., Griffiths, G., Webster, P., Stierhof, Y.-D., Opperdoes, F. R. &Overath, P. (1989) Intracellular localization of the glycosyl-phosphatidylinositol-specific phospholipase C of Trypanosoma brucei, J.Cell.Sci. 93, 233-240.
10. Cross, G. A. M. (1975) Identification, purification, and properties of clone-specific glycoprotein antigens constituting the surface coat of Trypanosomabrucei, Parasitology. 71, 393-417.
11. Davanloo, P., Rosenberg, A. H., Dunn, J. J. & Studier, F. W. (1984) Cloningand expression of the gene for bacteriophage T7 RNA polymerase, Proc NatlAcad Sci U S A. 81, 2035-9.
86
12. Teilhet, M., Rashid, M. B., Hawk, A., Al-Qahtani, A. & Mensa-Wilmot, K.(1998) Effect of short 5' UTRs on protein synthesis in two biological kingdomsGene. 222, 91-7.
13. Innis, M. A., Myambo, K. B., Gelfand, D. H. & Brow, M. D. (1988) DNAsequencing with Thermus aquaticus DNA polymerase and direct sequencing ofpolymerase chain reaction-amplified DNA, Proc.Natl.Acd.Sci.U.S.A. 85, 9436-9440.
14. Colosimo, A., Xu, Z., Novelli, G., Dallapiccola, B. & Gruenert, D. C. (1999)Simple version of "megaprimer" PCR for site-directed mutagenesis,Biotechniques. 26, 870-3.
15. Sambrook, J. & Russell, D. W. (2001) Molecular cloning : a laboratorymanual, 3rd edn, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
16. Sambrook, J., Fritsch, E. F. & Maniatis, T. (1989) Molecular cloning : alaboratory manual, 2nd edn, Cold Spring Harbor Laboratory, Cold Spring Harbor,N.Y.
17. Nicchitta, C. V. & Zheng, T. L. (1997) Regulation of the ribosome-membranejunction at early stages of presecretory protein translocation in the mammalianendoplasmic reticulum, J.Cell Biol. 139, 1697-1708.
18. Sommer, J. M., Thissen, J. A., Parsons, M. & Wang, C. C. (1990)Characterization of an in vitro assay for import of 3-phosphoglycerate kinase intothe glycosomes of Trypanosoma brucei, Mol Cell Biol. 10, 4545-54.
19. Lorenz, P., Maier, A. G., Baumgart, E., Erdmann, R. & Clayton, C. (1998)Elongation and clustering of glycosomes in Trypanosoma brucei overexpressingthe glycosomal Pex11p, Embo J. 17, 3542-55.
20. Armah, D. A. & Mensa-Wilmot, K. (1999) S-Myristoylation of a GPI-Phospholipase C in Trypanosoma brucei, J Biol Chem. 274, 5931-5939.
21. Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W. & Prasher, D. C. (1994)Green fluorescent protein as a marker for gene expression, Science. 263, 802-5.
22. Hammond, D. J., Aman, R. A. & Wang, C. C. (1985) The role ofcompartmentation and glycerol kinase in the synthesis of ATP within theglycosome of Trypanosoma brucei, J Biol Chem. 260, 15646-54.
23. Aman, R. A. & Wang, C. C. (1986) An improved purification of glycosomesfrom the procyclic trypomastigotes of Trypanosoma brucei, Mol BiochemParasitol. 21, 211-20.
87
24. Opperdoes, F. R. & Borst, P. (1977) Localization of nine glycolytic enzymesin a microbody-like organelle in Trypanosoma brucei: the glycosome, FEBS Lett.80, 360-4.
25. Sanders, S. L., Whitfield, K. M., Vogel, J. P., Rose, M. D. & Schekman, R.W. (1992 Apr 17) Sec61p and BiP directly facilitate polypeptide translocation intothe ER., Cell. 69, 353-65.
26. Bangs, J. D., Uyetake, L., Brickman, M. J., Balber, A. E. & Boothroyd, J. C.(1993) Molecular cloning and cellular localization of a BiP homologue inTrypanosoma brucei. Divergent ER retention signals in a lower eukaryote, J.CellSci. 105, 1101-1113.
27. Kelley, R. J., Alexander, D. L., Cowan, C., Balber, A. E. & Bangs, J. D.(1999) Molecular cloning of p67, a lysosomal membrane glycoprotein fromTrypanosoma brucei, Mol Biochem Parasitol. 98, 17-28.
28. Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., Walter, P. (2002)Molecular Biology of the Cell, 4th edn, Garland Science.
29. Morris, J. C., Ping-Sheng, L., Zhai, H.-X., Shen, T. Y. & Mensa-Wilmot, K.(1996) Phosphatidylinositol Phospholipase C is Activated Allosterically By TheAminoglycoside G418. 2-Deoxy-2-Fluoro-Scyllo-Inositol-1-O-Dodecylphosphonate and its Analogs Inhibit Glycosyl PhosphatidylinositolPhospholipase C, J.Biol.Chem. 271, 15468-15477.
30. McGuffin, L. J., Bryson, K. & Jones, D. T. (2000) The PSIPRED proteinstructure prediction server, Bioinformatics. 16, 404-5.
31. Schiffer, M. & Edmundson, A. B. (1967) Use of helical wheels to representthe structures of proteins and to identify segments with helical potential., BiophysJ. 7, 121-35.
32. Zhou, H. & Lutkenhaus, J. (2003) Membrane binding by MinD involvesinsertion of hydrophobic residues within the C-terminal amphipathic helix into thebilayer, J Bacteriol. 185, 4326-35.
33. Picot, D., Loll, P. J. & Garavito, M. (1994) The X-ray crystal structure of themembrane protein prostaglandin H2 synthase-1, Nature. 367, 243-249.
34. Spencer, A. G., Thuresson, E., Otto, J. C., Song, I., Smith, T., DeWitt, D. L.,Garavito, R. M. & Smith, W. L. (1999) The membrane binding domains ofprostaglandin endoperoxide H synthases 1 and 2. Peptide mapping andmutational analysis, J Biol Chem. 274, 32936-42.
35. Essen, L. O., Perisic, O., Cheung, R., Katan, M. & Williams, R. L. (1996)Crystal structure of a mammalian phosphoinositide-specific phospholipase Cdelta, Nature. 380, 595-602.
88
36. Ochatt, C. M., Butikofer, P., Navarro, M., Wirtz, E., Boschung, M., Armah, D.& Cross, G. A. (1999) Conditional expression of glycosylphosphatidylinositolphospholipase C in Trypanosoma brucei, Mol Biochem Parasitol. 103, 35-48.
37. Guerra-Giraldez, C., Quijada, L. & Clayton, C. E. (2002) Compartmentationof enzymes in a microbody, the glycosome, is essential in Trypanosoma brucei, JCell Sci. 115, 2651-8.
38. Purdue, P. E. & Lazarow, P. B. (2001) Peroxisome biogenesis, Annu RevCell Dev Biol. 17, 701-52.
39. Lumb, M. J., Purdue, P. E. & Danpure, C. J. (1994) Molecular evolution ofalanine/glyoxylate aminotransferase 1 intracellular targeting. Analysis of thefeline gene, Eur J Biochem. 221, 53-62.
89
CHAPTER III
DISCUSSION
Trypanosoma brucei is a protozoan parasite that causes African sleeping
sickness in humans. It is covered with a surface coat that consists of variant
surface glycoprotein (VSG) [1, 2]. This coat plays an important role in the
parasite’s ability to evade a host’s immune response through “antigenic variation”
[3]. The VSG protein is anchored to the extracellular surface of the plasma
membrane by a glycosyl phosphatidylinositol (GPI) anchor [1].
The trypanosome also express GPI-specific phospholipase C (GPI-PLCp)
that is highly specific for GPIs [4, 5]. GPI-PLCp is an integral membrane protein
however, how the protein binds membranes, and where it binds in vivo, is
unknown. Under normal conditions GPI-PLCp does not cleave GPI-anchored
proteins or intermediates [6]; therefore, the parasite remains viable in its host.
The enzyme is a virulence factor. It influences parasitemia in mice [7] and
may also regulate endocytosis (S. Subramanya, unpublished). It is because of
this that we wished to further characterize this enzyme in T. brucei. In an effort
to understand the function of GPI-PLCp in vivo, it was necessary to determine
how the enzyme binds to membranes and where it localizes in the cell.
In this work we found one region of GPI-PLCp that is sufficient in targeting
a soluble reporter polypeptide (GFP) to T. brucei microsomes. This region is
between amino acids 60-120. Kyte-Doolittle analysis of this region identified a
90
hydrophobic patch in residues 60-74. Further analysis predicts that these
residues may form an amphipathic a-helix. We propose GPI-PLCp binds
membranes by at least one amphipathic a-helix in residues 60-74.
In addition, we also found that GPI-PLCp cosedimented with aldolase on a
sucrose gradient. This, along with immunofluorescence experiments (Z. Zheng,
unpublished) suggests that GPI-PLCp localizes to glycosomes in vivo.
Endogenous GPI-PLCp associated with glycosomes is resistant to protease
digestion. Only after the addition of detergent is GPI-PLCp susceptiable to
digestion. Therefore, we propose that GPI-PLCp is imported into glycosomes
and resides in the lumen of the organelle.
GPI-PLCp does not contain any sequence homologous to known
peroxisomal targeting sequences (PTS). How GPI-PLCp is targeted to
glycosomes and imported is of interest. We believe the enzyme may contain a
novel PTS that has yet to be discovered or it may bind to another protein that
contains a PTS and “piggy-backs” its way into glycosomes.
In conlusion, GPI-PLCp is an integral membrane protein. It binds
membranes by at least one amphipathic a-helix. We believe that association of
GPI-PLCp with membranes is non-specific. GPI-PLCp is synthesized in the
cytosol and immediately after synthesis, could potentially bind to surrounding
membranes. However, GPI-PLCp localizes to glycosomes in vivo. Thus, binding
may be regulated in some way. We hypothisize, that after synthesis, GPI-PLCp
immediately associates with cytosolic factors that target the enzyme to
glycosomes, thereby sequestering non-specific binding. Only after GPI-PLCp
91
enters the glycosome and dissociates from the receptor protein, is it able to bind
membranes, specifically glycosomal membranes.
Further experimentation could be done to characterize the different stages
of our model in an effort to better understand the mechanisms by which GPI-
PLCp is imported into glycosomes. Also, immunofluorescene studies using the
truncated fusion constructs may be done to elucidate which region of GPI-PLCp
contains a glycosome targeting sequence. Furthermore, mutational anaylsis of
this region could be perfomed to identify the specific sequence of the targeting
signal.
92
REFERENCES
1. Ferguson, M. A. J., Haldar, K. & Cross, G. A. M. (1985) Trypanosoma bruceivariant surface glycoprotein has a sn-1,2-dimyristyl glycerol membrane anchor atits COOH terminus, J.Biol.Chem. 260, 4963-4968.
2. Mensa-Wilmot, K., Morris, J. C., Al-Qahtani, A. & Englund, P. T. (1995)Purification and use of recombinant glycosylphosphatidylinositol phospholipaseC, Methods Enzymol. 250, 641-655.
3. Turner, C. M. (1999) Antigenic variation in Trypanosoma brucei infections: anholistic view., J Cell Sci. 112, 3187-3192.
4. Bulow, R. & Overath, P. (1986) Purification and characterization of themembrane-form variant surface glycoprotein hydrolase of Trypanosoma brucei, JBiol Chem. 261, 11918-23.
5. Hereld, D., Krakow, J. L., Bangs, J. D., Hart, G. W. & Englund, P. T. (1986) Aphospholipase C from Trypanosoma brucei which selectively cleaves theglycolipid on the variant surface glycoprotein, J.Biol.Chem. 261, 13813-13819.
6. Black, S. J., Hewett, R. S. & Sendashonga, C. N. (1982) Trypanosoma bruceivariable surface antigen is released by degenerating parasites but not by activelydividing parasites, Parasite.Immunol. 4, 233-244.
7. Webb, H., Carnall, N., Vanhamme, L., Rolin, S., Van den Abbeele, J.,Welburn, S., Pays, E. & Carrington, M. (1997) The GPI-phospholipase C ofTrypanosoma brucei is nonessential but influences parasitemia in mice, J.CellBiol. 139, 103-114.