Animal Genetics, SHORT COMMUNICATION 1993, 24,441-443

R P M A Crooijmans A J A van Kampen J J van der Poel M A M Groenen Department of Animal Breeding, Agricultural University Wageningen, The Netherlands Postbox 338,6700 AH Wageningen.

Highly polymorphic microsatellite markers in poultry R P M A Crooijmans, A J A van Kampen, J J van der Poel, M A M Groenen

Summary

Microsatellite markers have been established for a large number of species, but up till now very few polymorphic microsatellite markers have been reported in poultry. We have isolated 34 polymorphic chicken microsatellite markers of the poly (TG) type. The number of repeats varied from 9 up to 33. Often, other repeats such as poly (T) or poly (GAA) were present adjacent to the poly (TG) repeat. Polymerase chain reaction amplification of the microsatellites resulted in detection of three or more alleles in a test panel of five different animals for 75% of the microsatellites. Segregation of five microsatel- lite markers has been tested in a small family. Keywords: microsatellites, chickens

Detection of a large number of highly polymor- phic DNA markers, such as simple sequence repeats or microsatellites, in the genomes of ver- tebrates has made it possible to construct link- age maps (Dietrich et al. 1992; Weissenbach et al. 1992). Microsatellite markers consist of a direct repeat of di, tri or tetra nucleotides such as (TG),, (TA),, (CAC), or (GGAT), were n can vary from 4 to over 30. In the genomes of verte- brates over 10, and probably as many as l o 5 microsatellites are present (Litt & Luty 1989; Love et al. 1990; Tautz & Renz 1984). Because of the small size of the microsatellites, the poly- merase chain reaction (PCR) can be used to detect different alleles caused by variation in the number of repeats. Generally, the larger the number of repeats the larger the number of alle- les. A preliminary linkage map for the chicken genome has recently been published (Bumstead & Palyga 1992). However, this map consists solely of diallelic restriction fragment length polymorphism (RFLP) type markers. Therefore, as a first step in the construction of a chicken

Correspondence: R P M A Crooijmans. Depart- ment of Animal Breeding, Agricultural Univer- sity Wageningen, Marijkeweg 40, 6709 PG Wageningen, The Netherlands.

Accepted 12 July 1993

genetic map, we and others [Khatib & Soller 1992; M. Soller, personal communications) have started to develop microsatellite markers in poultry. We constructed a genomic library of the DNA of a white leghorn chicken (partially filled in Sau3A fragments of 300-3000 bp), in the par- tially filled in XhoI site of lambda Zap11 vector (Stratagene, La Jolla, CA, USA). Approximately 85 000 clones were screened using the synthetic polynucleotides (TG),,, (CAC), and (GGAT), which were labelled at the 5’ end with [y3’P]ATP. This resulted in isolation of 178 (TG), clones, 5 (CAC), and only 2 (GGAT), clones. These results indicate that the frequency of these repeats is about 7500 per haploid genome, which is almost ten-fold less compared to other species (Hamada et al. 1982; Johansson et al. 1992). After isolation of the positive clones, the pBluescript plasmids were isolated and linear PCR sequencing of the repeat and its flanking regions was performed in a total volume of 10 pl using a DNA thermal cycler (Perkin-Elmer-Cetus, Norwalk, CT, USA). A set of six oligonucleotides ((TG),X, where X = A, C or G and (GT& Y, where Y = T, A or C) was used to obtain the sequence of the immediate flank of the cloned microsatellite (Krishnan et al. 1991; Yuille et al. 1991). This sequence information was used to synthesize a 24-bp PCR primer to obtain the sequence of the repeat and the other flanking region. Of the 178 positive (TG), clones approxi- mately 153 gave a very strong signal. Thus far we have completely sequenced the repeat and flank- ing sequences of 46 poly (TG) containing clones (Fig. 1). The weaker hybridizing clones contained incomplete repeats which sometimes consisted of more than six small complete repeats. Often other repeats, such as poly (A), poly (TA) or poly (GAA), which might increase the probability of finding polymorphisms, were found adjacent to small poly (TG) repeats. Thirty-six clones have a perfect TG-stretch and the number of the (TG) repeat in these clones varies from 4 till 33. The average number of the (TG) repeats is 16, and only 17% of the microsatellites consist of more than 20 repeats. This size distribution is similar to that found in man and pig (Beckman & Weber 1992; Winter0 et al. 1992) and considerably smaller than that found in the rat (Beckman & Weber

441

442 Crooijmans, van Kampen, van der Poel, Groenen

perfect

imperfect

@% compound

4-8 7-9 10-12 13-15 16-18 19-21 22-24 -25-27 26-30 31-33

number of sequences

Fig. 1. Length distribution of the poly (TG) sequences. The number of repeats within the longest run of uninter- rupted repeats in each category was used as the abscissa value. Compound repeats contain in addition to the poly (TG) repeat other repeats such as poly (T), poly [TA), poly (TTG) or poly (GACA).

1992). Primer pairs were synthesized for 44 microsatellites and the microsatellites were tested for polymorphism using a panel of five unrelated animals derived from three different breeds of lay- ers and two different breeds of broilers. Of the 44 markers 34 were polymorphic, with the number of alleles in the five animals varying from 2 to 6. Of the eight microsatellite markers that contained an imperfect repeat only three were polymorphic. These results indicate that chicken microsatellites with more than nine (TG) repeats have a probabil- ity of >80% of being polymorphic, whereas those

of the type (TG),X,.,(TG),, where n and m are both smaller than 8, have a probability of <40% of being polymorphic. Segregation of five of the microsatellite markers (Table 1) was verified in a small reference family. The results for one of the markers (MCW-1) are shown in Figure 2.

In conclusion these results show that highly polymorphic microsatellite chicken markers can be isolated relatively easy. Given the number of laboratories involved in genome mapping in chickens (workshop on chicken genome mapping, Interlaken, Switzerland, 1992), it is likely that a

Table 1. Characteristics of five microsatellite clones. Locus-specific primers for PCR amplification were designed and the PCR reactions were carried out in a total volume of 2 0 ~ 1 containing 10-50ng genomic DNA, 1 . 5 m ~ MgCl,, 5 0 m ~ KCl, lOmM Tris.HC1 pH=8.3, 1 mM tetramethylammoniumchloride (TMAC), 2 0 0 ~ ~ dNTP, 0.75 Unit Taq DNA polymerase (Pharmacia) and 30 ng of each primer, one of which was labelled at the 5' end. 35 cycles of PCR were performed, each cycle consisting of 1 min at 94' C, 2 min at 62' C and 3 min at 72°C. "Sequences are written in the 5'-3' direction. 'Number of alleles detected in three layers and two broilers. "The real repeat is (TG)fiAA(TG),(A),s(GAI,(GAA),.

PCR product No of Sequence Repeat unit Primer sequence" size (bp) allelesb

MCW-001 (TG), ACTGTCACAGTGGGGTCATGGACA 161 4

MCW-002 (TG),, TCCAGAGACAGTTGCTCCACATTC 148 4

MCW-003 (TG),, CCTAAACATAGCAATGAGGATAAC 143 4

MCW-004 (TGILR GGATTACAGCACCTGAAGCCACTAG 190 4

MCW-005 (TG),AA(TG),' ACCTCCTGCTGGCAAATAAATTGC 253 4

~- _ _ ~ __ ~~ ~~~~ ~ ~~~~~ ~~~

ACACGTCCTGTGTCACATGCCTGT

GCAAGTTAGTTATTGTAGGGGCTC

ATTCAGTTCCTTAAAGTTCTTGGG

AAACCAGCCATGGGTGCAGATTGG

TCACTTTAGCTCCATCAGGATTCA

443 Microsa tellite markers in poultry

Fig. 2. Segregation of a chicken microsatellite marker in a family. Three different alleles are detected in this white leghorn family. Slippage during PCR often results in extra bands.

20-CM genetic map with 90% coverage will become available within the next couple of years.

Acknowledgements

The authors wish to acknowledge financial sup- port from Euribrid B.V. They also want to thank Dr C.J. Davies for critical reading of the manuscript.

References Beckman J.S. & Weber J.L. (1992) Survey of human

and rat microsatellites. Genomics 12, 627-31. Bumstead N. & Palyga J. (1992) A preliminary linkage

map of the chicken genome. Genomics 13,690-7. Dietrich W., Katz H., Lincoln S.E., Shin H., Friedman J.,

Dracopoli N.C. & Lander E.S. (1992) A genetic map of the mouse suitable for typing interspecific crosses. Genetics 131,423-47.

Hamada H., Petrino M.G. & Kakunaga T. (1982) A novel

repeated element with Z-DNA-forming potential is widely found in evolutionary diverse eukaryotic enomes. Proceedings of the National Academy of Sci- ences of the USA 79,6465-9.

Johansson M., Ellegren H. & Andersson L. (1992) Cloning and characterization of highly polymorphic porcine microsatellites. Journal of Heredity83,196-8.

Khatib H. & Soller M. (1992) Mononucleotide repeat polymorphism at the MYHE locus in chicken. Animal Genetics 23,478.

Krishnan B.R., Blakesly R.W. & Berg D.E. (1991) Linear amplification DNA sequencing directly from single phage plaques and bacterial colonies. Nucleic Acids Research 19,1153.

Litt M. & Luty J.A. (1989) A hypervariable microsatellite revealed by in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene. Ameri- can Journal of Human Genetics 44,397-401.

Love J.M., Knight A.M., McAleer M.A. & Todd J.A. (1990) Towards construction of a high resolution map of the mouse genome using PCR-analyzed microsatel- lites. Nucleic Acids Research 18,4123-30.

Tautz D. & Renz M. (1984) Simple sequences are ubiqui- tous repetitive components of eukaryotic genomes. Nucleic Acids Research 12,4127-38.

Weber J.L. & May P.E. 11989) Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction. American Journal of Human Genetics 44,388-96.

Weissenbach J., Gyapay G., Dib C., Vignal A., Morissette J., Millasseau P., Vaysseix G. & Lathrop M. (1992) A second-generation linkage map of the human genome. Nature 259,794-801.

Winter0 A.K., Fredholm M. & Thomsen P.D. (1992) Vari- able (dG-dT), sequences in the porcine genome. Genomics 12,281-8.

Yuille M.A.R., Goudie D.R., Affara N.A. & Furguson- Smith M.A. (1991) Rapid determination of sequences flanking microsatellites. Nucleic Acids Research 19, 1950.