http://www.diva-portal.org
This is the published version of a paper published in ISRN Inflammation.
Citation for the original published paper (version of record):
Song, Y., Stål, P., Yu, J., Forsgren, S. (2013)
Marked effects of tachykinin in myositis both in the experimental side and contralaterally:
studies on NK-1 receptor expressions in an animal model.
ISRN Inflammation, 2013(907821)
N.B. When citing this work, cite the original published paper.
Permanent link to this version: http://urn.kb.se/resolve?urn=urn:nbn:se:umu:diva-68846
Hindawi Publishing Corporation ISRN In!ammation Volume "#$%, Article ID &#'("$, $& pages http://dx.doi.org/$#.$$))/"#$%/&#'("$
Research Article Marked Effects of Tachykinin in Myositis Both in the Experimental Side and Contralaterally: Studies on NK-1 Receptor Expressions in an Animal Model
Yafeng Song,1 Per S. Stål,1 Jiguo Yu,2 and Sture Forsgren1
! Section for Anatomy, Department of Integrative Medical Biology, Umea University, "#! $% Umea, Sweden & Sports Medicine Unit, Department of Surgical and Perioperative Sciences, Umea University, "#! $% Umea, Sweden
Correspondence should be addressed to Sture Forsgren; sture.forsgren@anatomy.umu.se
Received "( November "#$"; Accepted $( December "#$"
Academic Editors: L. Dagna, P. Gascon, and D. Szukiewicz
Copyright © "#$% Yafeng Song et al. *is is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Muscle injury and in!ammation (myositis) in a rabbit model of an unilateral muscle overuse were examined. It is unknown if the tachykinin system has a functional role in this situation. In this study, therefore, the neurokinin-$ receptor (NK-$R) expression patterns were evaluated. White blood cells, nerve fascicles, +ne nerve +bers, and blood vessel walls in myositis areas showed NK- $R immunoreaction. NK-$R mRNA reactions were observable for white blood cells and blood vessel walls of these areas. NK-$R immunoreaction and NK-$R mRNA reactions were also seen for muscle +bers showing degenerative and regenerative features. *ere were almost no NK-$R immunoreactions in normal muscle tissue. Interestingly, marked NK-$R expressions were seen for myositis areas of both the experimental side and the contralateral nonexperimental side. EIA analyses showed that the concentration of substance P in the muscle tissue was clearly increased bilaterally at the experimental end stage, as compared to the situation for normal muscle tissue. *ese observations show that the tachykinin system is very much involved in the processes that occur in muscle injury/myositis. *e e,ects can be related to proin!ammatory e,ects and/or tissue repair. *e fact that there are also marked NK-$R expressions contralaterally indicate that the tachykinin system has crossover e,ects.
1. Introduction
*e tachykinins conform to a group of neuropeptides with marked functional roles. *e neuropeptide which is most well known in the group is substance P (SP). SP has pro- nounced pro-in!ammatory e,ects, including the promotion of extravasation and accumulation of leukocytes at sites of injury [$]. SP is also involved in the so-called neurogenic in!ammation ["], wound healing [%], and angiogenesis [-]. SP is on the whole known to have autocrine/paracrine e,ects [)]. SP has a high a.nity for the neurokinin-$ receptor (NK- $R), having its major functions via this receptor [/].*e NK- $R has -#' amino acids and belongs to the G-protein-coupled group of receptors ['].*e NK-$R can play an important role in the modulation of the accumulation of white blood cells that occurs in in!ammatory processes [(].
*ere is frequently an upregulation of tachykinins in situ- ations with in!ammation and tissue injury.*at includes the
situation in, for example, ulcerative colitis [&] and experimen- tally induced acute pancreatitis and associated lung injury [$#]. In the latter situation, the NK-$R is considered to play a key role in the damaging process [$$]. It is actually a fact that the upregulation of tachykinins that occurs in in!ammation in general is associated with increases in NK-$R expression [$", $%].
We have in recent experimental studies been using a rabbit model of a marked overuse a,ecting the triceps surae muscle and found that the overuse led to muscle in!amma- tion (myositis) and muscle tissue derangements [$-]. *is model can be considered to be a suitable animal myositis model [$-–$/].*ere is a great lack of information concerning the involvement of tachykinins in situations with myositis and muscle injury. Tachykinins might possibly be involved in the processes that occur. Interestingly, in our studies using the overuse muscle model, it was observed that myositis and muscle tissue derangements not only occurred for the triceps
" ISRN In!ammation
surae muscle in the experimental side but also for this muscle in the nonexercised, contralateral side [$-].*is observation of an a,ection not only for the experimental side but also for the non-experimental contralateral side is completely new information concerning experimentally induced muscle injury/myositis. How the situation is for tachykinins in this respect is therefore also unknown. *e information that so far exists concerning tachykinins andmuscle in!ammation is related to the patterns of SP immunoreactions observed at the spinal cord level and for the neurons innervating the muscles [$'–$&].
*ere is no information at all on the expression of the NK-$R in the situationwithmyositis/markedmuscle changes. Our recent observations described above for the overuse rabbit model thus reinforced us to investigate the NK-$R pat- terns during myositis development. Immunohistochemistry and in situ hybridization were used. Comparisons between tachykinin (SP) and NK-$R expression patterns were also made.*e above described experimental model was used, as it has been observed to be suitable in establishing myositis. *e triceps surae muscle on both the experimental and non- experimental, contralateral sides were evaluated.
*e main aim of the study was to examine for the impor- tance of the tachykinin system in the myositis process. *e hypothesis was that NK-$R would be highly expressed in the a,ected areas with myositis. A further aim was to evaluate if there were upregulations of the NK-$R expressions not only in the experimental side but also in the contralateral non- experimental side.
2. Material and Methods
&.!. Animals. Female New Zealand white rabbits with a weight of approximately - kg (age ranging from / to & months) were used for the experiment. In total, samples from "- animals were evaluated. Six of the animals belonged to a reference group (controls). Eighteen animals corresponded to animals that were subjected to an exercise protocol leading to a marked overuse of the triceps surae muscle. *ey underwent the experimental exercise procedure on their right leg every second day, for a total period of $, %, and / weeks, respectively, (see further below).
&.&. Exercise Procedure. To induce muscle overuse, a lab- oratory model (a “kicking machine”) leading to marked overuse of the triceps surae muscle was used. Repetitive passive !exion and extension of the right ankle was achieved by means of a pneumatic piston and a band was placed around the hip/pelvis to restrict movements on the le0 side. During the plantar !exion phase, an active contraction was furthermore induced by electrical stimulation via surface electrodes (Pediatric electrodes -# -"/A, Hewlett Packard, Andover, MA, USA) placed " cm apart over the triceps surae on the right side.*e stimulation was synchronized with the plantar !exion movement of the piston by a microswitch, which trigged the stimulator unit (Disa stimulator Type $-E, Disa Elektronik A/S, Herlev, Denmark). A single impulse of #."ms duration was delivered ()ms a0er the initiation of the plantar !exion at an amplitude of %)–)#V. *e stimulation
intensity, which was tested out before the experiment, was submaximal and the intensity was individually corrected to obtain powerful muscle contractions. *e movement frequency was $)# movements per minute. *e le0 leg was not attached to the kicking machine. *is exercise session lasted for " hours and was repeated every second day for $, %, or / weeks. *e frequency and duration of repetitive movements were chosen in order to make a very marked strain on the muscles.*e experimental procedures conform to those previously described [$-, $), "#] and do, with some amendments being made, conform to those described in studies by Backman and collaborators ["$].
All animals were anaesthetized during the exercise pro- cedure, by means of an intramuscular injection of fen- tanyl!uanison (#."-#.%mL/kg) and diazepam (#."mL/kg; )mg/mL), followed by additional injections of fentanyl!u- anison (#.$mL/kg) every %#–-)min during the experimental procedure in order to maintain anesthesia. For analgesia, buprenorphine, #.#$–#.#)mg/kg, was given s.c. postopera- tively a0er each experiment session.
&.'. Collection, Freezing, and Sectioning of Muscle Samples. On the day a0er the last exercise, the rabbits were sacri+ced by an intraperitoneal injection of an overdose of Pentobar- bital natrium and the triceps surae with attached Achilles tendon was dissected out. *e muscle samples were directly transported on ice to the laboratory. Further dissection was made, whereby samples conforming to the distal parts of the soleus and gastrocnemius muscles () ! (–$#mm) were further processed. *ese samples were +xed by immersion overnight at -C in an ice-cold solution of -% formaldehyde in #.$M phosphate bu,er (pH '.#). *ey were therea0er thoroughly washed in Tyrode’s solution containing $#% sucrose at -C overnight.*e samples were mounted on thin cardboard in OCT embedding medium (Miles Laboratories, Naperville, IL, USA), frozen in propane chilled with liquid nitrogen, and stored at "(#C. Series of '-(#m thin sections were cut using a cryostat. *e sections were mounted on slides precoated with chrome-alum gelatine and were then processed for immunohistochemistry or morphology. Other series were sectioned for the purpose of being used for in situ hybridization. Additional samples were processed without being chemically +xed. *ese were directly mounted and frozen in the way described above and were sectioned and processed for the demonstration of tissue morphology.
&.(. Staining for the Demonstration of Morphology (Haema- toxylin-Eosin). Sections in the series were stained in Harris Haematoxylin solution for "min. *ey were then rinsed in distilled water, dipped in #.$% acetic acid for a few seconds, followed by washing in running water. Counterstaining was achieved by immersion in eosin for $min.*e sections were dehydrated in ethanol and mounted in Permount.
&.). Immunohistochemistry
&.).!. Staining Procedures for the Demonstration of NK-!R. A0er washing with PBS )min ! %, incubation for "#min in a $% solution of Triton X-$## (Kebo lab, Stockholm,
ISRN In!ammation %
Sweden) in #.#$M phosphate bu,er saline (PBS), pH '.", containing #,$%sodiumazide as preservative, was performed, wherea0er followed rinsing in PBS three times, )min each time.*e sections were then incubated in )% normal donkey serum (code no: #$'-###-$"$, Jackson Immune Research Lab. Inc.) in PBS and were therea0er incubated with the NK- $R primary antibody, diluted in PBS (pH '.-), in a humid environment. Incubation was performed for /#min at %'C. A0er incubation with speci+c antiserum and three )-minute washes in PBS, another incubation in normal donkey serum followed, a0er which the sections were incubated with FITC- conjugated A.niPure donkey anti-goat IgG ('#)-#&)-$-'; Jackson ImmunoResearch Lab Inc, dilution $ : $##) for %#min at %'. *e sections were therea0er washed in PBS and then mounted in Vectashield Mounting Medium (H-$###) (Vector Laboratories, Burlingame, CA, USA). Examination was carried out in a Zeiss Axioscope " plus microscope equipped with an Olympus DP'# digital camera.
As an alternative procedure, sections were initially pre- treated with acid potassium permanganate for "min, a pro- cedure found to enhance speci+c immuno!uorescence reac- tions [""]. A0er this pretreatment, the procedures described above followed. Both procedures (with or without acid potassium treatment) gave in principle similar results.*ere were, however, some di,erences in staining intensities and levels of background reactions. It was therefore found useful to analyse sections by using both procedures.
&.).&. Double-Staining NK-!R Antibody/Tachykinin (SP) Anti- body. *e initial procedures conformed to the procedures described above concerning the staining for the NK-$R anti- body. *at included the use of FITC-conjugated A.niPure donkey anti-goat IgG ('#)-#&)-$-'). *e sections were then rinsed in PBS -! ".)min and incubated in )%normal donkey serum in PBS for $)min. *e sections were therea0er incu- bated with a monoclonal tachykinin (SP) antibody ((-)#- #)#), Biogenesis, Poole, UK), diluted $ : )# in PBS with BSA, for /#min at %'C. A0er incubation with this antiserum and - ! ".)-minute washes in PBS, a new incubation in normal donkey serum followed, a0er which the sections were incubated in TRITC-conjugated A.niPure donkey anti-rat lgG ('$"-#")-$)#) (Jackson ImmunoResearch, West Grove, PA, USA), diluted $ : -# in PBS supplemented with #.$% BSA, for %#min at %'C. *e procedures for washing and mounting were as described above. *e reactions obtained with the tachykinin antibody are further on referred to as SP immunoreactive.
&.).'. Double-Staining NK-!R Antibody/Mouse Monoclonals. *e initial procedures conformed also in this case to the procedures described above concerning the staining for the NK-$R antibody. *at included the use of FITC-conjugated A.niPure donkey anti-goat IgG ('#)-#&)-$-') and rinsing in PBS - ! ".)min, and as normal serum, )% normal donkey serum in PBS was used. A0er the procedures for NK-$R immunolabelling were +nished, the sections were rinsed in PBS - ! ".)min and incubated in )% normal rabbit serum in PBS with BSA for $)min. A0er that, the sections were incu- bated with the other primary antibody to be stained for (all
of which were mouse monoclonal antibodies) and which was against white blood cell markers, betaIII-tubulin, S-$##beta, or desmin (see further below), and diluted in PBS with BSA, in a humid environment. Incubation was performed for /#min at %'C. A0er incubation with this antiserum and - ! ".)-minute washes in PBS, a new incubation in normal rabbit serum followed, a0er which the sections were incubated in rabbit anti-mouse immunoglobulins/TRITC (R#"'/) (Dako, Denmark). As an alternative procedure, normal donkey serum was used instead of rabbit normal serum, and in these cases, donkey anti-mouse immunoglobulins/TRITC ('$)-"&)-$)#) (Jackson ImmunoResearch)were utilized. Both variants gave similar and reliable results. *e secondary antibody was used at a dilution of $ : -# (R#"'/) or $ : )## ('$)-"&)-$)#); the incubation with secondary antiserum in both cases proceeded for %#min at %'C. *e sections were therea0er washed in PBS for - ! ".)min and were then mounted in Vectashield Mounting Medium (H-$###) or Mounting Medium with DAPI (H-$)##) (Vector Laborato- ries, Burlingame, CA, USA) in order to identify nuclei.
&.).(. Antibodies. AnNK-$R antibody produced in goats was used (sc-)""#, Santa Cruz). It is an a.nity puri+ed polyclonal antibody raised against a peptide mapping within an internal region of NK-$R of human origin. It was regularly used at a dilution of $ : )#–$ : $## in #.$% in PBS. *e tachykinin antibody used in double stainings was an SP monoclonal antibody produced in rats ((-)#–#)#), Biogenesis, Poole, UK). It was used at a dilution of $ : )# in #.$%BSA in PBS.*e antibody (-)#–#)#) recognizes the COOH terminal end of SP and has been previously used for the immunohistochem- ical detection of SP in experimental animals and man ["%].
*e other antibodies used in double stainings were mouse monoclonal antibodies. One of these conformed to an antibody against CD/(, (code no: M#($-), fromDAKOC- ytomation (Glostrup, Denmark), whichwas used at a dilution of $ : $## in #.$% BSA in PBS.*e antigen for this antibody is a glycosylated transmembrane glycoprotein, which is mainly located in lysosomes. Another one was an anti-rabbit T- cell/neutrophil antibody from AbD Serotec (Oxford, UK) (MCA(#)G), which was utilized at a dilution of $ : $## in #.$% BSA in PBS. *is antibody is an a.nity puri+ed antibody against a cell surface antigen, which is reported to be expressed by a subset of T cells, thymocytes, neutrophils, and platelets. A third antibody used was the antibody MAB$#(' from Chemicon (Temecula, CA, USA), which reacts with human eosinophil peroxidase. *is antibody was used at a dilution of $ : $## in #.$% BSA in PBS. Furthermore, an antibody against betaIII-tubulin (T(//#, Sima Aldrich, USA, $ : $##) was used, being utilized at a dilution of $ : )##. *e antibody speci+cially recognizes an epitope located on isotype III of beta-tubulin. An antibody against S-$## (beta- subunit) was also utilized (S ")%") (Sigma, New York, NY, USA). It was used at a dilution of $ : )##. *e antibody recognizes an epitope located on the beta-chain, but not the alpha-chain, of S-$##. An antibody against desmin was used as well (M#'/#). It was used at a dilution of $ : $##. It is by the supplier (DAKOCytomation, Glostrup, Denmark) reported to give speci+c reactivity with desmin in a wide
- ISRN In!ammation
variety of tissues as seen via Western blotting experiments. It is furthermore reported not to show reactivity with other types of intermediate +laments ["-]. Further descriptions of the antibodies are described elsewhere [$/, "), "/].
&.).). Control Stainings. Control stainings concerning the NK-$R antibody included the use of NK-$R blocking sub- stance (sc-)""#P) ()##g/mL antiserum). Ordinary stainings for NK-$Rweremade in parallel. Concerning controls for the SP antibody, blockingwith SP peptide (full length SP peptide) from Sigma (S/((%) ()##g/mL antiserum) was used. Other control stainings conformed to stainings when the primary antibodieswere excluded (bu,er instead of the antibody).*e characteristics of antibodies used have also been evaluated in previous studies ["%–")].
&.*. In Situ Hybridization (ISH). In order to complement the results obtained at the protein level (via immunohistochem- istry), stainings to show the situation at the mRNA level (via in situ hybridization) were performed. Digoxigenin- (DIG-) hyperlabelled oligonucleotide triple probe cocktail (ssDNA) for the detection of the NK-$R, also known as tachykinin receptor $ (TACR$) (Gene Detect, New Zealand), was thus used. A “triple probe cocktail” was prepared as the exact rabbit TACR$ sequence is not yet cloned. *is contained three antisense probes directed towards both human and rat TACR$ mRNA, which is considered to have a very high probability of detecting rabbit TACR$ mRNA. *e antisense probe sequences were
- probe 1$: GGCTGCACGAACTGGTTAGACTCAG- AGGTGTTGGTGGAGATGTTGGGG,
- probe 1": TGGAGCTTTCTGTCATGGTCTTGGA- GTTGCTGCGAGAGGAGCCGTTGG,
- probe 1%: TGACCACCTTGCGCTTGGCAGAGA- CTTGCTCGTGGTAGCGGTCAGAGG.
As a negative control, a “triple probe cocktail” of the cor- responding sense DIG-hyperlabelled ssDNA probes was used. Also $-actin antisense/sense probes (GD)###-OP) (GeneDetect, New Zealand) were used for control purposes.
Based on the features noted concerning tissue morphol- ogy (myositis a,ection) and NK-$R immunohistochemical reaction patterns, certain samples were chosen for the in situ hybridization. *ese corresponded to $ sample from the control nonexercised group, $ sample from the $-week group (exercised side), and " samples from the /-week group (one from nonexercised side and one from exercised side). Two of the samples were from the soleus muscle and two were from the gastrocnemius muscle. It was considered that the samples used were representative samples.
ISH was performed according to an established pro- tocol ["'] using an alkaline-phosphatase- (AP-) labelled anti-DIG antibody for detection, with a few modi+cations ["(, "&]. *e cryostat knife was washed in '#% EtOH in diethyl pyrocarbonate [DEPC]–H"O and the sections were mounted on Super Frost Plus slides (nr. #-$%##, Menzel- Glaser, Braunschweig, Germany). Concerning the further
procedures, see ["(, "&]. In brief, an aliquot ()# ng) of the ssDNA probe was added to $)#L of hybridisation solution in a $.)mL microfuge tube, denatured for )min in (#C and then put on ice. *e hybridisation solution was as follows: )###L formamide, "## #L "#x SSC, )# #L of "#x Denhardt’s solution, )##L herring sperm DNA [$#mg/mL] heat denatured, ") #L baker’s yeast RNA [$#mg/mL], $') #L dextran sulphate [)#%], and total volume was: $.#mL. *e probe-containing hybridisation solution was then applied to each section, the sections being covered with cover slips and sealed with nail polish. Incubation followed at )/C overnight.
&.%. EIAMethod. In order to complement theNK-$R reaction studies, EIA analysis of SP content for the muscle specimens was made. For this purpose, muscle samples were frozen in liquid nitrogen directly a0er being weighed, wherea0er they were homogenized, by the use of Precellys "- tissue homoge- nizer (Bertin Technologies, SaintQuentin enYvelines, Cedex, France), and further processed for EIA using commercially available enzyme immunoassay SP kit (Phoenix Pharma- ceuticals, Burlingame, CA, USA). For further details of the procedures, see [%#]. Analysis was restricted to the analysis of control muscles and muscles of /-week groups. *e assay was conducted in accordance with the instructions from the manufacturer. An SP EIA analysis evaluating all the various groups will be conducted and described in a forthcoming study.
&.$. Statistics. Independent T-tests were done concerning evaluations of di,erences in SP concentration between con- trols and /w groups. *e statistical so0ware SPSS PASW Statistics $( (SPSS Inc, Chicago, USA) was used. A %-value< #.#) was considered to be signi+cant.
&.". Ethics. *e study protocol was approved by the local eth- ical committee at Umea University (A %-/#'). *e approval was obtained before the start of the study. A licensed breeder had bred all animals for the sole purpose of being used in animal experiments. All e,orts were made to minimize animal su,ering.
3. Results
'.!. Morphology. *e specimens of the soleus and gastroc- nemius muscles showed marked morphological changes in response to the experimental procedure. *e changes were especially pronounced a0er the /-week experiment period (Figure $). However, morphological alterations were also to some extent seen in the $-week and %-week groups. *e morphological changes included an occurrence of marked in!ammatory in+ltrates, a pronounced variability in muscle +ber size, and occurrence of marked muscle +ber alter- ations (morphologically “abnormalmuscle +bers”) (Figure $). Numerous white blood cells could be seen to be dispersed in the tissue (Figures $(b) and $(c)).*e morphological changes were seen in certain parts of the specimens. In other areas of the specimens, the morphology was seemingly una,ected.
ISRN In!ammation )
Importantly, morphological changes occurred to an almost similar extent in the muscles in the contralateral nonexercised side as in the muscles in the exercised side (Figures $(b) and $(c)). *e pattern for the morphological changes was the same for the soleus and the gastrocnemius muscles, but the extent of the changes was somewhat more pronounced for the soleus muscle. *e +ndings concerning the morphology are in accordance with previous +ndings for the triceps surae muscle in response to the experimental regimen here used [$-].
'.&. Immunohistochemistry
'.&.!. Reactions in the InvadingWhite BloodCells. Immunore- actions for NK-$R occurred in cells that were dispersed in the in!ammatory in+ltrates (Figure ").*at was the situation for both the exercised (Figures "(a)–"(c)) and nonexercised (Figure "(d)) sides and for both muscles. *e reactions frequently showed a granular/punctuate appearance. Double stainings showed that parts of the NK-$R immunoreac- tive cells were also SP immunoreactive, whilst others did not show SP immunoreaction (Figures "(e) and "(f)). *e NK-$R immunoreactions were abolished in sections pro- cessed with NK-$R antiserum that had been preabsorbed with NK-$R antigen (Figures "(g) and "(h)). *e NK-$R immunoreactive cells were found to correspond to CD/( immunoreactive cells, that is, macrophages (Figures %(a) and %(b)), or eosinophils (Figure %(c)). *ere were no NK-$R immunoreactions in cells showing reactions for the antibody that was a T-cell/neutrophil marker.
'.&.&. Reactions in Muscle Fibers Showing In+ltration of White Blood Cells. White blood cells were not only seen to be dispersed in the tissue, but could also be seen to be coalesced into muscle +bers (morphologically “abnormal muscle +bers”) (c.f. above) in the myositis areas (Figure $(a)). *e stainings for NK-$R showed that there were frequently NK-$R immunoreactions in the cells that had invaded the muscle +bers (Figures -(a)–-(d)). *at was the situation for exercised as well as nonexercised sides and for soleus as well as gastrocnemiusmuscles. As was the case for thewhite blood cells that were dispersed in the tissue, white blood cells within the muscle +bers were also immunolabelled for eosinophil marker or CD/(. Double-staining NK-$R/SP showed that SP immunoreactions were frequently detected in the NK-$R immunoreactive cells within the muscle +bers (Figures -(d) and -(e)).*e characteristics of these abnormal muscle +bers are further clari+ed below.
'.&.'. Reactions inNerve Structures. Nerve fascicles of various dimensionswere seen in specimens of bothmuscles. Based on the morphologic appearance, a large number of these were entirely composed of myelinated nerve +bers. Immunohis- tochemical analysis revealed that NK-$R immunoreactions were never observed within nerve fascicles being entirely built up by myelinated nerve +bers (Figure )(a)).
# !
(c)
F23456 $: Sections of the soleus muscle of the /-week group, exercised side (a, b) and nonexercised side (c), stained with H&E. Morphological features are shown.*ere is an excess of connective tissue (asterisk) and presence of adipose tissue to the le0 in (a).*ere are pronounced in!ammatory cell in+ltrates in (b, c) (asterisks). *ere is an overall marked variability in muscle +ber sizes (b, c). In the inset in (a), a +ber that is invaded by numerous in!ammatory cells is seen. *e appearance to the right in (a) is to some extent resembling the situation for normal muscle. (1) indicates adipose tissue. Bar = )# #m.
experimental animals were nonimmunoreactive for NK-$R (Figures )(a) and )(b)). Occasional immunoreactive nerve +bers with a varicose appearance were, however, noted close to these nonimmunoreactive nerve fascicles (Figure )(b)). Such nerve +bers could also be observed in association with blood vessels in connective tissue spaces.
Marked immunoreactions for NK-$R were, on the other hand, noted in nerve fascicles of large/considerable sizes that were located in myositis areas and in the close proximities of these areas for both muscles and for both exercised and nonexercised sides. *e reactions were point-like but were frequently coalesced. Due to the occurrence of marked reaction intensities for these, broad areas were partly seen to exhibit !uorescence (Figures )(c)–)(e)). *ese types of
/ ISRN In!ammation
(a) (b)
(c) (d)
! (h)
F23456 ": Immunoreaction patterns for cells in in!ammatory in+ltrates are shown. Sections are from gastrocnemius muscle specimens, $- week group ((a), (b), and (e)–(h)), /-week group (c), exercised sides, and soleus muscle specimen of the /-week group, nonexercised side (d). In (a)–(d), the presence of cellular NK-$R immunoreactions is seen (arrows). *e reactions show frequently a granular appearance. Double staining for SP (e) and NK-$R (f) show that there is partly colocalization (arrows), partly not colocalization (arrowheads). Ordinary staining for NK-$R shows the presence of marked immunoreactions in cells (g) (arrows) (low magni+cation), whereas there are no speci+c immunoreactions in a parallel section processed for NK-$R a0er preabsorption with NK-$R antigen (h). *e immunoreactive cells seen in (g) are scattered in the connective tissue and coalesced into a muscle +bre (asterisk (g), c.f. (h)). Arrows in (h) point at nonimmunoreactive cells. Bars = ")#m.
immunoreactions were especially seen in the /-week groups (Figures )(c)–)(e)) but could also be seen in myositis areas of the $- and %-week groups. Such immunoreactions for nerve fascicles were never seen in areas of muscles from experimental animals showing normalmorphology andwere never seen in the specimens of the control nonexperimental animals (c.f. above). Double stainings revealed that theseNK- $R immunoreactions frequently, but not always, were associ- ated with comparatively marked S$##beta immunoreactions (Figure /).
*e nuclei of the nerve fascicles in which the NK-$R immunoreactions described above were noted and which thus were located in myositis areas showed, when DAPI was used in embedding medium and when S$##beta immuno- labelling was performed, another colour reaction than the nuclei located outside the nerve fascicles (Figures /(c) and /(f)). *e former nuclei showed a pink colour reaction, whilst the latter exhibited a bluish reaction; that is, a colour that is characteristic of the DAPI reaction. *e nuclei of nerve fascicles located in normally appearing
muscle tissue mainly showed the characteristic bluish DAPI reaction.
Via parallel double stainings for betaIII-tubulin/NK- $R and S$##beta/NK-$R and via comparisons with parallel stainings made for white blood cells further information on nerve-related NK-$R reactions was obtained. Strong NK- $R immunoreactions that were not present in large nerve fascicles and that were not in!ammatory cell related were thus seen in myositis areas of both sides and in close prox- imities to these areas (Figures '(a)–'(c)). *ese strong NK- $R immunoreactions were betaIII-tubulin immunoreactive (Figures ((a) and ((b)). It was hereby veri+ed that these corresponded to axonal pro+les. *e NK-$R immunoreac- tions were associated with strong S$##beta immunoreactions (Figures '(f) and '(g)). Parts of the NK-$R immunoreactive axonal pro+les were SP immunoreactive (Figures '(d) and '(e)). *ese axonal NK-$R immunoreactions (Figures ((c) and ((d)), as well as the point-like NK-$R immunoreactions seen in large nerve fascicles (Figures )(e) and )(f)), were abrogated by preabsorption with NK-$R antigen.
ISRN In!ammation '
(a) (b)
M
M
(c)
F23456 %: Results of double stainings for cells of in!ammatory in+ltrates. Sections are from gastrocnemius muscle specimen of the $-week group, exercised side. Double staining for NK-$R (a) and CD/( (b). *ere is colocalization in cells (arrows). Double staining for NK-$R (green) and eosinophil marker (MAB$#(') (reddish) is shown in a single montage (DAPI inmountingmedium) in (c).*ere is colocalization in eosinophils (arrows). M = muscle +bers. Bar = ") #m.
M
(a)
M
(b)
(c) (d) (e)
F23456 -: Sections of soleusmuscle specimens from the /-week group, nonexercised side (a, b) and the $-week group, exercised side (c), and of gastrocnemius muscle specimen from the $ week group, exercised side (d, e). Abnormal muscle +bers, that is, muscle +bers being completely in+ltrated by white blood cells, are shown. Such a +ber is seen in themiddle in (a) (H&E staining).*ere are cellular NK-$R immunoreactions in this +ber (b) (arrows).*ere are also cellular NK-$R immunoreactions in (c) and (d) (arrows indicate immunoreactive cells). (d) and (e) represent double staining for NK-$R (d) and SP (e).*ere is colocalization (arrows). M = ordinary muscle +bers. Bars = ") #m.
( ISRN In!ammation
(a) (b)
(c) (d)!
! (f)
F23456 ): NK-$R immunoreaction patterns in nerve fascicles. Sections of soleus muscle specimens from the control group (a), the $-week group, exercised side (b) and the /-week group, nonexercised side (c) and of gastrocnemius muscle specimens from the /-week group, exercised side (d) and nonexercised side (e, f).*e nerve fascicle shown in (b) was located in a region showing normal muscle morphology whilst those shown in (c)–(e) were localized tomyositis areas. Note that there are noNK-$R immunoreactions in the nerve fascicle in (a).*is fascicle is seemingly entirely composed of myelinated nerve +bers. *ere are also no immunoreactions in the nerve fascicles in (b) (above and below). Just outside these, there are +ne varicose immunoreactive nerve +bers (arrows). On the other hand, there are marked NK-$R immunoreactions in the nerve fascicles shown in (c)–(e) (arrows). *ese show a punctuate appearance, with the reactions to some extent, however, being spread out in broad areas. In (f), a section parallel to the section shown in (e) is seen, and for which the NK-$R antibody had been preabsorbed with NK-$R peptide.*ere are no NK-$R immunoreactions in the nerve fascicle in (f). Asterisks mark corresponding regions in (e) and (f). Bars = ") #m.
ISRN In!ammation &
(a) (b) (c)
(d) (e) (f)
F23456 /: Double staining for NK-$R (a, d) and S$## ($-subunit) (b, e). Merged images including DAPI reactions are shown in (c, f). Large nerve fascicles are seen. Sections are from gastrocnemius muscle specimen of the /-week group, nonexercised side. *ere is NK-$R immunoreaction and to some extent an extra marked S-$##beta immunoreaction in some regions (arrows) (a)–(f). For some regions there is NK-$R immunoreaction but not this type of marked S-$##beta immunoreaction (arrowheads). Note that the nuclei within the nerve fascicles show a pink colour reaction whilst those located outside these show the characteristic blue DAPI reaction in (c, f).*is means that the nuclei located inside the nerve fascicle exhibit the blue DAPI reaction merged with the colour reaction from the S-$##beta staining. Bar = ")#m.
'.&.(. Reactions in Blood Vessel Walls and Fibroblasts. NK- $R immunoreactions were noted for the endothelial layer of some of the blood vessels in myositis areas and areas located in the close proximities of these areas (Figure &).*ey were observable for small and intermediate-sized vessels. Blood vessel-related NK-$R immunoreactions were never seen for the walls of blood vessel walls of controls and those in normally appearing muscle tissue of experimental animals and were in principle not seen for the walls of large arteries of either of the groups. *e reactions were abrogated via NK-$R preabsorption (Figures &(c) and &(d)). NK-$R immunoreactions were also seen for +broblast-like cells located in connective tissue spaces (Figure &(e)).
'.&.). NK-!R in Muscle Fibers in Relation to Desmin Immu- noreaction. In order to further clarify the NK-$R reactions in muscle +bers, double staining for desmin and NK-$R was performed. In muscle +bers that were heavily in+ltrated by white blood cells (c.f. above) and for which NK-$R was
frequently detected in these cells, therewas amarkeddecrease or a lack of desmin immunoreactivity. *e lack of desmin immunoreaction could be seen in parts of the muscle +ber (Figure $#) or in the entire muscle +ber. Muscle +bers with an increased desmin immunoreactionwere also seen (Figure $$). *ese muscle +bers contained more internal nuclei than normally seen (Figure $$). In these +bers, there was also NK- $R immunoreaction, with the immunoreaction in this case being scattered in the form of punctuate reactions (Figure $$).
Both types of muscle +bers described above showingNK- $R immunoreactions and an aberrant desmin immunoreac- tion were observed in myositis areas or in areas that were closely adjacent to these areas. *ey were very occasionally seen in other areas ofmuscle samples of experimental animals and were never seen in muscle samples of control animals. Other muscle +bers in the myositis areas and in normally appearing muscle tissue of experimental animals and all muscle +bers in the specimens of control animals showed the characteristic desmin immunoreaction pattern, that is, a
$# ISRN In!ammation
(a) (b)
M
(f)
M
(g)
F23456 ': Sections stained for the demonstration of NK-$R (a)–(c). In (d, e), double-staining for SP (d) and NK-$R (e) is shown. In (f, g), double staining for NK-$R (f) and S$##beta (g) is shown. Specimens are from gastrocnemius muscle, exercised side, $-week group (a, d, e), gastrocnemius muscle, nonexercised side, /-week group (b, f, g), and soleus muscle, exercised side, /-week group (c). In (a), strong NK-$R immunoreactions are seen in nerve +bers (arrows) and weaker immunoreactions in in!ammatory cells (arrowheads). In (b, c), immunoreactive nerve pro+le reactions are seen (arrows). In (d, e) it is obvious that there is only partial colocalisation between SP- and NK- $R immunoreactions in the nerve +bers (arrows). In (f), coalesced NK-$R immunoreactive pro+les are seen.*ese are related to a markedly S$##beta-immunoreactive cell (arrowhead at nucleus). Note that this nucleus exhibits a pink colour reaction; other nuclei in (g) show the characteristic bluish DAPI reaction. M= muscle +ber (f, g). Bars = ") #m.
striated reaction pattern in longitudinally cut muscle +bers (Figure $$). *ese muscle +bers were NK-$R nonimmunore- active (Figure $$).
'.&.*. Comparisons Exercised versus Nonexercised Musdes Overall Comments. *e pattern andmagnitude of the NK-$R immunoreactions for all the various structures were similar for exercised and nonexercised sides. *e marked NK-$R immunoreactions seen for white blood cells, nerve fascicles, blood vessel walls, and muscle +bers described above were restricted to myositis areas and areas that were very close to these areas. *at was the case for both the soleus and gastrocnemius muscles. *us, the magnitude of the NK-$R immunoreactions was related to the degree of in!ammatory in+ltrates (myositis) within the specimens, which to some extent varied between the di,erent samples in the experimen- tal groups [$-].
'.'. In Situ Hybridization. *e in situ hybridization studies showed that NK-$R mRNA reactions were observable in the same cell structures as were found to be NK-$R immunore- active. *at included +broblast-like cells (Figure $"), cells of blood vessel walls in myositis areas and/or closely adjacent areas (Figures $% and $-), white blood cells in in!ammatory in+ltrates (Figure $)), and muscle +bers showing abnormal morphology, being heavily in+ltrated by cells (Figure $/) or containing frequent internal nuclei. *e NK-$R mRNA reactions in blood vessel walls were not only localized to the endothelial layer but could also be seen for the smoothmuscle part of the walls (Figure $%).*e speci+city of reactions seen for all the various structures was veri+ed via stainings with sense control probe (Figures $"(b), $%(b), $-(b), and $/(c)).
'.(. EIA Results. Analysis of SP concentration was made for muscles of control animals and animals for which the most pronounced myositis was observed, that is, the /-week
ISRN In!ammation $$
(a) (b)
(c)
(d)
F23456 (: Sections from gastrocnemius muscle of $-week exercised group. Double staining for NK-$R and $-Tubulin is shown in (a, b).$-Tubulin immunoreactions ((a), red, arrows) show colocalization with NK-$R immunoreactions ((b), green, arrows). In (b), the DAPI reaction is also seen. Results of preabsorption stainings are shown in (c, d), ordinary staining for NK-$R in (c), and preabsorption staining in (d). *e region in (c) corresponds to that in (d). *ere are axonal NK-$R immunoreactions in (c) (arrows). *ere are no NK-$R immunoreactions in the preabsorption control (d). Bars = ") #m.
groups. It was found that the concentrationwas clearly higher in the /-week groups for both muscles and for both sides. *e mean values were thus $.(% times higher for exercised side and $.'' times higher for nonexercised side, as compared to control muscle, concerning the soleus muscle (% = 0.004 in both cases), and %.-) times (exercised side) and %.#$ times (nonexercised side) higher than themean value in the control
group concerning the gastrocnemius muscle (% < 0.05 in both cases).
4. Discussion
(.!. Summary of Findings. Via evaluations of the NK-$R reaction pattern, the present study indicates that tachykinins are highly involved functionally in the myositis and muscle a,ection process in our rabbit model of muscle overuse. An upregulation of the expression of NK-$R was observed in both the exercised as well as the nonexercised sides. NK- $R immunoreactions and NK-$R mRNA reactions were seen for cells of the in!ammatory in+ltrates and for blood vessel walls within the in!amed and a,ected areas. Such reactions were also seen for +broblasts. Strong NK-$R immunoreac- tions in axonal pro+les and +ne NK-$R immunoreactions in large-sized nerve fascicles were furthermore frequently detected in the areas in!uenced by the myositis process. Additionally, morphologically abnormal muscle +bers in these areas displayed NK-$R immunoreactions and NK-$R mRNA reactions.*e NK-$R reactions were thus in principle restricted to the myositis areas and the areas located very close to these areas.
When interpreting the signi+cance of the NK-$R immu- noexpressions, one should be aware of the fact that not only SP but also endokinins and hemokinins show a remark- able potency for NK-$ receptors [%$]. Nevertheless, in the tachykinin stainings performed in the present study antibod- ies against SP (monoclonal antibodies) were used.
(.&. Crossover E,ects of the Tachykinin System. An interesting aspect in the current study is that the tachykinin system becomes involved in a process that occurs bilaterally in response to a unilateral experiment. *ere was thus an upregulation of NK-$R expression bilaterally, as well as an increase in SP levels bilaterally as seen via EIA analyses. *is suggests that the system has crossover e,ects. Similar crossover e,ects were reported in a recent study where retinal laser burn-induced neuropathy lead to an increase in SP- inducible NK-$R +rst in the retina of the burned eye and then in the contralateral eye [%"]. *e authors of this study, who had previously noted that unilateral retinal laser burn leads to in!ammation not only in this eye but also in the nonburned eye [%%], suggested that SP had transmitted early in!ammatory signals from the a,ected eye to the contralat- eral eye. In the same context, Chang and collaborators [%-] demonstrated that unilateral burn injury in a limb can have a long-lasting allodynia that spreads to the contralateral limb. It was concluded that central neuropathic mechanisms, via the occurrence of the hyperexcitability of second-order neurons and microglial activation, were responsible for the cross- transfer e,ect [%-].
It has previously been shown that unilateral experiments and unilateral in!ammation in limbs can lead to contralateral e,ects and in which cases neurological mechanisms are considered to be very important [%)–%(]. Occurrence of contralateral responses following unilateral stimuli in the form of intradermal injections of capsaicin has also been
$" ISRN In!ammation
!
!
F23456 &: (a)–(d) NK-$R immunoreactions in the walls of blood vessels located in myositis areas or close to these areas are shown (preabsorption control in (d)). Sections are from gastrocnemius muscles from the exercised side, the /-week (a) and $-week (b) groups, and from the nonexercised side, %-week group (c, d). Note that there are NK-$R immunoreactions in the blood vessel walls in both exercised and nonexercised sides (arrows, (a)–(c)).*e reactions are observed in the endothelial layer of the vessels.*ere is no reaction in the preabsorption control (d).*e vessel shown in (d) conforms to that in (c) but was sectioned in another level of the sectioning, why the vessel morphology is di,erent. Asterisks in the lumen of the blood vessel (c, d). Bars = ") #m. (e) Immunostaining for NK-$R. Soleus muscle specimen of the /-week group, nonexercised side.*ere are immunoreactions in +broblast-like cells (arrows). Bar = ") #m.
shown for humans [%&] and contralateral increases in sensory neural activity are suggested to be of importance for the sym- metry concerning the in!ammation in rheumatoid arthritis [-#]. It is furthermore known that electrical stimulation can lead to orthodromic activation of a,erent nerve +bers which can initiate the release of SP and changes in both the stimulated and the nonstimulated contralateral muscles [-$]. Bilateral e,ects concerning SP have previously been seen a0er experiments using heat injury [-"] and unilateral formaldehyde injections [-%] and in response to craniofacial in!ammation [--] as well. It should here be stressed that the NK-$R expressions seen in our model of myositis/muscle injury were not only related to nerve structures but also in!ammatory cells, blood vessel walls, and morphologically abnormal muscle +bers. It is also noteworthy that SP in experimental studies has been found to have a systemically acting wound messenger e,ect in the early wound healing
processes a0er an injury to the conjunctiva [-)]. In future studies using the currently used model, the bases for the contralateral e,ects should be further evaluated. It should be recalled that a,ections occurred bilaterally for the tendons in studies focusing on the Achilles tendons using the unilateral setup utilized in the present study ["#].
(.'. Presence of NK-!R in Axonal Pro+les and Large Nerve Fas- cicles. It is well known that there is a widespread expression of NK-$R in the central nervous system. It is also shown that unmyelinated axons in nerve bundles in peripheral locations can display NK-$R [-/], and that NK-$Rs are found on sensory nerves in various locations [-', -(]. However, nerve- related NK-$R immunoreactions were very infrequently seen in the controls and areas showingnormalmusclemorphology in experimental animals in this study. *e only pro+les that were encountered occurred as varicose pro+les.
ISRN In!ammation $%
! # (d)
#! (e)
! # (f)
F23456 $#: Parts of sections from a soleus muscle specimen, exercised side, /-week group. In (a)–(c) a normally appearing muscle area is shown, in (d)–(f) a part of a myositis area. *e muscle +bers in (a)–(c) are in principle transversely cut, whereas those in (d)–(f) are longitudinally cut. Double staining for desmin and NK-$R. Desmin staining is shown in (a, d), desmin staining coupled to DAPI in (b, e), and NK-$R staining in (c, f). In (a, b), the normal striated desmin immunoreaction pattern is seen. *ere are no NK-$R immunoreactions in (c). In (e), it is seen that there is a massive in+ltration of cells in a part of the muscle +ber (1), and to a certain extent an in+ltration in another part (asterisk).*e desmin immunoreaction is weak in the middle of the latter part and non-existent in the former.*ere are NK-$R immunoreactions in in+ltrating cells (arrows, (f)). Bar = ")#m.
M1
M2 !
(a)
M1
M2 !
(b)
F23456 $$: Section from a soleus muscle specimen, nonexercised side, /-week group. Double staining for desmin coupled to DAPI (a) and NK-$R (b) is shown. *e area is shown in higher magni+cation in (b) than in (a). *ere is a very marked desmin immunoreaction in the muscle +ber in the middle (asterisk), and the normal desmin striations cannot be seen in the +ber. *ese striations can be seen in adjacent muscle +bers. *ere are point-like NK-$R immunoreactions in this muscle +ber (arrows, (b)) but no NK-$R in adjacent +bers. M$, M" = muscle +bers.*ere are internal nuclei in the muscle +ber in the markedly desmin immunoreactive muscle +ber (arrows, (a)). Bar = ") #m.
On the other hand, nerve-related NK-$R immunoreac- tions were frequently detected in myositis areas and areas that were very close to these areas. NK-$R immunoreactions were thus seen in the form of +ne distinct point-like reactions that were coalesced in large nerve fascicles and in the form of strong immunoreactive axonal pro+les.*e double stainings we performed showed that theseNK-$R immunoactionswere o0en associated with markedly S$##beta immunoreactive
Schwann cells. *is observation suggests that these NK- $R expressing pro+les are enclosed by Schwann cells. In accordance with this interpretation, previous studies made at the ultrastructural levels in the rat dental mucosa have shown that NK-$Rs are present in vesicular structures and the axoplasm of axons that are enclosed by Schwann cells [-&]. Our double stainings also showed that the large nerve fascicles/axonal pro+les harbouring these NK-$R reactions
$- ISRN In!ammation
(a) (b)
(c)
F23456 $": Reactions in +broblast-like cells. Sections of a gastrocnemius muscle specimen of the $-week group, exercised side (a, b), and a soleus muscle specimen of the /-week group, exercised side (c), are shown. In situ hybridization (antisense staining in (a), (c); sense staining in (b); (b) is from a parallel section to (a)).*ere is an expression of NK-$R (TACR$) mRNA in the cells in (a).*ere are no reactions in the sense control (b). Arrows point at +broblast-like cells.*ere are also NK-$RmRNA reactions in the +broblast-like cells in (c) (arrows). Bar = ") #m.
(a) (b)
F23456 $%: Expression of NK-$R (TACR$) mRNA in blood vessel walls. Serial sections from soleus muscle specimen of the / week group, non-exercised side, showing small arteriole (le0 part, (a), (b)) and vein (right part, (a), (b)). Processing for NK-$R mRNA using anti-sense probe (a) and processing with corresponding sense probe (b). Expression of NK-$R mRNA is seen in the walls of the blood vessels in (a). *ere are no reactions in the sense control (b). Arrows indicate parts of the walls. Bar = ") #m.
were related to nuclei that showed another type of !uo- rescence reactions than nuclei located outside the nerve fascicles and than those usually seen for nerve fascicles of normal muscle regions. *e former !uorescence reactions are related to a combination of the DAPI reaction and S-$##beta immunoreaction. It, therefore, seems likely that these nerve fascicles/axons are in a phase of regeneration. It is thus known that the S-$##beta protein in principle is detected in the cytoplasm and themembranes of the Schwann cells, and not the nuclei, as seen in immunohistochemical stainings, in normal situations [)#]. Furthermore, it is known that Schwann cells can be activated when there is a nerve damage and that the S-$##beta protein can be involved in axonal regeneration [)$, )"] and that Schwann cells ensheath regenerating axons [)%].
(.(. Presence of NK-!R in White Blood Cells. *e NK-$R, as well as tachykinins like SP, has been detected in several types
of white blood cells [)-]. In the present study, NK-$R was detected in macrophages and eosinophils. NK-$R was o0en colocalized with SP in the cells. *e SP/NK-$R system may thus have an important role for the accumulation of these cells in the muscle tissue in the myositis process. Concerning macrophages, these +ndings are in accordance with a report saying that NK-$Rs are involved in the accumulation of macrophages in the airways in the development of smoking- induced emphysema and in response to cigarette smoking exposure [))].
*e NK-$R reactions in the cells in the in!ammatory in+ltrates showed frequently an intracellular location.*is is likely to be due to theNK-$Rs being internalized a0er binding to released SP or that it represents newly synthesized recep- tors. It is well known that the NK-$R in neurons undergoes rapid internalization a0er binding to SPhas occurred and that the receptor therea0er recycles to the plasmamembrane [)/]. *e intracellular location of NK-$Rs has been reported to be
ISRN In!ammation $)
! (a)
! (b)
F23456 $-: Expression of NK-$R (TACR$) mRNA in the wall of a large vein is shown (soleus muscle specimen of /w group, nonex- ercised side). Processing for NK-$R mRNA using anti-sense probe (a) and processing with corresponding sense probe (b). Expression of NK-$R mRNA is seen in the vein wall (a).*ere are no reactions in the sense control (b). Arrows indicate parts of the wall. Asterisks indicate similar parts of the vessel wall. Bar = ")#m.
F23456 $): Expression of NK-$R (TACR$) mRNA in in!ammatory in+ltrate. Staining for the demonstration of NK-$R mRNA (anti- sense probe) in a section of a gastrocnemius muscle specimen, exercised side, $-week group, is shown. Cells in an in!ammatory in+ltrate are showing NK-$R mRNA reactions (arrows). Bar = ") #m.
transport vesicles and endosomes [)']. Also in nonneuronal cells, there is a process of endocytosis and recycling of the NK-$R [)(]. It might be that the cells in the in!ammatory in+ltrates are under the continuous in!uence of SP in an autocrine/paracrine fashion and that there is a continuous NK-$R internalization but also a continuous synthesis. SP and the NK-$R are actually reported to be internalized in the same vesicles and then sorted into independent endosomes, leading to the eventual degradation of SP and recycling of the NK-$R [)&].
(.). Presence of NK-!R in Blood Vessel Walls. NK-$R immu- noreactions and NK-$R mRNA reactions were seen in the endothelium of blood vessels in myositis areas. It is well known that SP induces an increased vascular permeability, vasodilatation, and hyperthermia via binding to NK-$Rs on the endothelial cells of the blood vessel walls [/#]. *e vasodilator e,ect by SP is thus considered to be dependent upon the endothelium and to be mediated by the NK-$R. We also sometimes noted reactions for NK-$RmRNA for the smooth muscle layer. In accordance with this +nding, it has been found that smooth muscle cells of airways in rats show mRNA transcripts for the NK-$R [/$].
! (a)
! (b)
! (c)
F23456 $/: Expression of NK-$R (TACR$) mRNA. Serial sections of a soleus muscle specimen of the /-week group, nonexercised side, showing an abnormal muscle +ber (asterisks). In (a), the +ber is shown to be markedly in+ltrated by in!ammatory cells (staining with H&E). *ere is NK-$R mRNA expression in this +ber (b) (arrows). No reactions are visible in the sense control (c). Bar = ") #m.
(.*. NK-!R in Degenerating/Regenerating Muscle Fibers. NK- $R was not only detected in white blood cells that were dispersed in the tissue but also in white blood cells that heavily had in+ltrated muscle +bers. Based on the complete or relative loss of desmin immunoreactivity in these mus- cle +bers, they can be considered to represent degenerat- ing/necrotic muscle +bers. It is thus known that desmin is undetectable or much decreased in necrotic muscle +bers [/"]. On the other hand, we noted that other muscle +bers in myositis areas and adjacent areas showed a very marked desmin immunoreaction. *ese +bers are interpreted to be in a regenerative stage.*is is in accordance with the known fact that there is an overexpression of desmin during muscle regeneration processes [/%]. Also these +bers exhibited NK- $R immunoreaction, the reactions in this case showing a punctuate pattern. *is indicates that both degenerative and
$/ ISRN In!ammation
regenerative events occur in the myositis process and that the NK-$R is involved in both types of processes.
(.%. Functional Aspects: General Considerations. As discussed above, there were marked NK-$R reactions in myositis areas and areas adjacent to these areas, whilst there were almost no NK-$R reactions at all in areas with normal morphology. *e reactions were seen for nerve structures, white blood cells, blood vessel walls, and abnormal muscle +bers. *e observations of a very marked NK-$R expression in myositis specimens, in parallel with an increased content of SP in these specimens (as seen for specimens of the /-week groups), are comparable to +ndings made in other situations for tissues exhibiting in!ammation and tissue damage/reorganization. *at includes colonic +brosis [/-], immunode+ciency virus lesions [/)], airway in!ammation [//], and sarcoidosis [/']. It has since long been considered that the occurrence of interactions between tachykinins and in!ammatory cells is of great importance in pathological conditions and that the NK-$R has important roles in these conditions [/(].*ere is a reason to believe that tachykinin e,ects hereby are related to interactive e,ects with other signal substances.
*e fact that SP and NK-$R sometimes were found to be colocalized suggests that autocrine/paracrine SP e,ects may occur in the tissue. *is can be related to an auto- regulatory mechanism for SP in relation to the NK-$Rs. Autoreceptor functions for SP a,ecting NK-$Rs have since long been suggested to occur in other situations [-/]. It has also previously been suggested that NK-$Rs found on sensory neurons are autoreceptors, being related to the mod- ulation of peripheral pathophysiological e,ector functions [-']. Autocrine/paracrine e,ects by SP has on the whole been considered to take place in several conditions, including in leukemia [/&] and various in!ammatory situations ['#].
One can ask wheter the marked NK-$R expression in the myositis areas is not only related to proin!ammatory e,ects but also to healing e,ects. It should here be recalled that there occurs an overexpression of the NK-$R not only in response to in!ammation and tissue damage, but also in situationswith tissue repair andwoundhealing.*at includes the situation during gastric wound healing in rodents ['$]. An in!ammatory component is actually described to be involved in healing e,ects for the skin. Topical treatment of SP to skin wounds in genetically diabetic mice thus leads to an increase in in!ammatory density as a part of the healing process ['"]. SP is considered to be involved not only in cutaneous healing, but also in corneal wound healing [%] and to be involved in processes of tendon repair ['%–')]. Concerning tendinopathy, SP can accelerate the processes of hypercellularity and angiogenesis in tendon tissue in this condition ['/]. It is furthermore considered that SP can have protective roles. It is, for example, reported that NK-$R- mediated functions have protective roles in acute hyperoxic lung injury [''].
5. Conclusions
*e present study shows that the tachykinin system is markedly involved in the processes of muscle injury/myositis
that occur in the overuse model here used. To what extent the e,ects of tachykinin are related to proin!ammatory or tissue-healing e,ects remains to be answered. Our +ndings suggest that the NK-$R is involved in both degenerative and regenerative events. *ere is a reason to believe that tachykinins show interference e,ects with other signal sub- stances in the processes that occur. *e tachykinin system is upregulated on both sides, that is, in the myositis process that occurs in the experimental side as well as the one that occurs contralaterally. *e upregulation is for both sides not only restricted to nerve structures but also to cells of the in!ammatory in+ltrates, the blood vessels, and morphologically changed muscle +bers.
It has not previously been demonstrated that tachykinins have the marked e,ects that are shown here for muscle tissue. *e currently used model can be utilized in fur- ther studies evaluating the features of interactions between tachykinins and other signal substances in myositis and degenerative/regenerative muscle processes and to evaluate if interference with tachykinin e,ects can be of value for these processes. *e possible e,ectiveness of NK-$R blocking has been evaluated for various in!ammatory conditions ['(, '&]. *e results have been unclear. It remains for the future to evaluate if interference with e,ects at the NK-$R can have positive e,ects in situations with myositis and muscle injury.
Acknowledgments
*e authors are grateful to Ms. Ulla Hedlund for excellent technical assistance at the laboratory, to Mr. Adrian Lam- ouroux and Ms. Fellon Robson-Long for excellent technical service concerning the animal model, and to Professor R. Lorentzon and Dr. Clas Backman for cooperation on the animal experiments. Professor L-E *ornell is acknowl- edged for comments concerning the aspects of degenera- tion/regeneration. Financial support was received from the Faculty of Medicine, Umea University, the Swedish National Centre for Research in Sports (CIF) and the J. C. Kempe and Seth M. Kempe Memorial Foundations. China Scholarship Council provided a stipend to YS. *e funders had no role in the study design, data collection and analysis, decision to publish, or preparation of the manuscript.
References
[$] T. Patel, S. H. Park, L. M. Lin, F. Chiappelli, and G. T. J. Huang, “Substance P induces interleukin-( secretion from human dental pulp cells,” Oral Surgery, Oral Medicine, Oral Pathology, Oral Radiology, and Endodontics, vol. &/, no. -, pp. -'(–-(), "##%.
["] P. Geppetti, R. Nassini, S. Materazzi, and S. Benemei, “*e concept of neurogenic in!ammation,” BJU International, Sup- plement, vol. $#$, no. %, pp. "–/, "##(.
[%] T. Nishida, “Neurotrophic mediators and corneal wound heal- ing,” Ocular Surface, vol. %, no. -, pp. $&-–"#", "##).
[-] H. Kohara, S. Tajima, M. Yamamoto, and Y. Tabata, “Angiogen- esis induced by controlled release of neuropeptide substance P,” Biomaterials, vol. %$, no. %%, pp. (/$'–(/"), "#$#.
ISRN In!ammation $'
[)] M. Munoz, A. Pavon, M. Rosso et al., “Immunolocalization of NK-$ receptor and substance P in human normal placenta,” Placenta, vol. %$, no. ', pp. /-&–/)$, "#$#.
[/] A. D. Hershey and J. E. Krause, “Molecular characterization of a functional cDNA encoding the rat substance P receptor,” Science, vol. "-', no. -&-), pp. &)(–&/", $&&#.
['] H.Ohkubo and S.Nakanishi, “Molecular characterization of the three tachykinin receptors,” Annals of the New York Academy of Sciences, vol. /%", pp. )%–/", $&&$.
[(] T. Cao, E. Pinter, S. Al-Rashed, N. Gerard, J. R. Hoult, and S. D. Brain, “Neurokinin-$ receptor agonists are involved in mediating neutrophil accumulation in the in!amed, but not normal, cutaneous microvasculature: an in vivo study using neurokinin-$ receptor knockout mice,” Journal of Immunology, vol. $/-, no. $#, pp. )-"-–)-"&, "###.
[&] M. Jonsson, O. Norrgard, and S. Forsgren, “Presence of a marked nonneuronal cholinergic system in human colon: study of normal colon and colon in ulcerative colitis,” In-ammatory Bowel Diseases, vol. $%, no. $$, pp. $%-'–$%)/, "##'.
[$#] M. Bhatia, A. K. Saluja, B. Ho7auer et al., “Role of substance P and the neurokinin $ receptor in acute pancreatitis and pancreatitis-associated lung injury,” Proceedings of the National Academy of Sciences of the United States of America, vol. &), no. (, pp. -'/#–-'/), $&&(.
[$$] H. Y. Lau, F. L. Wong, and M. Bhatia, “A key role of neurokinin $ receptors in acute pancreatitis and associated lung injury,” Biochemical and Biophysical Research Communications, vol. %"', no. ", pp. )#&–)$), "##).
[$"] D. Renzi, B. Pellegrini, F. Tonelli, C. Surrenti, and A. Calabro, “Substance P (neurokinin-$) and neurokinin A (neurokinin- ") receptor gene and protein expression in the healthy and in!amed human intestine,” American Journal of Pathology, vol. $)', no. ), pp. $)$$–$)"", "###.
[$%] C. Remrod, S. Lonne-Rahm, and K. Nordlind, “Study of substance P and its receptor neurokinin-$ in psoriasis and their relation to chronic stress and pruritus,” Archives of Dermatolog- ical Research, vol. "&&, no. ", pp. ()–&$, "##'.
[$-] Y. Song, S. Forsgren, J. Yu, R. Lorentzon, and P. S. Stal, “E,ects on contralateral muscles a0er unilateral electrical muscle stim- ulation and exercise,” Plos ONE, vol. ', no. $", Article ID e)""%#, "#$".
[$)] S. Forsgren, L. Renstrom, C. Purdam, and J. E. Gaida, “TNF- alpha in the locomotor system beyond joints: high degree of involvement inmyositis in a rabbitmodel,” International Journal of Rheumatology, vol. "#$", Article ID /%'-)", "#$".
[$/] C. Spang, A. Scott, P. Danielson, R. Lorentzon, and S. Forsgren, “VGluT" and NMDAR$ expression in cells in the in!ammatory in+ltrates in experimentally induced myositis: evidence of local glutamate signaling suggests autocrine/paracrine e,ects in an overuse injury model,” In-ammation, vol. %), no. $, pp. %&–-(, "#$".
[$'] U. Hoheisel, A. Kaske, and S. Mense, “Relationship between neuronal activity and substance P-immunoreactivity in the rat spinal cord during acute and persistent myositis,” Neuroscience Letters, vol. ")', no. $, pp. "$–"-, $&&(.
[$(] A. Reinert, A. Kaske, and S. Mense, “In!ammation-induced increase in the density of neuropeptide-immunoreactive nerve ending in rat skeletal muscle,” Experimental Brain Research, vol. $"$, no. ", pp. $'-–$(#, $&&(.
[$&] R. Ambalavanar, D. Dessem, A. Moutanni et al., “Muscle in!ammation induces a rapid increase in calcitonin gene- related peptide (CGRP)mRNA that temporally relates to CGRP
immunoreactivity and nociceptive behavior,” Neuroscience, vol. $-%, no. %, pp. (')–((-, "##/.
["#] G. Andersson, S. Forsgren, A. Scott et al., “Tenocyte hypercellu- larity and vascular proliferation in a rabbit model of tendinopa- thy: contralateral e,ects suggest the involvement of central neuronal mechanisms,” British Journal of Sports Medicine, vol. -), no. ), pp. %&&–-#/, "#$$.
["$] C. Backman, L. Boquist, J. Friden, R. Lorentzon, and G. Toolanen, “Chronic achilles paratenonitis with tendinosis: an experimental model in the rabbit,” Journal of Orthopaedic Research, vol. (, no. -, pp. )-$–)-', $&&#.
[""] M. Hansson and S. Forsgren, “Immunoreactive atrial and brain natriuretic peptides are co-localized in Purkinje +bres but not in the innervation of the bovine heart conduction system,” Histochemical Journal, vol. "', no. %, pp. """–"%#, $&&).
["%] A. C. Cuello, M. Del Fiacco, and G. Paxinos, “*e central and peripheral ends of the substance P-containing sensory neurones in the rat trigeminal system,” Brain Research, vol. $)", no. %, pp. -&&–)#&, $&'(.
["-] G.N.VanMuijen,D. J. Ruiter, and S.O.Warnaar, “Coexpression of intermediate +lament polypeptides in human fetal and adult tissues,” Laboratory Investigation, vol. )', no. -, pp. %)&–%/&, $&('.
[")] J. Pettersson,D. Kalbermatten, A.McGrath, and L.N.Novikova, “Biodegradable +brin conduit promotes long-term regenera- tion a0er peripheral nerve injury in adult rats,” Journal of Plastic, Reconstructive and Aesthetic Surgery, vol. /%, no. $$, pp. $(&%– $(&&, "#$#.
["/] A. M. McGrath, M. Brohlin, P. J. Kingham, L. N. Novikov, M. Wiberg, and L. N. Novikova, “Fibrin conduit supplemented with human mesenchymal stem cells and immunosuppressive treatment enhances regeneration a0er peripheral nerve injury,” Neuroscience Letters, vol. )$/, no. ", pp. $'$–$'/, "#$".
["'] A. Panoskaltsis-Mortari and R. P. Bucy, “In situ hybridization with digoxigenin-labeled RNA probes: facts and artifacts,” BioTechniques, vol. $(, no. ", pp. %##–%#', $&&).
["(] P. Danielson, H. Alfredson, and S. Forsgren, “In situ hybridiza- tion studies con+rming recent +ndings of the existence of a local nonneuronal catecholamine production in human patellar tendinosis,”Microscopy Research and Technique, vol. '#, no. $#, pp. &#(–&$$, "##'.
["&] A. Scott, H. Alfredson, and S. Forsgren, “VGIuT" expression in painful achilles and patellar tendinosis: evidence of local gluta- mate release by tenocytes,” Journal of Orthopaedic Research, vol. "/, no. ), pp. /()–/&", "##(.
[%#] M. Johansson, M. Josson, O. Norrgard, and S. Forsgren, “New aspects concerning ulcerative colitis and colonic carci- noma: analysis of levels of neuropeptides, neurotrophins, and TNFalpha/TNFreceptor in plasma and mucosa in parallel with histological evaluation of the intestine,” In-ammatory Bowel Diseases, vol. $-, no. $#, pp. $%%$–$%-#, "##(.
[%$] Z. Helyes, K. Elekes, K. Sandor et al., “Involvement of pre- protachykinin A gene-encoded peptides and the neurokinin $ receptor in endotoxin-induced murine airway in!ammation,” Neuropeptides, vol. --, no. ), pp. %&&–-#/, "#$#.
[%"] K. Lucas, D. Karamichos, R. Mathew, J. D. Zieske, and J. Stein-Streilein, “Retinal laser burn-induced neuropathy leads to substance P-dependent loss of ocular immune privilege,” Journal of Immunology, vol. $(&, no. %, pp. $"%'–$"-", "#$".
[%%] H. Qiao, K. Lucas, and J. Stein-Streilein, “Retinal laser burn disrupts immune privilege in the eye,” American Journal of Pathology, vol. $'-, no. ", pp. -$-–-"", "##&.
$( ISRN In!ammation
[%-] Y. W. Chang, A. Tan, C. Saab, and S. Waxman, “Unilateral focal burn injury is followed by long-lasting bilateral allodynia and neuronal hyperexcitability in spinal cord dorsal horn,” Journal of Pain, vol. $$, no. ", pp. $$&–$%#, "#$#.
[%)] J. D. Levine, S. J. Dardick, A. I. Basbaum, and E. Scipio, “Re!ex neurogenic in!ammation. I. Contribution of the peripheral nervous system to spatially remote in!ammatory responses that follow injury,” Journal of Neuroscience, vol. ), no. ), pp. $%(#– $%(/, $&().
[%/] B. L. Kidd, S. C. Cruwys, N. E. Garrett, P. I. Mapp, V. A. Jolli,e, and D. R. Blake, “Neurogenic in!uences on contralat- eral responses during experimental rat monoarthritis,” Brain Research, vol. /((, no. $-", pp. '"–'/, $&&).
[%'] M. Koltzenburg, P. D.Wall, and S. B.McMahon, “Does the right side know what the le0 is doing?” Trends in Neurosciences, vol. "", no. %, pp. $""–$"', $&&&.
[%(] N. Shenker, R. Haigh, E. Roberts, P. Mapp, N. Harris, and D. Blake, “A review of contralateral responses to a unilateral in- !ammatory lesion,”Rheumatology, vol. -", no. $$, pp. $"'&–$"(/, "##%.
[%&] N. G. Shenker, R. C. Haigh, P. I. Mapp, N. Harris, and D. R. Blake, “Contralateral hyperalgesia and allodynia following intradermal capsaicin injection in man,” Rheumatology, vol. -', no. &, pp. $-$'–$-"$, "##(.
[-#] S. Kelly, J. P. Dunham, and L. F. Donaldson, “Sensory nerves have altered function contralateral to a monoarthritis and may contribute to the symmetrical spread of in!ammation,” European Journal of Neuroscience, vol. "/, no. -, pp. &%)–&-", "##'.
[-$] O. Hudlicka, L. Graciotti, G. Fulgenzi et al., “*e e,ect of chronic skeletal muscle stimulation on capillary growth in the rat: are sensory nerve +bres involved?” Journal of Physiology, vol. )-/, no. %, pp. ($%–("", "##%.
[-"] T. J. Coderre and R. Melzack, “Increased pain sensitivity fol- lowing heat injury involves a central mechanism,” Behavioural Brain Research, vol. $), no. %, pp. ")&–"/", $&().
[-%] A. M. Aloisi, C. A. Porro, M. Cavazzuti, P. Baraldi, and G. Carli, “’Mirror pain’ in the formalin test: behavioral and "- deoxyglucose studies,” Pain, vol. )), no. ", pp. "/'–"'%, $&&%.
[--] R. Ambalavanar, M. Moritani, A. Moutanni, P. Gangula, C. Yallampalli, and D. Dessem, “Deep tissue in!ammation upreg- ulates neuropeptides and evokes nociceptive behaviors which are modulated by a neuropeptide antagonist,” Pain, vol. $"#, no. $-", pp. )%–/(, "##/.
[-)] H. S. Hong, J. Lee, E. Lee et al., “A new role of substance P as an injury-induciblemessenger formobilization of CD"&+ stromal- like cells,” Nature Medicine, vol. $), no. -, pp. -")–-%), "##&.
[-/] S. M. Carlton, S. Zhou, and R. E. Coggeshall, “Localization and activation of substance P receptors in unmyelinated axons of rat glabrous skin,” Brain Research, vol. '%-, no. $-", pp. $#%–$#(, $&&/.
[-'] I. J. Lever, A. D. Grant, S. Pezet, N. P. Gerard, S. D. Brain, and M. Malcangio, “Basal and activity-induced release of substance P from primary a,erent +bres in NK$ receptor knockout mice: evidence for negative feedback,” Neuropharmacology, vol. -), no. (, pp. $$#$–$$$#, "##%.
[-(] A.M.Harrington, J.M. Hutson, and B. R. Southwell, “Immuno- histochemical localization of substance P NK$ receptor in guinea pig distal colon,”Neurogastroenterology andMotility, vol. $', no. ), pp. '"'–'%', "##).
[-&] T. Yamaza,M.A.Kido, B.Wang et al., “Distribution of substance P and neurokinin-$ receptors in the peri-implant epithelium
around titanium dental implants in rats,” Cell and Tissue Research, vol. %%), no. ", pp. -#'–-$), "##&.
[)#] A. Spreca, M. Grazia Rambotti, M. Rende et al., “Immunocy- tochemical localization of S-$##b protein in degenerating and regenerating rat sciatic nerves,” Journal of Histochemistry and Cytochemistry, vol. %', no. -, pp. --$–--/, $&(&.
[)$] J. Hu, S. Zou, Z. Tang, D. Wang, J. Li, and Z. Gao, “Response of Schwann cells in the inferior alveolar nerve to distraction osteo- genesis: an ultrastructural and immunohistochemical study,” International Journal of Oral and Maxillofacial Surgery, vol. %", no. %, pp. %$(–%"-, "##%.
[)"] T. Duobles, T. D. S. Lima, B. D. F. A. Levy, and G. Chadi, “S$##$ and +broblast growth factor-" are present in cultured Schwann cells and may exert paracrine actions on the peripheral nerve injury,” Acta Cirurgica Brasileira, vol. "%, no. /, pp. )))–)/#, "##(.
[)%] M.C. Brown andV. J.Hardman, “A reassessment of the accuracy of reinnervation bymotoneurons following crushing or freezing of the sciatic or lumbar spinal nerves of rats,” Brain, vol. $$#, no. %, pp. /&)–'#), $&('.
[)-] A. Sipka, K. Langner, H. M. Seyfert, and H. J. Schuberth, “Sub- stance P alters the in vitro LPS responsiveness of bovine mono- cytes and blood-derived macrophages,”Veterinary Immunology and Immunopathology, vol. $%/, no. %--, pp. "$&–""/, "#$#.
[))] K. O. De Swert, K. R. Bracke, T. Demoor, G. G. Brusselle, and G. F. Joos, “Role of the tachykinin NK$ receptor in a murine model of cigarette smoke-induced pulmonary in!ammation,” Respiratory Research, vol. $#, article %', "##&.
[)/] P. W. Mantyh, “Neurobiology of substance P and the NK$ receptor,” Journal of Clinical Psychiatry, vol. /%, supplement $$, pp. /–$#, "##".
[)'] T. Goto, T. Yamaza, M. A. Kido, and T. Tanaka, “Light- and electron-microscopic study of the distribution of axons containing substance P and the localization of neurokinin-$ receptor in bone,” Cell and Tissue Research, vol. "&%, no. $, pp. ('–&%, $&&(.
[)(] D. Roosterman,G. S. Cottrell, F. Schmidlin,M. Steinho,, andN. W. Bunnett, “Recycling and resensitization of the neurokinin $ receptor: in!uence of agonist concentration and Rab GTPases,” Journal of Biological Chemistry, vol. "'&, no. "&, pp. %#/'#– %#/'&, "##-.
[)&] E. F. Grady, A. M. Garland, P. D. Gamp, M. Lovett, D. G. Payan, and N. W. Bunnett, “Delineation of the endocytic pathway of substance P and its seven- transmembrane domain NK$ receptor,” Molecular Biology of the Cell, vol. /, no. ), pp. )#&– )"-, $&&).
[/#] S. Harrison and P. Geppetti, “Substance P,” International Journal of Biochemistry andCell Biology, vol. %%, no. /, pp. )))–)'/, "##$.
[/$] K. Maghni, M. C. Michoud, M. Alles et al., “Airway smooth muscle cells express functional neurokinin-$ receptors and the nerve-derived preprotachykinin-A gene: regulation by passive sensitization,” American Journal of Respiratory Cell and Molec- ular Biology, vol. "(, no. $, pp. $#%–$$#, "##%.
[/"] C. Young, M. Y. Lin, P. J. Wang, and Y. Z. Shen, “Immunocy- tochemical studies on desmin and vimentin in neuromuscular disorders,” Journal of the Formosan Medical Association, vol. &%, no. $#, pp. ("&–(%), $&&-.
[/%] A. Gallanti, A. Prelle, M. Moggio et al., “Desmin and vimentin as markers of regeneration in muscle diseases,” Acta Neu- ropathologica, vol. (), no. $, pp. ((–&", $&&".
ISRN In!ammation $&
[/-] H.W.Koon,D. Shih, I. Karagiannides et al., “Substance Pmodu- lates colitis-asscociated +brosis,”American Journal of Pathology, vol. $'', no. ), pp. "%##–"%#&, "#$#.
[/)] H. Vinet-Oliphant, X. Alvarez, E. Buza et al., “Neurokinin-$ receptor (NK$-R) expression in the brains of SIV-infected rhe- sus macaques: implications for substance P in NK$-R immune cell tra.cking into the CNS,” American Journal of Pathology, vol. $'', no. %, pp. $"(/–$"&', "#$#.
[//] H. Wu, C. Guan, X. Qin et al., “Upregulation of substance P receptor expression by calcitonin gene-related peptide, a possi- ble cooperative action of two neuropeptides involved in airway in!ammation,” Pulmonary Pharmacology and.erapeutics, vol. "#, no. ), pp. )$%–)"-, "##'.
[/'] T. M. O’Connor, J. O’Connell, D. I. O’Brien et al., “Upregulation of neurokinin-$ receptor expression in the lungs of patients with sarcoidosis,” Journal of Clinical Immunology, vol. "%, no. ), pp. -")–-%), "##%.
[/(] Y. Zhang, A. Berger, C. D. Milne, and C. J. Paige, “Tachykinins in the immune system,” Current Drug Targets, vol. ', no. (, pp. $#$$–$#"#, "##/.
[/&] M. Nowicki, B. Miskowiak, and D. Ostalska-Nowicka, “Detec- tion of substance P and its mRNA in human blast cells in child- hood lymphoblastic leukaemia using immunocytochemistry and in situ hybridisation,” Folia Histochemica et Cytobiologica, vol. -$, no. $, pp. %%–%/, "##%.
['#] J. P. Lai, S. D. Douglas, and W. Z. Ho, “Human lymphocytes express substance P and its receptor,” Journal of Neuroimmunol- ogy, vol. (/, no. $, pp. (#–(/, $&&(.
['$] A. Schmassmann, B. Waser, B. Flogerzi, and J. C. Reubi, “Expression of functional neurokinin-$ receptors in regenera- tive glands during gastric wound healing in rodents,” Gastroen- terology, vol. $"/, no. %, pp. '(-–'&), "##-.
['"] J. R. Scott, P. Muangman, and N. S. Gibran, “Making sense of hypertrophic scar: a role for nerves,” Wound Repair and Regeneration, vol. $), no. $, pp. S"'–S%$, "##'.
['%] P. Burssens, A. Steyaert, R. Forsyth, E. J. Van Ovost, Y. De Paepe, and R. Verdenk, “Exogenously administered substance P and neutral endopeptidase inhibitors stimulate +broblast proliferation, angiogenesis and collagen organization during Achilles tendon healing,” Foot and Ankle International, vol. "/, no. $#, pp. (%"–(%&, "##).
['-] A. E. Steyaert, P. J. Burssens, C. W. Vercruysse, G. G. Vander- straeten, and R. M. Verbeeck, “*e e,ects of substance P on the biomechanic properties of ruptured rat Achilles’ tendon,” Archives of Physical Medicine and Rehabilitation, vol. (', no. ", pp. ")-–")(, "##/.
[')] O. Carlsson, N. Schizas, J. Li, and P. W. Ackermann, “Substance P injections enhance tissue proliferation and regulate sensory nerve ingrowth in rat tendon repair,” Scandinavian Journal of Medicine and Science in Sports, vol. "$, no. -, pp. )/"–)/&, "#$$.
['/] G. Andersson, L. J. Backman, A. Scott, R. Lorentzon, S. Fors- gren, andP.Danielson, “Substance P accelerates hypercellularity and angiogenesis in tendon tissue and enhances paratendinitis in response to Achilles tendon overuse in a tendinopathy model,” British Journal of Sports Medicine, vol. -), no. $%, pp. $#$'–$#"", "#$$.
[''] M. Dib, Z. Zsengeller, A. Mitsialis et al., “A paradoxical protec- tive role for the proin!ammatory peptide substance P receptor (NK$R) in acute hyperoxic lung injury,” American Journal of Physiology, vol. "&', no. -, pp. L/('–L/&', "##&.
['(] T. Goode, J. O’Connell, D. O’Brien, T. Goode, C. Bredin, and F. Shanahan, “*e role of substance P in in!ammatory disease,” Journal of Cell Physiology, vol. "#$, pp. $/'–$(#, "##-.
['&] M. Gad, A. E. Pedersen, N. N. Kristensen, C. D. F. Fernandez, and M. H. Claesson, “Blockage of the neurokinin $ receptor and capsaicin-induced ablation of the enteric a,erent nerves protect SCID mice against T-cell-induced chronic colitis,” In-ammatory Bowel Diseases, vol. $), no. (, pp. $$'-–$$(", "##&.
Submit your manuscripts at http://www.hindawi.com
Hindawi Publishing Corporation http://www.hindawi.com Volume 2013
Oxidative Medicine and Cellular Longevity
Hindawi Publishing Corporation http://www.hindawi.com Volume 2013 Hindawi Publishing Corporation http://www.hindawi.com Volume 2013
The Scientific World Journal
9ROXPH
Oncology Journal of
PPAR Re sea rch
Ophthalmology Journal of
ISRN Allergy Hindawi Publishing Corporation http://www.hindawi.com Volume 2013
BioMed Research International
Obesity Journal of
ISRN Addiction Hindawi Publishing Corporation http://www.hindawi.com Volume 2013
Hindawi Publishing Corporation http://www.hindawi.com Volume 2013
Computational and Mathematical Methods in Medicine
ISRN AIDS Hindawi Publishing Corporation http://www.hindawi.com Volume 2013
Clinical & Developmental Immunology
Evidence-Based Complementary and Alternative Medicine
Volume 2013 Hindawi Publishing Corporation http://www.hindawi.com
Hindawi Publishing Corporation http://www.hindawi.com Volume 2013
Gastroenterology Research and Practice
ISRN Biomarkers
MEDIATORS INFLAMMATION