hoxb1 controls effectors of sonic hedgehog and mash1

INTRODUCTION

The vertebrate hindbrain coordinates multiple complexfunctions, including somatic and visceral motor activities andthe processing of sensory information. Formation of the neuralcircuits underlying these functions depends on the generationof distinct populations of neuronal subtypes that constitutethese circuits (Altman and Bayer, 1980; Carpenter and Sutin,1983; Paxinos, 1995; Ramón y Cajal, 1995). The molecularand cellular mechanisms that spatially and temporally specifythese neurons are beginning to be identified. This advancehas largely been made possible by assigning the plethora ofneurally expressed transcription factors and receptor-ligandsignaling systems to coherent molecular pathways that controlthe formation of the neuronal subtypes (Lumsden, 1990;Tanabe and Jessell, 1996; Kageyama and Nakanishi, 1997;Flanagan and Vanderhaeghen, 1998; Sasai, 1998; Edlund andJessel, 1999).

Genes belonging to the Hox complex constitute onecomponent of this molecular network. Gain- and loss-of-function analyses have identified Hox genes that are importantto the regional specification of the hindbrain intocompartmental units called rhombomeres (r) (Lumsden andKeynes, 1989; Lumsden and Krumlauf, 1996; Capecchi,1997). Hox genes have been implicated both in the processof rhombomere formation as well as in the subsequentspecification of cell identities within rhombomeres. Forexample, while loss-of-function mutations in Hoxa1 result inthe failure to form specific rhombomeres, disruption of Hoxb1leads to a failure to specify distinct motoneurons within r4(Carpenter et al., 1993; Mark et al., 1993; Goddard et al., 1996;Studer et al., 1996; Pata et al., 2000). Gain-of-function

experiments have also been informative. For example, ectopicexpression of either Hoxb1 or Hoxa2 in r1 results in theapparent mis-specification of neurons within this non-Hox-expressing rhombomere to acquire characteristics normallyassociated with r4 or r2 branchiomotor neurons, respectively(Bell et al., 1999; Jungbluth et al., 1999). Although the datalinking Hox genes to hindbrain neurogenesis is compelling, theways in which these genes interact with the other molecularpathways that define neuronal subtypes has not beendelineated.

We have examined the interaction of the Hoxb1 mutationwith two principal molecular pathways mediating neuronalsubtype specification, the sonic hedgehog (Shh) and theMash1 (Ascl1 – Mouse Genome Informatics)/Ngn signalingpathways. The former is required for motor and interneuronspecification in the ventral neural tube (Ericson et al., 1996,1997; Pierani et al., 1999), whereas the latter transcriptionfactors are involved in the specification of very early neuralprogenitors, principally at the ventricular surface of the neuraltube (Gradwohl et al., 1996; Lee, 1997; Ma et al., 1997). Wehave also established an epistatic relationship betweenHoxb1 and Phox2b/Phox2a (Arix/Pmx2b– Mouse GenomeInformatics) in r4, the latter of which are required forspecification of the branchial and visceral motoneurons in thebrainstem (Pattyn et al., 2000).

Mash1 and Ngns are homologues of the basic helix-loop-helix (bHLH) Drosophila acheate-scute complex and atonal-like proneural genes (Jan and Jan, 1994; Ma et al., 1996, 1997;Anderson and Jan, 1997). In the mouse peripheral nervoussystem, Mash1 and Ngns foster developmental programs thatspecify distinct neuronal subtypes. Thus Mash1-deficientmice lack peripheral neurons of the noradrenergic lineage

5343Development 127, 5343-5354 (2000)Printed in Great Britain © The Company of Biologists Limited 2000DEV3280

The diverse neuronal subtypes in the adult central nervoussystem arise from progenitor cells specified by thecombined actions of anteroposterior (AP) and dorsoventral(DV) signaling molecules in the neural tube. Analyses of theexpression and targeted disruption of the homeobox geneHoxb1 demonstrate that it is essential for patterningprogenitor cells along the entire DV axis of rhombomere 4(r4). Hoxb1 accomplishes this function by acting very earlyduring hindbrain neurogenesis to specify effectors of thesonic hedgehog and Mash1 signaling pathways. In the

absence of Hoxb1 function, multiple neurons normallyspecified within r4 are instead programmed for early celldeath. The findings reported here provide evidence for agenetic cascade in which an AP-specified transcriptionfactor, Hoxb1, controls the commitment and specificationof neurons derived from both alar and basal plates of r4.

Key words: Hox genes, Hindbrain neurogenesis, Motoneurons,Mouse, Hoxb1

SUMMARY

Hoxb1 controls effectors of sonic hedgehog and Mash1 signaling pathways

Gary O. Gaufo, Per Flodby* and Mario R. Capecchi ‡

Howard Hughes Medical Institute, Department of Human Genetics, University of Utah, Salt Lake City, UT 84112, USA*Present address: Karolinska Institute, Department of Medical Nutrition, Novum, SE-141 86 Huddinge, Sweden ‡Author for correspondence (e-mail: [email protected])

Accepted 10 October; published on WWW 14 November 2000

5344

(Guillemot et al., 1993; Hirsch et al., 1998), whereas Ngn1(Neurod3– Mouse Genome Informatics) and Ngn2 (Atoh4–Mouse Genome Informatics) mutants lack sensory ganglia(Fode et al., 1998; Ma et al., 1998, 1999). Within the centralnervous system (CNS), these mammalian proneural genes areexpressed in complementary as well as overlapping neuralprogenitor domains, suggesting that in the CNS they functionin a more complex, combinatorial fashion with each other,compared to their distinct roles in peripheral neurogenesis.

The Shh-signaling pathway has been elegantly demonstratedto play a pivotal role in dorsoventral (DV) patterning ofneurons within the spinal cord (Tanabe and Jessell, 1996;Davenne et al., 1999). In the ventral neural tube, the activityof Shh is graded ventralhigh to dorsall°w, and is absolutelyrequired for the induction of floor plate cells, motoneurons andinterneurons (Chiang, 1996; Ericson et al., 1996, 1997; Briscoeet al., 1999; Pierani et al., 1999). In response to Shh, cells ofthe ventral neural tube differentiate into progenitors expressingthe homeodomain transcription factors Nkx2.2 (Nkx2-2 –Mouse Genome Informatics) or Pax6. The progeny of theseventral progenitors express specific Lim-homeodomaintranscription factors during their progressive differentiationinto motor neurons or ventral interneurons, thus acquiringdistinct Lim-homeodomain codes (Tsuchida et al., 1995; Pfaff,1996; Tanabe and Jessell, 1996; Briscoe et al., 2000). Thespatiotemporal expression pattern of Mash1 and Ngns suggeststhat they may coordinate with Nkx2.2 or Pax6 to specifydistinct neural progenitors along the DV axis of the neural tube.

The molecules involved in neural determination and Shhsignaling pathways are expressed along the full extent of theanteroposterior (AP) axis. This makes unlikely the involvementof these pathways in conferring distinct identities on the neuralprogenitors at specific AP levels. However, the AP-restrictedexpression patterns of Hox genes (Dollé et al., 1989; Grahamet al., 1989), their ability to specify distinct neural subtypesand their correct spatiotemporal expression patterns duringhindbrain neurogenesis make them ideal candidates forinteracting with these pathways to confer AP identity on theneuronal progenitor cells (Davenne et al., 1999; this study). Inthis study we provide evidence that within r4 there is arequirement for Hoxb1 by both the Mash1/Ngn and Shhsignaling pathways. Hoxb1 is needed to correctly specify earlyprogenitor cells along the DV axis of r4 and subsequently fornormal neuronal differentiation along the ventriculopial (VP)axis, the third coordinate of the developing neural tube.

MATERIALS AND METHODS

Targeting vector and generation of Hoxb1 GFP homozygousmiceIn order to allow continuous monitoring of Hoxb1 expression in liveembryos and embryonic tissues, we generated an allele of Hoxb1, inwhich the reporter gene for green fluorescent protein (GFP), wastargeted inframe into the Hoxb1-coding sequence (Fig. 1a and b). Thegenomic DNA used for vector construction was isolated from a 129Svmouse library in lambda FIX II (Stratagene) (Goddard et al., 1996).A 12.3 kb segment of genomic sequence containing the Hoxb1locuswas included in the targeting vector. A 2.25 kb SalI fragment, derivedfrom the vector pEGFPKT1LOXNEO (Godwin et al., 1998),including the gene coding for GFP sequence (EGFP, Clontech),followed by a loxP-flanked neomycin-resistance gene, was cloned into

the unique EagI site in exon I by blunt-end ligation, placing EGFP inframe with the Hoxb1 gene (Fig. 1a). The targeting vector waslinearized with XhoI and electroporated into R1 ES cells (Nagy et al.,1993). After double selection with G418 and FIAU (Mansour et al.,1988), surviving clones were analyzed by Southern blot. To identifyhomologous recombinants, a 0.6 kb 5′ flanking probe was used withBamHI-digested DNA (Fig. 1b). To show that no random integrationof the targeting vector had occurred and that only one copy of the neogene was present, as a result of homologous recombination, a neoprobe (a 0.75 kb PstI fragment) was used to hybridize digestedgenomic DNA (data not shown). Positive clones were subsequentlyinjected into C57BL/6J (BL6) blastocysts and the resulting chimericmales bred with BL6 females. Offspring harboring the targeted allelewas identified by Southern blot using the same probe as describedabove (data not shown). A neo-resistance cassette, flanked by loxPsites, was located 3′ to the fusion gene.

Previously, we have encountered several examples where removalof the neo gene has been critical for appropriate expression of thereporter gene and/or to obviate problems associated with interferenceof the neo gene with the expression of neighboring genes (Barrow andCapecchi, 1996; Olson et al., 1996). For this reason, the loxP-flankedneo selection marker in the Hoxb1GFPne° allele was removed byCre/loxP-mediated recombination in vivo. This was accomplished bycrossing females heterozygous for the Hoxb1GFPne° allele with malemice transgenic for the Cre-deleter gene (Schwenk et al., 1995). Theoffspring from these intercrosses were screened for excision ofthe neo gene by PCR. The following neo primers, resulting in a355 bp product, were used: 5′GTGCTCGACGTTGTCACTGAAG3′(forward primer) and 5′CCATGATATTCGGCAAGCAGGC3′(reverse primer). The PCR conditions were one cycle at 94ºC for 1minute, then 94ºC, 30 seconds; 60ºC, 20 seconds; 72ºC, 1 minutefor 28 cycles and finally 72ºC for 7 minutes. The neo-less Hoxb1GFP

mice were then backcrossed to BL6 mice for two generations.Heterozygous Hoxb1GFP mice were subsequently intercrossed, whichproduced wild-type, heterozygous, and homozygous littermates in theexpected Mendelian ratio. The mice were genotyped by PCR using aset of three primers. These were as follows: Hoxb1 sense primer,5′AGCGCCTACAGCGCCCCAACCTCTTTT3′ (nucleotides 153-179, upstream of the EagI cloning site); Hoxb1 antisense primer,5′CTTGACCTTCATCCAGTCGAAGGTCCG3′ (nucleotides 615-64, downstream of the EagI cloning site) (Frohman et al., 1990) andGFP antisense primer, 5′ATGGTGCGCTCCTGGACGTAGCCTT3′.The PCR conditions were one cycle at 94°C for 1 minute and then94ºC, 30 seconds; 60ºC, 30 seconds; 68ºC, 2 minutes for 30 cycles.The wild type allele product was 489 bp and the Hoxb1GFP alleleproduct was 353 bp (Fig. 1c). The phenotype of mice homozygousfor the Hoxb1GFP mutation was indistinguishable from micehomozygous for our previously described mutant alleles of Hoxb1(Barrow and Capecchi, 1996; Goddard et al., 1996; Rossel andCapecchi, 1999).

Fluorescence imagingEmbryos used for detection of GFP fluorescence were the progeny ofHoxb1GFP-heterozygous intercrosses or crosses between Hoxb1GFP

homozygous males and C57BL/6J females. Embryos were harvestedbetween embryonic days 8.5 and 14.5 (E8.5-E14.5), and maintainedat room temperature in Leibovitz’s L-15 medium during imaging witha Bio-Rad MRC 1024 Laser Scanning Confocal Imaging Systemconnected to a Leitz Aristoplan microscope. Hoxb1GFP homozygotesdo not produce GFP protein in the hindbrain after E8.0 becausemaintenance of Hoxb1expression in r4 requires Hoxb1 autoregulation(Pöpperl et al., 1995).

ImmunohistochemistryEmbryos were fixed in 4% paraformaldehyde in PBS and processedfor single- or double-immunolabeling as transverse sectioned tissues.After immunolabeling, sections were then analyzed by confocal

G. O. Gaufo, P. Flodby and M. R. Capecchi

5345Hoxb1 and specification of neuronal subtypes

microscopy. Antibodies were used at the following dilutions: rabbitpolyclonal anti-Hoxb1 (Covance, Berkeley, CA), 1:200; mousemonoclonal anti-Shh, anti-HNF3β, anti-Pax6, anti-Nkx2.2 and anti-Isl1 (Developmental Hybridoma), 1:20; mouse monoclonal anti-Mash1, 1:20 (D. J. Anderson); and rabbit polyclonal anti-Phh3(Upstate Biotechnology, Waltham, MA). Fluoroscein-, Texas Red-, orCy5-conjugated secondary antibodies were obtained from JacksonImmunoresearch (Westgrove, PA).

Analysis of apoptosisThe TUNEL assay was used to detect apoptotic cell death in fixed,frozen transverse sections of E9.0-E12.0 embryos following themanufacturer’s protocol (Roche).

In situ hybridizationWhole-mount RNA in situ hybridization was performed as previouslydescribed (Manley and Capecchi, 1995; Goddard et al., 1996).

RESULTS

Visualization of Hoxb1-expressing neuronalcolumns during hindbrain developmentThe dynamic changes in Hoxb1 expression were monitored inlive mouse embryos using a targeted allele of Hoxb1in whichthe vital reporter gene for GFP, was fused, in frame, with thefirst protein encoding exon of this gene (Fig. 1; for details seeMaterials and Methods). The sensitivity of the Hoxb1GFP

reporter allowed detection of cell body migratory processesand axon-specific labeling of r4-derived neurons in liveembryonic tissues. In the present study we used the Hoxb1GFP

allele to monitor the spatiotemporal appearance of Hoxb1-positive neuronal columns during hindbrain development.

At E8.5 (six somites), Hoxb1GFPwas highly expressed alongthe entire AP neural axis up to the level of the presumptive r3-r4 boundary. Dorsal views show that Hoxb1GFPwas expresseduniformly in r4 (Fig. 2a, arrowheads). At this stage,reconstruction of the hindbrain from 5 µm sections showed thatall discernible nuclei in r4, approximately 1000, express Hoxb1(data not shown). Hoxb1GFP could also be seen in a moreanterior domain (r3) than has been previously reported (Fig.2a, arrow) (Murphy et al., 1989; Frohman et al., 1990; Murphyand Hill, 1991). At the posterior boundary of r4, a transverseband of cells not expressing Hoxb1GFPcould be seen (Fig. 2a,lower arrowhead). This reflects the onset of the r4-restrictedexpression of Hoxb1seen in later stages.

By E9.5, the hindbrain neural tube has fully closed. Inorder to visualize Hoxb1 expression in the ventricularneuroepithelium, a dorsal midline dissection along the AP axisof the hindbrain was made, and the neural tube was splayedopen (flat mount) exposing the ventricular surface. At E9.5(21 somites), two distinct Hoxb1GFP-expressing columns,corresponding to the basal (ventral) and the alar (dorsal) platesof r4, were visible on each side of the neural tube (Fig. 2b). Inslightly older embryos (E9.5, 27 somites), the formation of aHoxb1GFP-expressing intermediate column could be seen (Fig.2c). To confirm that the Hoxb1GFPsignal accurately reflects theexpression of endogenous Hoxb1 protein, immunolabeling ofE10.5 and E11.5 wild-type mice was performed using aHoxb1-specific polyclonal antibody (Goddard et al., 1996). AtE10.5, the ventral, intermediate and dorsal columns, containingearly differentiating neurons, were condensed, as compared

with younger embryos (Fig. 2d and data not shown). IntenseHoxb1 labeling could also be seen in the anterior and posteriorboundaries of r4. By E11.5, numerous Hoxb1-expressingcolumns containing later-born neurons had formed along theDV axis of r4 (Fig. 2e). Hoxb1GFP was similarly expressed inlive E10.5 and E11.5 Hoxb1GFP heterozygous mice (data notshown).

In summary, continuous analysis of Hoxb1 expression alongthe neural tube DV axis has shown that early in development,E8.0-E8.5, all of the cells in r4 express Hoxb1. Subsequent tothis stage, Hoxb1 expression first becomes concentrated to twozones within r4, the alar and basal plates, and then to a third,the intermediate zone. As neural development continues, moreHoxb1-expressing columns, of increasing refinement, become

Fig. 1. Targeted disruption of the mouse Hoxb1gene . (a) Schematicrepresentation of the Hoxb1GFPne° targeting vector (top), Hoxb1locus (upper middle), Hoxb1GFPne° recombinant allele (lowermiddle) and removal of neoby Cre-mediated recombination toproduce Hoxb1GFP allele (bottom). (b) Southern transfer analysis ofBamHI-digested genomic DNA from parental ES clone (lane 1) andan ES clone that has undergone homologous recombination (lane 2).Using a 5′ flanking probe (5′ fp), the wild-type gene is identified by a6.7 kb BamHI fragment, whereas the Hoxb1GFPne° allele has a 5.2 kbfragment. (c) Genotype analysis of tail DNA by PCR from Hoxb1GFP

heterozygous crossing showing wild-type (lane 1, 489 bp band),heterozygous (lane 2, 489 and 353 bp bands) and homozygous (lane3, 353 bp band) littermates. B, BamHI; p, loxP site; GFP, greenfluorescent protein gene; neo, neomycin resistance gene; TK, herpessimplex virus thymidine kinase gene.

5346

apparent. The segregation of increasing numbers of Hoxb1-expressing columns parallels the concomitant formation ofincreasing numbers of neuronal subtypes within r4 (TaberPierce, 1973; Marin and Puelles, 1995).

Migration pattern of the facial branchiomotorneuronsA very prominent population of neurons that are specifiedwithin r4 consist of those that innervate the muscles offacial expression, the facial branchiomotor (FBM) neurons(Goddard et al., 1996; Studer et al., 1996). However, innewborn animals these motoneurons are located within theventrolateral region of the r6-derived upper medulla. Themigration pattern of these motoneurons from r4 to theventrolateral region of r6 is shown in Fig. 2f-i by a series oftransverse sections of the hindbrain of E11.5 heterozygousHoxb1GFP embryos. Sections from levels spanning r4 to r6were immunostained with anti-Shh to distinguish Hoxb1GFP-

expressing cells (green) from the Shh-expressing floor plate(red). In ventral-r4, Hoxb1GFP expression was primarilyobserved in the ventricular and mantle layers of theneuroepithelium, juxtaposed to the floor plate (Fig. 2f). Thisregion contains proliferating progenitor and earlydifferentiating neurons, respectively. However, a smallpopulation of HoxbGFP-expressing neurons was visible in themarginal layer that contained more differentiated neurons. AsHoxb1GFP-expressing neurons migrated posteriorly into r5,they formed a distinct cluster in the mantle layer immediatelylateral to the ventral progenitor domain (VPD). The VPD is aregion containing progenitor cells juxtaposed to the Shh-expressing floor plate (Fig. 2g,h; defined molecularly in thenext section). At the level of r6, the HoxbGFP-expressing FBMneurons took a lateral course into the marginal layer of theneuroepithelium to contribute to the formation of the facialnucleus (VIIn, Fig. 2i).

At E12.5, the expression of Hoxb1GFPpersisted in columns


Fig. 2. Spatiotemporalappearance of Hoxb1-positiveneuronal columns in r4.(a) Dorsal view E.8.5, six-somiteembryo expressing Hoxb1GFP

uniformly in the presumptive r4(between arrowheads).Hoxb1GFPis also expressed inmore anterior domains in thedorsal region of r3 (arrow). TheHoxb1GFP-negative stripe belowr4 (lower arrowhead) indicatesthe downregulation of Hoxb1GFP

expression in the posteriorhindbrain region. (b) Ventricularview of E9.5, 21-somite embryoexpressing Hoxb1GFPin theventricular neuroepithelium ofr4. The hindbrain was splitdorsally and splayed with theventricular surface exposed toshow Hoxb1GFP-expressingventral and dorsal columnscorresponding to regions of thebasal and alar plates,respectively. (c) A slightly olderembryo (E9.5, 27 somites)exposing the ventricularneuroepithelium to show theappearance of a Hoxb1GFP-expressing intermediate column.(d) Hoxb1-immunolabeling ofE10.5 embryo shows three distinct ventral, intermediate and dorsal columns. Hoxb1-immunolabeling can also be seen in the anterior andposterior boundaries of r4 and in the posterior migrating branchiomotor neurons of the facial nucleus in ventral r5. (e) Hoxb1-immunolabelingof E11.5 embryo shows the appearance of more Hoxb1-expressing columns. (f-i) Transverse sections from AP levels spanning r4 to r6 of E11.5Hoxb1GFP heterozygous embryo demonstrating the developing facial nucleus. The sections were immunolabeled with anti-Shh (red) todistinguish the floor plate from the developing Hoxb1GFP-expressing cells. Hoxb1GFP-expressing progenitor and early differentiating cells in r4are located immediately dorsolateral to the Shh-expressing floor plate (f). The posteriorly migrating Hoxb1GFP-expressing neurons in r5 havetaken a position lateral to the ventral progenitor domain that juxtaposes the floor plate (g,h). In r6, the prospective upper medulla, Hoxb1GFP-positive neurons of the facial nucleus have taken a ventrolateral position in the marginal layer of the neuroepithelium (i). (j,k) Ventricular andpial views of Hoxb1GFP-labeled live, E12.5 embryonic tissue. Ventricular view of the hindbrain shows r4-specific neuronal columns and theposterior migrating neurons of the facial nucleus (j). Pial view of the same embryo in j shows extensive migration along the AP and DV axes ofr4-derived Hoxb1GFP-labeled neurons (k). The facial nucleus (VIIn) and the axonal projections (brackets) of r4-derived neurons are also labeledby Hoxb1GFP. Hoxb1GFP-labeled, commissural axons are also visible traversing at the level of the floor plate (arrow). A, anterior; D, dorsal;Fp, Floor plate; I, intermediate; P, posterior; r, rhombomere; V, ventral; VIIn, facial nucleus.


arrayed along the DV axis of the ventricular neuroepithelium(Fig. 2j). Furthermore, Hoxb1GFPexpression could still be seenamong posteriorly migrating FBM neurons located in the deepermantle layer. The morphology of migrating neurons in r5 waspyramidal, with their apical dendritic ends facing in the directionof their migratory path (data not shown). The extensivemigration patterns of neurons derived from r4 can be visualizedby exposing the pial surface of the hindbrain of E12.5, Hoxb1GFP

heterozygous embryos (Fig. 2k). In contrast to the ventricularlayer, where Hoxb1GFP-positive progenitor cells were restrictedto an r4 region, the marginal layer contained differentiatedHoxb1GFP-positive neurons, which were seen in r4 as well as inmore anterior and posterior regions of the hindbrain. Themigration pattern of the FBM neurons and their lack of migrationin Hoxb1 mutant homozygotes, has been well documented(Goddard et al., 1996; Studer et al., 1996; Pata et al., 2000). Here,we show that in addition to the FBM neurons, there was alsoextensive migration of non-branchiomotor, Hoxb1-expressingneurons rostral to r4. This observation provides an explanationof how disruption of Hoxb1 results in perturbation of theorganization of neurons in r3, a region that is rostral to the

majority of Hoxb1-expressing cells (data not shown). By E14.5,the expression of Hoxb1, as detected by Hoxb1GFP andconfirmed by Hoxb1 immunostaining, continues to be observedin the developing hindbrain (data not shown). This continuedexpression suggests functions for Hoxb1 during later periods ofhindbrain development.

Hoxb1 is required for specification of the ventralprogenitor domain in r4The most prominent feature of Hoxb1 mutant homozygous miceis a failure to specify at least two pools of motoneurons: theFBM and contralateral vestibuloacoustic efferent (CVA)neurons (Goddard et al., 1996; Studer et al., 1996; Pata et al.,2000). In the spinal cord, specification of motoneurons iscrucially dependent on Shh signaling (Chiang et al., 1996;Ericson et al., 1996, 1997; Briscoe et al., 1999; Pierani et al.,1999). To determine whether this signaling pathway is affectedby the Hoxb1 mutation, we examined the cellular organizationof the floor plate in r4, using two floor plate-specific markersShh and HNF3β (Foxa2 – Mouse Genome Informatics; Ruiz iAltaba et al., 1993; Weinstein et al., 1994; Chiang, 1996;Ericson et al., 1996). At all stages examined, the pattern of Shhexpression in the r4 floorplate of homozygous mutants wasindistinguishable from that of wild-type or heterozygouscontrols (Fig. 3a,b and data not shown). This is in contrast towhat was observed for HNF3β expression. In the spinal cordand most regions of the hindbrain, HNF3β expression wasrestricted to the floor plate. In ventral r4, however, HNF3β wasdetected in two distinct domains (Fig. 3c-f and data not shown):the most ventral domain, corresponding to the Shh-expressingfloor plate, and a more dorsal domain that co-expresses Hoxb1.We will refer to the more dorsal of the two HNF3β-expressingdomains as VPD. This domain appears to be unique to r4and may represent an important signaling center for this

Fig. 3. Cytoarchitecture of r4-specific ventral progenitor domain isdisrupted in Hoxb1mutant mice. (a,b) In transverse sections of E11.5embryos, the expression of phosphorylated histone H3 (Phh3, blue)is observed among actively dividing progenitor cells in ventral r4 andin the inner layers of Shh-expressing floor plate cells (red). In controlmice, Phh3 is restricted to the innermost neuroepithelial layer of theof the ventral progenitor domain (VPD); whereas in the dorsalregion, Phh3 is expressed in cells extending into the mantle layer(compare similarities with Mash1 expression in g). In Hoxb1 mutantmice, Phh3-expressing progenitor cells in the VPD cells haveexpanded into the mantle layer. At this level of analysis, it is difficultto detect appreciable changes in the expression of Shh in the floorplate between control and Hoxb1mutant mice. (c,d) In E11.5 controlembryos, HNF3β-immunolabeling (red) shows two distinct,expression domains: a ventral domain corresponding to the floorplate and a more dorsal region corresponding to the VPD, which co-expresses PHH3 (blue). In Hoxb1 mutant mice, HNF3β-expressingprogenitor cells in the VPD are reduced and have expanded into themantle layer of the neuroepithelium. (e,f) In E11.5 control embryos,Hoxb1-positive progenitor cells (green) are co-expressed with thedorsal domain of HNF3β (red). In Hoxb1mutant mice, HNF3β-expressing progenitor cells have expanded into the mantle layerformerly occupied by Hoxb1-expressing FBM neurons. (g,h) InE11.5 control embryos, Mash1 (green) expression is restricted to theinner ventricular neuroepithelium of the VPD. In Hoxb1mutantmice, Mash1-positive progenitor cells have expanded into the mantlelayer.

5348

rhombomere. Fig. 3c,g shows that this domain also expressesphosphorylated histone H3 (Phh3) and Mash1. Mash1 labelsearly neuronal progenitor cells, whereas Phh3 is a marker foractively dividing cells (Johnson et al., 1990; Gradwohl et al.,1996; Lee, 1997; Ma et al., 1997; Wei et al., 1999). As expectedin wild-type embryos, Mash1 and Phh3-expressing cells werefound close to the inner ventricular layer (i.e., the proliferativelayer of the developing neural tube). Fig. 3d shows that theintegrity of the VPD, the more dorsal HNF3β expressiondomain, requires Hoxb1 function, since in the absence ofHoxb1, the cytoarchitecture of this zone was disorganized. InHoxb1 mutant homozygous embryos, cells expressing Mash1and Phh3, which are normally restricted to the ventricular layer,had expanded into the mantle layer, a region normally occupiedby postmitotic, early differentiating neurons (Fig. 3b,d,f,h).This aberrant behavior of cells in Hoxb1 mutant homozygotessuggests a deficiency in neuronal specification, such that cellsleaving the ventricular layer have not appropriately turned offexpression of these genes. Furthermore, as indicated by thecontinued expression of Phh3, these cells continue to divideaberrantly.

Changes in Nkx2.2, Pax6 and Isl1 expression in r4 ofHoxb1 mutant miceIn the ventral spinal cord, the activities of the transcriptionfactors Nkx2.2, Pax6 and Isl1 are required for interpretation ofthe floor plate intercellular signal, Shh (Ericson et al., 1996,1997; Briscoe et al., 1999, 2000). These molecules are requiredfor proper formation of motoneurons and ventral interneurons.As a further indication that the motoneuron population in r4 isnot properly specified in Hoxb1 mutant embryos, the normalexpression pattern of these transcription factors is markedlyperturbed by this mutation (Fig. 4).

In normal embryos at E11.5, approximately 18-20 layers ofcells expressing Nkx2.2 could be viewed in transverse section(Fig. 4a). This figure shows such a section through the ventralregion of r4. In Hoxb1mutant homozygotes, there was a lossof Nkx2.2 expression in the most dorsal aspect of thisexpression domain, which now occupies only approx. 12 celllayers (Fig. 4b). As described for Mash1 and Phh3, thistranscription factor also remained active in cells that wereleaving the ventricular surface and progressing towards themantle layer. Moreover, the Pax6-expression domain expandedventrally in Hoxb1 mutant embryos into the region thatformerly expressed Nkx2.2 (Fig. 4c,d). This observation isconsistent with the reported role of Nkx2.2 as a negativeregulator of Pax6 expression (Briscoe et al., 1999, 2000).

In the r4-region of E11.5 mouse embryos, Isl1 prominentlylabelled both the FBM and CVA (contralateralvestibuloacoustic) neurons, and a population of ventrolateral(VL) neurons scattered along a ventral-dorsal region of themantle layer (Fig. 4e). Expression of this protein is one of theearliest postmitotic markers for motoneurons along the entireextent of the neural tube (Ericson et al., 1996, 1997; Pfaff,1996). In Hoxb1 mutant homozygous embryos, the two Isl1-labeled motor pools, FBM and CVA, were not observed,whereas the Isl1-labeled VL neuron population had increasedin number and was displaced more dorsally (Fig. 4f and datanot shown).

Increased cell death in Hoxb1 mutant embryosTo determine how the two motoneuron pools (FBM and CVA)are lost in Hoxb1 mutant mice, we performed TUNEL assaysto assess possible loss via programmed cell death. In Hoxb1mutant mice, we observed a dramatic increase in apoptosis inr4 (Fig. 5a,b). This wave of ectopic cell death began at E9.5


Fig. 4. Effectors of SHH-mediated DV patterning is defectivein Hoxb1mutant mice. (a,b) Nkx2.2-positive progenitor cells(red) co-express Hoxb1 (green) in transverse sections of E11.5control embryos. In r4 of control tissues, Nkx2.2-expressingprogenitor cells (red) are confined to the inner layers of theventral neuroepithelium juxtaposed to the floor plate. In Hoxb1mutant mice, Nkx2.2-expressing progenitors are reduceddorsally and have expanded into the mantle layer formerlyoccupied by postmitotic, Hoxb1-expressing neurons (arrows).(c,d) Pax6-positive progenitor cells (red) co-express Hoxb1(green) in E11.5 control embryos. The Pax6-positiveprogenitor domain complements the more ventral Nkx2.2-positive VPD. In Hoxb1mutant mice, the progenitor domainsof both Pax6 and Nkx2.2 are shifted ventrally (arrows). (e,f) InE11.5 control embryos, Isl1 (red) is expressed in at least threepopulations of cells in ventral r4: the facial branchiomotormotor (FBM) neurons, the contralateral vestibuloacousticefferent (CVA) neurons, and a population of ventrolateral (VL)neurons. At this stage, Hoxb1 (green) is primarily co-expressed with Isl1-positive FBM. While the FBM and CVAare missing in Hoxb1mutant mice, the VL population hasexpanded dorsolaterally in the ventral region of r4.


and was finished by E10.5. This increase in apoptosis in r4 ofHoxb1 mutant embryos was not restricted to just the ventralaspect of the neural tube, where motoneurons are normally

formed, it was also seen in intermediate and dorsal zones thatcoincide with the three zones normally occupied at this stageby cells expressing high levels of Hoxb1 (Fig. 2c,d). Fig. 5c-hillustrate parts of transverse sections through r4 at highermagnifications. These figures highlight the cellular detail ofapoptosis occurring in these three zones in Hoxb1 control andmutant embryos. The sections were also immunolabeled forPhh3 to delineate the distribution of dividing cells within theseregions. From these figures, it is apparent that in Hoxb1mutants, cells are aberrantly dying in r4 throughout the extentof the neuroepithelium, from the inner ventricular to the outerpial surfaces. In particular, note that cells, at the position of thevery early, still proliferating neural progenitors, are dying. Thismay explain the absence of Isl1-positive FBM and CVAneurons normally seen at later stages (Fig. 4e,f).

Hoxb1 is epistatic to Phox2b in r4Pattyn et al. (2000) have recently demonstrated that theformation of the branchial and visceral motoneurons in thehindbrain is crucially dependent on the function of the paired-like homeodomain transcription factor, Phox2b. In mouseembryos homozygous for Phox2b loss-of-function mutations,the branchial and visceral motoneurons of the brainstem arenot properly specified. These neurons do not express earlypostmitotic molecular markers common to motoneurons, suchas Isl1 and Phox2a. Moreover, they do not turn off earlyneuronal progenitor markers such as Mash1 and Nkx2.2.Progenitors continue to divide as they migrate from theventricular to the mantle layer, and they are programmed forcell death at E10.5. The aberrant cellular phenotype of thebranchial motor neurons in Phox2b mutants is very similar tothe mutant cellular phenotype described above for the r4-component of this motoneuron system in Hoxb1 mutantembryos, suggesting possible involvement of these twotranscription factors in a common genetic pathway.

Fig. 6 shows that Hoxb1 is epistatic to Phox2b for theformation of the FBM neurons. At the onset of Phox2bexpression, E9.5 (Pattyn et al., 1997), the dorsal region of ther4 VPD domain was significantly depleted in mutant comparedwith control embryos, whereas the more ventral VPDmaintained the expression of Phox2b (Fig. 6a,b). At this stage,the dorsal VPD was occupied by a significant number ofTUNEL-positive cells (Fig. 6b). At a slightly later time point,E10.0, the entire VPD was almost completely devoid ofPhox2b-expressing progenitor cells with significant numbersof TUNEL-positive cells occupying this region (Fig. 6c,d).After E10.5, few TUNEL-positive cells were detected in r4 ofcontrol and mutant embryos (data not shown). By E11.0-E11.5,the expression of Phox2b in the r4 VPD of mutant embryoswas completely absent compared with control embryos (Fig.6e-h). However, an expanded population of cells expressingIsl1 and/or Phox2b was observed in the marginal layer ofventral r4. The loss of Phox2b expression in the dorsal VPDwas supported by a similar loss of Nkx2.2 expression in thisprogenitor pool (Fig. 6g,h). The expanded population ofNkx2.2-expressing progenitor cells in the ventral region of theVPD corresponded to an increase of Isl1- and Phox2b-expressing VL neurons (Fig. 6e-h). The overall requirementalong the DV axis of r4 neuronal columns expressing Phox2band its effector, Phox2a, on Hoxb1 is demonstrated in Fig. 6i-l. From these flatmount preparations, it is apparent that by

Fig. 5. Mutation of Hoxb1results in programmed cell death duringearly neurogenesis of r4. (a,b) The TUNEL assay was used to detectapoptotic cells (red) in transverse sections through r4 of E9.5embryos. Apoptosis was observed sporadically in control tissues,whereas in Hoxb1mutant mice, programmed cell death was observedextensively throughout the entire DV region of the neuroepitheliumin r4. (c-h) Detection of actively dividing cells with Phh3 (green) andapoptotic, TUNEL-positive cells (red) in the ventral, intermediateand dorsal regions through r4 of E9.5 embryos. In control tissue(c,e,g), Phh3-expressing cells are restricted to the inner ventricularneuroepithelium with few detectable TUNEL-positive cells. InHoxb1mutant mice (d,f,h), apoptotic cells are detected throughoutthe neuroepithelium; more specifically, from the ventricular layer(arrows) to the marginal layer.

5350

E11.5 the entire Phox2b and Phox2a expressing, FMB neuralpopulation has gone in the Hoxb1 mutant embryos (Fig. 6jand l), as well as the r4 components of restricted, moredorsal neural columns. Taken together, these experimentsdemonstrate that Hoxb1 function is required to activate andmaintain cells expressing one of the earliest knowntranscription factors needed for specification of the r4components of the branchiomotor system.

Hoxb1 is required for specification of neurons alongthe entire dorsoventral extent of r4Examination of Fig. 6 shows that the Hoxb1mutation not onlyaffects the formation of the r4-component of the branchiomotorsystem, but also the r4 component of intermediate and dorsalneural columns that express Phox2a and Phox2b (arrow),

respectively. As an example, the r4-component of the mostdorsal Phox2b-expressing column is absent in Hoxb1 mutanthomozygous embryos (Fig. 6j). Similarly, the r4 component ofthe intermediate column that expresses Phox2ais also absent inHoxb1 mutant embryos (Fig. 6l). These results show that Hoxb1is not only involved in the specification of motoneurons withinr4, but in the specification of neurons throughout the DV extentof r4. These results are entirely consistent with the reportrecently published by Davenne et al. (1999) that demonstrated arole for Hoxa2 in the specification of neurons along DV extentof r2 and r3. Consistent with the early mis-specification ofneurons throughout the DV extent of r4, Hoxb1 mutants showed


Fig. 6.Hoxb1is required early in the specification of progenitors ofthe facial branchiomotor neurons. (a-d)Transverse sections throughthe r4 ventral progenitor domain (VPD) immunolabeled with Phox2b(green) and the TUNEL assay to detect apoptotic cell death (red).(a) In control E9.5 embryo, Phox2b is expressed in the ventral neuraltube throughout the neuroepithelium from the ventricular layer(arrow) to the outer marginal layer. Few detectable TUNEL-positivecells are observed within the Phox2b-expressing domain of controlembryos. (b) In a Hoxb1-mutant embryo, Phox2b-expressing cellsare dramatically reduced in the ventricular layer with significantnumbers of TUNEL-positive cells throughout the ventricular andmarginal neuroepithelium. (c) In a slightly older, control embryo(E10.0), Phox2b expression remains throughout the ventralneuroepithelium with few, sporadic TUNEL-positive cells. (d) In anE10.0 Hoxb1-mutant embryo, few Phox2b-expressing cells aredetected in the ventricular layer (arrow) of the neuroepithelium withan appreciable amount of TUNEL-positive cells. (e-h)In an E11.0control embryo, Phox2b expression (green) remains in two distinctregions in the ventricular layer (arrow) of the r4 VPD: a dorsal andventral region (e). Postmitotic cells representing the FBM and CVAneurons emerging from the r4 VPD co-express Phox2b and Isl1(yellow). Another population of Phox2b- and Isl1-doubled labeledcells is seen in the ventrolateral region of r4 (arrowhead), whichappear to emerge from the more ventral region of the r4 VPD. In anE11.0 Hoxb1-mutant, the r4 VPD is devoid of Phox2b-expressingprogenitor cells (arrow, f). A mixed population of cells expressingPhox2b and/or Isl are observed in the ventromedial and ventrolateral(arrowhead) region of r4. In an E11.5 control embryo, the r4 VPD(arrow) maintains its distinct cytoarchitecture, expressing both(yellow), Phox2b (green) and Nkx2.2 (red) with a cluster ofpostmitotic Phox2b-expressing cells outside of the VPD. Apopulation of Phox2b-expressing cells is also observed in theventrolateral region of the r4 VPD (arrowhead, g). In an E11.5Hoxb1-mutant embryo, the dorsal Nkx2.2-positive region of the r4VPD is absent and the more ventral region has expanded from theventricular to the marginal layer of the neuroepithelium (arrowhead,h). Moreover, the population of Phox2b-expressing cells in theventrolateral region have expanded (arrowhead). Note that betweenE11.0 and E12.0, no significant cell death were detected in eithercontrol or Hoxb1-mutant embryos in r4 (data) not shown. (i,j) In aflat-mount of E11.5 control embryo, Phox2bis expressed in threedistinct, longitudinal columns containing progenitor and earlypostmitotic neurons (i). In an E11.5 Hoxb1mutant embryo, theventral columns in r4 and r5 representing the developing andmigrating neurons of the FBM are missing (panel b, arrowhead). Thedorsal-most Phox2b-expresssing columns are also absent (arrows).(k,l) In a flat-mount E11.5 Hoxb1-mutant, Phox2ais expressed intwo distinct columns containing early, postmitotic neurons (k). In anE11.5 Hoxb1mutant embryo, the r4-component of the intermediatecolumn is missing. In the ventral region, the columns in r4 and r5representing early differentiating and migrating FBM neurons,respectively, are also absent (arrowhead).


extensive aberrant cell death in E9.5 mutant embryos in thedorsal, intermediate and ventral regions of r4 (Fig. 5).

Hoxb1 restricts the extent of Mash1 expressionwithin r4We have shown that the pattern of Hoxb1 expression in r4 is

very dynamic. Initially Hoxb1 is expressed uniformly in r4.Subsequently, its expression becomes confined to more andmore refined columns within r4. The early neural specificationdefects seen in Hoxb1 mutants suggest interactions of Hoxb1with homologues of the Drosophila proneural genes achaete-scute and atonal, the bHLH transcription factors Mash1, Ngn1and Ngn2 (Jan and Jan, 1994; Anderson and Jan, 1997; Fodeet al., 1998; Ma et al., 1996, 1997, 1998, 1999). These genesare expressed in broad columns along the length of the AP axisin proliferating and early differentiating neurons as early asE8.5 in the mouse, approx. 1 day after Hoxb1 expression isfirst detected in r4 (Guillemot and Joyner, 1993; Lee, 1997).

Comparison of the columnar expression pattern of Mash1 inHoxb1 mutant and control embryos suggests that one role ofHoxb1 is to restrict the boundaries of these columns within r4.This is illustrated in Fig. 7. Fig. 7a,b show flatmountpreparations of Hoxb1 control and mutant hindbrains labeledwith a Mash1 RNA probe. Figs 7c-l show transverse sectionsthrough r4 immunostained with Mash1 and Hoxb1 antibodies.It is apparent from these figures that in control embryos theMash1-expressing, early neural progenitor columns arejuxtaposed by columns of cells expressing high levels ofHoxb1. In Hoxb1 mutant homozygotes, the widths of theMash1-expressing columns in r4 have expanded. Very similarchanges in the widths of the r4-component of the Ngn1 andNgn2 neuronal expression columns are observed in Hoxb1mutant embryos (data not shown).

DISCUSSION

Individual members of the Hox complex are differentiallyexpressed along the embryonic AP axis. As such, they areideally suited to provide the positional cues to reiterated cell

Fig. 7.Hoxb1 is required for restricting Mash1-expressing progenitorcolumns along the DV axis of r4. (a,b) Mash1RNA in situexpression in splayed, flat-mount E11.5 embryos (preparations as inFig. 6). In r4 control embryos, Mash1is highly expressed in fourbroad, longitudinal columns in the alar and basal plates: AP and BP,respectively (a). In Hoxb1mutant mice, the column in the BP hasshifted ventrally and the columns in the AP appear as one, broadcolumn (b). The boundary between the AP and BP represents thehypothetical sulcus limitans (SL). This boundary also appears tohave shifted ventrally in Hoxb1mutant mice. The abnormal ventralshift of the SL was also observed for the expression of Pax7, Ngn1and Ngn2(data not shown). (c-l) Immunolocalization of Mash1(green) and Hoxb1 (red) in transverse sections through r4 of E11.5embryos. In control tissues, Hoxb1-positive columns appear tocomplement the neuronal columns expressing Mash1 (c). In Hoxb1mutant, the dorsal, Mash1-expressing columns have merged and theventral column has shifted toward the ventral midline (d). Highermagnification of c and d shows in detail the relationship of Hoxb1-and Mash1-expressing progenitor and early differentiating neurons(e-l). In control tissues, Mash1-expressing columns are bordered byHoxb1-positive columns. However, the expression of Mash1 andHoxb1 appear to be co-localized in a subset of progenitor cells in theventricular layer (e,g,i,k). In Hoxb1mutant mice, the expression ofMash1 has expanded into the domain formerly occupied by Hoxb1-positive postmitotic neurons (d,f,h,i,j). The expansion of Mash1-progenitor cells into the region once occupied by Hoxb1-postmitoticFBM neurons is most apparent in the ventral-most region of r4 inHoxb1mutant mice (l, arrow).

5352

types and structures, such as neurons, vertebrae and muscles,that are needed to guide their distinction along this major axis.Indeed, it appears that a major role for Hox genes duringembryogenesis is to provide such positional values to thesecells (Chisaka and Capecchi, 1991; Krumlauf, 1994; Lumsdenand Krumlauf, 1996; Duboule, 1998). The question then arises,when and through which molecular circuits are Hox positionalvalues contributed to these differentiating cells? From thestudies described here, we would argue that with respect toHoxb1 and the neurons derived from r4, this specificationoccurs very early during hindbrain neurogenesis. Specifically,Hoxb1-mediated neuronal specification appears to occur at theventricular or proliferative layer of the r4 neuroepithelium,working in parallel with molecules required for early DVpatterning, Shh and HNF3β, and those involved in neuraldetermination, Mash1, Ngn1 and Ngn2.

Fate of the facial branchiomotor neurons in Hoxb1mutant embryosThe most prominent mutant phenotype associated withdisruption of Hoxb1 is the absence of a functional FBMnucleus (Goddard et al., 1996; Studer et al., 1996; Pata et al.,2000). As a consequence, Hoxb1 mutant homozygous adultsshow complete paralysis of the muscles of facial expression,which are normally innervated by this nerve (Goddard et al.,1996). Consistent with the hypothesis that the absence of aFBM nucleus results from a failure to specify FBM neurons,early postmitotic molecular markers that normally label theseneurons, such as Isl1 and Phox2a, fail to do so in r4 and r5 ofthese mutant embryos. Even more informative, one of theearliest transcription factors known to be required forspecification of all branchial and visceral motor neurons of thebrainstem, Phox2b, is not expressed in a distinct pool ofprogenitor cells in the ventral progenitor domain of r4 ofHoxb1 mutant embryos, at any stages that we have examined.Instead, we observe that cells expressing effector molecules ofShh, such as HNF3β and Nkx2.2, that are normally associatedwith early, dividing neural progenitors, are reduced andcontinue to be expressed ectopically in the mantle layernormally occupied by postmitotic neurons. This aberrantcellular phenotype is very similar to that described by Brunetand his colleagues for mis-specified FBM neurons resultingfrom disruption of Phox2b (Pattyn et al., 2000). This isaccompanied in Hoxb1 mutant embryos by induction of a waveof ectopic apoptosis that begins at E9.5, and correspondsdirectly to the time of normal onset of FBM neuron generationand Phox2b expression (Taber Pierce, 1973; Pattyn et al.,1997). The ectopic apoptosis is, however, not restricted to theventral region of r4 in Hoxb1 mutant embryos, but extendsacross the three regions of high Hoxb1 expression. And indeed,failure to specify the r4-component of specific neuronalcolumns is observed throughout the DV extent of the neuraltube.

An alternative to the hypothesis that failure to specify theFBM neurons leads to their aberrant death in Hoxb1 mutants,is that as a consequence of this mutation, these neurons acquirea different fate. For example, in the absence of Hoxb1 geneproduct, these neurons could now behave as r2-like, trigeminal-branchiomotor neurons. This hypothesis would predict thatthese mis-specified neurons should still express Phox2b,Phox2a and Isl1, reflecting their motoneuron character.

However, the failure to detect populations of such cells inHoxb1 mutant embryos that express these markers, either inthe ventral or in ectopic regions of r4, argues against thisalternative hypothesis. There still remains the possibility thatin Hoxb1 mutant mice, later-born neurons derived from theventral r4 VPD, such as the VL neuron population, may be mis-specified, owing to their dependence on interactions withearlier-born motoneurons (McConnell, 1995; Sockanathan andJessell, 1998).

Although the fate of cells within r4 is affected by the Hoxb1mutation, the overall cytoarchitecture of this rhombomere isnot dramatically altered by this mutation (Goddard et al., 1996;Studer et al., 1996). This observation suggests that the Hoxb1mutation affects selective cell populations within r4 and thatthe wave of ectopic apoptosis observed in r4 does notdramatically alter the final cell number within thisrhombomere. Interestingly, in Hoxb1 mutant embryos we alsoobserve ectopic expansion of cell proliferation identified byPhh3 expression, extending from the ventricular to the mantleneuroepithelial layers. This increase in cell proliferation may,in part, compensate for the loss of cells via aberrant apoptosisearly in neurogenesis.

Dorsoventral patterning of neurons in the hindbrainDavenne et al. (1999) have recently shown that Hoxa2playsan important role in the DV patterning of neurons within r2and r3. As observed for the Hoxb1 mutation, disruption ofHoxa2 selectively affects the formation of the r2/r3-componentof neuronal columns that express transcription factors, such asPax6 and Phox2b, that are in turn involved in the specificationof neuronal subtypes. Together, these observations emphasizethat the neuronal columns that extend longitudinally acrossmultiple rhombomeres and even into the spinal cord, are builtin modules, with different Hox genes being responsible for theformation of the separate modules. Concomitant with this earlyrole of Hox genes in neuronal specification, the progenitor cellsautomatically acquire a positional value along the AP axis, thatallows them to be distinguished from similar cells within acontiguous longitudinal functional column. These observationsalso emphasize that these Hox genes are epistatic to the set oftranscription factors that are used to specify neuronal subtypedifferentiation. The obvious advantage of this strategy is thatpositional value can be assigned to multiple neuronal subtypeswithin an AP region, rather than having to ascribe positionalcues individually to each subtype subsequent to itsspecification.

Interestingly, Hoxb1 mutant mice also show defects in thefunction of the lacrimal and salivary glands (Goddard etal., 1996). These glands are innervated by postganglionicparasympathetic neurons of the pterygopalatine andsubmandibular ganglia, respectively (Carpenter and Smith,1988). These ganglia are in turn innervated by preganglionicparasympathetic neurons of the superior salivatory nucleus.The source of these visceral efferent neurons has not been wellestablished. They may arise in r5, or they may be born in r4and migrate into r5. In either case, their function is affected bythe Hoxb1 mutation. However, the expressivity of this defectin Hoxb1 is variable. Generally, variability in expressivity of amutant phenotype in Hox mutants is associated with theparticipation of more than one Hox gene in that function.Therefore, it may be possible that Hox genes expressed in r5,



such as members of the Hox3 paralogous family, are goodcandidates for such a shared function with Hoxb1.

A potential role for Hoxb1 in the restriction and/orreinforcement of neuronal subtypesTo examine the role of Hoxb1 during early neuraldifferentiation, the effects of the Hoxb1 mutation on cellsexpressing the neural-specific bHLH transcription factors werestudied. From an examination of in situ hybridization andimmunohistochemical patterns of flat-mount and transversesection preparations, respectively, it is apparent that the broadlongitudinal columns expressing Mash1, Ngn1 and Ngn2 arejuxtaposed in r4 with columns of cells expressing high levelsof Hoxb1. In the absence of Hoxb1, the width of these columnsexpands in r4, suggesting that Hoxb1 normally restricts thedomains of these early neural progenitor cells. Since it has beenshown in multiple laboratories that in both Drosophila andvertebrates the early neural progenitor domains are restrictedand reinforced by the Delta/Serrate/Notch signaling pathways(Jan and Jan, 1994; Heitzler et al., 1996; Anderson and Jan,1997; Panin et al., 1997), it is attractive to consider that therestriction of the Mash1, Ngn1 and Ngn2 domains within r4 byHoxb1 is also mediated by the same signaling pathway. On thebasis of this hypothesis, it will be of interest to determinewhether the production of successively more refined Hoxb1-expressing columns within r4 is involved in restricting and/orreinforcing increasing numbers of neuronal subtype columnswithin this rhombomere.

In Hoxb1 mutant mice, there is a loss of r4-dorsal andintermediate columns expressing Phox2b and Phox2a,respectively. Interestingly, in Mash1 mutant mice, there isalso a loss of the same Phox2b-expressing column, but incontiguous dorsal columns along the hindbrain (Hirsch etal., 1998). Together, these data suggest that these twotranscriptional systems work in parallel with each other duringneural determination of common progenitors, and providefurther support for Hoxb1 contributing the AP-specificinformation to progenitor cells that may otherwise be similaralong the length of the hindbrain.

In conclusion, the present study provides evidence thatHoxb1 is required for the formation of multiple neuronalsubtypes along the full extent of the DV axis of r4. The role ofHoxb1 appears to be required very early during hindbrainneurogenesis in parallel with molecules required for DVpatterning and neural determination, and prior to the activationof the transcription factors such as Nkx2.2, Isl1, Phox2b andPhox2a, which are used to specify neuronal subtypes. In theabsence of Hoxb1, the r4-component of multiple neuronalsubtypes fails to be properly specified and is then destined foraberrant programmed cell death.

We are deeply grateful to members of the Capecchi laboratory foruseful discussion and comments, to members of the mouse and tissueculture facilities for technical support, and to L. Oswald forpreparation of the manuscript. We also thank the following scientistsfor providing valuable reagents: D. Anderson, J. Brunet, C. Goridis,F. Guillemot, R. Kageyama and Q. Ma. Monoclonal antibodies againstSHH, HNF3β, Pax6, Nkx2.2, and Isl1 were obtained from theDevelopmental Hybridoma Bank under the contract N01-HD-62915.P. F. was supported by the Wenner-Gren Foundations. G. O. G. is aresearch associate of the Howard Hughes Medical Institute.

REFERENCES

Altman, J. and Bayer, S. A.(1980). Development of the brain stem in the rat.11. Thymidine-radiographic study of the time of origin of neurons of theupper medulla, excluding the vestibular and auditory nuclei. J. Comp.Neurol. 194, 37-56.

Anderson, D. J. and Jan, Y. N.(1997). The determination of the neuronalphenotype. In Molecular and Cellular Approaches to Neural Development(ed. W. M. Cowan, T. M. Jessell and S. L. Zipursky), pp. 26-63. New Yorkand Oxford: Oxford University Press.

Barrow, J. R. and Capecchi, M. R.(1996). Targeted disruption of the hoxb-2 locus in mice interferes with expression of hoxb-1 and hoxb-4.Development122, 3817-3828.

Bell, E., Wingate, R. J. and Lumsden, A.(1999). Homeotic transformationof rhombomere identity after localized Hoxb1 expression. Science284,2168-2171.

Briscoe, J., Pierani, A., Jessell, T. M. and Ericson, J.(2000). Ahomeodomain protein code specifies progenitor cell identity and neuronalfate in the ventral neural tube. Cell 101, 435-445.

Briscoe, J., Sussel, L., Serup, P., Hartigan-O’Connor, D., Jessell, T. M.,Rubenstein, J. L. and Ericson, J. (1999). Homeobox gene Nkx2.2 andspecification of neuronal identity by graded Sonic hedgehog signalling.Nature398, 622-627.

Capecchi, M. R.(1997). The role of Hox genes in hindbrain development. InMolecular and Cellular Approaches to Neural Development(ed. W. M.Cowan, T. J. Jessell and S. L. Zipursky), pp. 334-355. New York and Oxford:Oxford University Press.

Carpenter, M. B. and Sutin, J. (1983). Human Neuroanatomy.8th edn.Baltimore and London: Williams and Wilkins.

Carpenter, E. M., Goddard, J. M., Chisaka, O., Manley, N. R. andCapecchi, M. R. (1993). Loss of Hox-A1 (Hox-1.6) function results in thereorganization of the murine hindbrain. Development118, 1063-1075.

Chiang, C., Litingtung, Y., Lee, E., Young, K.E. Corden, J.L., Westphal,H. and Beachy, P.A.(1996). Cyclopia and defective axial patterning in micelacking Sonic hedgehog gene function. Nature383, 407-413.

Chisaka, O. and Capecchi, M. R. (1991). Regionally restricteddevelopmental defects resulting from targeted disruption of the mousehomeobox gene hox-1.5. Nature 350, 473-479.

Davenne, M., Maconochie, M. K., Neun, R., Pattyn, A., Chambon, P.,Krumlauf, R. and Rijli, F. M. (1999). Hoxa2 and Hoxb2 controldorsoventral patterns of neuronal development in the rostral hindbrain.Neuron22, 677-691.

Dollé, P., Izpisúa-Belmonte, J.-C., Falkenstein, H., Renucci, A. andDuboule, D. (1989). Coordinate expression of the murine Hox-5 complexhomeobox-containing genes during limb pattern formation. Nature 342,767-772.

Duboule, D. (1998). Vertebrate hox gene regulation: clustering and/orcolinearity? Curr. Opin. Genet. Dev. 8, 514-518.

Edlund, T. and Jessell, T. M. (1999). Progression from extrinsic to intrinsicsignaling in cell fate specification: a view from the nervous system. Cell 96,211-224.

Ericson, J., Morton, S., Kawakami, A., Roelink, H. and Jessell, T. M.(1996). Two critical periods of sonic hedgehog signaling required forspecification of motor neuron identity. Cell 87, 661-673.

Ericson, J., Rashbass, P., Schedl, A., Brenner-Morton, S., Kawakami, A.,van Heynigen, V. and Jessell, T. M.(1997). Pax6 controls progenitor cellidentity and neuronal fate in response to graded Shh signaling. Cell 90, 169-189.

Flanagan, J. G. and Vanderhaeghen, P. (1998). The ephrins and Ephreceptors in neural development. Annu. Rev. Neurosci.21, 309-345.

Fode, C., Gradwohl, G., Morin, X., Dierich, A., LeMur, M., Goridis, C.and Guillemot, F. (1998). The bHLH protein NEUROGENIN 2 is adetermination factor for epibranchial placode-derived sensory neurons.Neuron20, 483-494.

Frohman, M. A., Boyle, M. and Martin, G. R. (1990). Isolation of the mouseHox-2.9 gene; analysis of embryonic expression suggests that positionalinformation along the anterior-posterior axis is specified by mesoderm.Development110, 589-607.

Goddard, J. M., Rossel, M., Manley, N. R. and Capecchi, M. R.(1996).Mice with targeted disruption of Hoxb1 fail to form the motor nucleus ofthe VIIth nerve. Development122, 3217-3228.

Godwin, A. R., Stadler, H. S., Nakamura, K. and Capecchi, M. R.(1998).Detection of targeted GFP-Hox gene fusions during mouse embryogenesis.Proc. Natl. Acad. Sci. USA95, 13042-13047.

5354

Gradwohl, G., Fode, C. and Guillemot, F. (1996). Restricted expression ofa novel murine atonal-related bHLH protein in undifferentiated neuralprecursors. Dev. Biol.180, 227-241.

Graham, A., Papalopulu, N. and Krumlauf, R. (1989). The murine andDrosophila homeobox gene complexes have common features oforganization and expression. Cell 57, 367-378.

Guillemot, F., Lo., L., Johnson, J. E., Auerbach, A., Anderson, D. J. andJoyner, A. L. (1993). Mammalian achaete-scute homolog 1 is required forearly development of olfactory and autonomic neurons. Cell. 75, 463-476.

Heitzler, P., Bourouis, M., Ruel, L., Carteret, C. and Simpson, P.(1996).Genes of the Enhancer of split and achaete-scute complexes are required fora regulatory loop between Notch and Delta during lateral signalling inDrosophila. Development122, 161-171.

Hirsch, M., Tiveron, M., Buillemot, F., Brunet, J. and Goridis, C. (1998).Control of noradrenergic differentiation and Phox2a expression by MASH1in the central and peripheral nervous system. Development125, 599-608.

Jan, Y. N. and Jan, L. Y.(1994). Genetic control of cell fate specification inDrosophila peripheral nervous system. Annu. Rev. Genet.28, 373-393.

Johnson, J. E., Birren, S. J. and Anderson, D. J.(1990). Two rat homologuesof Drosophila achaete-scute specifically expressed in neuronal precursors.Nature346, 858-861.

Jungbluth, S., Bell, E. and Lumsden, A.(1999). Specification of distinctmotor neuron identities by the singular activities of individual Hox genes.Development 126, 2751-2758.

Kageyama, R. and Nakanishi, S.(1997). Helix-loop-helix factors in growthand differentiation of the vertebrate nervous system. Curr. Opin. Genet. Dev.7, 659-665.

Krumlauf, R. (1994). Hox genes in vertebrate development. Cell 78, 191-201.Lee, J. E.(1997). Basic helix-loop-helix genes in neural development. Curr.

Opin. Neurobiol.7, 13-20.Lumsden, A. and Keynes, R. (1989). Segmental patterns of neuronal

development in the chick hindbrain. Nature337, 424-428.Lumsden, A. (1990). The cellular basis of segmentation in the developing

hindbrain. Trends Neurosci.13, 329-335.Lumsden, A. and Krumlauf, R. (1996). Patterning the vertebrate neuraxis.

Science274, 1109-1115.Ma, Q., Kintner, C. and Anderson, D.J. (1996). Identification of neurogenin,

a vertebrate neuronal determination gene. Cell 87, 43-52.Ma, Q., Chen, Z., del Barco Barrantes, I., de la Pompa, J. L. and Anderson.,

D. J. (1998). neurogenin1is essential for the determination of neuronalprecursors for proximal cranial sensory ganglia. Neuron20, 469-482.

Ma, Q., Fode, C., Guillemot, F. and Anderson, D. J.(1999). Neurogenin1and neurogenin2 control two distinct waves of neurogenesis in developingdorsal root ganglia. Genes Dev.13, 1717-1728.

Ma, Q., Sommer, L., Cserjesi, P. and Anderson, D. J. (1997). Mash1 andneurogenin1 expression patterns define complementary domains ofneuroepithelium in the developing CNS and are correlated with regionsexpressing notch ligands. J. Neurosci.17, 3644-3652.

Manley, N. R. and Capecchi, M. R.(1995). The role of hoxa-3 in mousethymus and thyroid development. Development121, 1989-2003.

Mansour, S. J., Thomas, K. R. and Capecchi, M. R.(1988). Disruption of theproto-oncogene int-2 in mouse embryo-derived stem cells: a general strategyfor targeting mutations to non-selectable genes.Nature336, 348-352.

Marin, F. and Puelles, L. (1995). Morphological fate of rhombomeres inquail/chick chimeras: a segmental analysis of hindbrain nuclei. Eur. J.Neurosci.7, 1714-1738.

Mark, M., Lufkin, T., Vonesch, J.-L., Ruberte, E., Olivo, J.-C., Dollé, P.,Gorry, P., Lumsden, A. and Chambon, P.(1993). Two rhombomeres arealtered in Hoxa-1mutant mice. Development 119, 319-338.

McConnell, S. K. (1995). Constructing the cerebral cortex: neurogenesis andfate determination. Neuron 15, 761-768.

Murphy, P., Davidson, D. R. and Hill, R. E. (1989). Segment-specificexpression of a homeobox-containing gene in the mouse hindbrain. Nature341, 156-159.

Murphy, P. and Hill, R. E. (1991). Expression of the mouse labial-likehomeobox-containing genes, Hox 2.9 and Hox 1.6, during segmentation ofthe hindbrain. Development111, 61-74.

Nagy, A., Rossant, J., Abramow-Newerly, W. and Roder, J. C.(1993).Derivation of completely cell culture-derived mice from early-passageembryonic stem cells. Proc. Natl. Acad. Sci. USA90, 8424-8428.

Olson, E. N., Arnold, H.-H., Rigby, P. W. J. and Wold, B. J. (1996). Knowyour neighbors: three phenotypes in null mutants of the myogenic bHLHgene MRF4. Cell 85, 1-4.

Panin, V. M., Papayannopoulos, V., Wilson, R. and Irvine, K. D.(1997).Fringe modulates Notch-ligand interactions. Nature387, 908-912.

Pata, I., Studer, M., van Doorninck, J. H., Briscoe, J., Kuuse, S., Engel, J.D., Grosveld, F. and Karis, A. (2000). The transcription factor GATA3 isa downstream effector of Hoxb1 specification in rhombomere 4.Development126, 5523-5531.

Pattyn, A., Hirsch, M., Goridis, C. and Brunet, J. F. (2000). Control ofhindbrain motor neuron differentiation by the homeobox gene Phox2b.Development127, 1349-1358.

Pattyn, A., Morin, X., Cremer, H., Goridis, C. and Brunet, J. (1997).Expression and interactions of the two closely related homeobox genesPhox2a and Phox2b during neurogenesis. Development 124, 4065-4075.

Paxinos, G.(1995). The Rat Nervous System.San Diego, CA: Academic Press.Pfaff, S. L., Mendelsohn, M., Stewart, C.L., Edlund, T. and Jessell, T.M.

(1996). Requirement for LIM homeobox gene Isl1 in motor neurongeneration reveals a motor neuron-dependent step in interneurondifferentiation.Cell 84, 309-320.

Pierani, A., Brenner-Morton, S., C., C. and Jessell, T. M.(1999). A sonichedgehog-independent, retinoid-activated pathway of neurogenesis in theventral spinal cord. Cell 97, 903-915.

Pöpperl, H., Bienz, M., Studer, M., Chan, S., Aparicio, S., Brenner, S.,Mann, R. S. and Krumlauf, R. (1995). Segmented expression of Hoxb-1is controlled by a highly conserved autoregulatory loop dependent uponexd/pbx. Cell 81, 1031-1042.

Ramòn y Cajal, S.(1995). Histology of the Nervous System. Vol. I (ed. N.Swanson and L. W. Swanson). New York and Oxford: Oxford UniversityPress.

Rossel, M. and Capecchi, M. R.(1999). Mice mutant for both Hoxa1 andHoxb1 show extensive remodeling of the hindbrain and defects incraniofacial development. Development 126, 5027-5040.

Ruiz i Altaba, A., Prezioso, V. R., Darnell, J. E. and Jessell, T. M.(1993).Sequential expression of HNF-3 beta and HNF-3 alpha by embryonicorganizing centers: the dorsal lip/node, notochord and floor plate. Mech.Dev. 44, 91-108.

Sasai, Y. (1998). Identifying the missing link: genes that connect neuralinduction and primary neurogenesis in vertebrate embryos. Neuron21, 455-458.

Schwenk, F., Baron, U. and Rajewsky, K. (1995). A cre-transgenic mousestrain for the ubiquitous deletion of loxP-flanked gene segments includingdeletion in germ cells. Nucleic Acids Res.23, 5080-5081.

Sockanathan, S. and Jessell, T. M.(1998). Motor neuron-derived retinoidsignaling specifies the subtype identity of spinal motor neurons. Cell 94,503-514.

Studer, M., Lumsden, A., Ariza-McNaughton, L., Bradley, A. andKrumlauf, R. (1996). Altered segmental identity and abnormal migrationof motor neurons in mice lacking Hoxb1. Nature384, 630-634.

Taber Pierce, E.(1973). Time of origin of neurons in the brain stem of themouse. Prog. Brain Res. 40, 53-65.

Tanabe, Y. and Jessell, T. M.(1996). Diversity and pattern in the developingspinal cord. Science274, 1115-1123.

Tsuchida, T., Ensini, M., Morton, S. B., Baldassare, M., Edlund, T., Jessell,T. M. and Pfaff, S. L. (1995). Topographic organization of embryonicmotor neurons defined by expression of LIM homeobox genes. Cell 79, 957-970.

Wei, Y., Yu, L., Bowen, J., Gorovsky, M. A. and Allis, C. D. (1999).Phosphorylation of histone H3 is required for proper chromosomecondensation and segregation. Cell 97, 99-109.

Weinstein, D. C., Ruiz i Altaba, A., Chen, W. S., P., H., Prezioso, V. R.,Jessell, T. M. and Darnell, J. E. J. (1994). The winged-helix transcriptionfactor HNF-3 beta is required for notochord development in the mouseembryo. Cell 78, 575-588.


hoxb1 controls effectors of sonic hedgehog and mash1

Documents