[CANCER RKSKARCH 56. 4453-445"). October I. 1996]

Excision of 2',2'-Difluorodeoxycytidine (Gemcitabine) Monophosphate Residuesfrom DNA1

Varsha Gandhi,2 Jaswinder Legha, Feng Chen, Larry W. Hertel, and William Plunkett

Dciwnmml of Clinical Inveslif-aliiui, The University »fTexas M. D. Änderst»!Cancer Center, Hauslim, Texas 77030 ¡V.C.. J. L. F. C.. W. /'./. anil Lilly Research Lahnratnries.

EU Lilly and Co.. Indianapalis. Indiana 46285 IL W. H.I

ABSTRACT

The activity of gemcitabine (dFdC), an effective agent against solidtumors, depends on the incorporation of its triphosphate into DNA. Invitro investigations demonstrated that, depending on the sequence oftemplate DNA, polymerases may pause after incorporation of gemcitabinenucleotide at either the 3'-terminal or 3'-penultimate position. Proofreading enzymes such as 3'—»5'exonucleases,which are associated with DNA

polymerases, can excise mismatched deoxynucleotides from DNA. Tomodel this reaction, we evaluated excision of the gemcitabine nucleotidefrom oligodeoxynucleotide (19-mer) containing 3'-penultimate dFdCmonophosphate (dFdCMP) or dCMP by the 3'—»5'exonuclease of theKlenow fragment. The rate of excision of the 3'-terminal deoxynucleotide

was similar, with both primers resulting in formation of primers withterminal dCMP or dFdCMP. The primer containing dCMP was furtherexcised, and by 40 min, more than 75% of total radioactivity was inexcision products smaller than 18-mer. In contrast, most of the primers

(90%) with terminal dFdCMP were unexcised. When primers terminatedwith either dFdCMP or dCMP were used as substrates, normal primerwas hydrolyzed almost completely by 20 min; however, only 40% ofprimers containing dFdCMP had excision of dFdCMP molecule. Kineticstudies demonstrated that the enzyme had similar affinity for primerscontaining penultimate or terminal dFdCMP, but the apparent I ,„.,„forexcision was 4-5-fold greater for removal of a 3'-terminal deoxynucle

otide than for cleavage of a dFdCMP molecule. Reaction conditions thatpermitted polymerization of one deoxynucleotide to primers containingeither 3'-penultimate dCMP or dFdCMP were used to evaluate excision

during DNA synthesis. The excised primers could not be extended becausethe reaction lacked the requisite deoxynucleotide triphosphate. After 5min, more than one-half of the dCMP primers were extended, whereasonly 15% had been excised. In comparison, 30% of the analogue-contain

ing primers lost the terminal deoxynucleotide, with a proportional lowerincidence of extension (30%). Lesser excision of dFdCMP-containingsubstrate was observed in reactions containing deoxynucleotide triphos-phates required to make full-length products. Consistent with this result,in the absence of 3'—»5'exonuclease activity, both primers were extended

similarly by the polymerization unit of the Klenow fragment. Takentogether, these data demonstrate that dFdCMP residues are difficult toexcise from DNA, and DNA polymerase can extend primers with 3'-

dFdCMP. This results in the internal incorporation of dFdCMP intoDNA, as observed in whole cells.

INTRODUCTION

dFdC,3 a difluorine-substituted deoxycytidine analogue (gemcitab

ine), has proven effective in Phase I and II trials for several malignancies (1). Metabolic investigations demonstrated that, similar toother nucleoside analogues. dFdC requires phosphorylation to act as a

Received 6/4/96: accepted 8/1/96.The costs of publication of this article were defrayed in part by the payment of page

charges. This article must therefore be hereby marked advcriist'int'iil in accordance with

18 U.S.C. Section 1734 solely to indicate this fact.1Supported in part by Grants CA 28596. CA 57629. and ÇAI6772 from the National

Cancer Institute and Grant DHP-I from the American Cancer Society.2 To whom requests for reprints should be addressed, at Department of Clinical

Investigation. Box 52. The University of Texas M. D. Anderson Cancer Center. Houston.TX 77030. Phone: (713) 792-2989: Fax: (713) 794-4316.

1The abbreviations used are: dFdC. dFdCMP. and dFdCTP. 2'.2'-difluorodeoxycyti-dine (gemcitahine) and its 5'-monophosphate and -triphosphate: ara-C and ara-CTP.I-ß-D-arabinofurunosylcytosine and its 5'-triphosphate; pol. polymerase; dNTP. de

oxynucleotide triphosphulc.

cytotoxic agent (2). The diphosphate of dFdC, one of the cytotoxicmetabolites, is a mechanism-based inhibitor of ribonucleotide reduc

íase(3). Several studies have demonstrated that the triphosphate(dFdCTP) is the major metabolite of dFdC (2, 4, 5). The principalmechanism through which dFdC exerts cytotoxicity is by inhibition ofDNA synthesis after incorporation of dFdCTP into growing DNAstrand by polymerases (2. 6). Because dFdCDP inhibits ribonucleotidereducíaseand lowers the dCTP pool competing for incorporation intoDNA (4, 5, 7), the resulting high dFdCTP/dCTP value may furtherstimulate the insertion of dFdC nucleotide into the elongating DNAstrand.

Mechanistic studies involving the molecular action of dFdC onDNA synthesis have demonstrated that dFdCTP acts as an alternativesubstrate for incorporation into the C-site of the growing DNA primer.

Although the kinetic studies indicated that compared to dCTP insertion, DNA polymerases have lower affinity for incorporation ofdFdCTP into DNA, the high dFdCTP:dCTP ratio of concentrations inwhole cells and in experimental systems results in substantial incorporation of dFdCMP molecules into DNA (6). Studies using DNAprimer elongation assays demonstrated that after insertion of dFdCMP.the primer was extended by one deoxynucleotide before a major pausein the polymerization process was observed (6). This pattern ofpolymerase pausing when dFdCMP was in the 3'-penultimate position

was also observed in synthetic oligonucleotide model systems for bothdFdCMP and 2',2'-difluorodeoxyguanosine monophosphate (8, 9).

More detailed investigations demonstrated that this was sequencespecific (10). In whole cells, however, isolation of DNA after incubation of cells with dFdC demonstrated that the majority of dFdCMPmolecules (93%) were incorporated in phosphodiester linkage inDNA. When isolated from intact cells after incubation with gemcitabine, nascent DNA demonstrated incorporation of gemcitabine insmall DNA fragments that progressed to larger fragments and intogenomic-length DNA after removal of dFdC from the medium (11).

These data indicate that there was inefficient excision of dFdCMPmolecules from the DNA in whole cells, and that DNA strands withdFdCMP molecules were extended by polymerases. resulting in theinternali/.ation of gemcitabine nucleotide.

The fate of DNA primers with either a 3'-terminal or penultimate

dFdCMP molecule suggests two possibilities. The first is that theanalogue is subject to excision by proofreading enzymes such as3'—»5'exonuclease associated with prokaryotic and eukaryotic DNA

polymerases. The second is that these primers may be extended byDNA polymerases. We evaluated these postulates by determining thekinetics of exonucleolytic degradation of DNA primers containingeither the dFdCMP or the dCMP molecule from the 3'-penultimate or3'-terminal position by the 3'—»5'exonuclease of Klenow fragment

during reaction conditions that would favor either excision or polymerization of the primers. Extension of these oligomers by the polymerization unit of the Klenow fragment provided evidence of inter-

nucleotide incoiporation of dFdCMP molecules in whole cells. Theseresults were then compared with error-correcting functions of DNA

polymerases that may act to remove other nucleoside analogues, suchas fludarabine (12, 13), 1-ß-D-arabinofuranosylcytosine (14, 15), and

chlorodeoxyadenosine (16) from DNA.4453

Research. on February 10, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

EXCISION Oh CîKMCITABINKFROM DNA

MATERIALS AND METHODS

Chemicals. dFdC and dFdC phosphoramidite were synthesized a( LillyResearch Laboratories (17). The .V-triphosphate ofdFdC (dFdCTP) was chemically synthesized by Sierra Bioresearch (Tucson. AZ). Ultrapure deoxynucle-

otides were purchased from Pharmacia Biotech Inc. (Piscataway. NJ). All otherchemicals were of the highest purity available.

Klenow Fragment of [)NA pol I. The large fragment of DNA poi I(Klenow fragment) from Escherichia coli contains both a 3'—»_Vexonucleaseand a 5'—>3' polymerization activities but lacks the 5'—>3' exonuclease of

intact DNA pol l. The Klenow fragment was obtained from United StatesBiochemical Corp. (Cleveland. OH). The concentrations and specific activityof the enzyme were 5 unils/jxl and 9318 units/ing of protein, respectively. Forextension experiments in the absence of excision. Klenow fragment without3'—>5'exonuclease activity was used. The concentration of the enzyme was 10

units/fil; the specific activity was 22.353 units/mg of protein. One unit is theamount of en/yme required to catalyze the incorporation of 10 nmol of totaldeoxynucleotides into an acid-insoluble material in 30 min at 37°Cusing

poly|d(A-T)| as template-primer.Preparation of dFdCMP and dCMP Primers. dFdC-2'-cyanoethyl-

phosphoramidite was synthesized as described previously (18). Oligonucleo-tides (19-mer) with either dCMP or dFdCMP at the 3'-penultimate position

were used as primers. These primers were synthesized using an AB1 model381A DNA synthesizer available at the M. D. Anderson core facility. Theaddition of dFdCMP was achieved by increasing the coupling time from 30 to900 s ( 18. 19). Oligomers were initially purified on an OPC column (AppliedBiosystems. Foster City, CA). For PAGE purification, the primers werelabeled with <:P at their 5'-ends, and products were separated on a sequencing

gel (6). The 19-mer oligonucleotides were then excised from gel. annealed to

complementary sites on a defined sequence template (Genosys Biotechnologies. Inc., Woodlands. TX), and precipitated with ethanol as described before(20). To ensure complete hybridization of the labeled single-stranded DNAprimers, a 2-4-fold excess of template was added to the annealing reaction.

The extent of hybridization of the primer/template was checked routinely andwas >95%, as evidenced by the formation of full-length extension products

during extension reactions with Klenow fragments in the presence of requireddNTPs.

5'|!:P]GTAAAACGACGGCCAGTCG3' CATTTTGCTGCCGGTCAGCACACAC

The normal (dCMP) and dFdCMP-containing (at the C site on primer above)primer/template hybrids were used as substrates for excision by the 3 '—>5'

exonuclease activity of DNA pol I.For synthesis of 18-mer primers with 3'-terminal dFdCMP. 19-mer oligo

nucleotides described above were incubated with the Klenow fragment for 30min. The products were separated on a 15% polyacrylamide sequencing gel.The 18-mer product was then excised from the gel, processed as described

before, quantitated based on the radioactivity, and annealed to a complementary template as shown below.

:5'[3:P]GTAAAACGACGGCCAGTC3' CATTTTGCTGCCGGTCAGCACACAC

DNA Primer Excision Assay. The primer/template complexes were usedin a 10-¡ureaction mixture containing 20 rnw Tris-HCl (pH 7.5). 8 mM MgCK,

0.5 mM DTT. 10 m.vt NaCI. and the indicated units of Klenow fragment. Theprimer concentration in each reaction was 1100 pM. The reactions were carriedout at 37°Cfor up to 40 min. stopped by the addition of an equal volume of

50 IHMEDTA with 0.3% bromophenol blue in 90% deionized formamide. andanalyzed by electrophoresis through a 15% polyacrylamide sequencing gel.For quantitation of the rate of excision, radioactivity associated with each laneat the primer site and the bands below the primer band were quantitated usinga Betascope 603 blot analyzer (Belagen. Waltham, MA). The loading error wascorrected by normalizing the radioactivity in each lane to the average totalradioactivity in each lane for each experiment. The rate of excision wascalculated as the percentage of initial substrate. The final values representedthe mean ±SD of at least four sets of data points generated by two separatereactions, each analyzed twice by gel electrophoresis.

Determination of Kinetic Constants. Various concentrations of DNAsubstrates (22. 44. 110, 220. 440. I 100. 2200. and 4400 pM) were used todetermine the kinetic parameters. In each experiment. 0.05 unit of enzyme ina reaction volume of 10 /il was used. The reactions were run so that the amountof product formed comprised 15-30% of the substrate. Reaction products were

denatured and run on sequencing gels. Radioactivity associated with the bandsfor oligonucleotides of 18-mer or less (in experiments with 3'-penultimate

dFdCMP or dCMP primers) and oligonucleotides of 17 or less (in experimentswith 3'-terminal dFdCMP or dCMP primers) was quantitated using a Beta-

scope 603 blot analyzer. The reaction velocity (radioactivity in the excisionproduct hands over time) was plotted against the concentrations of the respective substrates. The apparent Kll: values were then calculated based on theMichaelis-Menlen equation, using a computer-assisted program (21). The

apparent Vm.,xvalues obtained through these calculations were converted to apercentage of product per minute based on the total radioactivity in each lane.

DNA Primer Extension Assay. The primers containing 3'-penullimate

dFdCMP or dCMP were hybridized to complementary templates and used assubstrates for extension by the polymerization activity of the Klenow fragment.

For extension of primers without excision. Klenow fragment lacking theexonuclease domain was used. The primer extension reaction mixture contained 20 mM Tris-HCl (pH 7.4). 0.5 mM MgCK. 0.25 mM DTT. 40 ng/ml

BSA. the indicated concentrations of dNTPs along with the labeled, primer/template complexes ( 1100 pM). and Klenow fragment of DNA pol I (with orwithout 3'—»5'exonuclease). The reactions were carried out at 37°Cfor the

indicated times, stopped by addition of an equal volume of 50 HIMEDTA with0.3% bromphenol blue in 90% deionized formamide. and analyzed by electrophoresis through a 15% polyacrylamide sequencing gel.

RESULTS

Excision of DNA Primers with 3'-Penultimate dFdCMP or

dCMP. Oligonucleotides (19-mer) containing dFdCMP or dCMP atthe 3'-penultimute position annealed to a complementary 25-mer were

used as substrates for excision by Klenow fragment (Fig. 1). Fig. 1,Lanes I and 9. represent reaction mixtures without the Klenow enzyme. In reactions with each primer, the band intensity at the 19-mer

position gradually decreased, whereas formation of excision product( 18-mer and lesser size bands) increased with time. The nucleotide atthe 3'-position was removed from both dFdCMP- and dCMP-conlain-

ing primers.There was a major difference in the intensity of products formed

after removal of the 3'-terminal deoxynucleotide: this difference is

represented by the intensity of band formed at site 18 on the gels. The18-mer band intensity increased during incubation time for dFdCMP-primer but decreased gradually for dCMP-primer. The 18-mer productformed in each case had a 3'-terminal dFdCMP (Fig. 1, Lanes 2-8) or

dCMP (Fig. 1, Lanes 10-16). The further excision of 18-mer frag

ments with terminal dFdCMP was much less frequent than for primerswith terminal dCMP; hence, very little product of 17 nucleotides orless was formed with dFdCMP primers (Fig. 1. Lanes 2—8),suggesting that 3'-terminal dFdCMP strongly resisted excision by the Klenow

fragment. In contrast, the primer containing the normal deoxynucleotide produced excision bands of different lengths, and the smallestsize was 9-nucleotides (Fig. 1. Lanes 10-16}.

The radioactivity in the product bands was quantitated by Beta-

scope from the gels shown in Fig. 1 and from three similar gels, andthe excision activity with each primer was plotted against time (Fig.2). The rate of excision of the first deoxynucleotide (dGMP) from the19-mer oligomers was similar for primers containing dFdCMP or

normal dCMP (Fig. 2, compare solid symbols in A and B). However,the kinetics of excision of dFdCMP and dCMP from the 3'-position of

primers was very different. The rate of excision of dCMP was similarto that of the terminal deoxynucleotide. but the dFdCMP excision ratewas less than 5% during the first 10 min of the incubation period (Fig.

4454

Research. on February 10, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

Fig. l. Autoradiogram of polyacrylamide gelsshowing excision of primers by the Klenow fragmentof DNA polymerase I. The ability of the 3'—»5'exo-

nuclease of Klenow fragments to excise deoxynucle-otides from the vP-labeled DNA primers containingdFdCMP (Lanes I-X) or dCMP (Limes 9-16} at the3'-penultimate position was evaluated. Limes t and 9

represent reactions containing primers without anyenzyme. Litnes 2-H and Limes 10-16 show reactionproducts after a I-. 2.5-. 5-. 10-. 20-. 30-, and 40-minincubation with Klenow fragment, respectively.

EXCISION OF GEMCITABINE FROM DNA

lanes 12345678

19—18—

9 10 11 12 13 14 15 16

rnmf!—¿�19—¿�18

min. O 1 2.5 5 10 20 30 40

^ ^ W

•¿�••«

"I

0 1 2.5 5 10 20 30 40

2A). The total excision of dFdCMP was only 10% by 40 min, muchless than the extent of dCMP excision from the primers.

Although the amount of enzyme was 7-fold in excess of the startingsubstrate (19-mer) during these incubations, it is possible that after

dissociation from the primer containing an analogue such as dFdCMPat 3'-end, the enzyme may not have been functional to remove any

further nucleotides. To evaluate this possibility and to ensure thealmost complete excision of normal primers, the levels of Klenowfragment were increased 4-fold to 0.2 unit of enzyme with 1100 pMof

substrate, an enzyme:substrate ratio of approximately 30. At such highlevels of enzyme, less than 20% of the primer with 3'-terminal

80.u3•¿�oOQ.

I 40J

UX0)

60.

20-

0-

10 20 30—¿�i—40

80

2 604Q.C

.2 404co'o

Xo 20.

0.

18-mer

10 20

minutes

30 40

Fig. 2. Excision products from 19-mer oligonucleotides with 3'-penultimate dFdCMP

(A) or dCMP (B). The radioactivity in product bands of 18-bases and smaller fragments(•.A) or 17-mer and smaller products (O. A) from 4 gels similar to Fig. 1 was quantitated

and expressed as the percentage of total input radioactivity. Each data point represents themean of four values; bars, SD.

dFdCMP was excised, indicating its poor substrate efficiency (datanot shown).

Excision of DNA Primers with 3'-Terminal dFdCMP or dCMP.To investigate the pattern of excision from primers with 3'-terminaldFdCMP, these oligomers (18-mer) were exposed to 3'—*5' exonu-

clease for up to 40 min. As illustrated in Fig. 3, during the first minuteof reaction, the exonuclease excised the gemcitabine molecule fromsome primers to form a 17-mer product (Fig. 3. Lane 2). The intensityof the band at the 18-rner position was stable during the incubationtime. In contrast, the intensity of the band at the 17-mer positiondecreased gradually with time (Fig. 3, Lanes 2-8), suggesting afurther digestion of 17-mer. This observation was consistent with the

accumulation of lesser size products. Although the formation andaccumulation of smaller bands were evident in primers with dCMP attheir 3'-termini (data not shown), there was a gradual decrease in the

band intensity of the original substrate (18-mer). By 40 min, theoriginal substrate (18-mer) was almost completely excised, and products of mostly 9-12 nucleotides were visible.

The radioactivity in substrate and product bands from the gel shownin Fig. 3 and other similar gels was quantitated to determine the extentof excision of 3'-terminal dFdCMP in comparison to 3'-terminaldCMP. The removal of 3'-dCMP was quick, and by 5 min, more than

70% of 18-mer was reduced to 17-nucleotide-long products. ThedCMP from 3'-termini of these primers was almost completely (96%)cleaved by 20 min. In contrast, although excision of dFdCMP from 3'

terminus was apparent during the first 5 min, it reached a plateau onlyafter 40% of primers were excised. Thereafter, the enzyme excised the17-mer product, and the original 18-mer substrate remained unex-

cised. Even at 40 min, more than 55% of primer with dFdCMPremained intact.

Kinetic Parameters of Primer Excision. To determine the kinetics of excision of deoxynucleotides from primers containing dFdCMPor dCMP at the 3'-penultimate position or dFdCMP at the 3'-terminalposition, several concentrations (see "Materials and Methods") of

substrates (19-mer or 18-mer primers) were incubated with Klenow

enzyme. The reaction products were then analyzed on sequencinggels. Increasing concentrations of substrate containing a 3'-penulti

mate dCMP or dFdCMP resulted in an increase in the product formation.

The data obtained from these experiments were used to calculatethe kinetic parameters for excision. The rate of excision was plottedagainst the concentration of substrate, and apparent Km and Vmaxvalues were determined using Michaelis-Menten kinetics (Table 1).

4455

Research. on February 10, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

EXCISION Oí (il-.MCÕTAWM: I ROM DNA

lanes 118—

17—

H—18

min. O 1 2.5 5 10 15 30 40Fig. 3. Excision of DNA primers with 3'-terminal dFdCMP hy the Klenow fragment.

Reactions were carried out in a reaction mixture as described in "Materials and Methods."

using I KX)pw of substrates in a I0-fil volume, for 0. I. 2.5. 5. IO. IS. 30. and 40 min.The reaction products were analy/ed on a l5'/f polyacrylamide gel.

Table I Kìnelìcpurtiint'lcrs of i'.\cisìonh\ Klt'iltw frtlxitlt'in of DNA pol I fordFttCMP- tinti iiCMP-foiituinini> primer*

Primers3'-PenullimatedFdCMPdCMP3'-TerminaldFdCMPApparentKm

(pM)406

±I444I2±44505

±187Apparent

Vmax(fmol/min/units)1

0.57 ±0.887.12±0.452.04

±0.54

When these parameters were compared, the affinity of 3'—»5'exonu-clease of the DNA pol I for removal of the 3'-terminal normaldeoxynucleotide was similar from primers with 3'-penultimate dCMP

or dFdCMP. Thus, the enzyme did not differentiate between a normaldeoxyoligomer and an oligomer with gemcitabine. Kinetic constantvalues for removal of the terminal dFdCMP from the DNA suggestedthat, although the exonuclease bound to this terminus with similaraffinity as with normal 3' terminus, the reaction velocity was about

4-fold less.

Excision of DNA Primers during Extension Conditions. Theexcision pattern and kinetics presented above were observed in theabsence of dNTPs, a reaction condition that favors the 3'—>5'exonu

clease activity of the Klenow fragment. In whole cells, however, theproofreading and error-correcting functions are generally coupled

during DNA extension. To determine the rate of excision of bothnormal and dFdCMP-containing primers under DNA polymerization

conditions, reactions were run in the presence of 0.5 ¿IMdTTP. thesubstrate needed to extend these primers by I deoxynucleotide. Theabsence of dGTP in the reaction mixture prevented the polymerizationof the excision products. Accumulation of 20-mer (representing extension) and 18-mer or shorter oligonucleotides (representing exci

sion) were quantitated at the indicated times (Fig. 4). Comparison ofnormal versus dFdCMP primers suggested that in each case, polymerization of the 19-mer occurred, resulting in a 20-mer product. This

effect was visible 1 min after the reaction started and increasedgradually during IO min of reaction for both dFdCMP (Fig. 4, Limes1-5) and dCMP primers (Fig. 4, Lanes 6-10). In both cases, a portion

of the substrate was also cleaved to form an excision product of18-mer or less. An hydrolysis product of 18-nucleotide length wasformed from dFdCMP primers (Fig. 4, Lanes 2-5), whereas shorterproducts formed from dCMP primers (Fig. 4, Lanes 7-10). This

pattern was consistent with that observed when reaction conditionswere suitable only for excision (Fig. 1). The extension of normal

primer was 1.5-2.5-fold greater than that of the dFdC primer (Fig. 5).The rate of excision of 3'-terminal dCMP was substantially less than

that observed during reaction in the absence of dTTP (compare Fig.1). Furthermore, the excision of the 3'-terminal nucleotide from theprimers containing dFdCMP at the 3'-penultimate position was about

2-fold greater than from the normal oligomer. Increasing the concen

tration of dTTP (50 /UM)resulted in a major decrease in excision of thedeoxynucleotide from the 3' terminus. At 20 min, the accumulation of

excision products from dFdCMP primers was less than 5% of the totalradioactivity and was \c/c for dCMP primers. This in turn was asso

ciated with an increase in the extension reaction for both these primers(data not shown).

These results indicate that the Klenow fragment with an associated3'—>5'exonuclease activity extended primers containing dFdCMP at

a slower rate than the normal primers. Two things may account forthis: (i() the enzyme may have difficulty to associate with a substratecontaining the difluoro analogue at the 3'-penultimate position; (b)

when this bifunctional enzyme is in the exonuclease mode, the enzyme may not fulfill the polymerization function.

In the previous experiments, dTTP was present in the reaction,which allowed extension of primers by a single nucleotide but alsoallowed DNA pol to dissociate from the extended primer and bedistributed to other available primers to initiate either the excision orextension reaction. To reduce the chance of such dissociation, reac-

lanes

20—19—

18—

67 8 9 10

»MM—¿�20—¿�19—¿�18

min. O 1 2.5 5 10 0 1 2.5 5 10Fig. 4. Excision of DNA primers hy Klenow fragment during polvmeri/ation. DNA

primers with dFdCMP (Umcs 1-5) or dCMP (Lanes 6-10) at .V-penullimate position

were used as substrates. Reactions were curried out in a reaction mixture containing 1100pM of substrate DNA. 0.5 /U.Mof dTTP to extend primers by I nucleotide. and 0.05 unitof the Klenow fragment. Lanes I and 6 show the uncxtended primers. Limes 2-5 andLanes 7-10 show products after incubation for 1. 2.5, 5. and IO min, respectively. Thereaction products were analy/ed on a 15% polyacrylamide gel. Both excision products(18-mer and smaller si/,e) and extension products (20-mer) were quantitated to comparethe rates of excision and extension by the Klenow fragment.

60-

50 _

Oa 30J

20-

10-

0-

8 10

minutesFig. 5. Extension and excision kinetics of 19-mer oligonucleotidcs with 3'-pcnultimatc

dFdCMP or dCMP. The reactions were run as described in Fig. 4. The radioactivity wasquantiialed and expressed as percentage of total radioactivity. The extension products (•.A) were 20-mer oligonucleotides. and the excision products (O, A) were less than19-nucleotidcs long obtained from dCMP primer •¿�O) or dFdCMP (A. A) primer. Eachdata point represents the mean of four values: htirs. SD.

4456

Research. on February 10, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

l:\CISION 01 : FROM DNA

O3•¿�oO

60-

50-

40-

30-

20-

10-

0.

10 15 20

minutesFig. 6. Extension and excision kinetics of 19-mer oligonucleotidcs with .V-penultimate

dFdCMP or dCMP in the presence of dGTP and dTTP. The reactions were run asdescribed in Fig. 4 hut in the presence of both dGTP and dTTP to make lull-length

products. The radioactivity was quantitated and expressed as the percentage of totalradioactivity. The extension products (•.A) were 20-mer or longer oligonucleolides. and

the excision producís(O, A) were products less than I9 nuclcotidcs long from dCMPprimer (•.O) or dFdCMP (A, A) primer. Each data point represents the mean of fourvalues: bars. SD.

lions were conducted in the presence of both dGTP and dTTP (0.5 /¿Meach), thus allowing extension of primers to full-length products.

Under these conditions, the excision and extension of primers with3'-penultimate dCMP were similar to that observed when only dTTP

was present in the reaction (e.g., Fig. 5). The dFdCMP primer,however, was extended at a greater rate by the Klenow fragmentduring these reaction conditions (Fig. 6). The extension of bothprimers was similar, especially at longer incubation times (5-20 min),

consistent with the established preference of the Klenow fragment forpolymerization relative to excision (22). Increasing the concentrationof required dNTPs (dTTP and dGTP at 50 ¿¿M)in the reaction againfavored extension of both primers at an increased rate: at 15 min, morethan 80% of primers (83.1% ±5.0% for dFdCMP primer versus83.6% ±4.5% for dCMP primer) were extended to make full-length

products (data not shown).Extension of DNA Primers. The data presented show that al

though the 3'—>5' exonuclease was available for excision of dFd-

CMP-containing primers, the rate of extension was similar for both

primers, suggesting that polymerization was not affected by the presence of the difluoro analogue in the DNA. To determine further theextension of primers with 3'-penultimate dFdCMP. reactions were

carried out in the presence of 5 ¡JLMdGTP and dTTP with 0.005 unitof DNA pol I lacking both the 3'—>5'exonuclease and 5'—»3'exo

nuclease activities (enzymeisubstrate ratio, less than 0.4). The use ofthis fragment represents a direct comparison of polymerizing activityof DNA pol I for an analogue-containing DNA or an identical DNAprimer with normal deoxynucleotide at its 3'-penultimate position.

The products from these reactions were run on a polyacrylamide gel,and radioactivity was quantitated to determine the rate of extension ofeach primer (data not shown). At all time points from 1 to 30 min, therates of extension of dFdCMP primers by DNA pol I were similar tothose observed for dCMP primers (86% ±1% for dFdCMP primerversus 89% ±1% for dCMP primers at 15 min). This suggested thatthe binding and polymerization of dFdCMP- or dCMP-containing

primers by DNA pol l may not be affected by the presence of adifluoro analogue 1 nucleotide upstream.

DISCUSSION

Previous studies demonstrated that the pause of DNA pol could be

either at the incorporation of dFdCMP or after incorporation of 1 morenucleotide. In each case, the incorporated dFdCMP molecule is vulnerable for excision immediately (at the 3' terminus) or after excisionof the terminal deoxynucleotide (3'-penultimate position) by the3'—>5'exonuclease associated with DNA polymerases. The present

study focuses on the fate of the dFdCMP molecule after it has beeninserted at the 3'-terminal or 3'-penultimate position. We have com

pared the substrate properties of oligonucleotides containing eitherdFdCMP or dCMP to evaluate polymerization, excision, or bothactivities by the Klenow fragment of DNA pol I.

A primary requirement of DNA polymerases for extension orexcision is the association and binding of the enzyme to a modified 3'

terminus. The interaction of a fluorescent duplex DNA oligomer withthe Klenow fragment of DNA pol I suggested that 5 or 6 bases of theprimer strand upstream of the 3' terminus were in contact with the

protein (22). This was in agreement with X-ray crystallography studies (23) and other investigations involving substitution of the phos-phodiester backbone of DNA by introduction of site-specific sulfon-amide linkages (24), which revealed that this long-range interaction

occurs in the pol domain of the enzyme. In contrast, the exonucleasedomain interacted with the three 3'-terminal phosphodiester linkages(24). The fact that, in the present study (in primers with 3'-penulti-mate gemcitabine), the 3'-terminal deoxynucleotide adjacent to a

dFdCMP residue was excised at a similar rate as a deoxynucleotideadjacent to dCMP suggests that the association and binding of the polI to these primers may be similar (Figs. 1 and 2). This is consistentwith the observation that the 3'—»5'exonuclease of the Klenow

fragment had a similar affinity for both primers (Table 1). Furthermore, the rate of extension of primers containing 3'-penultimatedFdCMP verxux dCMP by an enzyme lacking 3'—»5'exonuclease was

similar. During extension by the DNA pol I lacking both exonucleaseactivities, the formation of product would depend on association and

dissociation of the enzyme to the primers and subsequent polymerization. Because the only difference in the present case was the natureof primer (with dCMP or dFdCMP), the rate of extension of theseprimers would represent differences in the rate of association anddissociation of enzyme to these primers. Hence, these data suggestthat the presence of a 3'-penultimate dFdCMP in a primer may not

affect the binding of DNA pol I to the primer, either at the pol domainor at the exonuclease moiety.

The reaction conditions for the present experiments were geared forexcision or extension of primers already containing a dFdCMP molecule. It is known that during polymerization, the Klenow fragmentedits its own pol errors by a predominantly intermolecular processinvolving dissociation of the enzyme-DNA complex and reassociationof the DNA with the 3'—»5'exonuclease site of a second molecule of

Klenow fragment (25). Although the present experiments were notconducted under conditions where DNA pol I would first incorporatedFdCMP followed by further extension or excision of this oligomer.because the process occurs by intermolecular exchange, the presentdata should represent the kinetic balance of extension verxux excision.

Primers containing a dFdCMP residue at the 3' terminus affected

the rate of excision by the Klenow fragment (Fig. 3: Table I ). The factthat polymerization of such primers by human DNA poi a is muchslower (10) than that of the normal primers is in agreement with thisdata. Several studies have shown that polymerases bind with roughlyequal affinity to matched and mismatched primer termini (26-30):

however, excision occurs at a much faster rate for mismatched terminicompared to matched termini. The presence of a modified nucleotide

4457

Research. on February 10, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

EXCISION OF OEMC1TABINE FROM DNA

at the 3' terminus (gemcitubine in the present study) lowers the rate of

the excision reaction.Comparison of excision of different nucleoside analogues from

DNA by the 3'—*5'cxonuclease of DNA polymerases suggests that a

modification in the sugar plays a major role in retarding the excisionprocess. For example, the presence of an OH group at the 2'-arabi-

nosyl position with either a purine ( 12, 31 ) or pyrimidinc (6. 14) in theDNA primer resulted in a relative inhibition of the removal of analogues compared to normal DNA substrates. Excision of fludarabinefrom the 3' terminus of DNA. however, proceeded at a much slower

rate than other ara-nucleotides, and the excision of a fludarabine

molecule from DNA inactivated the exonuclease and prevented further degradation or extension of the primer. This suggests that modification of the base of an ara-nucleotide further limits its excision(13). With respect to antiviral drugs, the incorporated 3'-azidoTMP is

removed by human DNA pò! o or e with relative difficulty (32),whereas 2',3'-dihydro-2',3'-dideoxyadenosine is not a substrate for

the same enzyme (33). In contrast to a nonphysiological carbohydrate,a normal deoxysugar with a base modification, for example a halogen,in the purine ring (2-chlorodeoxyadenosine: Ret. 16) was an excellentsubstrate for excision by .V—>5'exonucleascs of several polymerases.

This further indicates that an alteration in the carbohydrate moiety ofnucleoside analogues makes them either completely or relativelyresistant to editing by 3'—»5'exonucleases. Consistent with thisnotion, fluorine at the 2'-geminal position of deoxycytidine is fairlyresistant to excision by 3'—>5'exonuclease of poi e (6) or pol I (the

present study).During primer extension. DNA polymerases show unique pausing

patterns after insertion of difluoro analogues that reflect the kinetics ofen/.yme action (6, 10). After incorporation of (he analogue, one moredeoxynucleotide is incorporated before the pol pauses (6, 8, 9).Hydrolysis products from such primers demonstrate that the en/ymeprefers excision of the terminal normal deoxynucleotide to cleavageof the gemcitubine residue (Fig. 1. 18-mer versus 17-mer excision

products!. If this differential cleavage pattern also occurs in wholecells, it could be expected that during DNA synthesis the availabilityof other 3'-DNA termini for excision would leave gemcitabine-ter-

minated primers unexcised. In addition, other conditions such as thepresence of deoxynucleotides may favor extension rather than excision of gemcitabine-containing primers by DNA polymerases withassociated 3'—>5'exonuclease activities. The preference for extension

may limit either the excision of normal deoxynucleotidcs from DNAstrands with a penultimate dFdCMP (Figs. 5 and 6) or excision ofgemcitabine molecules from primers terminated by dFdCMP (Fig. 4).When the conditions are completely geared for excision, only a lewprimers may lose 3'-terminal dFdCMP (Fig. 3, Lanes 2 and .?). Taken

together, the kinetic balance between the en/ymatic conditions, resistance of gemcitabine to excision by exonuclease. and the presenceof dNTPs in whole cells may result in internal incorporation ofdFdCMP residues in DNA.

Although the present studies were conducted using a prokaryoticen/yme. the information obtained may be translated to eukaryoticpolymerases. This is bused on the fact that three amino acid regionscontaining critical residues of the Klenow fragment involved in metalbinding. DNA binding, and catalysis of the exonuclease reactions arelocated in the amino terminal half and in the same linear arrangementin several prokaryotic and eukaryotic DNA polymerases (34). Basedon this amino acid sequence homology, it could be predicted that the3'—»5'exonuclease active site of DNA pol I is conserved for eukary

otic DNA polymerases. Consistent with this, previous studies havedemonstrated that the yeast poi II has functional homology to mammalian DNA polymerase €¿�(35). Furthermore, the excision properties

of the Klenow fragment are similar to those of yeast pol II with regardto hydrolysis of normal primers or primers containing analogue (16).

In conclusion, the incorporation of dFdCMP in DNA during DNAsynthesis in whole cells results in a strong pause of the pol either at theincorporation site or at a site beyond incorporation of a gemcitabinenucleotide. We postulate that when replication or repair synthesis isconducted by pol 7. <5.or e, which contain 3'—>5'exonuclease activ

ities, only a small portion of the inserted dFdCMP would be excisedby a 3'—»5'exonuclease, whereas the pol domain of these enzymes

would extend the remaining primers by adding dNTPs. resulting inlong DNA strands with ¡nternucleotide dFdCMP residues, as has beenobserved in cellular systems.

ACKNOWLEDGMENTS

We are grateful to Frank Richardson lor guidance regarding the synthesis ofoligomers containing gemcitabine and to Roger Barber for his advice withkinetic evaluation of the experimental data. The expert technical advice provided by Cathy Searcy and editorial assistance by Jude Richard are greatlyappreciated.

REFERENCES1. Kaye, S, H. (icmcilahiiie. ("linoni slalus of phase I and II trials l Editorial), J. Clin.

Oncol.. 12: 1527-1531. 1994.

2. Hcincmann. V.. Hcncl. I.. W.. Grindcy. (i. B., und Plunkclt. W. Comparison of inecellular pharmacokinetics and loxicily of 2'.2'-dilluorodeo\ycyiidinc and I-/Ü-D-

arahinofuranosylcytosine. Cancer Res.. -IH: 4024-4031. I'M«.

3. Baker. C. H.. Bañ/on. J.. Bollinger. J M.. Sluhhe. J.. Samano. V.. Robins. M. J..Lippen, B.. Jarvi. I:., and Resvick. R. 2'-Deoxy-2'-mcthylcnccytidinc and 2'-dcoxy-2'.2'-dinuorocytidine 5'-diphosphaies. Potent mechanism-bused inhihiiors of rihonu-

clcolide reduélase.J. Med. Chem.. .1-1: 1879-1884. 1991.4. Gandhi. V.. and Plunkcll, W. Modulatory activity of 2'.2'-dilluorodcoxycytidinc on

the phosphorylalion and eytotoxieily of arahinosyl tuicleosides. Cancer Res., 50:3675-3680, 1990.

5. Shcwach. D. S.. Hahn. T. M., Chang, E.. Heriel. !.. W.. and Lawrence. T. S.Melaholism of 2',2l-difliioro-2'-deoxycylidine and radiation sensiti/alion of human

colon carcinoma cells. Cancer Res.. 54: 3218-3223. 1994,

6. Huang. P.. Chuhh. S.. Hcncl. L. W.. Grindcy. G. B.. and Plunked. W. Action of2'.2'-difluorodeoxycytidinc on DNA synthesis. Cancer Res.. 51: 6110-6117. 1991.

7. Heinemann. V.. Xu. Y-Z., Chuhh. S.. .Sen. A.. Hcncl. L. W.. Grindcy. G. B.. andPlunkell. W Inhibition of rihonucleolide reduction in CCRF-CEM cells by 2'.2'-

difluorodcoxycylidine. Mol. Pharmacol.. ÃŒH:567-572. 1990.8. Gandhi. V.. Mincishi. S.. Huang. P.. Chapman. A. J., Yang. Y.. Chen. F.. Nowak. B..

Chubb, S., Hertel. L. W., and Plunkett. W. Cyloloxicily. metabolism, and mechanismsof action of 2l.2'-dilluorodeoxyguanosinc in Chinese hamster ovary cells. Cancer

Res., 55: 1517-1524. 1995.9. Gandhi. V.. Mincishi. S.. Huang. P., Yang. Y.. Chubb. S.. Chapman. A. J.. Nowak.

B. J.. Hcncl. L. W.. and Plunkett. W. Difluorodcoxyguunosinc: cylotoxicity. metabolism, and actions on DNA synthesis in human leukemia cells. Semin. Oncol., 22(Suppl. 11); 61-67. 1995.

10. Searcy. C., Huang. P.. Gandhi, V.. and Plunkett. W. DNA sequence plays a role in theeffects of gemcitahine on strand elongation with DNA polymerase a. Proc. Am.Assoc. Cancer Res.. Ì6:404. 1995.

11. Ross, D. D.. and Cuddy, D. P. Molecular effects of 2'.2'-difluorodeoxycylidine

(gemcitahine) on DNA replication in intact HI.-60 cells. Biochcm. Pharmacol.. 4H:1619-1630, 1994.

12. ! hi.ui:- P.. Chuhh, S.. and Plunkell. W. Termination of DNA synthesis by 9-/3-O-arahinofuranosyl-2-fluoroadeninc: a mechanism for cylotoxicily. J. Biol. Chent., 2fi5:16617-16625. 1990.

13. Kamiya. K.. Huang. P.. and Plunkell. W. Inhibition of ihc 3'—-5' exonuclease of

human DNA polymerase f by fludarahinc-lcrminatcd DNA. J. Biol. Chem.. 271:19428-19435. 1996.

14. Mikita. T., and Beardsley. G. P. Functional consequences of the arahinosylcytosinestructural lesion in DNA. Biochemistry, 27: 4698-4705, 1988.

15. Perrino. F. W.. Miller. H., and Baley. K. A. Identification of a 3'—«S'-cxonucleasethatremoves cylosine arahinoside monophosphalc from 3' termini of DNA. J. Biol.

Chem.. 2W: 16357-16363. 1994.16. Hentosh. P.. and Grippo. P. 2-Chloro-2'-dcoxyadenosinc monophosphalc residues in

DNA enhance susceptibility to 3'—»5'exonucleases. Biochcm. J.. )02: 567-571.

1994.17. Hertel. L. W.. Kroin. J. S.. Misncr. J. W., and Tustin. J. M. Synthesis of 2-dcoxy-

2.2-dilluoro-D-ribose and 2-deoxy-2.2-dilluoro-ii-rihofuranosyl nucleosidcs. J. Org.Chem., 5.<: 2406-2409. 1988.

18. Richardson, F. C.. Richardson. K. K.. Kroin, J. S.. and Hertel. L. W. Synthesis andrestriction en/yme analysis ol oligodeoxyribonucleoiides containing the ami-cancerdrug 2'.2'-diniioro-2'-deoxycytidinc. Nucleic Acids Res.. 20: 1763-1768, 1992.

19. Schy. W. E.. Hcncl. L. W.. Kroin. J. S.. Bloom. L. B.. Goodman. M. F.. andRichardson. F. C. Effect of a template-located 2'.2'-dilluorodeoxycytidine on the

4458

Research. on February 10, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

EXCISION OF OEMCITABINK PROM DNA

kinetics and fidelity of buse insertion by Klenow (3'—>5' exonucleuse) fragment.

Cancer Res.. 53: 4582-4587. 1993.20. Huang. P.. Farquhar, D.. and Plunkett. W. Selective action ot 3'-a/ido-3'-deoxythy-

midine .V-triphosphate on viral reverse transcriptases and human DNA polymerases.J. Biol. Chem.. 265: 11914-11918. 1990.

21. Chou. J.. and Chou. T. Dose-effect analysis with microcomputers, pp 5-18. Amster

dam: Elsevier Science Publishers. 1985.22. Guest. C. R.. Hochstrasser. R. A.. Dupuy. C. G.. Allen. D. J.. Benkovic. S. J.. and

Millar. D. P. Interaction of DNA with the Klenow fragment of DNA polymerase 1studied hy time-resolved fluorescence spectroscopy. Biochemistry. 30: 8759-8770.1991.

23. Beese. L. S.. Derbyshire. V.. and Stcitz. T. A. Structure of DNA polymerase I Klenowfragment hound to duplex DNA. Science (Washington DC). 260.- 353-355. 1993.

24. Perrin. K. A.. Huang. J.. McElroy. E. B.. lams. K. P.. and Widlanski. T. S. Definingthe interactions between DNA and the exonuclease domain of DNA polymerases. J.Am. Chem. Soc.. /In: 7427-7428. 1994.

25. Joyce. C. M. How DNA travels between the separate polymerase and 3'—»5'-

exonuclease sites of DNA polymerase I (Klenow fragment). J. Biol. Chem.. 264:10858-10866. 1989.

26. Mendelman. L. V., Petruska. J.. and Goodman. M. F. Base mispair extension kinetics:comparison of DNA polymerase a and reverse transcriptase. J. Biol. Chem.. 265:2338-2346. 1990.

27. Wong. I.. Patel. S. S.. and Johnson. K. A. An induced-fit kinetic mechanism for DNAreplication fidelity: direct measurement hy single-turnover kinetics. Biochemistry. 30:526-537. 1991.

28. Crcighton. S.. Huang. M-M.. Cai. H.. Arnheim. N., and Goodman, M. F. Base mispair

extension kinetics: binding of avian myelohlasts reverse transcriptase to matched andmismatched base pair termini. J. Biol. Chem.. 267: 2633-2639. 1992.

29. Huang, M-M.. Arnheim. N.. and Goodman. M. Extension of base mispairs by Taq

DNA polymerase: implications for single nucleotidc discrimination in PCR. NucleicAcids Res.. 20: 4567-4573. 1992.

30. Reddy. M. K.. Weitzel. S. E.. and von Hippel. P. H. Processive proofreading isintrinsic to T4 DNA polymerase. J. Biol. Chem.. 267: 14157-14166. 1992.

31. Derse. D.. and Cheng. Y-C. Herpes simplex virus type 1 DNA polymerase. Kineticproperties of the associated 3'—»5'exonuelease activity and its role in araAMP

incorporation. J. Biol. Chem.. 256: 8525-8530. 1981.

32. Nickel. W., Austermann. S.. Bialek. G.. and Grosse. F. Interactions of a/idothymidinetriphosphate with the cellular DNA polymerases a. &. and t with DNA primase.J. Biol. Chem.. 267: 848-854. 1992.

33. Huang. P.. Farquhar. D.. and Plunkett. W. Selective action of 2',.V-didehydro-2'.3'-

dideoxythymidine triphosphatc on human immunodeficiency virus reverse transcriptase and human DNA polymerases. J. Biol. Chem.. 267: 2817-2822. 1992.

34. Bernad. A.. Blanco. L.. Lá/.aro.J. M.. Martin, G.. and Salas. M. A conserved 3'—»5'

exonuclease active site in prokaryotic and eukaryotic DNA polymerases. Cell, 59:219-228. 1989.

35. Araki. H., Ropp. P. A.. Johnson. A.. Johnston. L-H.. Mortson. A., and Sugino. A.

DNA polymerase II: the probable homolog of mammalian DNA polymerase 6.replicates chromosomal DNA in the yeast Sacchanmnces cererisiae. EMBO J.. II:733-740. 1992.

4459

Research. on February 10, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from

1996;56:4453-4459. Cancer Res   Varsha Gandhi, Jaswinder Legha, Feng Chen, et al.   Monophosphate Residues from DNA

-Difluorodeoxycytidine (Gemcitabine)′,2′Excision of 2

  Updated version

  http://cancerres.aacrjournals.org/content/56/19/4453

Access the most recent version of this article at:

   

   

   

  E-mail alerts related to this article or journal.Sign up to receive free email-alerts

  Subscriptions

Reprints and

  .pubs@aacr.orgDepartment at

To order reprints of this article or to subscribe to the journal, contact the AACR Publications

  Permissions

  Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerres.aacrjournals.org/content/56/19/4453To request permission to re-use all or part of this article, use this link

Research. on February 10, 2020. © 1996 American Association for Cancercancerres.aacrjournals.org Downloaded from