fungal keratitis: epidemiology, rapid detection, and...

Research ArticleFungal Keratitis Epidemiology Rapid Detection andAntifungal Susceptibilities of Fusarium and AspergillusIsolates from Corneal Scrapings

PalanisamyManikandan 123 Ahmed Abdel-hadi 14

Yendrembam Randhir Babu Singh5 Rajaraman Revathi2

Raghavan Anita2 Saeed Banawas 1 Abdul Aziz Bin Dukhyil1

Bader Alshehri1 Coimbatore Subramanian Shobana6

Kanesan Panneer Selvam7 and Venkatapathy Narendran2

1Department of Medical Laboratory Sciences College of Applied Medical Sciences Majmaah University Al Majmaah Saudi Arabia2Aravind Eye Hospital and Postgraduate Institute of Ophthalmology Coimbatore India3Greenlink Analytical and Research Laboratory India Private Limited Coimbatore India4Botany and Microbiology Department Faculty of Science Al-Azhar University Assiut Branch Egypt5Microbial Resources Division Institute of Bioresources and Sustainable Development Takyel Imphal Manipur India6Department of Microbiology PSG College of Arts and Science Coimbatore India7Department of Microbiology MR Government Arts College Mannargudi Tamilnadu India

Correspondence should be addressed to Palanisamy Manikandan manikandanpalanisamygmailcom

Received 31 October 2018 Accepted 10 December 2018 Published 20 January 2019

Academic Editor Macit Ilkit

Copyright copy 2019 PalanisamyManikandan et alThis is an open access article distributed under the Creative CommonsAttributionLicense which permits unrestricted use distribution and reproduction in anymedium provided the originalwork is properly cited

Fungal aetiology of keratitiscorneal ulcer is considered to be one of the leading causes of ocular morbidity particularly indeveloping countries including India More importantly Fusarium and Aspergillus are reported commonly implicating cornealulcer and against this background the present work was undertaken so as to understand the current epidemiological trend of thetwo fungal keratitis During the project period a total of 500 corneal scrapings were collected from suspected mycotic keratitispatients of which 411 (822) were culture positive for bacteria fungi and parasites Among fungal aetiologies Fusarium (216525of 411) andAspergillus (68 165of 411)were predominantly determinedWhile the study revealed amale preponderancewithboth the fungal keratitis it further brought out that polyene compounds (natamycin and amphotericin B) and azoles were activerespectively against Fusarium spp and Aspergillus spp Additionally 941 of culture proven Fusarium keratitis and respectively100 and 636 ofA flavus andA fumigatuswere confirmed bymultiplex PCRThe sensitivity of the PCR employed in the presentstudy was noted to be 10 fg120583l 1 pg120583l and 300 pg120583l of DNA respectively for Fusarium A flavus and A fumigatusAlarming factwas that Fusarium and Aspergillus regionally remained to be the common cause of mycotic keratitis and the Fusarium isolates hada higher antifungal resistance than Aspergillus strains against most of the test drugs

1 Introduction

Blindness due to corneal infections is a serious problemnext to cataract [1] and fungal infections of the cornea haveemerged as amajor eye disease globallyThe corneal infectionof fungal etiology is very common and comprising at least50 of all culture positive cases in India [2] However the

prevalence rate varies from one country to the other andalso from one population to another within the same country[3 4] In South India the dominance of fungal keratitisparticularly of Fusarium and Aspergillus is prevalent morethan a decade and have been documented in many literatures[5ndash8] Species of Fusarium and Aspergillus are widespreadin nature being causative agents of important diseases of

HindawiBioMed Research InternationalVolume 2019 Article ID 6395840 9 pageshttpsdoiorg10115520196395840

2 BioMed Research International

major crops as well as immunocompromised humans [9]and have been considered as important pathogens in eyeinfections especially keratitis [2 10] In India Fusarium andAspergillus species are being isolated from corneal ulcers inlarge numbers [6 8 11ndash14] irrespective of the geographicallocation

The importance of fungal keratitis gained momentumin 2005 following the outbreak of fungal keratitis amongcontact lenswearers inmany developed countries [15 16]Thefact that the outcome of fungal keratitis is worse than thatof bacterial keratitis must be underscored [17] due to poorresponse to the therapy as well as the limited availability ofantifungal agents [18] The diagnosis and treatment of fungalkeratitis is one of the most difficult problems encounteredby ophthalmologists Further the prognoses of the fungalkeratitis worsen with inadvertent antifungal agents and recal-citrant course of the disease [2] Although voriconazole andother triazoles have broad-spectrumactivity against causativefungal isolates clinically no single drug was found to beeffective against fungal keratitis Also Fusarium spp arecompletely tolerant to itraconazole and caspofungin [19]

Accurate identification of the aetiological agent of fun-gal keratitis is of great importance in order to administerappropriate treatment [10 20] Though conventional culturemethods are often useful it takes more time for sufficientgrowth and subsequent identification of the causative agent[2] The use of molecular techniques offers a significantreduction in time required for precise diagnosis of such infec-tions [20 21] Also the scarcity of region-specific antifungalsusceptibility data the limited availability of commerciallyavailable antifungal drugs and the lack of response lead tocorneal blindness in a high number of infected patientsTherefore due to the magnitude of the fungal keratitis inTamilnadu India a survey of local antifungal susceptibilitypattern and exploring a suitable rapid diagnostic method isof paramount importance

Hence the present study was designed for the rapiddetection fungal pathogens causing keratitis by multiplexpolymerase chain reaction (PCR) and also to evaluate theefficacy of multiplex PCR against routine culture methodFurther the study also presents data on regional prevalenceof fungal keratitis andminimum inhibitory concentration [4]values of routinely used antifungal agents against Fusariumand Aspergillus isolated from corneal ulcers The paper notonly provides information on the current incidence of Fusar-iumAspergillus keratitis but also gives valuable informationon drug susceptibilities so as to help the ophthalmologiststo initiate appropriate antifungal regimen against fungalkeratitis

2 Materials and Methods

21 Patients A total of 500 (including repeat specimens)corneal scraping specimens were collected between June 2010and January 2011 from clinically suspected patients withmycotic keratitis who attended Cornea services at AravindEye Hospital Coimbatore after obtaining ethical clear-ance (Institutional Review Board Aravind Medical ResearchFoundation Madurai India)

22 Collection of Specimens Corneal scrapingwas performedunder aseptic condition by an ophthalmologist using asterile Kimurarsquos spatula and a portion was inoculated on 5sheep blood agar (SBA) chocolate agar (CA) and potatodextrose agar (PDA) Additionally the remaining specimenwas smeared on two clear glass slides to observe the presenceof fungal filaments microscopically using 10 KOH wetmount and Gram staining Corneal scrapings that revealedfungal filaments in direct microscopy were considered for thestudy Repeat corneal scraping was done to collect specimenfor PCR assay The collected specimens were placed in 400 120583lof lysis buffer (05M Tris HCL 05M EDTA 3 SDS 1 120573-mercaptoethanol) and were stored at minus20∘C until furtherprocessing

23 Identification of Fusarium spp and Aspergillus spp byCulture Method All fungal isolates were identified based onthe standard culture techniques followed by microscopy afterlacto-phenol cotton blue stainingThe identified isolates werepreserved in 085 saline at 4∘C

24 Determination of Minimum Inhibitory Concentration(MIC) The MICs of seven different antifungal agentsnamely amphotericin B (Himedia Mumbai India) itra-conazole (Sigma-Aldrich St Louis MO USA) natamycin(Sigma-Aldrich St LouisMO USA) voriconazole (AurolabMadurai India) ketoconazole (Himedia Mumbai India)econazole (AurolabMadurai India) and clotrimazole (Auro-lab Madurai India) were determined in accordance withthe guidelines of Clinical and Laboratory Standards Institute(CLSI) [22] The MIC values were defined as the lowest con-centrations of antimicrobials that inhibit the visible growth ofan isolate The MIC

50and MIC

90values were defined as the

MICs required to inhibit the growth of 50 and 90 of theisolates from a given species respectively [23]

A flavus ATCC 204304 was included as a quality controlstrain in all the batches of MIC analysis The antifungalagents were prepared in order to achieve the dilution rangesin the order of 8 120583gml - 0015 120583gml (amphotericin Beconazole voriconazole and clotrimazole) 32 120583gml - 006120583gml (itraconazole) 16 120583gml - 003 120583gml (ketoconazole)and 128 120583gml - 025 120583gml (natamycin)

25 DNA Extraction DNA was extracted from infectedcorneal tissue scrapings using Qiagen DNA extraction kit(Hilden Germany) as per the manufacturer instructionsThe concentration of extracted DNA was determined bynanophotometer (Implen Munich Germany)TheDNAwasstored at minus20∘C (Sanyo Osaka Japan) until further use

26 Polymerase Chain Reaction The extracted DNA wasinitially subjected to the first round of PCR using universalfungal primers (ITS1 and ITS4 internal transcribed spacerregion) The first round amplicons were subsequently sub-jected for multiplex PCR using Fusarium and Aspergillusspecific primers [24]

For each reaction in the first round PCR a cocktailcomprising 10 120583l of DNA extract with 5120583l of 10 times PCR buffer(mixed with 15mMmagnesium chloride) 1120583l of dNTPs mix

BioMed Research International 3

(200 120583M each dNTPs) 20 pm120583l of each primer and 05 Uof Taq DNA polymerase amounting to a total volume of 50120583lwas prepared The ITS primers (Sigma St Louis MO USA)used were 51015840-TCCGTAGGTGAACCTGCGG-31015840 (F) and 51015840-TCCTCCGCTTATTGATATGC-31015840 (R)The reaction was runin gradient thermocycler (Eppendorf Hamburg Germany)involving initial denaturation at 95∘C for 5min followed by34 cycles in series of denaturation at 95∘C for 30s annealingat 54∘C for 1min and extension at 72∘C for 1min with a finalstep of extension at 72∘C for 6min and final holding at 4∘C

Multiplex PCR cocktail was prepared as described aboveThe specific primers (Sigma St Louis MO USA) used foridentification of Fusarium spp A flavus and A fumigatuswere CAACTCCCAAACCCCTGTGA (F) amp GCGACGAT-TACCAGTAACGA (R) CCGCCGGAGACACCACGAAC(F) amp TGGGCAGCAATGACGCTCGG (R) and TTGT-GTGTTGGGCCCCCGTC (F) amp AAAGTTGGGTGTCG-GCTGGCG (R) respectively The amplicons were subjectedto agarose gel electrophoresis in 15 agarose (Sigma StLouis MO USA) for 20-25min at 80V (GeneI BangaloreIndia) along with 100 bp (Sigma St Louis MO USA)molecularmarkerTheDNAbands were visualized analyzedand documented using gel documentation system (VilberLourmat France)

3 Results

Of the 500 corneal scrapings collected during the studyperiod the culture revealed that 411 (822 of 500) werepositive for fungi bacterial and mixed etiologies (Table 1)Of 402 ocular specimens (978 of 411) 6 (14 of 411) and 3(072 of 411) were identified to be due to fungal bacterialand mixture of bacterial and fungal causes respectivelyFurther 10 KOH and Gram staining revealed that 961(449 of 467) and 947 (473 of 499) correlated with culturefindings in the detection of fungi from corneal scrapingsNumber of Fusarium (n=216) keratitis cases occurred morein males (134 62) than among females (82 38) The agegroup affected with Fusarium keratitis ranged from 21 to 70years and particularly 66 patients (305 of 216) belonged to41-50 years and 50 (231 of 216) belonged to 51-60 years

Similarly Aspergillus keratitis was confirmed predomi-nantly among males (558 of 68) The age group affectedwithAspergillus keratitis ranged from 31 to 50 years (31 455of 68)A flavus (48 116of 411) was the predominant speciesamong the identified Aspergillus identified during the studyperiod Bipolaris spp (22 53 of 411) Curvularia spp (1229 of 411) and Exserohilum spp (11 26 of 411) were theother fungi isolated during the study period

31 Minimum Inhibitory Concentration (MIC) In this studya total of 200 Fusarium and 67 Aspergillus isolates (47 Aflavus 11 A fumigatus 5 A terreus 3 A niger and 1 Atamarii) were included to determine theminimum inhibitoryconcentrations MIC

50and MIC

90of routine antifungal

drugs Overall the isolates of Fusarium spp required higherconcentrations (Tables 2 and 3) of specific antifungal drugthan Aspergillus spp in order to be inhibited Most of theAspergillus isolates were inhibited by amphotericin-B at a

concentration of ge 1 120583gml More interestingly natamycinacted against 65 (130 n = 200) of the Fusarium isolatesat a concentration of 16 120583gml while majority of Aspergillusspp were inhibited at ge 32 120583gml A notable observationwas with itraconazole activity where 925 (185 n = 200)Fusarium spp were susceptible only at a concentration of ge32 120583gml while 100 (n = 67) of the Aspergillus isolates werecompletely inhibited at le 1 120583gml Similar MIC patterns wereobserved with econazole clotrimazole and ketoconazolewhere Fusarium isolates had higher MICs compared toAspergillus spp

32 PCR Study A total of 473 corneal scrapings which wereculture positive for Fusarium spp (205) A flavus (46) Afumigatus (11) A terreus (4) A tamarii (1) Bipolaris spp(22) Exserohilum spp (10) Curvularia spp (12) Cladospo-rium spp (4) Aureobasidium spp (3) Exophiala spp (2)Lasiodiplodia sp (1) Pseudallescheria sp (1) Alternaria sp(1) Scedosporium spp (2) UID (20) and UIH (36) wereincluded for PCR Additionally 86 culture negative cornealscrapings along with 2 mixed infections and 4 bacterialpositive specimens were also included for PCR analysis

All the primers specifically amplified the target regionThe specific primers of ITS 1amp4 (1st round) Fusarium sppAflavus and A fumigatus after PCR and upon electrophoresisproduced amplicons of approximately 600 bp 400 bp 250 bpand 150 bp respectively (Figure 1(a)) In addition otherfungal culture positive corneal scrapings such as BipolarisCurvularia Exserohilum etc could not be amplified in 2ndround multiplex PCR (Figure 1(b)) All the PCR positivespecimens (Fusarium A flavus A fumigatus) were furtherconfirmedwith culture identification to ensure the specificity

33 Sensitivity of the PCR To determine the minimumamount of fungal DNA that could be detected by the estab-lished PCR assay variable quantities (ranging from 10 ng120583lto 300 fg120583l) of Fusarium andAspergillus genomic DNAwereused as DNA template (Figure 2(a)) and it was found that thebest optimized PCR conditions could amplify FusariumDNAas less as 10 fg 120583l (Figure 2(b)) SimilarlyA flavusDNAcouldbe amplified as low as 1 pg120583l However the PCR was notedto be less sensitive towards the detection of A fumigatusDNAas it required aminimumDNA concentration of at least300 pg120583l for amplification and detection (Figure 3)

34 PCR-First Round of Amplification with ITS PrimersIn the 1st round of PCR amplification using the universalfungal primers (ITS1 and ITS4) PCR products (550-600 bp)were generated from 347 (733) corneal specimens Of347 337 (971) specimens were already confirmed to befungal culture positive An increase in the total number ofpositive cases through the applications of PCR under theproject indicated the obvious and inevitable requirement ofsuch techniques in routine diagnostic procedures Also theaccuracy of the PCR detection was superior as most (1676 of 473) of the PCR negative cases (ITS1 and ITS4) werealso negative for conventional culture primarily However theDNA from 50 (105 of 473) corneal scrapings which were


Table 1 Microbial etiologies of corneal ulcer isolates during the study period

Fungi Incidence Percentage (n = 411)Fusarium spp 216 525A flavus 48 116A fumigatus 11 26A terreus 5 12A niger 3 07A tamarii 1 02Bipolaris spp 22 53Curvularia spp 12 29Exserohilum spp 11 26Cladosporium spp 4 09Aureobasidium spp 3 07Exophiala spp 2 04Lasiodiplodia spp 1 02Pseudallescheria sp 1 02C albicans 1 02Alternaria sp 1 02Scedosporium spp 1 02S apiospermum 1 02Unidentified dematiaceous fungi (UID) 21 51Unidentified hyaline fungi(UIH) 37 9BacteriaS aureus 1 02Pseudomonas spp 1 02Nocardia spp 1 02CoNS 1 02S viridans 1 02Citrobacter spp 1 02Mixed infectionCoNS + Fusarium spp 1 02S pneumoniae + Bipolaris spp 1 02Citrobacter spp + Bipolaris spp 1 02Total 411 100CoNS coagulase negative Staphylococcus spp

(a) (b)

Figure 1 First and second round of PCR amplifications (a) Uniplex PCR with ITS1 amp ITS4 primers Lane 1 - 100 bp ladder lane 2 - Fusariumsp (sim600 bp) lane 3 - A flavus lane 4 - A fumigatus lane 5 - Bipolaris spp lane 6 - Exerohilum sp lane 7 - Alternaria sp lane 8 - Curvulariasp (b) Multiplex PCR with species specific primers Lane 1 - 100 bp marker Lane 2 - Fusarium sp Lane 3 - A flavus Lane 4 - A fumigatusLane 5 - Bipolaris sp Lane 6 - Exerohilum sp Lane 7 - Alternaria sp Lane 8 - Curvularia sp Lane 9 - UID Lane 10 - UID


Table 2 Minimum inhibitory concentration (120583gml) of antifungal agents against Fusarium spp (n=200)

Amphotericin BMIC range le05 120583gml ge1 120583gml MIC

50MIC90

8 ndash 0125 77 (385) 123 (615) 1 1Natamycin

MIC range le8 120583gml ge16 120583gml MIC50

MIC90

64 ndash 2 70 (35) 130 (65) 16 32Itraconazole


MIC90

32 ndash 4 15 (75) 185 (925) 32 32Voriconazole


MIC90

8 ndash 1 101 (505) 99 (495) 4 8Econazole


MIC90

8 ndash 2 38 (19) 162 (81) 8 8Clotrimazole


MIC90

8 ndash 05 145 (725) 55 (275) 4 8Ketoconazole


MIC90

16 ndash 2 35 (175) 165 (825) 16 16

(a) (b)

Figure 2 Determination of PCR sensitivity and specificity (a) A flavus Lane 1 - 100 bp marker lane 2 - negative control Lane 3 - 10 ng Lane4 - 1 ng Lane 5 - 100 pg lane 6 - 10 pg lane 7 - 1 pg lane 8 - 100 fg lane 9 - 10 fg lane 10 - 1 fg (b) Fusarium sp Lane 1 - 100 bp marker lane2 - negative control Lane 3 - 10 ng Lane 4 - 1 ng Lane 5 - 100 pg lane 6 - 10 pg lane 7 - 1 pg lane 8 - 100 fg lane 9 - 10 fg lane 10 - 1 fg

Figure 3 PCR sensitivity for A fumigatus Lane 1 - 100 bp marker lane 2 - negative control lane 3 - 30 ng lane 4 - 3 ng lane 5 - 300 pg lane6 - 30 pg lane 7 - 3 pg lane 8 - 300 fg lane 9 - 30 fg lane 10 - 3 fg


Table 3 Minimum inhibitory concentration (120583gml) of antifungal agents against Aspergillus spp

Amphotericin BIsolates MIC range le05 120583gml ge1 120583gml MIC

50MIC90

A flavus (n = 47) 8 ndash 025 21 (447) 26 (534) 1 2A fumigatus (n = 11) 4 ndash 025 5 (454) 6(545) 1 4A terreus (n = 5) 2 ndash 05 2 (40) 3 (60) 1 2A niger (n = 3) 05 ndash 025 3 (100) - 05 05A tamarii (n = 1) NA 1 (100) - NA NA

NatamycinIsolates MIC range le16 120583gml ge32 120583gml MIC

50MIC90

A flavus (n = 47) 64 ndash 16 18 (382) 29 (617) 32 64A fumigatus (n = 11) 64 ndash 16 7 (636) 4 (363) 16 32A terreus (n = 5) 32 ndash 16 1 (20) 4 (80) 32 32A niger (n = 3) 32 ndash 8 2 (667) 1 (334) 16 32A tamarii (n = 1) NA - 1 (100) NA NA

ItraconazoleIsolates MIC range le025 120583gml ge05 120583gml MIC

50MIC90

A flavus (n = 47) 1 ndash 025 25 (531) 22 (468) 025 05A fumigatus (n = 11) 05 ndash 025 5 (454) 6 (545) 05 05A terreus (n = 5) NA - 5 (100) 05 05A niger (n = 3) 05 ndash 025 2 (667) 1 (334) 025 05A tamarii (n = 1) NA 1 (100) - NA NA

VoriconazoleIsolates MIC range le05 120583gml ge1 120583gml MIC

50MIC90


EconazoleIsolates MIC range le05 120583gml ge1 120583gml MIC

50MIC90


ClotrimazoleIsolates MIC range le05 120583gml ge1 120583gml MIC

50MIC90

A flavus (n = 47) 1 ndash 0125 31 (659) 16 (34) 05 1A fumigatus (n = 11) 1 ndash 0125 8 (727) 3 (272) 05 1A terreus (n = 5) 1 ndash 05 1 (20) 4 (80) 1 1A niger (n = 3) 1 ndash 05 1 (334) 2 (667) 1 1A tamarii (n = 1) NA 1 (100) - NA NA

KetoconazoleIsolates MIC range le05 120583gml ge1 120583gml MIC

50MIC90

A flavus (n = 47) 8 ndash 05 14 (297) 33 (702) 1 4A fumigatus (n = 11) 4 ndash 0125 4 (363) 7 (636) 1 2A terreus (n = 5) 4 ndash 1 - 5 (100) 2 4A niger (n = 3) 4 ndash 05 1 (334) 2 (667) 1 4A tamarii (n = 1) NA - 1 (100) NA NA

NA not applicable


actually identified to be culture positive failed to amplify ITS1 amp 4 by PCR

35 PCR-Second Round of Amplification with Fungal SpeciesSpecific Primers The findings upon second round of ampli-fication using exclusive primers for each genusspecies werediverse Of the 205 corneal scrapings that were positivefor Fusarium spp culture only 193 (941 of 205) werereconfirmed as Fusarium spp (Figure 1(b)) Similarly 46(100) A flavus and 7 (636 of 11) A fumigatus were con-firmed with PCR No amplification of other fungal DNA wasobserved for which specific primers were not used (but theirDNA could be amplified in the first round using universalfungal primers for ITS) More remarkably of the 86 culturenegative corneal scrapings 9 (104 of 86) of them showedpositive for Fusarium spp in PCR which indicated thatthe PCR primers could identify even those specimenscaseswhich were reported to be negative in culture and that theprimers could amplify minimum quantity of Fusarium DNAin culture negative cases also

4 Discussion

Rapid identification of fungal pathogens and instilling ofappropriate antifungal agents are key factors of a successfulfungal keratitis management and the present study focusedon the two features with special reference to Fusarium sppand Aspergillus spp The study included only fungal positivespecimens identified through direct microscopy to evaluatethe PCR specificity of rapid detection The incidences offungal keratitis reported were highly variable across theIndian states southern and western India with 367 [8] and363 [8 25] northern (73) northeastern (256) andeastern India (264) [26ndash28] The present study revealed adirect microscopic sensitivity of 10 KOH and gram staining961 and 947 respectively from corneal scrapings andwere in accordancewith Bibhudutta et al 2011 [28] SimilarlyBharathi et al [8] reported 9923 and 8873 sensitivity inKOH wet mount and Gram staining respectively In anotherstudy giemsa stain (75) and Gram stain (555) were usedfor the detection of fungal filaments [29]

Similar to other studies [8 30] male patients (605)were dominant with Fusarium and Aspergillus keratitis thanfemales (394) Gonzales et al [31] and Srinivasan et al [6]reported the ratio of male to female with corneal ulcer as 16to 1 Fusarium and Aspergillus keratitis were majorly (94)confirmed in middle aged (21-70 years) individuals with afocused predominance in 41-50 years (288)

Middle age group was noted to be highly vulnerable forfungal keratitis in Madurai [6] region with 31-60 and Nepal[32] with 21 -50 years In this study male patients were ata higher risk (558) for Aspergillus keratitis though ourprevious assessment [23] brought out 60 with 151 male tofemale ratio In this study Fusarium spp (525) followedby Aspergillus spp (165) were predominantly responsiblefor mycotic keratitis Similar findings were observed in otherparts of Southern India [6 8] western India [25 30] andeastern India [28] Also the prevalence ofAspergillus keratitis

was found to be consistent with our previous findings [23]However Aspergillus spp had been the dominant aetiologyin fungal keratitis followed by Fusarium spp in parts ofnorthern [26] and eastern India [4] In addition the fungalkeratitis aetiology greatly varied from country to country[10] Candida spp with incidence rates of 606 and 327were observed in London [33] and Melbourne [18] respec-tively Acremonium spp (40) were the most predominantfungal isolate in Paraguay [34] Antifungal susceptibility test-ing and MIC determination procedures have very significantrole in terms of successful management of fungal keratitispatients However the limited availability of commercialantifungal agents especially in the form of eye drops madethe therapy more complicated [10] In this study Fusariumspp required higher concentration of antifungal agents toinhibit the growth when compared to Aspergillus spp exceptfor amphotericin B and natamycin In a similar investigationamphotericin-B and natamycin were reported with signifi-cant activity against Fusarium spp [35] Exactly 90 of theFusarium spp were sensitive at 1 120583gmlwhile 90ofA flavusA fumigatus A terreus and A niger were sensitive at 2 42 and 05 120583gml respectively [36] However an assessmentby Lalitha et al [19] and Isabel et al [35] reported MIC

90at

4 120583gml and 462 120583gml respectively against Fusarium sppwith amphotericin-BTheMIC

90ofAspergillus spp observed

in the present study was similar to the study by Lalithaet al [19] Natamycin though the drug of choice againstfilamentous fungi [37] because of its poor penetration iseffective only in nonsevere superficial keratitis [13] Fusariumspp were more sensitive to natamycin than Aspergillus sppIn this study 90 of the Fusarium and Aspergillus strainswere inhibited at 32120583gml and 64 120583gml respectively andthe findings were similar to the previous assessments [19]The resistant pattern of Fusarium spp against itraconazolein this study was clearly evident from other reports [19 35]though the MIC values showed variations On the contraryAspergillus was significantly sensitive against itraconazolewith consistent findings to our previous work [23] as well aswith other investigators [19 38] Similar to itraconazole otheragents such as voriconazole econazole clotrimazole andketoconazole were relatively effective against Aspergillus sppLikewise higher drug concentrationswere required to inhibitFusarium spp indicating that the tested azole drugs wereineffective Eduardo et al 2008 [39] andLalitha et al 2007 [19]reported MIC

90of voriconazole as 4 120583gml and the similar

range was found in the present study (8 120583gml) Eduardoet al concluded that F solani tends to be more resistantto certain azoles [39] However in case of Aspergillus spphighest MICwas noted against voriconazole (1 120583gml) whichwas similar to the data published previously [19 23] In caseof ketoconazole theMIC

90andMIC

50of Fusarium spp were

noted as 16 120583gml while among Aspergillus spp A flavus Aterreus and A niger had a highest MIC

90of 4 120583gml Isabel

et al 1997 [35] reported higher MIC90

(gt5120 mgl) againstFusarium On the contraryTheresa et al 2006 [36] reportedhigher MIC percentile value of ketoconazole in A niger andA terreus when compared to other filamentous fungi Ingeneral the isolates of Fusarium spp showedmore resistancethan Aspergillus spp Most of the Fusarium isolates required


higher concentration of drugs to get inhibited Further mostof the Aspergillus isolates were sensitive to amphotericin-B

All the test PCR primers (ITS 1 amp 4) amplified thetarget region of Fusarium spp A flavus and A fumigatusrepresenting 600 bp 400 bp 250 bp and 150 bp respectivelyafter fractionation and were confirmed with suitable positive(fungal culture positive corneal scraping with Bipolaris sppCurvularia spp Exserohilum spp etc) and negative controlsThe PCR identified Fusarium A flavus and A fumigatuswere subsequently determined to be culture positiveThougha prompt identification of fungal causative agent is themost important task behind every successful managementof mycotic keratitis the issue never has been completelyredressed The impediments of rapid identification could bepossibly due to the less than a minimum quantity of thesamples and cross contamination of conjunctival floraThere-fore studies on rapid identification of fungi directly fromcorneal scrapings are very limited Hence the present studyevaluated direct identification of major fungal agents suchas Fusarium and Aspergillus directly from corneal scrapingusing multiplex PCR The specificity of the PCR primers wasdetermined by evaluation of positive control using knownfungal isolates and negative control (bacterial DNA) andsubsequent observation of culture positive cases PCR con-firmed positivity for all the positive control specimens whileno bands in negative controls The specimens positive forFusarium spp and Aspergillus spp in PCR analyses were alsoidentified to be culture positive in respective microbiologicalmedia

Ferrer et al 2001 [21] reported high specificity of PCRupon amplification of ITS of the fungal genome isolated fromocular infection when DNA isolated from human leukocytesand bacterialDNAwere used as a negative control Zunaina etal 2008 [40] used 18S rRNA segment for direct identificationof fungal pathogens from corneal scrapings in which thespecificity (947) was confirmed by sequencing of amplifiedDNA fragment The PCR sensitivity of the present study forFusarium sppA flavus andA fumigatuswas 10 fg 1 pg and300 pgmicro liter of DNA respectively Other investigatorsreported the sensitivity of A versicolor genome with 100fg [40] In a significant difference from our findings Afumigatus sensitivity was also reported up to 1 fg upon semi-nested PCR [21] A positive PCR detection of the fungalpathogens was reported by Emma et al 2000 [41] from asingle patient which was culture negative However in thepresent study PCR detected and amplified fungal DNA from10 patients Ferrer et al 2011 [42] asserted that fungal PCRmust be added as the screening diagnosis since PCR not onlyproved to be an effective rapid method for the diagnosis offungal keratitis but was also sensitive compared to stainingand culture methods of investigation To the best of theliterature survey the present study was the first attempt toidentify the species of Fusarium andAspergillus directly fromcorneal scrapings of culture proven fungal keratitis casesThe outcomes of the preliminary assessment were highlyspecific and sensitive in detecting Fusarium and AspergillusAn extended scientific evaluation and optimization is beingsuggested as to apply PCR in vitro assays for a routine as wellas rapid diagnostic applications

Data Availability

The data used to support the findings of this study areincluded within the article

Conflicts of Interest

The authors declare that there are no conflicts of interestregarding the publication of this paper

Acknowledgments

This study was supported by the Indian Council of MedicalResearch (IRIS ID 2008-03140) New Delhi India Theauthors of this study were also supported by the Deanship ofScientific Research atMajmaahUniversity Kingdom of SaudiArabia under Project No 38128

References

[1] J P Whitcher M Srinivasan and M P Upadhyay ldquoCornealblindness a global perspectiverdquo Bulletin of the World HealthOrganization vol 79 no 3 pp 214ndash221 2001

[2] P A Thomas ldquoCurrent perspectives on ophthalmic mycosesrdquoClinical Microbiology Reviews vol 16 no 4 pp 730ndash797 2003

[3] G T H Smith and H R Taylor ldquoEpidemiology of cornealblindness in developing countriesrdquo Journal of Refractive Surgeryvol 7 no 6 pp 436ndash439 1991

[4] S K Basak A Mohanta and A Bhowmick ldquoEpidemio-logical and microbiological diagnosis of suppurative keratitisin Gangetic West Bengal Eastern Indiardquo Indian Journal ofOphthalmology vol 53 no 1 pp 17ndash22 2005

[5] S Savitri M Srinivasan and G Celine ldquoThe Current Status OfFusarium Species In Mycotic Keratitis In South Indiardquo IndianJournal of Medical Microbiology vol 11 no 2 pp 140ndash147 1993

[6] M Srinivasan C A Gonzales and C George ldquoEpidemiologyand aetiological diagnosis of corneal ulceration in MaduraiSouth Indiardquo British Journal of Ophthalmology vol 81 no 11pp 965ndash971 1997

[7] R Vasudevan and M Jeya ldquoPrevalence of bacterial and fungalkeratitis in and around Chidambaramrdquo Journal of TNOA pp44-25 2006

[8] M J Bharathi R Ramakrishnan S Vasu R Meenakshi and RPalaniappan ldquoEpidemiological characteristics and laboratorydiagnosis of fungal keratitis A three-year studyrdquo Indian Journalof Ophthalmology vol 51 no 4 pp 315ndash321 2003

[9] A J De Lucca ldquoHarmful fungi in both agriculture andmedicinerdquo Revista Iberoamericana de Micologıa vol 24 no 1pp 3ndash13 2007

[10] P Manikandan I Doczi S Kocsube J Varga T Nemet andZ Antal Aspergillus in the genomic era J Varga and R SamsonEdsWageningenAcademic PublishersTheNetherlands 2008

[11] M J Bharathi R Ramakrishnan S Vasu and R MeenakshiPalaniappan ldquoAetiological diagnosis of microbial keratitis inSouth India - a study of 1618 casesrdquo Indian Journal of MedicalMicrobiology vol 20 no 1 pp 19ndash24 2002

[12] I Doczi T Gyetvai L Kredics and E Nagy ldquoInvolvement ofFusarium spp in fungal keratitisrdquo Clinical Microbiology andInfection vol 10 no 9 pp 773ndash776 2004


[13] M Srinivasan ldquoFungal keratitisrdquo Current Opinion in Ophthal-mology vol 15 no 4 pp 321ndash327 2004

[14] M J Bharathi R Ramakrishnan R Meenakshi S Mittal CShivakumar and M Srinivasan ldquoMicrobiological diagnosis ofinfective keratitis Comparative evaluation of direct microscopyand culture resultsrdquo British Journal of Ophthalmology vol 90no 10 pp 1271ndash1276 2006

[15] D C Chang G B Grant K OrsquoDonnell et al ldquoMultistateoutbreak of Fusarium keratitis associated with use of a contactlens solutionrdquoThe Journal of the American Medical Associationvol 296 no 8 pp 953ndash963 2006

[16] W-B Khor T Aung S-M Saw et al ldquoAn outbreak of Fusariumkeratitis associatedwith contact lens wear in Singaporerdquo Journalof the American Medical Association vol 295 no 24 pp 2867ndash2873 2006

[17] T J Liesegang and R K Forster ldquoSpectrum of microbialkeratitis in South Floridardquo American Journal of Ophthalmologyvol 90 no 1 pp 38ndash47 1980

[18] P Bhartiya M Daniell M Constantinou F M A Islamand H R Taylor ldquoFungal keratitis in Melbournerdquo Clinical ampExperimental Ophthalmology vol 35 no 2 pp 124ndash130 2007

[19] P Lalitha B L Shapiro M Srinivasan et al ldquoAntimicrobialsusceptibility of Fusarium Aspergillus and other filamentousfungi isolated from keratitisrdquo JAMA Ophtalmology vol 125 no6 pp 789ndash793 2007

[20] P Manikandan H F Vismer L Kredics et al ldquoCorneal ulcerdue to Neocosmospora vasinfecta in an immunocompetentpatientrdquoMedical Mycology vol 46 no 3 pp 279ndash284 2008

[21] C Ferrer F Colom S Frases E Mulet J L Abad and J L AlioldquoDetection and identification of fungal pathogens by PCR andby ITS2 and 58S ribosomal DNA typing in ocular infectionsrdquoJournal of Clinical Microbiology vol 39 no 8 pp 2873ndash28792001

[22] CLSI ldquoReference Method for Broth Dilution AntifungalSusceptibility Testing of Filamentous Fungi ApprovedStandardmdashSecond Edition CLSI document M38-A2 WaynePA Clinical and Laboratory Standards Institute 2008rdquo

[23] P Manikandan J Varga S Kocsube et al ldquoEpidemiology ofAspergillus keratitis at a tertiary care eye hospital in South Indiaand antifungal susceptibilities of the causative agentsrdquoMycosesvol 56 no 1 pp 26ndash33 2013

[24] A Kamel N Ibrahim A Mohmed S Mohmed and AJoseph ldquoPCR identification of Fusarium genus based on nuclearribosomal-DNA sequence datardquo African Journal of Biotechnol-ogy vol 2 no 4 pp 82ndash85 2003

[25] S D Deshpande and G V Koppikar ldquoA study of mycotic ker-atitis inMumbairdquo Indian Journal of Pathology andMicrobiologyvol 42 no 1 pp 81ndash87 1999

[26] J Chander and A Sharma ldquoPrevalence of fungal corneal ulcersin Northern Indiardquo Infection vol 22 no 3 pp 207ndash209 1994

[27] S Saha D Banerjee A Khetan and J Sengupta ldquoEpidemio-logical profile of fungal keratitis in urban population of WestBengal Indiardquo in Oman J Ophthalmol vol 2 pp 114ndash118 3edition 2009

[28] B Rautaraya S Sharma S Kar S Das and S K SahuldquoDiagnosis and treatment outcome of mycotic keratitis at atertiary eye care center in eastern indiardquo BMC Ophthalmologyvol 11 no 1 article 39 2011

[29] S H Khairallah K A Byrne and K F Tabbara ldquoFungalkeratitis in Saudi Arabiardquo Documenta Ophthalmologica vol 79no 3 pp 269ndash276 1992

[30] S Deorukhkar R Katiyar and S Saini ldquoEpidemiologicalfeatures and laboratory results of bacterial and fungal keratitisA five-year study at a rural tertiary-care hospital in westernMaharashtra Indiardquo Singapore Medical Journal vol 53 no 4pp 264ndash267 2012

[31] C A Gonzales M Srinivasan J P Whitcher and G SmolinldquoIncidence of corneal ulceration in Madurai district SouthIndiardquoOphthalmic Epidemiology vol 3 no 3 pp 159ndash166 1996

[32] M P Upadhyay P C D Karmacharya S Koirala et al ldquoEpi-demiologic characteristics predisposing factors and etiologicdiagnosis of corneal ulceration in Nepalrdquo American Journal ofOphthalmology vol 111 no 1 pp 92ndash99 1991

[33] D J Galarreta S J Tuft A Ramsay and J K G Dart ldquoFungalkeratitis in London Microbiological and clinical evaluationrdquoCornea vol 26 no 9 pp 1082ndash1086 2007

[34] F Laspina M Samudio and D Cibils ldquoEpidemiological char-acteristics of microbiological results on patients with infectiouscorneal ulcers a 13-year survey in ParaguayrdquoGraefersquos Archive forClinical and Experimental Ophthalmology vol 242 no 3 pp204ndash209 2004

[35] I Pujol J Guarro J Gene and J Sala ldquoIn-vitro antifungalsusceptibility of clinical and environmental Fusarium sppstrainsrdquo Journal of Antimicrobial Chemotherapy vol 39 no 2pp 163ndash167 1997

[36] K LTherese R Bagyalakshmi H N Madhavan and P DeepaldquoIn-vitro susceptibility testing by agar dilutionmethod to deter-mine the minimum inhibitory concentrations of amphotericinB fluconazole and ketoconazole against ocular fungal isolatesrdquoIndian Journal of Medical Microbiology vol 24 no 4 pp 273ndash279 2006

[37] D M OrsquoDay ldquoSelection of appropriate antifungal therapyrdquoCornea vol 6 no 4 pp 238ndash245 1987

[38] S Arikan M Lozano-Chiu V Paetznick S Nangia and JH Rex ldquoMicrodilution susceptibility testing of amphotericinB itraconazole and voriconazole against clinical isolates ofAspergillus and Fusarium speciesrdquo Journal of Clinical Microbi-ology vol 37 no 12 pp 3946ndash3951 1999

[39] E C Alfonso ldquoGenotypic identification of Fusarium speciesfrom ocular sources comparison to morphologic classificationand antifungal sensitivity testing (an AOS thesis)rdquo Transactionsof the American Ophthalmological Society vol 106 pp 227ndash2392008

[40] Z Embong W H Wan Hitam C Y Yean et al ldquoSpecificdetection of fungal pathogens by 18S rRNA gene PCR inmicrobial keratitisrdquo BMC Ophthalmology vol 8 2008

[41] E EM Jaeger NM Carroll S Choudhury et al ldquoRapid detec-tion and identification of Candida Aspergillus and Fusariumspecies in ocular samples using nested PCRrdquo Journal of ClinicalMicrobiology vol 38 no 8 pp 2902ndash2908 2000

[42] C Ferrer and J L Alio ldquoEvaluation of molecular diagnosis infungal keratitis Ten years of experiencerdquo Journal of OphthalmicInflammation and Infection vol 1 no 1 pp 15ndash22 2011

Hindawiwwwhindawicom

International Journal of

Volume 2018

Zoology

Hindawiwwwhindawicom Volume 2018

Anatomy Research International

PeptidesInternational Journal of



Journal of Parasitology Research

GenomicsInternational Journal of


Hindawi Publishing Corporation httpwwwhindawicom Volume 2013Hindawiwwwhindawicom

The Scientific World Journal

Volume 2018


BioinformaticsAdvances in

Marine BiologyJournal of



Neuroscience Journal


BioMed Research International

Cell BiologyInternational Journal of



Biochemistry Research International

ArchaeaHindawiwwwhindawicom Volume 2018


Genetics Research International


Advances in

Virolog y Stem Cells International



Enzyme Research



MicrobiologyHindawiwwwhindawicom

Nucleic AcidsJournal of

Volume 2018

Submit your manuscripts atwwwhindawicom


major crops as well as immunocompromised humans [9]and have been considered as important pathogens in eyeinfections especially keratitis [2 10] In India Fusarium andAspergillus species are being isolated from corneal ulcers inlarge numbers [6 8 11ndash14] irrespective of the geographicallocation

The importance of fungal keratitis gained momentumin 2005 following the outbreak of fungal keratitis amongcontact lenswearers inmany developed countries [15 16]Thefact that the outcome of fungal keratitis is worse than thatof bacterial keratitis must be underscored [17] due to poorresponse to the therapy as well as the limited availability ofantifungal agents [18] The diagnosis and treatment of fungalkeratitis is one of the most difficult problems encounteredby ophthalmologists Further the prognoses of the fungalkeratitis worsen with inadvertent antifungal agents and recal-citrant course of the disease [2] Although voriconazole andother triazoles have broad-spectrumactivity against causativefungal isolates clinically no single drug was found to beeffective against fungal keratitis Also Fusarium spp arecompletely tolerant to itraconazole and caspofungin [19]

Accurate identification of the aetiological agent of fun-gal keratitis is of great importance in order to administerappropriate treatment [10 20] Though conventional culturemethods are often useful it takes more time for sufficientgrowth and subsequent identification of the causative agent[2] The use of molecular techniques offers a significantreduction in time required for precise diagnosis of such infec-tions [20 21] Also the scarcity of region-specific antifungalsusceptibility data the limited availability of commerciallyavailable antifungal drugs and the lack of response lead tocorneal blindness in a high number of infected patientsTherefore due to the magnitude of the fungal keratitis inTamilnadu India a survey of local antifungal susceptibilitypattern and exploring a suitable rapid diagnostic method isof paramount importance

Hence the present study was designed for the rapiddetection fungal pathogens causing keratitis by multiplexpolymerase chain reaction (PCR) and also to evaluate theefficacy of multiplex PCR against routine culture methodFurther the study also presents data on regional prevalenceof fungal keratitis andminimum inhibitory concentration [4]values of routinely used antifungal agents against Fusariumand Aspergillus isolated from corneal ulcers The paper notonly provides information on the current incidence of Fusar-iumAspergillus keratitis but also gives valuable informationon drug susceptibilities so as to help the ophthalmologiststo initiate appropriate antifungal regimen against fungalkeratitis

2 Materials and Methods

21 Patients A total of 500 (including repeat specimens)corneal scraping specimens were collected between June 2010and January 2011 from clinically suspected patients withmycotic keratitis who attended Cornea services at AravindEye Hospital Coimbatore after obtaining ethical clear-ance (Institutional Review Board Aravind Medical ResearchFoundation Madurai India)

22 Collection of Specimens Corneal scrapingwas performedunder aseptic condition by an ophthalmologist using asterile Kimurarsquos spatula and a portion was inoculated on 5sheep blood agar (SBA) chocolate agar (CA) and potatodextrose agar (PDA) Additionally the remaining specimenwas smeared on two clear glass slides to observe the presenceof fungal filaments microscopically using 10 KOH wetmount and Gram staining Corneal scrapings that revealedfungal filaments in direct microscopy were considered for thestudy Repeat corneal scraping was done to collect specimenfor PCR assay The collected specimens were placed in 400 120583lof lysis buffer (05M Tris HCL 05M EDTA 3 SDS 1 120573-mercaptoethanol) and were stored at minus20∘C until furtherprocessing

23 Identification of Fusarium spp and Aspergillus spp byCulture Method All fungal isolates were identified based onthe standard culture techniques followed by microscopy afterlacto-phenol cotton blue stainingThe identified isolates werepreserved in 085 saline at 4∘C

24 Determination of Minimum Inhibitory Concentration(MIC) The MICs of seven different antifungal agentsnamely amphotericin B (Himedia Mumbai India) itra-conazole (Sigma-Aldrich St Louis MO USA) natamycin(Sigma-Aldrich St LouisMO USA) voriconazole (AurolabMadurai India) ketoconazole (Himedia Mumbai India)econazole (AurolabMadurai India) and clotrimazole (Auro-lab Madurai India) were determined in accordance withthe guidelines of Clinical and Laboratory Standards Institute(CLSI) [22] The MIC values were defined as the lowest con-centrations of antimicrobials that inhibit the visible growth ofan isolate The MIC

50and MIC

90values were defined as the

MICs required to inhibit the growth of 50 and 90 of theisolates from a given species respectively [23]

A flavus ATCC 204304 was included as a quality controlstrain in all the batches of MIC analysis The antifungalagents were prepared in order to achieve the dilution rangesin the order of 8 120583gml - 0015 120583gml (amphotericin Beconazole voriconazole and clotrimazole) 32 120583gml - 006120583gml (itraconazole) 16 120583gml - 003 120583gml (ketoconazole)and 128 120583gml - 025 120583gml (natamycin)

25 DNA Extraction DNA was extracted from infectedcorneal tissue scrapings using Qiagen DNA extraction kit(Hilden Germany) as per the manufacturer instructionsThe concentration of extracted DNA was determined bynanophotometer (Implen Munich Germany)TheDNAwasstored at minus20∘C (Sanyo Osaka Japan) until further use

26 Polymerase Chain Reaction The extracted DNA wasinitially subjected to the first round of PCR using universalfungal primers (ITS1 and ITS4 internal transcribed spacerregion) The first round amplicons were subsequently sub-jected for multiplex PCR using Fusarium and Aspergillusspecific primers [24]

For each reaction in the first round PCR a cocktailcomprising 10 120583l of DNA extract with 5120583l of 10 times PCR buffer(mixed with 15mMmagnesium chloride) 1120583l of dNTPs mix




3 Results




50and MIC











(a) (b)





50MIC90

8 ndash 0125 77 (385) 123 (615) 1 1Natamycin


MIC90



MIC90



MIC90

8 ndash 1 101 (505) 99 (495) 4 8Econazole


MIC90



MIC90



MIC90

16 ndash 2 35 (175) 165 (825) 16 16

(a) (b)






50MIC90



50MIC90



50MIC90



50MIC90



50MIC90



50MIC90



50MIC90


NA not applicable




4 Discussion





90at






90andMIC










Data Availability




Acknowledgments


References














































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018





3 Results




50and MIC











(a) (b)





50MIC90

8 ndash 0125 77 (385) 123 (615) 1 1Natamycin


MIC90



MIC90



MIC90

8 ndash 1 101 (505) 99 (495) 4 8Econazole


MIC90



MIC90



MIC90

16 ndash 2 35 (175) 165 (825) 16 16

(a) (b)






50MIC90



50MIC90



50MIC90



50MIC90



50MIC90



50MIC90



50MIC90


NA not applicable




4 Discussion





90at






90andMIC










Data Availability




Acknowledgments


References














































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018





(a) (b)





50MIC90

8 ndash 0125 77 (385) 123 (615) 1 1Natamycin


MIC90



MIC90



MIC90

8 ndash 1 101 (505) 99 (495) 4 8Econazole


MIC90



MIC90



MIC90

16 ndash 2 35 (175) 165 (825) 16 16

(a) (b)






50MIC90



50MIC90



50MIC90



50MIC90



50MIC90



50MIC90



50MIC90


NA not applicable




4 Discussion





90at






90andMIC










Data Availability




Acknowledgments


References














































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018





50MIC90

8 ndash 0125 77 (385) 123 (615) 1 1Natamycin


MIC90



MIC90



MIC90

8 ndash 1 101 (505) 99 (495) 4 8Econazole


MIC90



MIC90



MIC90

16 ndash 2 35 (175) 165 (825) 16 16

(a) (b)






50MIC90



50MIC90



50MIC90



50MIC90



50MIC90



50MIC90



50MIC90


NA not applicable




4 Discussion





90at






90andMIC










Data Availability




Acknowledgments


References














































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018





50MIC90



50MIC90



50MIC90



50MIC90



50MIC90



50MIC90



50MIC90


NA not applicable




4 Discussion





90at






90andMIC










Data Availability




Acknowledgments


References














































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018





4 Discussion





90at






90andMIC










Data Availability




Acknowledgments


References














































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018






Data Availability




Acknowledgments


References














































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018



































Volume 2018

Zoology











Volume 2018

















Advances in




Enzyme Research





Volume 2018


fungal keratitis: epidemiology, rapid detection, and...

Documents