THE NOVEL GR29D09 EFFECTOR FAMILY FROM POTATO CYST

NEMATODE GLOBODERA ROSTOCHIENSIS SUPPRESSES PLANT IMMUNITY

TO PROMOTE NEMATODE PARASITISM

A Dissertation

Presented to the Faculty of the Graduate School

of Cornell University

In Partial Fulfillment of the Requirements for the Degree of

Doctor of Philosophy

by

Tien Thi Thuy Tran

February 2016

© 2016 Tien Thi Thuy Tran

ALL RIGHTS RESERVED

THE NOVEL GR29D09 EFFECTOR FAMILY FROM POTATO CYST

NEMATODE GLOBODERA ROSTOCHIENSIS SUPPRESSES PLANT IMMUNITY

TO PROMOTE NEMATODE PARASITISM

Tien Thi Thuy Tran, Ph.D.

Cornell University 2016

Potato cyst nematodes – Globodera rostochiensis and G. pallida are considered to be the most

devastating plant pathogens that threaten the potato production in the United States and

worldwide. Understanding the functions of nematode-secreted effectors is necessary to uncover

the molecular mechanisms of nematode parasitism which could be translated into novel

nematode control strategies. The novel 29D09 gene was cloned as a candidate effector gene in

the soybean cyst nematode Heterodera glycines and in G. pallida. An initial study confirmed the

expression of 29D09 orthologues (Gr29D09) in G. rostochiensis. The overall objective of this

study was to clone and characterize the function of Gr29D09 genes in G. rostochiensis

parasitism. Specifically, this thesis focuses on four research objectives: i) To clone and analyze

Gr29D09 sequences from G. rostochiensis populations, and to investigate their roles in nematode

parasitism; ii) To determine a role of Gr29D09 effectors in host innate immunity suppression; iii)

To identify Gr29D09-targeted proteins in potato; and iv) To develop PTI assays that can be used

in plant-nematode pathosystems.

Sequence analysis revealed that Gr29D09 belongs to a gene family because multiple gene

sequences were identified in individual nematodes. Gr29D09 genes were found to be exclusively

expressed within the dorsal gland cell and significantly upregulated in nematode parasitic stages,

suggesting an involvement of this effector family in nematode parasitism. Polymorphic variants

of Gr29D09 family were indicated to have undergone diversifying selection, suggesting that this

effector family has evolved to avoid host immune system. Multiple approaches were utilized to

investigate the function of four major Gr29D09 variants. Gr29D09 overexpression in potato

resulted in increased susceptibility to G. rostochiensis and an unrelated potato pathogen

Streptomyces scabies, as well as the suppression of callose deposition after treatment with PTI

inducer Pseudomonas fluorescens. Using Agrobacterium-mediated transient expression assays in

Nicotiana benthamiana, we found that all four Gr29D09 variants were able to suppress PTI and

ETI responses to variable degrees. These results clearly demonstrated a critical role of Gr29D09

effectors in suppression of plant immunity, possibly by involving different defense signaling

pathways. Interestingly, transient expression of two Gr29D09 variants (Gr29D09-V3 and

Gr29D09-V4) were found to induce hypersensitive response in leaves of two wild potato species

and the potato cultivar ‘Kennebec’, indicating that the two variants may function as avirulence

proteins for yet-to-identified R proteins in these potato species. Co-immunoprecipitation coupled

with nano LC-MS/MS analysis identified three defense-related proteins Hexokinase 1, heat

shock protein 90 and a homologue of the late blight resistance protein R1A as strong candidate

host targets of Gr29D09-V1 and Gr29D09-V3. Altogether, this study demonstrated that G.

rostochiensis uses Gr29D09 effectors to suppress plant innate immunity to promote successful

nematode parasitism.

iii

BIOGRAPHICAL SKETCH

Born on May 1st, 1983 in Dalat, a small highland city in the south of Central Vietnam,

Tien Tran is the first child in a grower family with four siblings who used to help their

parents with farming since the young age. Inspired by her parents’ exciting works, she

nurtured the dream to pursue her career in agriculture. She enrolled in the Biotechnology

major at the University of Agriculture and Forestry (a.k.a. Nong Lam University) in Ho

Chi Minh City, Vietnam. She obtained the BS degree in 2005 and her research thesis

involved entomopathogenic fungi diversity. After completion of her college education,

Tien landed her first job as a field technician for a representative office of Seminis

Vegetable Seed Company located in her hometown of Lam Dong Province and worked

there for almost two years. In 2007, she was offered as an apprentice lecturer in the

Department of Biotechnology at Ho Chi Minh City Open University. Her duty involved

teaching freshmen and sophomores in lab sections of various introductory biology

courses. In 2009, Tien won the prestigious Vietnam Education Foundation Fellowship

award for graduate study in the United States and was admitted to Cornell University in

the Department of Plant Pathology and Plant-Microbe Biology as a Ph.D. student. She

has been particularly interested in studying nematology which is currently in need of

experts in Vietnam. Therefore, she pursued her Ph.D. in the nematology laboratory of Dr.

Xiaohong Wang, majoring in plant pathology and having minors in plant-microbe

biology and plant breeding and genetics.

iv

To my family for being very supportive of my journey.

To my mentors for inspiring me in the pursuit of my dream career in science.

To my friends and colleagues for giving advices and encouragements.

v

ACKNOWLEDGMENTS

I would like to thank Xiaohong Wang for having mentored me with dedication, patience and

encouragements. Xiaohong herself was introducing me important experiments with nematodes

such as nematode extraction, nematode inoculation and in situ hybridization soon after I joined

her lab. Her great carefulness while doing these experiments did have influence on the way I do

my own experiments in the later years as a Ph.D. student. Xiaohong has encouraged and

supported me to attend many scientific conferences, which has made me more confident in

presenting my work and more familiar with seeking to network with scientists in the field. My

writing and presentation skills improve much more than they would have been without

Xiaohong’s guidance. Most importantly, Xiaohong is an outstanding and inspiring mentor who

has guided me to successfully accomplish my career goal.

I am deeply grateful to my committee members Dr. Gregory Martin and Dr. Walter de

Jong. My work has benefited from the helpful feedback and advice after each annual committee

meeting. Importantly, Dr. Gregory Martin and his lab members enthusiastically supported us in

developing ROS and cell death assays and kindly provided us with many plasmids and bacterial

strains that were used in our immunity assays. Similarly, Dr. Walter De Jong and his lab

members helped us establishing the potato transformation system, frequently provided us with

new Desiree potato plants and consulted us in making the collections of wild type potato

accessions. With all of these great helps, I was able to expand my projects broadly with

promising results.

vi

I would like to express my gratefulness to all the lab and greenhouse members in the

Virology and Nematology Lab. In particular, I would like to have special thanks to Shiyan Chen,

Ping Lang and David Thurston. Shiyan introduced me most of the established protocols,

discussed with me experiment designs and proofread my thesis. Ping instructed me on potato

transformation techniques and gave me many advices on bioinformatics tools. David patiently

and carefully prepared nematodes for all of my inoculation assays. Although small, our team

work efficiently and I feel very lucky to be a member of it.

My work has been supported by many other labs on and off campus: Loria Lab provided

us with the Streptomyces inoculation protocol; Cilia Lab supported us in establishing the co-

immunoprecipitation assay; Thannhauser Lab and Zhang Lab assisted us in protein digestion and

proteomics work; Dr. Hai-Lei Wei introduced us the N. benthamiana infiltration method; Mofett

Lab (Sherbrooke University, Canada) provided us with the pBIN61HA vector, and Smant Lab

(Wageningen University, Netherlands) helped us cloning Gr29D09 sequences from H1-avirulent

and virulent lines.

Finally, I could not have all the memorial experience at Cornell without the exceptional

support from my family, old and new friends, graduate school, ISSO, and department staffs.

My work was sponsored by USDA, Vietnam Education Foundation (VEF) and

Department of Plant Pathology and Plant-Microbe biology.

vii

CONTENTS

CHAPTER 1

Introduction.

CHAPTER 2

Sequence diversification of the novel Gr29D09 effector gene family from

potato cyst nematode Globodera rostochiensis and its critical role in nematode

parasitism.

CHAPTER 3

The novel Gr29D09 effector family from potato cyst nematode Globodera

rostochiensis suppresses plant immunity to promote nematode parasitism.

CHAPTER 4

The defense responses activated by PAMPs and nonpathogenic bacteria in

potato and tomato roots and the potential suppression of PTI responses by

nematode secreted effectors.

CHAPTER 5

General discussion and future direction.

REFERENCES

1

14

46

80

96

105

1

CHAPTER 1

Introduction

1.1 Agricultural importance of plant-parasitic nematodes

Nematodes are the most ubiquitous and numerous multicellular animals on earth that have

successfully inhabit all kinds of environments. The majority of nematodes are beneficial, feeding

on bacteria and other microbes. However, a minority of nematode species that can infect plants

and animals cause serious economic and social impacts (Davis et al., 2000). More than 4100

phytonematode species have been described and new species or pathotypes have been

continuously emerging or evolving, posing a serious threat to global food security resulting an

annual worldwide crop loss of approximately $125 billion (Chitwood, 2003; Decraemer and

Hunt, 2006; Nicol et al., 2011).

Plant-parasitic nematodes are obligate, biotrophic parasites and the majority of them are

root parasites that are frequently separated into three groups according to their feeding strategies

(Davis et al., 2000; Hussey, 1989). Ectoparasitic nematodes, which have an unspecialized

feeding strategy, remain outside of the roots and feed on epidermal or deeper cells using their

stylet. Migratory endoparasitic nematodes invade and migrate within the roots, feeding on

various tissues. The most evolutionarily advanced nematodes are the sedentary endoparasitic

nematodes which have evolved an intimate parasitic relationship with their host plants. In spite

of host defenses, this group of nematodes can induce unique feeding structures within the host

root and solely depend on the feeding structure for nutrient uptake in order to complete their life

cycle.

2

Both root-knot (Meloidogyne spp.) and cyst nematodes (Heterodera and Globodera spp.)

are the most economically-important sedentary endoparasites, accounting for most of the global

crop losses and approximately 10 billion dollars annual losses in the United States (Jones et al.,

2013; Chitwood, 2003). Root-knot nematodes generally have broad host range and are

widespread in tropical and subtropical regions. Cyst nematodes, however, generally have narrow

host range and are more adapted to temperate regions. Despite their narrow host range, cyst

nematodes can survive in the soil in the absence of host plants for a very long period of time

(e.g., decades), making control of these pests very problematic. Cyst nematodes infect many

important crops. For example, potato cyst nematodes (PCN) (Globodera pallida and G.

rostochiensis) are responsible for the loss of approximately 9% of potato production globally

(http://www.cabi.org/isc/datasheet/27034; Turner and Rowe, 2006); and soybean cyst nematodes

Heterodera glycines caused annual loss of approximately $US 1.5 billion in the United States

alone (Jones et al., 2013).

1.2 Nematode parasitism of plants

Nematode parasitism of plants involves many complex and dynamic host-pathogen interactions

such as hatching stimulation, host attraction, host penetration and feeding-site formation through

host tissue manipulation (Hussey, 1989). All plant-parasitic nematodes are equipped with a

hollow and protrusible stylet, which is used for root penetration and food uptake from plant

tissue. Both root-knot and cyst nematodes have also evolved three large and specialized

esophageal gland cells (two subventral and one dorsal) where secretory proteins are synthesized

and eventually secreted through the nematode stylet into host plant cells during the parasitic

interaction (Figure 1.1) (Davis et al., 2000).

3

Figure 1.1 The relative positions of the esophageal gland cells in the anterior end of a second-

stage juvenile of a plant-parasitic nematode (Modified from Hussey, 1989) (Left) and the

model of nematode parasitism (Right) (Proposed by Dr. Thomas Baum, Iowa State

University).

Root-knot and cyst nematodes have the most advanced mode of parasitism compared

with other plant-parasitic nematodes (Davis et al., 2000). These nematodes have evolved to

manipulate gene expression in specific root cells to transform them into a complex feeding

structure (Bird, 1996). Infective second-stage juveniles (J2) hatch from eggs and penetrate into

host roots with the aid of stylet thrusts and cell wall degrading or modifying enzymes originating

from the esophageal gland cells. After root penetration, parasitic second-stage juveniles (par-J2)

migrate towards the vasculature where they select individual cells to induce the formation of a

unique feeding structure, referred to as syncytium for cyst nematodes or giant cells for root-knot

nematodes (Wyss et al., 1992; Davis et al., 2008). Both syncytium and giant cells are

4

multinucleate and metabolically active feeding cells that share characteristic features including

dense cytoplasm, enlarged nuclei and nucleoli, increased number of organelles, thickened walls

and formation of wall ingrowth adjacent to vascular tissue (Jones, 1981). The transformation of

feeding cells involves complex morphological, physiological, and molecular changes in the

selected host cells to enable them to function as a permanent source of nutrients for the feeding

nematode to develop into adult stages (Davis et al., 2000). Repeated mitosis without cytokinesis

of selected cells gives rise to giant-cells, whereas cell fusion following extensive cell wall

dissolution of neighboring cells of the initial selected cell results in the formation of syncytium

(Jones and Dropkin, 1975; Jones, 1981). Accumulating evidence has indicated that secretory

proteins (now named as effector proteins) originated from the three esophageal gland cells

represent the major molecular signals responsible for the initiation and formation of feeding cells

(Hussey, 1989; Davis et al., 2004, 2008) (Figure 1.1).

1.3 Discovery of secreted effector proteins originating from the esophageal gland cells

Early microscopic observations indicated a direct association of gland secretion and feeding cell

formation (Wyss and Zunke, 1986). In the early days, monoclonal antibodies generated from

nematode homogenates were used for the study of gland secretions, leading to the cloning of two

cellulases from cyst nematodes (Smant et al. 1998). The two cellulase genes represent the first

effector protein genes reported from plant-parasitic nematodes. In recent years, the speed of

effector gene discovery has been greatly increased as the result of the development of molecular

biology, genomics, and sequencing technologies (reviewed in Davis et al., 2008 and others). A

large number of candidate effector genes have been cloned and identified through a variety of

approaches, such as cDNA-AFLP, EST analysis, and most importantly construction of gland

cell-specific cDNA libraries (Wang et al., 2001; Gao et al., 2001a). Standard criteria to classify

5

genes encoding candidate nematode effectors include the presence of an N-terminal signal

peptide for secretion, a lack of transmembrane domain motifs in the protein sequences, and the

confirmation of specific expression within the nematode esophageal gland cells (Davis et al.,

2004). By specifically targeting the gland cells, approximately 40 to 50 candidate effector genes

were cloned from the soybean cyst nematode H. glycines and the root-knot nematode M.

incognita (Huang et al., 2003; Gao et al., 2003). Interestingly, >70% of these identified effector

protein genes showed no obvious similarity to any reported genes. Recently a few genome

sequences including those of M. incognita, M. hapla, and G. pallida have become available

(Abad et al., 2008; Opperman et al., 2008; Cotton et al., 2014). For example, studies have

indicated that the G. pallida genome encode > 200 candidate effector proteins; however, the

function of these effector genes are largely unknown (Cotton et al., 2014; Thorpe et al., 2014).

1.4 General functions of esophageal gland secreted effector proteins

The single dorsal and two subventral esophageal gland cells of Tylenchid nematodes (e.g., root-

knot and cyst nematodes) are evolved secretory cells where secretory proteins are synthesized

and produced (Hussey, 1989; Davis et al., 2004, 2008). These two types of gland cells undergo

morphological changes during parasitism; the subventral gland cells are more active and contain

numerous secretory granules in the pre-parasitic J2 stage, whereas the dorsal gland cell enlarges

and becomes more active following the onset of nematode parasitism. Interestingly, genes

encoding a variety of cell modifying enzymes/proteins are found to be expressed specifically

within the subventral gland cells, indicating a major role of subventral gland secretions in

facilitating nematode evasion and penetration within the root tissue (Smant et al., 1998; Ding et

al., 1998; Popeijus et al., 2000, De Boer et al., 2002, Jaubert et al., 2002; Qin et al., 2004; Kudla

et al., 2007; Vanholme et al., 2007; Hewezi et al., 2008). However, genes including those

6

encoding choristmate mutases and venom allergen-like effector proteins that are found to have a

role in host defense suppression are also specifically expressed in the subventral gland cells,

revealing that subventral gland secretions are also involved in facilitating the early stages of

nematode parasitism (Lambert et al., 1999b; Ding et al., 2000; Gao et al., 2001b; Vanholme et

al., 2009; Rehman et al., 2009a; Lozano-Torres et al., 2014)

Studies have indicated that effector proteins originating from the dorsal gland cell play a

major role in the initiation and maintenance of the feeding structure that supports nematode

growth and development (Hussey et al., 1990). A variety of dorsal gland cell-expressed effector

protein genes have been cloned and a few of them have been functionally characterized. Based

on these studies, it seems that the dorsal gland effectors could modulate various cellular

processes. For example, cyst nematode CLAVATA-3/Endosperm surrounding region (CLE)

peptides function as a ligand mimic to manipulate shoot and root apical meristem, as well as

vascular meristem differentiation (Wang et al., 2005; Lu et al., 2009; Replogle et al., 2012). M.

incognita 16D10 effector targets Scarecrow-like plant transcription factors which regulate root

proliferation (Huang et al., 2006). In another case, effector 19C07 of beet cyst nematode

Heterodera schachtii physically interacts with Arabidopsis auxin influx transporter LAX3,

presumably to regulate auxin balance during feeding cell formation (Lee et al., 2011).

Furthermore, several dorsal gland-secreted effectors have recently found to have roles in plant

defense activation and suppression (e.g. SPRYSEC proteins). These effectors will be discussed

in detail in the next section.

7

1.5 Activation and suppression of plant innate immunity by phytonematodes

Plants have developed an effective two-layered immune system to defend themselves against

pathogen attacks. The first layer of defense, referred to as basal defense or pattern-triggered

immunity (PTI), is induced when membrane-residing pattern recognition receptors recognize

conserved PAMPs associated with broad range of pathogens (Jones and Dangl, 2006; Chisholm

et al., 2006). This early defense, acting to inhibit pathogen growth, involves the induction of a

variety of downstream responses including the calcium burst, the activation of mitogen-activated

protein kinase (MAPK) cascades, the production of reactive oxygen species (ROS), the

expression of numerous defense genes, the production of ethylene, and the deposition of callose

in the plant cell wall at infected sites (Boller and Felix., 2009). Successful pathogens specifically

suppress PTI by exploiting effectors that, in turn, may be directly or indirectly perceived by plant

resistance (R) proteins and activate effector-triggered immunity (ETI) (Chisholm et al., 2006;

Jones and Dangl, 2006). ETI induces defense responses similar to PTI but at a higher titer and is

often associated with the development of the hypersensitive response (HR), a type of

programmed cell death, at the infection site to effectively restrict pathogen growth (Heath, 2000).

However, pathogens are able to invade ETI either by avoiding the recognition or suppressing

ETI using new effectors. In this coevolutionary arms race, plants and pathogens ceaselessly

restore or suppress ETI by evolving new R or effector genes. Due to natural selection, the result

of this coevolution is the occurrence of high genetic diversity at the interacting molecules at the

plant-pathogen interaction interface (Ma and Guttman, 2005).

The role of basal defenses in nematode-plant interactions is largely unknown. Gene

expression studies indicate that basal defense is activated during nematode migration within the

root, but it is then suppressed within nematode-induced feeding cells in susceptible host plants

8

(Goto et al., 2013; Kyndt et al., 2013). Furthermore, nematodes that migrate intracellularly

activate plant basal defense more strongly than those that migrate intercellularly (Alkharouf et

al., 2006; Bhattarai at al., 2008; Lambert et al., 1999a). Plants are also equipped with major

resistance genes to defend themselves against nematode attacks. To date, several nematode

resistance genes have been cloned and confirmed to confer resistance to root-knot and cyst

nematodes (reviewed in Kaloshian et al., 2011; Kandoth and Mitchum, 2013). All three of the

cloned resistance genes against potato cyst nematodes belong to the CC-NB-LRR or TIR-NB-

LRR classes of R genes. Potato resistance genes Gro-1 and Gpa2 confer resistance to G.

rostochiensis RO1 pathotype and specific G. pallida populations (van der Vossen, 2000; Paal et

al., 2004). Tomato resistance gene Hero A confers broad resistance against both potato cyst

nematodes G. rostochiensis and G. pallida (Ernst et al., 2002). To date, only two avirulence

genes from plant-parasitic nematodes were identified. The Cf1 from root-knot nematode

populations has been linked to Mi-1 mediated resistance in tomato (Gleason et al., 2008).

Similarly, the product of SPRYSEC gene Gp-RBP-1, member of the largest dorsal gland-

expressed effector family from potato cyst nematodes, is recognized by potato resistance protein

Gpa2 (Sacco et al., 2009). These resistance genes activate hypersensitive responses surrounding

feeding sites, either during early initiation and expansion or during late maintenance of feeding

site functions, effectively stopping or diminishing nematode feeding (Goverse and Smant, 2014).

Plant-parasitic nematodes may use multiple mechanisms to manipulate host defenses. For

example, endoparasitic nematodes are thought to use multiple antioxidant enzymes present on

the surface and in the hypodermis to protect them from host-derived oxidative stress (Robertson

et al., 2000; Henkle-Duhrsen et al., 2001; Li et al., 2011; Dubreuil et al., 2011). Evidence is

emerging that endoparasitic nematodes deliver effector proteins into the apoplast and cytoplasm

9

of host cells to suppress PTI and/or ETI (Goverse and Smant, 2014). For instance, the apoplastic

M. incognita effector calreticulin Mi–CRT and cyst nematode venom-allergen like effectors

suppress basal defense responses triggered by PAMP elf18 and putative damage-associated

molecular patterns (DAMPs), respectively (Jaouannet et al., 2013; Lozano-Torres et al., 2014).

G. rostochiensis effectors GrCEP12, GrSKP1 and GrEXPB2 could suppress both PTI and ETI

responses, possibly by targeting the shared components of these two pathways (Chronis et al.,

2013; Chen et al., 2013; Ali et al., 2015). An annexin-like effector protein from cereal cyst

nematode Heterodera avenae was demonstrated to specifically target mitogen-activated protein

kinase (MAPK) signaling pathway mediated by two kinases MKK1 and NPK1 (Chen et al.,

2015). In a few cases, the identified host targets of several nematode effectors have provided

insights into the mechanisms that plant-parasitic nematodes exploit to modulate host immunity.

The novel H. schachtii effector 10A06 was reported to interact with the Arabidopsis spermidine

synthase and indirectly suppress plant defense through the disruption of salicylic signaling

pathway (Hewezi et al. 2010). Another effector from H. schachtii, 4F01, likely functions as a

redox regulator by interfering with an oxidoreductase that involves jasmonic acid-mediated

defense responses (Patel et al., 2010). GrSRYSEC-19 from G. rostochiensis, another member of

the SPRYSEC family, suppresses ETI specifically triggered by CC-NB-LRR resistance genes

(Rehman et al., 2009b; Postma et al., 2012). Notably, its interaction with SW5-F resistance

protein appeared to be independent of its function as host immunity suppressor. Interestingly,

other effectors of the SPRYSEC family from G. rostochiensis also suppress host innate

immunity (Ali et al., 2015). SPRYSEC family appears to be a very interesting family since its

members can both activate and suppress host defense, indicating that the expansion of the

10

SPRYSEC family may reflect their adaptations to functional diversifications of host virulent

targets and/or host immune receptors (Postma et al., 2012).

1.6 Potato cyst nematodes are pests of economic and regulatory importance

Potato (Solanum tuberosum) is the fourth most important staple food crop in the world after rice,

wheat and corn (Hawkes, 1990). According to the 2013 data, the US is among the five countries

that produce the most potatoes in the world, generating approximately 4 billion dollars of annual

sale values (FAOSTAT data, 2015; National Agricultural Statistics Service -USDA, 2013).

Among many pathogens that attack potato, the two potato cyst nematode (PCN) species –

Globodera rostochiensis (a.k.a. golden nematode) and G. pallida (a.k.a. pale cyst nematode) are

considered to be the most devastating pests threatening potato production in the United States

and worldwide (Mendoza, 1987; Brodie and Mai, 1989). Without control, these nematode pests

can cause up to 80% yield loss (Franco et al., 1998). Potato cyst nematodes are the most difficult

plant pathogens to control due to their long survival in soil as egg-containing cysts that resist

harsh environmental conditions and chemical treatments (Spears, 1956), their genetic variability

as well as the lack of commercially available resistant varieties. Apart from yield loss, adverse

economic impact caused by PCN also comes with costly quarantine and regulatory procedures

and trade embargoes.

PCNs are believed to be indigenous in the Andean region of South America where they

have coevolved with their preferred host potatoes. These potato pests were introduced to Europe

through potato collections brought back from South America to breed for late blight resistance

(Spears, 1968; Jones, 1970; Hockland et al., 2012) and then spread to other parts of the world

from Europe (Brodie and Mai, 1989). In the United States, O. S. Cannon, a Cornell graduate

11

student of Plant Pathology Department initially observed nematode females on roots of some

poorly growing plants in a potato field near Hockville, Long Island, New York in 1941. These

nematodes were later identified as G. rostochiensis by B. G. Chitwood, a nematologist with

USDA-ARS (Cannon, 1941; Spears, 1968; Mai, 1977; Brodie and Mai, 1989). The pest was

thought to be introduced to Long Island by military equipment brought back from Europe after

World War I (Spears, 1968).

Since the discovery of G. rostochiensis on Long Island, New York, federal, state and

local governments have worked together to eliminate the threat of the pest to the U.S. potato

industry (Brodie and Mai, 1989). Using host resistance is the most effective and sustainable

means for nematode control. To date, more than forty golden nematode resistant varieties have

been released. In the meantime, a four-year management plan that includes two-years of a

resistant variety, a third year of a non-host, and a fourth year of a susceptible variety has been

implemented in regulated fields, which has been found to be central in reducing nematode

infestations and preventing a further spread of the pest to other states (Brodie and Mai, 1989). As

the result of quarantine regulations and effective management strategies, G. rostochiensis has

been successfully confined to New York for the past seventy years since its discovery.

Unfortunately, a virulent pathotype, named RO2, that can reproduce on resistant varieties

containing the H1 resistance gene was discovered in 1994 (Brodie, 1993). Until today, there are

no commercially available potato varieties that confer resistance to RO2. In addition, potato cyst

nematodes have been recently found to be spreading in North America. In 2006, G. rostochiensis

was detected for the first time in Quebec and Alberta, Canada (Sun et al., 2007). In the same

year, G. pallida was detected in Idaho, signifying the first detection of a second PCN species in

the U.S. (Skantar et al., 2007). Furthermore a new Globodera nematode species described as G.

12

ellingtonae confirmed to be able to reproduce well on potatoes was discovered in Oregon and

Idaho (Fraley et al., 2009; Skantar et al., 2011, Handoo et al., 2012). The persistent presence of

the endemic RO1 pathotype of G. rostochiensis and the emergence of virulent pathotype and

species of PCN have highlighted the threat that this group of nematodes poses to the multi-

billion-dollar U.S. potato industry. Therefore, understanding the molecular mechanisms of PCN

parasitism, especially through elucidating the function of gland-secreted effector proteins, is

necessary to develop novel control strategies against PCN.

1.7 Objectives and scope of this dissertation

The overall objective of this work was to elucidate the function of an interesting effector gene

family Gr29D09 from the potato cyst nematode G. rostochiensis in nematode parasitism.

Understanding the molecular basis of nematode parasitism is necessary for the development of

novel strategies for controlling plant-parasitic nematodes. More specifically, this thesis focuses

on four research objectives: i) To clone and analyze the sequences of Gr29D09 effector gene

family from G. rostochiensis populations, and to determine their role in nematode parasitism; ii)

To characterize the potential roles of Gr29D09 effectors in host innate immunity suppression; iii)

To identify the potato host targets of Gr29D09 effectors; and iv) To study basal defense

responses activated by PAMPs and microbes in potato and tomato roots and the potential

suppression of these responses by nematode secreted effectors, aiming at developing PTI assays

that can be used in the nematode-plant pathosystems.

13

Chapter 2: Sequence diversification of the novel Gr29D09 effector gene family from potato

cyst nematode Globodera rostochiensis and its critical role in nematode parasitism.

I cloned the family of Gr29D09 effector genes from G. rostochiensis and investigated their role

in nematode parasitism. In addition, I analyzed the variations of Gr29D09 sequences from two

different G. rostochiensis populations that differ in virulence on H1-mediated resistance.

Chapter 3: The novel Gr29D09 effector family from potato cyst nematode Globodera

rostochiensis suppresses plant immunity to promote nematode parasitism

I studied the functions of four major Gr29D09 variants in the suppression of host innate

immunity using multiple approaches. Subsequently, I investigated whether Gr29D09 variants

might function as typical avirulence proteins by transiently express Gr29D09 variants in the

leaves of wild type potato accessions and monitoring hypersensitive response phenotype. I

finally carried out the co-immunoprecipitation assay to identify the putative host targets of

Gr29D09 effectors.

Chapter 4: The defense responses activated by PAMPs and nonpathogenic bacteria in

potato and tomato roots and the potential suppression of PTI responses by nematode

secreted effectors

I investigated the defense responses activated by two flagellar peptides and two nonpathogenic

bacteria Pseudomonas fluorescens strain 0-1 and P. syringae strain DC3000 hrcU in potato and

tomato roots. I also studied whether the activated responses could be suppressed by nematode

secreted effectors demonstrated to have a role in host immunity suppression.

Chapter 5: General discussion and future direction

14

CHAPTER 2

Sequence diversification of the novel Gr29D09 effector gene family from potato cyst

nematode Globodera rostochiensis and its critical role in nematode parasitism

2.1 Abstract

The potato cyst nematode Globodera rostochiensis is an obligate biotrophic pathogen that

invades the plant root where it transforms cells near the vascular cylinder into a specialized

feeding site that sustains the growth of the parasite. A growing body of evidence has

demonstrated that the secreted effector proteins originating from the nematode’s esophageal

gland cells play critical roles in the initiation, formation and maintenance of the feeding structure

to ensure successful parasitism. The novel gene 29D09 was identified as a candidate effector in

the soybean cyst nematode Heterodera glycines (Hg29D09) and the potato cyst nematode G.

pallida (Gp29D09); however, the function of this novel 29D09 effector gene has not been

characterized in the soybean-H. glycines or the potato-G. pallida pathosystem. Using homology-

based approach, we cloned several homologous 29D09 sequences from G. rostochiensis

(Gr29D09) populations. Notably, individual G. rostochiensis nematodes consist multiple

Gr29D09 variants, revealing that Gr29D09 belongs to a multigene family. Gr29D09 genes were

found to be exclusively expressed within the dorsal gland cell and highly upregulated in

nematode parasitic stages, indicating an involvement of this effector family in nematode

parasitism. Transgenic potato lines overexpressing individual Gr29D09 genes showed increased

susceptibility not only to G. rostochiensis but also to Streptomyces scabies, an unrelated bacterial

pathogen causing common scab of potato. As the increased host susceptibility to adapted

pathogens is often a result of suppression of pattern-triggered immunity (PTI), thus the novel

Gr29D09 effector family was hypothesized to involve in PTI suppression. Members of the

15

Gr29D09 effector family showed significant sequence variations with positive selection detected

at several sites, which might allow the family to expand their virulent targets in the host or to

avoid host recognition to maximize their roles in parasitism.

2.2 Introduction

Potato cyst nematodes (Globodera rostochiensis and G. pallida) are biotrophic pathogens that

reproduce on roots of potatoes and tomatoes, two crops of economic importance, as well as

eggplant and other solanaceous weeds (Mai and Lownsbery, 1948). They are the most difficult

potato pests to control due to the long survival in soil of the egg-containing cysts in harsh

environmental conditions and chemical treatments (Spears, 1956), their genetic variability and

the lack of commercially available resistant varieties. Since their discovery in 1941 in the United

States, G. rostochiensis primary pathotype has been successfully controlled by H1-harboring

resistant potato varieties until the emergence of new virulent pathotype RO2 that overcomes H1-

mediated resistance (Brodie, 1993). The successful breeding of RO2 resistance depends on the

mining of single and dominant natural resistance genes in wild potato accessions and the

knowledge of the mechanism underlying the parasitic ability of G. rostochiensis on resistant

potato.

Cyst nematodes are sedentary endoparasites that have evolved intimate parasitic

relationship with their host plants. Life cycle of cyst nematodes starts with infective second-stage

juveniles (J2) hatching from eggs within the cyst in the soil and infecting host roots. This process

is usually initiated by root diffusates of the host plants (Rawthorne and Brodie, 1987). The J2

uses its stylet (hollow mouth spear) to aid its intracellular root migration and selects a fully

differentiated cortical cell within root tissues for the development of a complex feeding structure

16

called a syncytium (Dropkin, 1969). At the onset of the feeding, the nematode becomes

sedentary and relies on this unique feeding structures for nourishment for the remainder of its life

cycle.

Ability of plant associated nematodes to parasitize plant hosts is facilitated by multiple

effector genes that, with a few exceptions, are expressed and secreted from esophageal gland

cells in a unique manner (Davis et al, 2000). These secretory esophageal cells consist of two

subventral and one dorsal gland cells which go through changes in morphology and content

during development stages (Hussey, 1989). A growing body of evidence suggests that nematode

effectors have critical roles in host invasion, feeding cell formation and maintenance, and

suppression or evasion of host plant innate immunity. With the advance in molecular and

sequencing technologies, large or some case almost complete set of effectors from cyst

nematodes have been identified through large scale transcriptome- (of various development

stages), secretome- (esophageal gland cells) and genome-wide mining (Gao et al., 2001a, 2003;

Jones et al., 2009; Qin et al., 2000; Rutter et al., 2014, Thorpe et al., 2014). Notably,

approximately 70% of the identified effector gene sequences have no significant homology to

characterized genes in databases, indicating that they may be specific to plant-parasitic

nematodes (Davis et al., 2008). The standard criteria to identify potential novel effectors include

the possession of a signal peptide for extracellular secretion, a lack of transmembrane domain,

and the confirmation of specific expression within the nematode esophageal gland cells (obtained

by in situ hybridization) (Davis et al., 2004, 2008).

Coevolutionary interactions between plants and their pathogens are mediated by host

defense proteins and pathogen virulence effectors (Ma and Guttman, 2008). Plants defend

themselves against attacking pathogens by evolving surveillance system equipped with surface

17

and intracellular recognition mechanisms that directly or indirectly recognize effectors and

trigger ETI responses (Dodds and Rathjen, 2010). These interactions lead to an evolutionary

arms race between plants and pathogens which either interacting partners ceaselessly evolve

more effective defense and counter-defense factors (Anderson et al., 2010). Therefore, effectors

that function in the host-pathogen molecular interface are likely to be under strong

diversifying/positive selection pressures (selectively increases frequency of beneficial alleles in a

population in the expense of the other) to evade or suppress host recognition (Ma and Guttman,

2008). In fact, effectors have been demonstrated to be amongst the most rapidly evolving genes

in pathogen genomes, presumably to circumvent plant defense in the recurring cycles of host

encounter (Win et al, 2007; Raffaele et al., 2010; Sperschneider et al., 2014).

Diversifying selection has been extensively reported in viral, bacterial and filamentous

pathogen effectors, especially in the avirulent (Avr) genes that rapidly evolve in response to

pressures imposed by host defense (Ma and Guttman, 2008). The diversification of avirulence

genes generally results in the shift of the host-pathogen interaction from incompatible

(resistance) into compatible (disease). Furthermore, high percentage of effectors have been

shown to bear signatures of positive selection when diversifying selection was comprehensively

analyzed in large scale (Rohmer et al., 2004; Sarkar et al., 2006; Stergiopoulos et al., 2007; Win

et al., 2007; Raffaele et al., 2010; Sperschnerder et al., 2014). For instance, positive selection

was detected in 70% of the analyzed RXLR effector families from various oomycetes plant

pathogens Phytopthora sojae, P. ramarun and H. parasitica (Win et al., 2007). In plant-

nematode interactions, nematode effector proteins under diversifying selection have been

recently reported in only a few cases. Two SPRYSEC effectors from potato cyst nematode

(GpRBP-1 and GrSPRYSEC-19) that are subject to positive selection are indirectly or directly

18

recognized by resistance proteins (Sacco et al., 2009, Carpentier et al., 2011; Rehman et al.,

2009b). In another case, H. glycines choristmate mutase Hg-cm-1 showed increased frequency of

its allelic variant in virulent H. glycines populations (Lambert et al., 2005).

Novel 29D09 gene was identified as one of 50 candidate effector genes of soybean cyst

nematode Heterodera glycines and potato cyst nematode G. pallida in the expressed sequence

tag (EST) analysis of cDNA libraries from gland cells and various life stages, respectively (Gao

et al., 2003; Jones et al., 2009). Using homology-based strategy, we performed qRT-PCR to

investigate the relative expression of 50 G. pallida candidate effector homologues in parasitic

stages of G. rostochiensis. Gr29D09 was one of the genes that showed significantly high

upregulation in nematode parasitic stages, suggesting its critical role in G. rostochiensis

parasitism. The two main objectives of this study were: i) clone and analyze the sequences of the

novel effector gene family Gr29D09 from potato cyst nematode G. rostochiensis populations,

and ii) test the possible role of this effector family in G. rostochiensis parasitism.

2.3 Materials and Methods

2.3.1 Cloning of Gr29D09 effector gene family from different G. rostochiensis populations

Gr29D09 sequences were cloned from 14 dpi (days post inoculation) females of two G.

rostochiensis populations RO1 and RO2 that were grown on compatible potato varieties

(Nordonna for RO1 and Hudson for RO2) under monoxenic conditions. 200 females were

collected at 14 dpi for mRNA extraction using The Dynabeads mRNA DIRECT Kit (Life

Technologies Corporation). The partial fragments that cover the full length Gr29D09 were

cloned from synthesized cDNA by 3’-RACE and 5’-RACE (Rapid Amplification of cDNA End)

(Invitrogen). RACE primers were designed from mRNA sequences (accession numbers

19

54546985 and GO251644) of the homologous gene in G. pallida (Jones et al., 2009). Based on

the obtained 3’-RACE and 5’-RACE sequences, two new primers Gr29D09-ATG and Gr29D09-

TGA were designed to clone the full length of Gr29D09. Approximately 100 ng of cDNA was

used for a 25 ul PCR reaction (GoTaq Green Master Mix, Promega) with 10 uM of each primer.

Thermal cycles included 4 min at 94oC, then proceeded with 30 cycles of 30 sec at 94oC, 30 sec

at 55oC and 45 sec at 72oC and finished with 5 min at 72oC. The purified amplification product

was cloned by T-A cloning into pGEM-T Easy vector (Promega). 100 positive colonies were

cultured to extract plasmids for sequencing using universal M13F primer. All the obtained

Gr29D09 sequences were translated into protein sequences to submit to SignalP-3.0

(Emanuelsson et al., 2007) and TMHMM (Krogh et al., 2001) to predict the presence of signal

peptides and transmembrane domain regions. The deduced protein sequences in each population

were aligned using Clustal X 2.1 (Chenna et al., 2003) and the Neighbor-Joining phylogenetic

tree was subsequently built with bootstrapping values presented from 1000 replications. Finally,

the frequencies of four major variants were calculated for each population.

2.3.2 Genomic DNA extraction and cloning of Gr29D09 from single nematode

Potato roots infected with G. rostochiensis pathotype RO1 at 14 dpi were removed from the agar

media and observed under the microscope. Individual females were picked up with tweezers and

placed in 10 ul of water on a glass microscope for rinsing off any remaining agar. The water was

then replaced by 12 uL of lysis buffer (100 mM KCl, 20 Tris-HCl pH 8.3, 120 ug/ml proteinase

K) and the females were squashed with a needle before being transferred by pipet into the

individual 0.2 ml-tubes. The tubes were flash frozen in liquid nitrogen and placed at -80oC for 15

min. The tubes were incubated at 60oC for 1 h, followed by 90oC for 10 min, and 5 ul of DNA

extract was used per 25 ul PCR reaction. Gr29D09 genes were amplified from single female and

20

cloned into pGEM-T Easy vector using the same procedures applied to bulked females.

Approximately 10 clones were sequenced per single female.

2.3.3 Cloning genomic sequences of Gr29D09 effector gene family

Thousands of pre-parasitic juveniles (J2s) from RO1 population were used for genomic DNA

extraction by following previously described protocol (Hang et al., 2011). Nematodes were

ground and liquid nitrogen and DNA was extracted by 150 ul of lysis buffer (250 mM NaCl, 200

mM Tris-HCl (pH 8.5), 25 mM EDTA, 0.5% SDS, 120 ug/ml proteinase K) and 75 ul of 3M

sodium acetate (pH 5.2), followed by an incubation of 10 min at -20oC and 5 min of

centrifugation at 13200 rpm. The DNA contained in the supernatant was precipitated by

isopropanol using 13200 rpm/25 min centrifugation. The acquired DNA pellet was washed two

times with 70% ethanol and one time with 100% ethanol. Genomic DNA was finally diluted in

sterile water. Approximately 100 ng of genomic DNA was used for a 25 ul PCR reaction (GoTaq

Green Master Mix, Promega) with 10 uM of each primer Gr29D09-ATG and Gr29D09-TGA.

Thermal cycles included 4 min at 94oC, then proceeded with 35 cycles of 30 sec at 94oC, 30 sec

at 55oC and 60 sec at 72oC and finished with 5 min at 72oC. The purified amplification product

was cloned by T-A cloning into pGEM-T Easy vector (Promega). 50 positive colonies were

cultured to extract plasmids for sequencing with universal M13F primer. The obtained genomic

sequences were aligned with four major RT-PCR derived variants using Muscle method

implemented in Mega6 program to identify the corresponding genomic sequences of each cDNA

variant (Edgar, 2004).

21

2.3.4 Detection of positive selection with PAML

A subset of RT-PCR derived Gr29D09 sequences from two G. rostochiensis populations (105

sequences) were used to test for evidence of diversifying selection. The cDNA data set and

maximum likelihood phylogenetic tree were analyzed in PAML CODEML version 4.8 (Yang

and Nielsen, 2000) under different selection models (M2a, M7 and M8) to test for positive

selection at codon sites (“Site Model”), allowing the dN/dS ratio (dN: nonsynonymous

substitutions and dS: synonymous substitutions) to vary across codons within a sequence.

Positive selection is indicated by the codons having a dN/dS > 1. Naive Empirical Bayes (NEB)

analysis and/or Bayes Empirical Bayes (BEB) analysis (Yang et al., 2005) were performed to

find the positively selected sites with posterior probability higher than 0.99. The initial

phylogenetic tree was generated in Clustal X 2.1 (Chenna et al., 2003).

2.3.5 In situ mRNA hybridization and developmental profiling

Spatial expression of Gr29D09 in the nematode was determined by in situ mRNA hybridization

using antisense digoxigenin (DIG)-labeled cDNA probes. Asymmetric PCR was performed

using pGEM-T Easy plasmid harboring full length Gr29D09-V1 as template and two primers

Gr29D09-ISH-F and Gr29D09-ISH-R to synthesize the 181-bp probes that cover the region from

position 290 to 471 of Gr29D09 genes. The hybridization was carried out on fixed and

permeabilized parasitic nematodes according to previously described protocol (De Boer et al.,

1998; Wang et al. 2001; Lu et al., 2009). Phosphatase-conjugated anti-DIG antibody and 5-

bromo-4-chloro-3-indolyl phosphate–nitroblue tetrazolium substrate were used for the

visualization of the hybridized samples under the compound light microscope.

22

mRNA from various nematode life stages were extracted (Lu et al., 2008). Gr29D09

expression pattern across parasitic stages (cyst, preparasitic J2, parasitic J3 and parasitic J4) was

quantified by qRT-PCR using two primers Gr29D09-252F and Gr29D09-486R and Taqman

probe Gr29D09-c283F for amplifying and detecting Gr29D09 transcripts. Similarly, primers

GrActin-R2b, GrActin-c660Fb and probe GrActin-c808F were used for the internal control gene

(Lu et al., 2009). Both probes were designed to specifically hybridize to one of the gene exon-

exon junctions to avoid any potential hybridization to contaminated DNA in the cDNA

templates. The real time PCR reaction and the calculation of the expression level were performed

according to previously described protocol (Lu et al., 2009). Melting curve analysis was also

performed at the end of each run to ensure that unique products were amplified. The assays were

repeated three times on parasitic nematodes collected from independent infection assays.

2.3.6 Transgene expression and potato transformation

Two Gr29D09 variants Gr29D09-V1 and Gr29D09-V3 were cloned from pGEM-T Easy

harboring the corresponding Gr29D09 sequences and constructed into 35S promoter-harboring

expression vector pMD1 for functional characterization, using primers with relevant restriction

enzymes (XbaI and XhoI). In both constructs, the regions coding for the predicted signal

peptides of Gr29D09 variants were excluded to ensure the expression of these variants in the

plant cytoplasm. Digested amplicons and pMD1 vector digested with the same enzymes were

ligated and the constructs were subsequently transformed into competent cells of Escherichia

coli strain TOPO-10 from which plasmids were extracted for sequencing to confirm the correct

sequences of the inserts. The expression constructs were transformed into LBA 4404 strain of

Agrobacterium tumefaciens. Gr29D09 overexpression potato plants were generated from Desiree

cultivar using A. tumeficiens-mediated method according to previously described method

23

(Chronis et al., 2014b). Eight independent transgenic lines per variant were tested for transgene

expression and two independent lines showing highest expression were selected for further study

(Supplementary figure 2.1). The transgenic potato line overexpressing empty vector is used as

the control line.

Table 2.1 Primers used in this study.

Primer Primer sequence (5’-3’) Application

Primers used for cloning Gr29D09 and making expression constructs. Gr29D09-27F

Gr29D09-444F

AUAP2

Gr29D09-136R

Gr29D09-ATG

Gr29D09-TGA

M13F

Gr29D09-RT-265F

Gr29D09-RT-460R

AATGCCTTCCCCGTCGTCTCTG

AAATTACCGAAATTGACGCACT

GGCCACGCGTGACTAGTAC

GCCAATGTATTTGGTCATCAGA

AATGCCTTCCCCGTCGTCTCTG

TCAGTTGGCGGCGCTGTATTCG

GTAAAACGACGGCCAG

GCGTACAATCTCGGCTTCG

CAAAATTTGCTGAACGAGGGT

3’ RACE

3’ RACE-Nested PCR

3’ RACE

5’ RACE

Cloning full length Gr29D09

Cloning full length Gr29D09

pGEM-T-Easy primer

Checking mRNA expression in

transgenic potato lines

Primers used in the identification of Gr29D09 spatial and developmental expression pattern.

Gr29D09-ISH-F

Gr29D09-ISH-R

Gr29D09-252F

Gr29D09-486R

Gr29D09-c283F

GrActin-R2b

GrActin-c660Fb

GrActin-c808F

GAGCGTACACATGAAAATGGAG

CGTGGACAGTGCGTCAATTT

GCAGCAGAATTGTGAACGAA

AAATGGTCAGTTCCGTGGAC

CTCACCACGAGCGTACACATGAAAAT

ATGTCGATGTCGCACTTC

CGACTTCGAGCAGGAAAT

CCTCTTCCAGCCGTCCTTCATC

Generating probes for in situ

hybridization assay

For qRT-PCR to determine Gr29D09

expression in developmental stages

Tagman probe (5’FAM, 3’TAMRA)

Nematode housekeeping gene, for

qRT-PCR

Tagman probe (5’FAM, 3’TAMRA)

Primers used in making overexpression constructs.

Gr29D09-SP-XbaI

Gr29D09-TGA-XhoI

ATTCTAGAATGGCCCCGCATCCATGCTGT

ATCTCGAGTCAGTTGGCGGCGCTGTA Making expression construct

Making expression construct

24

2.3.7 Nematodes infection assay on transgenic potato lines

Approximately 20 shoots and/or nodal stems of transgenic potato lines overexpressing either EV,

Gr29D09-V1 or Gr29D09-V3 were cut from stock and transferred to propagation media (4.3 g/l

Murashige and Skoog salts, 0.17 mg/l Na2HPO4.H2O, 100 mg/l inositol, 0.4 mg/l Thiamine HCl,

3% sucrose, 2.5 g/l gelrite, 50 µg/ml kanamycin, 100 µg/ml timentin, pH 6.0) for 7-10 days in

100 x 25 mm deep petri dishes. Shoots grown from these plantlets were cut and propagated in 6-

well plates and 14 day-old plantlets were used for nematode infection. All transgenic potatoes

were propagated at 22oC in the growth chamber under 16 h of light.

Nematode infection assay was performed according the previously described protocol

(Chronis et al., 2014a). In brief, cysts of the potato cyst nematode G. rostochiensis RO1

population propagated on compatible potato (Solanum tuberosum cv. Katahdin) were extracted

and hatched second-stage juveniles (J2s) were sterilized for the inoculation assay on transgenic

potato lines under monoxenic condition. Two independent lines overexpressing each variant

were tested and 12-18 plants per line were inoculated with 150 sterilized infective juveniles per

plant. The infected plants were maintained at 20oC in dark chamber and nematode females were

counted at 5 weeks after inoculation. Two independent nematode infection assays were

performed.

2.3.8 Streptomyces infection assay on transgenic potato lines

The Streptomyces infection assay was performed on transgenic potato lines overexpressing

Gr29D09-V1 or Gr29D09-V3 according to the previously described protocol (Chronis et al.,

2013) with minor modifications. Briefly, spores of S. scabies strain 88-34 were collected after

culturing at 28°C on ISP4 agar medium for 5–7 days and resuspended in sterile water at a final

25

absorbance at 600 nm of 1.5. Shoots of transgenic potato lines were cut and briefly dipped in the

S. scabies suspension culture. Symptom photographs were taken at 5-6 weeks and root lengths

were measured at 8-9 weeks after inoculation. Three independent assays were performed.

2.4 Results

2.4.1 Identification of Gr29D09 effector genes in G. rostochiensis populations

Based on the EST (expressed sequence tags) and the genomic sequence data of G. pallida

(https://www.sanger.ac.uk/resources/databases/), the full length sequences of Gr29D09 were

cloned from G. rostochiensis. Of a total of 83 Gr29D09 deduced protein sequences that are

derived from qRT-PCR from bulked 14 dpi females of RO1 population, four major variants,

constituting 61 sequences, were identified (V1: 21 times; V2: 13 times; V3: 14 times and V4: 13

times). The amino acid sequences of these four variants showed high polymorphism (89-98%

identity) with 28 variable sites (Figure 2.1a). Gr29D09-V1 and Gr29D09-V2 showed 98%

identity while Gr29D09-V3 and Gr29D09-V4 showed 90% identity. The remaining 22 sequences

represent mostly one time-occurring variants that slightly diverge (>98% identity or less than 4

different amino acid residues) from the four major variants, leading to a total of 26 identified

variants of Gr29D09 from this data set (Supplementary figure 2.2). The amino acid alignment of

four major variants showed uneven distribution of substitutions and variable sites are

accumulated in three ‘variation hot spot’ regions (positions 59-63, 134-153 and 165-170). These

variable regions may represent important functional domains and be subject to positive selection.

26

Figure 2.1 Sequence variations of Gr29D09 effector genes. (A) Amino acid alignment of

four major Gr29D09 variants (V1-V4) showed high polymorphism and positively selected

amino acid sites (indicated by arrows). (B) The phylogenetic relationship between four major

variants of Gr29D09 and their homologues from G. pallida and soybean cyst nematode H.

glycines. (C) Frequencies of four major variants and their closely-related sequences in RO1

and RO2 populations. Abbreviations: Gr, Globodera rostochiensis; Gp, Globodera pallida;

Hg, Heterodera glycines.

2.4.2 Genotyping of single nematodes showed that Gr29D09 belongs to a gene family

We performed genotyping of five individual G. rostochiensis females by sequencing

approximately 10 cloned Gr29D09 sequences per nematode and showed that all five single

nematodes have at least four Gr29D09 variants (Table 2.2). This result demonstrated that

Gr29D09 members represent different copies (and possibly different alleles) of the same gene,

indicating that at least several Gr29D09 variants are paralogues.

27

Table 2.2 Gr29D09 genotyping in single G. rostochiensis females

Number of sequences representing Gr29D09 variants

Individual

nematodes

Number of

sequences

V1 and/or

V1-like

V2 and/or

V2-like

V3 and/or

V3-like

V4 and/or

V4-like

Others

Nematode 1 10 5

1 2 2

Nematode 2 9 2 3

2 2

Nematode 3 10 6

1 2 1

Nematode 4 10 3

3 3 1

Nematode 5 11 3 2 2 4

2.4.3 Gr29D09 genes encode for secreted proteins and are specific to cyst nematodes

All identified Gr29D09 variants contain an open reading frame of 597 base pairs, resulting in the

deduced protein sequences of 199 amino acids. A signal peptide of 24 amino acids was predicted

at the N-terminus for all variants (SignalP-3.0, Emanuelsson et al., 2007) and no transmembrane

domain regions were detected (TMHMM, Krogh et al., 2001), indicating that Gr29D09 would be

putatively secreted. The amino acid sequences of four identified Gr29D09 variants showed 76-

89% identities to G. pallida homologue Gp29D09 and 51-53% identities to soybean cyst

nematode H. glycines homologues Hg29D09 and Hg4D06 (Figure 2.1b). We also used BLAST

to compare Gr29D09 sequences to published root-knot nematode (M. incognita and M. hapla)

genomes (Abad et al., 2008; Opperman et al., 2008) and pine wood nematode Bursaphelenchus

xylophilus genome (Kikuchi et al., 2011), as well as the entire GenBank databases of other

migratory endo and ectoparasitic nematodes and found no other homologous sequences,

suggesting that Gr29D09 effector gene family may be cyst nematode-specific. Furthermore,

Gr29D09 showed no similarity to any characterized genes in the databases.

28

2.4.4 Gr29D09 genomic structures

We cloned the genomic sequences of Gr29D09 and identified the corresponding genomic

structures of 4 major variants by sequencing PCR-derived Gr29D09 genomic sequences cloned

from bulked RO1 J2s. The corresponding genomic sequences comprise four exons and three

introns which are 997 bp (Genomic Gr29D09-V1, -V2 and -V4) and 1184 bp (Genomic

Gr29D09-V3) in length (Figure 2.2). The intron sequences are 100% conserved except for

insertions in intron 2 and 3 that exclusively occur in the genomic sequence of Gr29D09-V3.

Identity percentage Exon 1 95-100% Exon 2 94-100% Exon 3 91-97% Exon 4 94-96%

Figure 2.2 Corresponding genomic structures of four major Gr29D09 variants. The

genomic sequences of Gr29D09 variants were cloned from bulked RO1 J2s. Genomic

Gr29D09-V1, -V2 and -V4 sequences constitute similar structure while the genomic sequence

of Gr29D09-V3 showed large/small insertions in intron 2 and 3 (the position of the largest

insertion is indicated within vertical black lines). Open boxes represent the coding sequences.

Numbers above the exons or below the introns indicate the length of base pairs in each region.

The identity percentages in nucleotide sequences of the exons were indicated below the map.

The scale is in base pair.

29

2.4.5 Gr29D09 expression is dorsal gland cell-specific and highly upregulated in nematode

parasitic stages

To determine whether Gr29D09 is expressed in the esophageal gland cells where a majority of

plant parasitic nematode effectors are synthesized for secretion, antisense cDNA probe designed

based on a conserved region of the Gr29D09 family was used for whole mount in situ mRNA

hybridization. Hybridization signals were observed exclusively within the dorsal gland cell of

parasitic nematodes (Figure 2.3a). The corresponding sense probe used as negative control did

not give any hybridization signal in the esophageal dorsal gland cell (data not shown).

Expression patterns during different developmental stages of esophageal gland specific

genes can indicate their involvement in particular parasitism stages such as host penetration,

early migration, feeding site establishment or maintenance. Therefore, quantitative real-time RT-

PCR analysis was performed to determine the expression profile of Gr29D09 in pre-parasitic and

parasitic stages including cysts, pre-parasitic second stage juveniles (pre-J2), parasitic second-,

third- and fourth-stage juveniles (par-J2, -J3, -J4). Gr29D09 mRNA expression was highly

upregulated (up to 3000 fold relative to expression in cysts) at late par-J2 and gradually

diminished in later parasitic stages (Figure 2.3b), which is associated with the timing of feeding

site establishment and its maintenance by the nematodes.

30

Figure 2.3 Spatial and developmental expression of Gr29D09

(a) A digoxigenin-labeled antisense Gr29D09 cDNA probe localized Gr29D09 transcripts to

within the dorsal gland (DG) cell of parasitic life stage of G. rostochiensis. Scale bars = 10

µm. Abbreviations: M, metacorpus; S, stylet. (b) Gr29D09 highly upregulates in parasitic

stages of G. rostochiensis. The relative expression of Gr29D09 was quantified using

quantitative RT–PCR in five G. rostochiensis life stages: cyst, pre-parasitic second-stage

juvenile (pre–J2), and parasitic second-, third- and fourth-stage juveniles (par–J2, J3 and J4).

The expression was normalized to the G. rostochiensis –actin gene and relative to expression

in cyst. Values are means ± standard errors of two biological repeats. Abbreviation: dpi, day(s)

post inoculation. The experiments were repeated at least three times.

2.4.6 Overexpression of Gr29D09-V1 and Gr29D09-V3 in potato resulted in increased

susceptibility to compatible G. rostochiensis

Since plant-parasitic nematodes cannot be genetically transformed, we assessed the potential role

of secreted Gr29D09 variants in nematode virulence by generating transgenic potato lines over-

expressing either Gr29D09-V1 or V3 under the control of CaMV 35S promoter. No obvious

phenotypic differences were observed in the shoots and roots of transgenic lines compared to EV

control lines. Nematode infection was performed on two independent transgenic potato lines per

31

variant (V1-Line 1 and 16; V3-Line 5 and 9) and all these lines showed significantly increased

number of females compared with the control line (Figure 2.4). We conclude that Gr29D09

family enhance nematode virulence, with assumption that the remaining closely related variants

would show similar function.

Figure 2.4 Potato lines overexpressing Gr29D09-V1 and V3 showed increased

susceptibility to G. rostochiensis. Two independent transgenic lines per variant were

inoculated with 150 G. rostochiensis infective juveniles and nematode females were counted

at 5 weeks after inoculation. Data are presented as means ± standard errors of 12-17 replicates

(vegetatively propagated plantlets for each transgenic line) per line. Mean values significantly

different from the control are denoted by asterisks, as determined by student t tests (P < 0.05).

Identical results were obtained from two independent experiments. Abbreviation: L, line.

32

2.4.7 Overexpression of Gr29D09-V1 and Gr29D09-V3 in potato increased plant

susceptibility to an unrelated pathogen

Emerging evidence suggests that plant-parasitic nematode secreted effectors can suppress PTI to

facilitate nematode parasitism. For instance, overexpression of nematode effectors in host plants

often led to increased susceptibility to nematode infection and (some cases) to infection by other

adapted plant pathogens (Patel et al., 2010; Postma et al., 2012; Chronis et al., 2013, Jaouannet et

al., 2013; Lozano-Torres et al., 2014). Generally, this enhanced susceptibility to nematodes and

unrelated pathogens indicates a compromised basal defense (Chen et al., 2013). We showed that

overexpression of Gr29D09 variants in host potato resulted in increased susceptibility to G.

rostochiensis, indicating their critical role in nematode parasitism. Here we further evaluate a

role of Gr29D09 variants in basal defense suppression by testing the susceptibility of the same

Gr29D09 overexpression lines (V1-L16 and V3-L9) to infection by Streptomyces scabies,

another adapted pathogen that causes common scab of potato. Either when the roots were

visually assessed at 5-6 weeks after infection or when root lengths were measured at 8-9 weeks,

S. scabies infected lines V1-L16 and V3-L9 showed more severe root symptoms when compared

to the S. scabies infected EV line, indicating that basal defense is compromised in Gr29D09

overexpression lines (Figure 2.5). Similar results were obtained in three independent

experiments.

33

Figure 2.5 Potato lines overexpressing Gr29D09-V1 and Gr29D09-V3 showed increased

susceptibility to Streptomyces scabies. 6-10 shoot tops of vegetatively propagated plantlets of

each line were dipped briefly in the S. scabies suspension culture and cultivated in tubes. (A)

Photographs were taken at 5–6 weeks after inoculation. (B) The lengths of S. scabies infected

and non-infected roots at 8-9 weeks after inoculation. Data are presented as means of 6-10

vegetatively propagated plantlets ± standard errors. Mean values of infected roots that are

significantly different from the non-infected roots are denoted by different letters, as

determined by paired Student t tests (P < 0.05). Identical results were obtained from three

independent experiments.

2.4.8 Gr29D09 polymorphisms in the RO2 population

There are two G. rostochiensis pathotypes RO1 and RO2 existing in the United States. H1 gene

has been widely and effectively deployed to control G. rostochiensis RO1 populations until the

emergence of virulent population RO2 that overcomes H1-mediated resistance (Ellenby, 1952;

34

Brodie, 1993). Therefore, knowledge of genes that govern G. rostochiensis parasitic ability on

H1 harboring resistant potato is of great interest. Gr29D09 family showed extensive sequence

diversity in RO1 population and was demonstrated to have a critical role in G. rostochiensis

parasitism. To identify whether there are polymorphisms in Gr29D09 sequences that are

associated with RO2 population, we performed similar cloning and analysis of 90 Gr29D09

sequences derived from RT-PCR from bulked 14 dpi females. As in RO1 population, a total of

28 variants were identified from RO2 population. Four identical major variants (Gr29D09-V1 to

V4) were identified in RO2 population but with slightly different frequencies compared with

RO1 population (Table 2.3, Figure 2.1c). 24 minor variants mostly occur only one time in our

data set and include 2 variants with 5bp deletion in exon 2 causing translation frameshift.

Although not statistically significant, there is a respective 34% decrease and 40% increase in

frequencies of Gr29D09-V1 and V3 in RO2 population, suggesting that Gr29D09-V3 may be

more important in assisting the nematodes in parasitizing H1-mediated resistant potato. Although we

could not repeat this experiment with other G. rostochiensis populations from different

geographical regions to confirm the association of Gr29D09 variants with RO2 populations due

to international quarantine regulations of this pathogen, we believed that this result could be

useful for the functional characterization of Gr29D09 effectors.

Table 2.3 Frequencies of Gr29D09 variants in G. rostochiensis populations

Major variants Minor variants

G. rostochiensis

populations V1 V2 V3 V4 Total

V1-

like

V2-

like

V3-

like

V4-

like Others Total

RO1 21 13 14 13 61 5 3 7 5 2 22

RO2 14 13 20 15 62 6 6 10 4 2 28

Changed frequencies in

RO2 compared to RO1 -34% 0% 40% 13%

35

2.4.9 Gr29D09 family is subject to strong diversifying selection

Coevolutionary arms race between hosts and pathogens imposes strong diversifying/positive

selection to interacting factors of either partners, leading to extensive sequence diversity in

effectors and host proteins that function in the host-pathogen molecular interface (Ma and

Guttman, 2008). To determine whether positive selection underlies the diversity in Gr29D09

sequences, a subset of sequence data (105 sequences from RO1 and RO2 population) and their

maximum likelihood phylogenetic tree were analyzed in PAML CODEML version 4.8 (Yang

and Nielsen, 2000) under different selection models (M0 (one ratio) vs. M3 (discreet), M1a

(neutral) vs. M2a (selection) and M7 (neutral) vs. M8 (selection)) to test for positive selection at

codon sites (“Site Model”). All three CODEML models M3, M2a and M8 showed with high

confidence (p<0.001) that Gr29D09 has indeed undergone diversifying selection. 16 amino acid

sites along the Gr29D09 protein sequences were found to be under strong positive selection with

posterior probability of 0.99 or higher in at least two out of three models (Table 2.4). Notably,

these sites mostly distribute in the ‘variation hot spot’ regions of four major variants (Table 2.3).

36

Table 2.4 Positively selected sites predicted by CODEML models and likelihood ratio test

showing the good evolutionary models fitting Gr29D09 data set.

Model Code p l Positively selected

sites

Likelihood ratio test (LRT)

LRT 2l df P

M0 (one ratio) 1 -1814.04 None

M0 vs.

M3 82.52 2

<0.001

significant

M3 (discreet) -1772.78 39L, 51R, 59N, 61E,

62S, 63V, 99E, 104V,

118A, 140K, 143K,

144D, 146G, 147K,

150D, 165K, 167L,

169K

M1a (neutral) 2 -1792.44 None

M1a

vs.

M2a

39.3 2 <0.001

significant

M2a (positive

selection)

4 -1772.79 39L, 51R, 59N, 61E,

62S, 63V, 99E, 104V,

118ª, 140K, 143K,

144D, 146G, 147K,

150D, 165K, 167L,

169K

M7 (beta) 2 -1792.61 none

M7 vs.

M8 39.32 2

<0.001

significant

M8 (beta & ) 4 -1772.95 39L, 51R, 59N, 61E,

99E, 104V, 118A,

140K, 143K, 144D,

146G, 147K, 150D,

165K, 167L, 169 K

Six PAML CODEML models (M0, M3, M1a, M1b, M7 and M8) were used to identify the

positive selected sites in Gr29D09 effector gene family and the likelihood scores (l) of each

model were recorded. The significance of likelihood score difference (P) was estimated

using the likelihood score difference (2l) between positive selection models (M3, M2a and

M8) and the null models (M0, M1 and M7) to look up the 2 table (likelihood ratio test,

LRT). In all three comparisons (M0 vs. M3, M1a vs. M2a and M7 vs. M8), 2l > 13.82

(equivalent to P< 0.001) indicated that the positive selection models adapt better than the

null models with our dataset.

37

2.5 Discussion

29D09 was identified as a candidate effector gene in H. glycines and G. pallida but its role in has

not been characterized (Gao et al., 2003; Jones et al., 2009). In this study, we have cloned the

sequences of candidate effector gene Gr29D09 from G. rostochiensis using a homologue-

approach and demonstrated that Gr29D09 belongs to a highly polymorphic multigene family

with four major variants identified. We showed the exclusive expression of Gr29D09 in the

dorsal esophageal gland cell (the same localization pattern as Gr29D09 homologue in H.

glycines) and the dramatic upregulation (1000- to 3000-fold change) in parasitic stages

corresponding with feeding cell initiation and maintenance. These two lines of evidence, along

with the predicted signal peptides in Gr29D09 protein sequences, strongly indicate that gene

members of Gr29D09 family are good candidate effectors of G. rostochiensis. Notably, although

thousand-fold changes in effector gene expression have been observed in genes encoding cell

wall degrading enzymes during root invasion or in a number of novel genes during the transition

from sedentary to migratory male nematodes, the striking and lasting upregulation in Gr29D09

expression during parasitic stages is not a common case in characterized nematode effectors

(Cotton et al., 2014; Thorpe et al., 2014). Much lower upregulation levels during parasitic stages

in relative to cysts were reported in other dorsal gland effector genes (which quantitative

expression data are available) such as G. rostochiensis CLE genes (4-600 folds), H. schachtii

30C02 (50-350 folds), and G. rostochiensis GrUBCEP12 (<5 folds) (Lu et al., 2009,

Hamamouch et al., 2012; Chronis et al., 2013). These characterized effectors showed diverse

parasitism functions and therefore the association of high gene upregulation to its biological

functions is unclear.

38

Plant-parasitic nematodes cannot be genetically transformed for gain-of-function

analysis. However, many functional studies of phytonematode effectors showed that expression

of nematode effectors in plants indeed reflects the secretion of effectors into host tissues. With a

few exceptions, transgenic host plants overexpressing nematode effectors which have potential

roles in assisting nematode parasitism would show increased susceptibility to nematode infection

(Hewezi et al, 2008, 2010; Postma et al., 2012; Chronis et al., 2013; Lozano-Torres et al., 2014).

Therefore, this method could be used as a direct way to study the roles of candidate effectors in

nematode parasitism. Using this approach, a significant increase in susceptibility to nematode

and an unrelated pathogen S. scabies was observed in transgenic potato lines that constitutively

overexpress Gr29D09-V1 and V3, indicating a critical role of Gr29D09 family in compromising

host basal defense to promote G. rostochiensis parasitism. The lack of the signal peptides in

overexpression constructs indicates that these Gr29D09 variants function within the plant cell.

This evidence, together with the lasting high upregulation of Gr20D9 during parasitic stages,

indicates the important role of this gene family in G. rostochiensis parasitism, potentially

through the suppression of host innate immunity.

The Gp29D09 genes from G. pallida that showed highest similarities with Gr29D09 are

among the 39 genes of the large and diverse multigene family named ‘family of protein similar

to Heterodera glycines effectors 4D06 and G16B09’, one of the three large effector gene family

in G. pallida (Supplementary figure 2.3) (Cotton et al., 2014; Thorpe et al, 2014). It is revealed

in our study that Gr29D09 itself is a multigene family with multiple gene variants found in

individual nematodes. Furthermore, Gr29D09 variants appeared to be less variable (88-98%

identity) than six homologous Gp29D09 genes identified from G. pallida genome (30-88%

39

identity), suggesting that Gr29D09 variants represent different gene copies that undergo recent

duplication (and possibly different alleles of the same gene) (Supplementary figure 2.3).

Amino acid alignment of four major Gr29D09 variants showed significant sequence

variation and mutated sites are accumulated in “variation hot spot” regions (two of them are near

the C-terminus) of the sequences. The alignment of Gr29D09 variants and the homologous genes

in G. pallida also showed significant variation in the C-terminus (Supplementary figure 2.4). It

has been shown that the C-terminal regions of oomycete RXLR effectors carry the effector

activity that functions inside plant cells (Whisson et al., 2007; Dou et al., 2008; Win and Kamoun,

2008) and are more likely to undergo positive selection under host defense pressures (Haas et al.,

2009; Jiang et al., 2008; Win et al., 2007). For instance, the C-terminal half of P. infestans RXLR

effector AVR3a is sufficient to trigger resistance protein R3a- and elicitor INF1-mediated cell

death in Nicotiana benthamiana (Bos et al., 2006). This suggests that variable regions in C-

terminal of Gr29D09 sequence may represent important functional domains and be subject to

positive selection.

Additional sequence analysis of Gr29D09 from G. rostochiensis RO2 population that is

virulent on H1-harboring resistant potato genotypes led to the identification of four identical

major variants (Gr29D09-V1 to V4) as identified in RO1 population. However, we observed a

decreased and increased frequency of Gr29D09-V1 (34%) and V3 (40%) variants in RO2

population. The increased frequency of effector gene variant in virulent population was reported

in another cyst nematode effector gene Hg-cm-1 which has an indirect role in altering host

defense (Lambert et al., 1999b; Lambert et al. 2005). When H. glycines F2 populations that

segregate for two alleles Hg-cm-1A and Hg-cm-1B were used to infect resistant and susceptible

soybean, an increased frequency of Hg-cm-1A allele in the F2 H. glycines J2s growing on

40

resistant soybean was consistently observed in three independent crosses. It was therefore

suggested that Hg-cm-1A showed more important role in aiding the nematode to parasite on

resistant soybean, possibly by suppressing host defense and maybe other biochemical barriers in

resistant soybean. Although the change in V3 frequency (14/61 sequences derived from RO1 and

20/62 sequences derived from RO2) is as significant as in case of Hg-cm-1A (detected in 29/83

J2s growing on susceptible soybean and in 49/82 J2s growing on resistant soybean), the PCR-

based individual J2 genotyping in Hg-cm-1 case might reflect the change in allele/variant

frequencies more directly and accurately than using sequences derived from RT-PCR from

bulked females as in case of Gr29D09. Similar genotyping method would be useful to clarify

whether certain Gr29D09 variants are associated with different G. rostochiensis populations,

possibly by designing probes that specifically anneal with variant-specific regions to track the

potential selection of Gr29D09 variants on H1 harboring potato genotypes. However, it is

necessary to notice that high frequency (more than 50% of sequences cloned from bulked

nematode J2s) of Gpa2-recognized variants of GpRBP-1 occurs in G. pallida virulent population,

indicating that frequency-based approach may not be enough to hypothesize potential roles of

candidate effectors in virulent populations due to the heterogeneous attribute of nematode

populations (Sacco et al., 2009).

Positive selection signatures have been frequently reported in eukaryotic effectors (Ma

and Guttman, 2008; Win et al, 2007; Liu et al. 2005; Stukenbrock and McDonald, 2007). In

plant-nematode pathosystem, diversifying selection has been only reported within Globodera-

specific SPRYSEC effector family. G. pallida SPRYSEC effector gene GpRBP-1, which

encodes for the Avr protein that triggers Gpa2-mediated hypersensitive cell death and nematode

resistance in potato host, was demonstrated to be under positive selection (Sacco et al., 2009;

41

Carpentier et al., 2011). Interestingly, the recognition specificity is determined by a single

positively selected amino acid in the SPRY domain. Furthermore, SPRYSEC gene family from

G. rostochiensis also showed footprint of positive selection in 9 sites in the SPRY domain

(Rehman et al., 2009b). Notably, SPRYSEC family is an interesting effector family since its

members can activate and suppress host innate immunity. Therefore, it was proposed that the

expansion of the SPRYSEC family may reflect their adaptations to functional diversifications of

host virulent targets and/or host immune receptors (Postma et al., 2012). Sequence diversity in

Gr29D09 also suggests that this family might function at the interface of plant-pathogen

molecular interactions. Interestingly, most of positively selected sites in Gr29D09 sequences

were also distributed in two ‘variation hot spot’ regions near C-terminus of the sequences,

suggesting that Gr29D09 might exert diversifying functions in host plants, either to expand its

host targets or to avoid host recognition. This is the first report of positive selection in plant-

parasitic nematode effector genes outside of the diversified SPRYSEC family.

Numerous Avr genes have been characterized in other microbial pathogens by traditional

genetic approach which cannot be effectively applied to plant parasitic nematodes due to the

complexity of their genomes, life cycles and a lack of genetically transformable model organism

(Sacco et al., 2009). For that reason, the only unambiguous report of nematode effector protein

that could trigger R-gene-mediated defense responses is G. pallida GpRBP1 (Sacco et al., 2009).

To date, 14 PCN resistance gene loci have been mapped to different linkage groups in potato

(Finkers-Tomczak et al., 2011) and only 2 of them (Gpa2, Gro1) were cloned (Van der Vossen

et al., 2000; Paal et al., 2004). Pathogen effectors are emerging as tools to accelerate the

identification and functional characterization of resistance genes hence assisting breeding for

resistant crops (Vleeshouwers et al., 2014). Sequence diversity observed in Gr29D09 effector

42

family is a characteristic often possessed by pathogen Avr genes (Dodds et al., 2004; Allen et al.,

2004). Therefore, variants of Gr29D09 effector family, which showed significant sequence

diversifications and play critical role in enhancing nematode parasitism, could function as

avirulence proteins and should be used to mine natural nematode resistance resources in wild

potato accessions.

Collectively, the data in this study demonstrated a critical role of Gr29D09 effector gene

family in nematode parasitism and its potential roles in the suppression of host basal defense. In

addition, Gr29D09 sequences bear signatures of diversifying selection, indicating that Gr29D09

members might exert diversifying functions in the host tissue. Functional characterization of

Gr29D09 variants and identification of its interacting proteins in the potato host would elucidate

the specific roles of this effector family in the interaction between G. rostochiensis and its potato

host.

Supplementary Figure 2.1 mRNA expression of Gr29D09-V1 and Gr29D09-V3 in

independent transgenic potato lines. The circled lines were selected for the functional studies.

43

Supplementary Figure 2.2 Phylogenetic tree (based on amino acid alignment) showing the

identification of four sequence clades from 83 Gr29D09 sequences derived from RT-PCR

from 14 dpi females of RO1 population. The clones in red are the representative variants of

each sequence clade. Scale bar represents 0.01 substitution per site.

44

Supplementary Figure 2.3 Phylogenetic tree showing the relationship of approximately 40

gene members of ‘family of protein similar to Heterodera glycines effectors 4D06 and

G16B09’, one of three large multigene family in G. pallida genome. The homologous genes

from soybean cyst nematode H. glycines are also included. The highlighted clade represents

Gp29D09 members.

45

Supplementary Figure 2.4 Deduced protein alignment of Gr29D09 variants from G.

rostochiensis and Gr29D09 homologues from G. pallida genome.

46

CHAPTER 3

The novel Gr29D09 effector family from potato cyst nematode Globodera rostochiensis

suppresses plant immunity to promote nematode parasitism

3.1 Abstract

Sedentary endoparasitic nematodes rely on secreted effectors to suppress host defenses to ensure

the formation and maintenance of their feeding structures. Our results shown in Chapter 2

suggest a role of the Gr29D09 effector family in host defense suppression. Here we reported a

further functional characterization of the four Gr29D09 variants and provided direct evidence

that the Gr29D09 family can suppress both PTI and ETI. First, overexpression of Gr29D09-V1

or Gr29D09-V3 in potato resulted in the suppression of Pseudomonas fluorescens- induced

callose deposition in the roots. Using Agrobacterium-mediated transient expression assays in

Nicotiana benthamiana, we found that all the four Gr29D09 variants could suppress flg22-

induced defense marker gene expression and ROS production to variable degrees and that the

four variants could also suppress cell death induced by potato resistance genes R3a and/or Gpa2.

The diversifying selection found in the Gr29D09 effector family might indicate that this effector

family has undergone rapid change to avoid recognition by host resistance proteins.

Agrobacterium-mediated expression assay was then used to transiently express individual

Gr29D09 genes in leaves of wild potato species to screen for a hypersensitive response (HR).

Interestingly, two of the Gr29D09 variants (Gr29D09-V3 and Gr29D09-V4) were found to

induce an HR phenotype in leaves of two wild potato species (Solunum berthaultii and S.

kurtzianum) and a potato cultivar ‘Kennebec’, indicating that the two variants may function as

avirulence proteins for the yet-to-identified R proteins in these potato species. In order to gain a

better understanding of how the Gr29D09 family members function as host immunity

47

suppressors during nematode parasitism, we generated transgenic potato lines overexpressing

Gr29D09-V1-GFP or Gr29D09-V3-GFP fusion protein and used them in co-

immunoprecipitation (Co-IP) assay coupled with nano LC-MS/MS analysis to identify host

targets of Gr29D09-V1 and Gr29D09-V3. Three proteins Hexokinase 1, heat shock protein 90

and a homologue of the late blight resistance protein R1A were repeatedly co-

immunoprecipitated with Gr29D09 variants and considered to be the most likely host targets of

Gr29D09-V1 and Gr29D09-V3. Altogether, these results not only demonstrated a critical role of

Gr29D09 effector proteins in host defense suppression, but also suggested that the Gr29D09

family members may function in different defense signaling pathways.

3.2 Introduction

Obligate biotrophic plant parasitic nematodes totally rely on plant nutrients to complete their life

cycle. Advanced parasites such as sedentary endoparasitic cyst-forming nematodes of the genera

Heterodera and Globodera have evolved intimate parasitic relationships with their host plants.

These nematodes penetrate host roots as motile juveniles and migrate intracellularly towards the

vasculature, where they select single cells to transform into a specialized feeding structure called

the syncytium (Jones and Northcote, 1972). The nematodes become sedentary after the

syncytium initiation and rely solely on this unique feeding structure for their supply of nutrients

until maturation. Syncytia are multi-nucleate structures consisting of thickened cell walls, dense

cytoplasm and enlarged nuclei and nucleoli (Jones et al., 1981). These metabolically active

syncytia serve as strong sinks for nutrients that are specifically tailored according to nematode

demand (Grundler et al., 2011). Fascinatingly, although causing extensive host tissue damage

and complex alterations in host cellular processes during nematode invasion, formation and

48

maintenance of feeding sites, cyst nematodes can achieve the successful parasitism without being

attacked by the innate immune system of their hosts during compatible interactions. The recent

accumulated findings demonstrated that nematode secreted effectors, which are mainly

synthesized in the esophageal gland cells, could manipulate both host development and defense

pathways to facilitate nematode parasitism (Goverse and Smant, 2014).

Plant have evolved an effective two layered immune system to defend themselves against

pathogen attacks (Jones and Dangl, 2006). Basal defense or pattern-triggered immunity (PTI)

involves the perception of the conserved pathogen-associated molecular patterns (PAMPs) by

host cell surface-localized pattern recognition receptors (PRRs) and the activation of a variety of

downstream responses including the ion fluxes, mitogen-activated protein kinase (MAPK)

cascades, reactive oxygen species (ROS), defense gene expression, and cell wall reinforcement

(Boller and Felix, 2009). Successful pathogens can overcome PTI responses by utilizing secreted

effectors, which in turn may be directly or indirectly recognized by intracellular resistance

proteins and trigger effector-triggered immunity (ETI). ETI induces defense responses similar to

PTI but at higher titer and is often associated with the development of the hypersensitive

response (HR), a type of programmed cell death, at the infection site to effectively restrict

pathogen growth (Heath, 2000). For survival, pathogens invade ETI either by avoiding being

recognized or suppressing ETI using new effectors. The coevolution continues in which plants

and pathogens ceaselessly restore or suppress ETI by respectively evolving new R or effector

genes.

Increasing number of nematode effectors have been recently showed to directly suppress

PTI and ETI responses (Postma et al., 2012; Chronis et al., 2013; Chen et al., 2014; Jaouannet et

49

al., 2012; Lozano-Torres et al., 2014; Chen et al., 2015; Ali et al., 2015ab). Furthermore, there

have been also reports on nematode effectors that indirectly suppress host defense through

interfering with plant metabolism, indicating a link between feeding cell metabolism and host

defense. For instance, effector 10A06 from beet cyst nematode H. schachtii was demonstrated to

protect feeding sites from excessive oxidative stress by interacting with spermidine synthase 2

(SPD2) of A. thaliana (Hewezi et al., 2010). SPD2, which is an enzyme in the polyamine

biosynthesis, catalyzes the synthesis of spermidine that can directly or indirectly decrease

oxidative stress. Another effector from H. schachtii, 4F01, likely functions as a redox regulator

by interfering with an oxidoreductase that involves jasmonic acid-mediated defense responses

(Patel et al., 2010). Similarly, both cyst and root knot nematodes secrete proteins similar to plant

chorismate mutases, which have been proposed to interfere with the biosynthesis of salicylic acid

and phytoalexin through the competition with chorismate to prevent the triggering of host

defense (Bekal et al., 2003; Jones et al., 2003; Doyle and Lambert, 2003; Huang et al.,

2005a; Vanholme et al., 2009). These examples showed that interfering with feeding cell

metabolism is one of the strategies sedentary endoparasitic nematodes exploit to manipulate host

defense.

Gr29D09 is a novel effector family from potato cyst nematode G. rostochiensis. This

effector family appeared to be specific to cyst nematodes and to have undergone considerable

expansion (Cotton et al., 2014). We demonstrated in Chapter 2 that Gr29D09 family bears

signatures of positive selection in their sequences and plays a critical role in nematode

parasitism. Sequence diversity in Gr29D09 also suggests that members of this family might

function at the interface of plant-pathogen molecular interactions, possibly as host defense

manipulators. We therefore set out to study the roles of four Gr29D09 variants in the suppression

50

of host innate immunity. Molecular functional characterization of multiple Gr29D09 variants

would not only elucidate the roles of Gr29D09 family in plant-nematode interactions but also

provide insights into the mechanism underlying the evolution of this family. To date, the

SPRYSEC protein RBP-1 from G. pallida (Sacco et al., 2009; Carpentier et al., 2011) and other

SPRYSEC proteins from G. rostochiensis (Rehman et al., 2009b; Ali et al., 2005) are among the

few nematode effectors whose sequence diversity has been extensively studied and considered in

functional analysis, providing valuable insights into the evolution of this effector family.

In this chapter, we report the functional characterization of four Gr29D09 variants and

provide direct evidence that Gr29D09 family suppresses basal defense and effector-triggered

immunity. A role of Gr29D09 variants in suppressing host basal defense was demonstrated in

Chapter 2 using Gr29D09 overexpression potato plant, which showed increased susceptibility to

G. rostochiensis and the unrelated pathogen S. scabies. In this chapter we continued to show

reduction in P. fluorescens-mediated callose deposition in these transgenic lines. Using

Agrobacterium-mediated transient expression assays, all four Gr29D09 variants were able to

suppress flg22-mediated ROS production and defense gene expression. In addition, the same

proteins suppress the ETI-associated cell death triggered by two different potato resistance genes

R3a and Gpa2. More importantly, Gr29D09 variants appeared to suppress plant immunity to

variable degrees. Interestingly, two Gr29D09 variants Gr29D09-V3 and Gr29D09-V4 induce cell

death response in several wild type potato accessions, indicating that they might function as

typical avirulence proteins. Additionally, we report the identification of three candidate

Gr29D09-interacting proteins in potato host. Hexokinase 1 and heat shock protein 90 (HSP90)

were repeatedly co-immunoprecipitated with Gr29D09-V1 and Gr29D09-V3, whereas a

homologue of the late blight resistance protein R1A was repeatedly co-immunoprecipitated with

51

only Gr29D09-V3. Notably, Hexokinase 1 plays dual roles in sugar metabolism and programmed

cell death regulation. Taken together, we propose that four major Gr29D09 variants suppress

host immunity to promote nematode parasitism, possibly by targeting sugar metabolism in the

feeding site.

3.3 Materials and Methods

3.3.1 Expression constructs

Four Gr29D09 variants Gr29D09-V1 to V4 were cloned from pGEM-T Easy harboring the

corresponding variants and constructed into various expression vectors (pMD1-HA, pBIN61-HA

and pMD-GFP-HA) for functional characterization using appropriate restriction enzymes (XbaI

and XhoI or BamHI). All vectors make use of a CAMV 35S promoter to drive the constitutive

expression of the transgenes. In all constructs, the regions coding for the predicted signal

peptides of Gr29D09 variants were excluded to ensure the expression of these variants in the

plant cytoplasm. The expression constructs were transformed into Escherichia coli strain TOPO-

10 and correct sequences were confirmed by sequencing. The final expression constructs were

then transformed into either Agrobacterium tumefaciens GV3101 strain for transient expression

assays on Nicotiana benthamiana leaves or LBA 4404 strain for the generation of stable

transgenic potato plant. Corresponding vectors carrying either no insertion or GFP were used as

control.

52

Table 3.1 Primers used for cloning Gr29D09 and making expression constructs.

Primer Primer sequence (5’-3’) Application

Gr29D09-SP-XbaI

Gr29D09-TGA-XhoI

Gr29D09-TGA-BamHI

ATTCTAGAATGGCCCCGCATCCATGCTGT

ATCTCGAGTCAGTTGGCGGCGCTGTA

AAGGATCCGTTGGCGGCGCTGTATTC

Making expression construct

Making expression construct

Making expression construct

3.3.2 Callose deposition assay on transgenic potato lines

Callose deposition assay was performed on the transgenic potato lines using nonpathogenic

bacteria Pseudomonas fluorescens strain 0-1 (kindly provided by Martin Lab, Boyce Thompson

Institute for Plant Research, Ithaca, NY) to activate PTI responses. To prepare the bacterial

culture for infection, bacteria were grown on KB agar medium supplemented with 100 µg/mL

ampicillin for 1 day at 30oC. Bacteria were washed and suspended into MgCl2 10 mM to a final

OD600 of 1.5. To induce callose deposition, whole 8-day old potato plantlets were removed from

propagation media, washed once with sterile water and subsequently submerged into 5 ml of

bacterial suspension or 10 mM MgCl2 mock solution for vacuum infiltration of the roots for 5

minutes. The infiltrated potato plantlets were transferred into ½ solid Murashige and Skoog basal

medium and 12-14 root tips from different plantlets were collected at 72 hours after infiltration

for callose staining according to previously described method (Millet et al., 2010) with some

modifications. In brief, treated potato roots were fixed in the solution of 3 to 1 ratio of 95%

ethanol : acetic acid overnight to ensure the thorough fixing and the clearing of the tissues. The

roots were rehydrated in 70% ethanol for 1 h, 50% ethanol for 1 h and water for 1 h.

Subsequently, the roots were treated with 10% NaOH for 1.5 h at 37oC to make the tissues

transparent. After 2 or 3 washes by water, the roots were finally incubated in 1% aniline blue

dissolved in 150 mM K2HPO4, pH 9.5 for at least 1 h. The stained roots were excised and

53

mounted on slides for callose observation on Leica DM5500 microscope under UV light

(excitation: 390 nm; emission: 460 nm) and callose spots were counted by ImageJ software.

3.3.3 Nicotiana benthamiana growth conditions and preparation of Agrobacterium

tumeficiens culture for leave agroinfiltration

N. benthamiana were grown in the greenhouse at 22-28oC from 3-6 weeks. One day before the

agroinfiltration, plants were transferred into a growth room with monitored conditions

(temperatures 20-25oC, humidity 35-50%, 16 : 8 light-dark cycle). The same culture conditions

for bacteria were applied for all the assays involving N. benthamiana agroinfiltration except for

adjustments in the bacterial density. Transformed GV3101 cells were cultured overnight in liquid

media at 28oC (12-16 hours). The collected cells were washed and resuspended in the solution of

10 mM MES pH 5.5 and 200 uM acetosyringone at a final absorbance at 600 nm of 0.15 (for

Avr/R expression constructs) or 0.3 (for Gr29D09 variant expression constructs and all the

controls). Cell suspensions were cultured for 3 h and before being infiltrated into N. benthamiana

leaves.

3.3.4 ROS assay in N. benthamiana

The protocol for ROS assay and P. syringae effector AvrPtoB (positive control) were kindly

provided by Martin Lab (Boyce Thompson Institute, Ithaca, NY). Four-week-old N.

benthamiana plants were syringe infiltrated on a well-expanded leaf with a suspension of

Agrobacterium strain GV3101 carrying HA-tagged Gr29D09 variants (Gr29D09-V1 to V4) in

pBIN61 vector, the EV control or AvrPtoB as positive control. Infiltrated plants were kept in a

growth chamber under controlled conditions (20 to 25°C temperatures, 35-50% humidity, 16 : 8

light-dark cycle). At 48 h after infiltration, 24 leaf discs from 8 different plants per expression

54

construct were collected and treated with water overnight. The water was replaced by 100 μL of

assay solution (17 mM luminol, 1 μM horseradish peroxidase, and 100 nM flg22) and ROS

production was measured in the Synergy HT plate reader (Biotek) (Segonzac et al., 2011). The

experiment was repeated 10 times and the percentage of plants showing the suppression of flg22-

induced ROS production compared with the empty vector control was calculated.

3.3.5 Assay to measure flg22-triggered defense gene expression in N. benthamiana

Six-week-old N. benthamiana plants were syringe infiltrated on of a well-expanded leaf with a

suspension of Agrobacterium strain GV3101 carrying Gr29D09 variants (V1-V4) in pMD1

vector or the EV control. Leaf discs were collected at 48 h after infiltration, treated with water

overnight and flg22 for 30 minutes. mRNA was isolated using The Dynabeads mRNA DIRECT

Kit (Life Technologies Corporation) according to the manufacturer’s instruction. One microgram

of DNase-treated mRNA was used to synthesize cDNA using ProtoScript II Reverse

Transcriptase (New England Biolabs, Inc.). qRT-PCR was performed in 20 µl volume containing

50 ng of cDNA, 10 pmol of each primer, and 1X SYBR Green Supermix (Bio-Rad). Each

reaction was performed in triplicate and melting curve analysis was performed at the end of each

run to ensure that unique products were amplified. Primer sequences to amplify NbPit5 and

NbAcre31) were retrieved from Nguyen et al. (2010). Data were normalized to the elongation

factor 1-alpha (EF1) control gene. Fold-induction of gene expression was calculated using the

2-ΔΔCt method. The assay was repeated two times from two independent infiltration assays.

55

Table 3.2 Primers used in PTI marker gene expression assay.

Primer Primer sequence (5’-3’) Application

NbEF1α_F

NbEF1α_R

NbPit5F

NbPit5R

NbAcre31F

NbAcre31R

AAGGTCCAGTATGCCTGGGTGCTTGAC

AAGAATTCACAGGGACAGTTCCAATACCAC

CCTCCAAGTTTGAGCTCGGATAGT

CCAAGAAATTCTCCATGCACTCTGTC

AATTCGGCCATCGTGATCTTGGTC

GAGAAACTGGGATTGCCTGAAGGA

PTI marker gene expression assay

PTI marker gene expression assay

PTI marker gene expression assay

PTI marker gene expression assay

PTI marker gene expression assay

PTI marker gene expression assay

3.3.6 Cell death suppression assay

The following pairs of resistance and cognate Avr genes were used (all were kindly provided by

Martin Lab, Boyce Thompson Institute for Plant Research, Ithaca, NY): R3a/Avr3a (Huang et

al., 2005b), Gpa2/RBP–1 (Sacco et al., 2009), Pto/AvrPto (Scofield et al., 1996) and Rx2/CP

(Bendahmane et al., 2000). A. tumefaciens cells of GV3101 strain carrying HA-tagged Gr29D09

variants in pMD1 vector were used to infiltrate six-week-old N. benthamiana plants. HA tag was

used as negative control and GrCEP12 from G. rostochiensis was used as positive control. Two

days after the first infiltration, equal volumes of bacteria carrying R and Avr expression

constructs were mixed and infiltrated into the same sites of the first infiltration. Agroinfiltrated

leaves were monitored for visual programmed cell death (a.k.a. hypersensitive responses or HR)

phenotype up to 5 days after the last infiltration. Three independent repeats were performed for

each pair of R/Avr proteins.

3.3.7 Transient expression of Gr29D09 variants in wild potato accessions

Potato plants from different wild accessions were grown from lateral buds and placed in the

greenhouse under 16 light : 8 dark conditions. 3-4 week old plants were moved to the chamber

with controlled conditions (temperatures 20-25oC, humidity 35-50%, 16 : 8 light-dark cycle) at

56

one day before the infiltration. Agrobacteria strain C58C1-pCH32 carrying Gr29D09 variants

Gr29D09-V2, V3 and V4 in pMD1 vector were cultured on solid media with selective antibiotics

at 28oC for one day. The cells were collected, washed and resuspended in the 10mM MES buffer

(pH 5.5) to the final absorbance at 600 nm of 0.3 with added 200 uM acetosyringone. The cell

culture was incubated for 2 hours before being infiltrated into potato leaves. For each construct,

6 – 13 leaves were infiltrated in three independent repeats and programmed cell death phenotype

in infiltrated leaves were monitored until 5 – 7 days after infiltration.

3.3.8 Co-immunoprecipitation (Co-IP) assay

Transgenic potato lines overexpressing Gr29D09-GFP fusion proteins or GFP control were

propagated in propagation media with 100 ul/l timentin. 8-day-old plantlets were infected with

compatible G. rostochiensis juveniles at density of 200 J2s/plant. Nematode-infected roots were

collected at 8 dpi and snap-frozen in liquid nitrogen.

The protocol for the IP assay was adapted from Dr. Cilia (Boyce Thompson Institute for

Plant Research, Ithaca, NY) and optimized for potato root tissue. In brief, 1 g of root tissue

powder (obtained by grinding 2-3 g of frozen nematode-infected root tissue) was used to extract

total protein using 5 ml of freshly made extraction buffer (50 mM HEPES-KOH pH 7.5; 150

mM NaCl; 0.5% Triton X-100; 1% Tween 20; 1X Protease cocktail (Sigma Aldrich); 1X PMSF).

The lysate was incubated for 15 min on ice with occasional vortex, placed on a rotator for 30 min

at 4oC and centrifuged at 3000 rpm for 10 min at 4oC. Collected supernatant was incubated with

125 ul of prewashed anti-GFP mAb-magnetic beads (MBL International Corporation) for 1 hour

on the rotator at 4oC. The beads were washed five times with lysis buffer on magnetic separation

rack and immunoprecipitated proteins were obtained by boiling the washed beads for 3 min in

57

100 ul of 2x Laemmli sample buffer (Biorad). The samples were sent to Zhang lab (Cornell

Proteomics and Mass Spectrometry Facility, Ithaca, NY) for trypsin digestion and nano LC-

MS/MS analysis.

3.4 Results

3.4.1 Gr29D09-V1 and Gr29D09-V3 variants suppress P. fluorescens-induced callose

deposition in host root

Generally, the compromised basal defense is a result of the weakened PTI responses. It has been

recently shown that the calreticulin Mi-CRT effector from Meloidogyne incognita suppressed

callose deposition and defense marker gene expression induced by PAMP efl18, and the

GrCEP12 from G. rostochiensis suppressed ROS production and PTI marker gene expression

mediated by PAMP flg22 (Jaouannet et al., 2013; Chen et al., 2013). These examples provide

direct evidence for a role of nematode effectors in PTI suppression. Since Gr29D09

overexpression potato lines (V1-L16 and V3-L9) were shown to be compromised in basal

defense, we therefore assessed whether callose deposition, one of the typical PTI responses, was

suppressed in these lines after treatment with nonpathogenic bacteria Pseudomonas fluorescens.

P. fluorescens bacteria has been widely used to trigger PTI responses in plant leaves and was

shown in this study to also activate defense responses in potato roots (Chapter 4). Expectedly,

GFP overexpression control line showed approximately 10-fold increase of callose deposition in

the P. fluorescens-treated roots (relative to mock-treated roots). However, Gr29D09

overexpression potato lines showed a lower level of callose deposition induction (approximately

2-fold for line V1-16 and no significant change for line V3-L9) after P. fluorescens treatment,

indicating the suppression of P. fluorescens-triggered callose deposition in these lines (Figure

58

3.1). The similar trend was observed in three independent experiments. We conclude that

suppression of callose deposition is one of the mechanisms that underlies the increased

susceptibility to G. rostochiensis and S. scabies in Gr29D09 overexpression potato lines. This is

also the first direct evidence that Gr29D09 variants might show functional diversification in

basal defense suppression.

Figure 3.1 Gr29D09 variants Gr29D09-V1 and V3 suppress P. fluorescens-induced

callose deposition at varying degrees in host potato. Transgenic potato roots were infiltrated

for 5 min with cell suspension of P. fluorescens at OD600 of 1.5. Infiltrated roots were

collected after 72 hpi for callose deposition assay. Aniline blue stained root tissues were

observed under UV illumination and callose spots were counted using ImageJ software. The

bars represent the average numbers (from 12-14 roots) of callose depositions per 5 mm2 root

section at 1 cm from the root tip. Error bars represent standard errors. Bars annotated with an

asterisk indicate the significant difference to mock control (P<0.05, according to paired

Student t-test analysis). Similar results were obtained in 3 independent experiments.

59

3.4.2 Gr29D09 variants (V1-V4) suppress flg22-mediated PTI responses in N. benthamiana

PTI responses are considered to be conserved across plant kingdom (Zipfel, 2008). We therefore

investigated whether Gr29D09 variants also suppress PTI defense responses such as ROS

production and PTI marker gene expression in the heterologous plant system. Using

Agrobacterium-mediated transient expression assays, we first evaluated the ability of four

Gr29D09 variants to inhibit ROS production induced by PAMP flg22, a 22-amino-acid peptide

that is derived from flagellin and recognized by plant receptor FLS2 (Zipfel et al., 2004). All

four Gr29D09 variants suppressed flg22-induced ROS production but at varying suppression

degrees (Figure 3.2a). The varying degrees in ROS suppression by Gr29D09 variants were

confirmed in large scale experiment. Of the total 80 N. benthamiana plants from 10 independent

experiments, Gr29D09 variants V1, V2, V3 and V4 suppress flg22-induced ROS production in

9%, 54%, 82% and 31% of the plants, respectively (Figure 3.2b). Either within a single

experiment or as percentage from multiple experiments, we observed that the strongest

suppression of flg22-induced ROS production is associated with V3 expression. This is the

second direct evidence indicating that Gr29D09 variants might perform diversifying functions in

host tissues.

60

Figure 3.2 Gr29D09 variants suppress flg22-induced ROS production in N. benthamiana

Agrobacterium tumefaciens cells carrying expression constructs of Gr29D09 variants, the

empty vector (EV) control or positive control AvrPtoB were infiltrated into leaves of 8

different four-week-old N. benthamiana plants. Infiltrated leaf discs were collected at 48 h

post-agroinfiltration and assayed for ROS production as described (Segonzac et al., 2011). (A)

Flg-22 induced ROS production in a single experiment. Presented values are averages of

relative luminescence units (RLUs) ± standard errors of 18–24 leaf discs. (B) Protein

expression of Gr29D09 variants in N. benthamiana leaves at 48 h. (C) The percentage of

plants showing flg22-induced ROS suppression out of 80 N. benthamiana plants expressing

Gr29D09 variants. The difference in ROS suppression among Gr29D09 variants is statistically

significant (P<0.05).

PAMP perception in N. benthamiana also elicits the expression of defense-associated

genes such as NbPti5 and NbAcre31 (Nguyen et al. 2010). We therefore determined whether four

Gr29D09 variants also affect the expression of these two marker genes after flg22 treatment. In

61

N. benthamiana leaf tissue infiltrated with A. tumefaciens carrying EV construct, both

NbPti5 and NbACRE31 were induced by flg22 at expected levels. However, this induction of

these two marker genes was significantly reduced in N. benthamiana leaf tissues expressing

Gr29D09 variants (Figure 3.3). The same results were obtained in two independent biological

repeats.

Figure 3.3 Gr29D09 variants suppress flg22-induced expression of two PTI marker genes

in N. benthamiana. N. benthamiana leaf discs overexpressing Gr29D09 variants or the empty

vector (EV) were collected at 48 h post-agroinfiltration. mRNA was extracted from flg22 or

distilled H2O-treated leaf discs and quantitative RT-PCR was conducted to determine the

expression of NbPti5 and NbAcre31 genes in flg22-treated leaf discs, in relative to water-

treated leaf discs. All samples were normalized against the house-keeping gene NbEF1α.

Values are means ± standard errors of two independent experiments with three technical

replicates of each. Asterisks indicate statistically significant difference compared with the EV

control (P < 0.05; paired t-test).

62

3.4.3 Gr29D09 variants selectively suppress resistance gene–mediated programmed cell

death

Examples of nematode effectors with a role in suppressing ETI are rare. To date, effectors in the

SPRYSEC family, GrCEP12, and GrEXPB2 from G. rostochiensis are among the few nematode

effectors that suppress ETI- associated programmed cell death (Postma et al., 2012; Ali et al.,

2015ab; Chronis et al., 2013). To evaluate the possibility of Gr29D09-mediated suppression of

ETI-associated hypersensitive cell death response (also called hypersensitive response or HR), 4

pair of resistance-avirulence effector genes from different pathogen groups were co-expressed

with Gr29D09 variants in N. benthamiana leaves. In all cases, coexpression of the R gene and its

cognate effector gene following the expression of HA tag control triggered strong HR phenotype

in most infiltration sites at 5 dpi. However, the HR phenotype triggered by two potato resistant

genes (R3a against late blight and Gpa2 against potato cyst nematode G. pallida) was selectively

suppressed in most infiltration sites expressing Gr29D09 variants (Figure 3.5). Interestingly,

Gr29D09 variants also showed different degrees of ETI suppression. PTI and ETI appear to

share downstream signaling machinery (Tsuda and Katagiri, 2010). Given that Gr29D09

members suppress both PTI and ETI responses, it is possible that Gr29D09 members target

shared components in the downstream signaling pathways of PTI and ETI.

63

Figure 3.5 Gr29D09 effectors suppress cell death triggered by potato resistance genes

R3a and Gpa2 in N. benthamiana. Agrobacterium cells carrying expression constructs of

Gr29D09 variants were infiltrated into N. benthamiana leaves, followed by a second

infiltration in the same sites (after 48 h) with Agrobacterium cells carrying R3a and Avr3a or

Gpa2 and RBP-1 expression constructs. The HA tag (EV) and GrCEP12 from G. rostochiensis

(Chronis et al., 2013) were used as negative and positive controls. The sites showing

hypersensitive response (HR) phenotype were scored, and photographs were taken at 5 days

after the last infiltration. Data represent the number of infiltration sites showing HR

suppression phenotype out of the total infiltration sites from three independent experiments.

The statistically differences in HR suppression are denoted by different letters, as determined

by paired Student t tests (P < 0.05).

3.4.4 Gr29D09-V3 and Gr29D09-V4 induced hypersensitive response in leaves of wild

potato species

For over 100 years, primitive potato cultivars and wild potato species have been used in breeding

programs as the natural genetic resource for disease (including nematode) resistance (Hawkes,

64

1958). For instance, nematode resistance genes have been transferred to cultivated potato

cultivars from multiple wild potato species such as S. tuberosum ssp. andigena, S. andigena, S.

vernei, S. spegazzini and S. tuberosum ssp. tuberosum (reviewed by Tomczak et al., 2009). The

ability of Gr29D09 family members in host immunity suppression may predispose them to being

recognized by the host immune system, as a reflection of the incessant coevolutionary arms race

between plants and pathogens. Furthermore, sequence diversification in Gr29D09 family is a

characteristic often possessed by pathogen Avr genes (Dodds et al., 2004; Allen et al., 2004).

Therefore, we investigated whether Gr29D09 effectors may function as avirulence proteins.

Agrobacterium-mediated expression assay was used to transiently express individual Gr29D09

genes in leaves of wild potato species to screen for a hypersensitive response (HR) phenotype in

a collection of 40 wild potato accessions. Wild potato accessions were requested from United

States Potato Genebank (www.ars-grin.gov/nr6/) and showed different degrees of PCN

resistance. Our results showed that Gr29D09-V3 and Gr29D09-V4 transient expression triggered

HR phenotype in leaves of two wild potato species (Solunum berthaultii and S. kurtzianum) and

a potato cultivar ‘Kennebec’, indicating that the two variants may function as avirulence proteins

for the yet-to-identified R proteins in these potato species (Table 3.3).

Table 3.3 Hypersensitive response triggered by Gr29D09 variants in the leaves of wild potato

accessions using the Agrobacterium-mediated expression assay.

Accession

No Species (PI) Origin 2n

No of leaves showing HR out of total

infiltrated leaves

GFP Variant 2 Variant 3 Variant 4

PI 265858 Solanum berthaultii Bolivia 24 4/10 6/12 11/11* 10/11*

PI 498357 Solanum kurtzianum Argentina 24 3/11 5/11 10/12* 10/12*

Kennebec Solanum tuberosum United States 48 4/13 7/13 13/13* 8/13

* indicates statistical significance (p<0.05)

65

3.4.5 Co-immunoprecipitation (CoIP) assay resulted in the identification of putative

Gr29D09-interacting proteins in potato host

In order to identify virulence targets of Gr29D09 variants in potato host, co-immunoprecipitation

(IP) assay was performed using nematode-infected transgenic potato lines overexpressing

Gr29D09-GFP fusion proteins. Evidence indicates that Gr29D09 family showed functional

diversification and that the family might evolve to expand their host targets. We therefore

performed the co-immunoprecipitation assay for two different Gr29D09 variants Gr29D09-V1

and Gr29D09-V3 and hypothesized that these two variants might have different host targets.

Western blot showed a successful immunoprecipitation of GFP-tagged V1, GFP-tagged V3 and

GFP alone by anti-GFP mAb-magnetic beads (Supplementary figure 3.1). The co-

immunoprecipitated proteins were identified by nano LC-MS/MS analysis, in conjugation with

database searching against the predicted protein database of potato.

The MS results showed the enrichment of V1, V3 variants and GFP peptides in the

respective samples, again validating the precipitation of these proteins in the IP samples. The

numbers of co-immunoprecipitated proteins identified in each sample are shown in the table 3.4.

The candidate Gr29D09-interacting proteins are those that are present in Gr29D09-V1 or

Gr29D09-V3 sample in at least one repeat, but not in any repeats of GFP control sample. 51

identified proteins (9 proteins co-immunoprecipitated with both Gr29D09-V1 and Gr29D09-V3,

9 proteins co-immunoprecipitated with Gr29D09-V1 and 33 proteins co-immunoprecipitated

with Gr29D09-V3) are listed in Supplementary table 3.1. The proteins that were identified in at

least 3 independent experiments would be our strong Gr29D09-interacting candidates in the

potato host. Based on those criteria, three proteins were identified as the most likely host targets

of Gr29D09. Hexokinase 1 and heat shock protein 90 (HSP90) were co-immunoprecipitated with

66

Gr29D09-V1 and Gr29D09-V3 in 5 total independent repeats, and a homologue of late blight

resistance protein R1A was co-immunoprecipitated with Gr29D09-V3 in three independent

repeats. These proteins were also carefully checked for predicted or reported subcellular

localization to ensure their potential colocalization with Gr29D09 variants which were shown to

localize in cytoplasms when being overexpressed in N. benthamiana leaves (Supplementary

figure 3.2). The other co-immunoprecipitated proteins (especially those that identified in two

repeats) could also be potential Gr29D09-interacting proteins but will not be discussed in detail.

Table 3.4 Number of co-immunoprecipitated proteins in the co-immunoprecipitation assay.

Number of identified proteins

Repeat 1 Repeat 2 Repeat 3

GFP 72 87 105

Gr29D09-V1-GFP 72 93 144

Gr29D09-V3-GFP 121 112 168

Hexokinase, which catalyzes the phosphorylation of hexoses, is a major enzyme in sugar

metabolism and a conserved sugar-sensing component in plants and animals (Rolland and Sheen,

2005). It has been demonstrated that mitochondria-associated Hexokinase negatively regulates

programmed cell death in animals (Hexikinase 1 and 2) (Pastorino et al., 2002; Downward,

2003; Birnbaum, 2004; Majewsky et al, 2004), and in plants (Hexokinase 1) (Kim et al., 2006).

Virus-induced gene silencing of N. benthamiana Hexokinase 1 induced programmed cell death

in the leaves (Kim et al., 2006). In addition, expression of Hexokinase 1 in N. benthamiana is

induced in response to non-host pathogen but not by adapted pathogen (Sarowar et al., 2008).

Notably, overexpression of Hexokinase 1 and 2 in Arabidopsis resulted in elevated ROS and

defense gene expression, and hence enhanced resistance to pathogens (Sarowar et al., 2008).

67

Hexokinase 1 therefore appears to play critical role in plant defense and Gr29D09 might interfere

with this protein to manipulate host defense.

Heat shock proteins (HSP) generally function as molecular chaperones that involve in

regulating protein folding and trafficking (Schulze-Lefert, 2004). Cytoplasmic HSP90 has been

shown to be required for pathogen resistance induced by various resistance genes, including

nematode resistant gene Mi-1 in tomato (Hubert et al., 2003; Liu et al., 2004; Bhattarai et al.,

2007). Interestingly, it has been recently demonstrated that HSP90 inhibition impaired

mitochondrial Hexokinase II activity (Chae et al., 2013; Zaromytidou et al., 2012). For the

mentioned reasons, HSP90 is another important Gr29D09-interacting candidate for its

involvement in plant defense and its possible association with Hexokinase 1.

Gr29D09 appeared to show functional diversification and we expectedly identified the

proteins that uniquely co-immunoprecipitated with Gr29D09-V1 and Gr29D09-V3. Interestingly,

homologue of R1A resistance protein, one of three strong Gr29D09-interacting candidates, was

repeatedly identified in the proteins co-immunoprecipitated with Gr29D09-V3. R1A resistance

gene confers resistance to potato late blight and is a member of a gene family (Ballvora et al.,

2002). Given that the potato cultivar used for the CoIP assay is susceptible to nematode

infection, the physical interaction between V3 and this homologue of R1A needs to be confirmed

to elucidate the role of this interaction in host defense against nematode.

3.5 Discussion

To successfully parasite host plants, sedentary endoparasitic nematodes exploit their secreted

effectors to degrade or modify host cell walls, reprogram host cell development and metabolism,

and suppress host defense. It has been recently reported that various G. rostochiensis effectors

such as members of GrSPRYSEC family, GrUBCEP12, and GrEXPB2 suppress PTI and/or ETI

68

(Postma et al., 2012; Chronis et al., 2013; Chen et al., 2013; Ali et al., 2015ab). All the four

Gr29D09 variants we have characterized were able to suppress PTI and ETI responses to varying

degrees (Supplementary table 3.2). The Gr29D09 family was determined in Chapter 2 to play a

critical role in nematode parasitism though compromising basal defense. We therefore conclude

that Gr29D09 variants suppress host immunity to facilitate nematode parasitism and that host

defense suppression may be one of the core functions of Gr29D09 members. The suppression of

host plant immunity appeared to be common in pathogen effectors. The majority of tested

candidate effectors from Phyphtopthora sojae (Wang et al., 2011) and Hyaloperonospora

arabidopsidis (Fabro et al., 2011) suppressed host immunity. Similarly, majority of 36 effectors

from P. syringae pv tomato strain DC3000 have also been reported to suppress plant immunity

(Guo et al., 2009).

Although signatures of positive selection were detected in Gr29D09 sequences, the

mechanism underlying the sequence diversification of Gr29D09 effector family is not clear.

However, functional diversification of four Gr29D09 variants in host immunity suppression

indicates that Gr29D09 may evolve to target different host proteins and may contribute

differently to nematode virulence. For instance, Gr29D09-V3, which often suppresses plant

immunity stronger than other Gr29D09 variants in our assays appeared to be more frequently

found in G. rostochiensis RO2 population. This indicates that Gr29D09-V3 might be more

important in assisting nematodes in parasitizing H1-mediated resistant potato. Functional

diversification was evident in the largest effector family SPRYSEC in the genus Globodera.

Members of this family show extensive sequence diversity and function as immunity activators

(GpRBP1 from G. pallida, GrSPRYSEC-15 from G. rostochiensis) or suppressors

(GrSPRYSEC- 4, 5, 8, 15, 18, 19 from G. rostochiensis) (Postma et al., 2012; Ali et al., 2015ab).

69

The G. pallida polymorphic RBP-1 effector of this family has evolved under diversifying

selection, resulting in variants with varying recognition specificity by the potato resistance

protein Gpa2 (Sacco et al., 2009; Carpentier et al., 2011). Furthermore, members of G.

rostochiensis SPRYSEC family also showed functional diversification in host immunity

suppression (Ali et al., 2015b). Therefore, it was proposed that Globodera-specific SPRYSEC

family might expand to adapt to functional diversifications in host virulence targets and/or plant

immune receptors (Postma et al., 2012). Additionally, functional diversifications have been

widely reported in many eukaryotic pathogen effectors, mostly in avirulence proteins. For

instance, RXLR effector ATR13 from Hyaloperonospora arabidopsidis (Allen et al., 2004,

2008; Hall et al., 2009), Avr567 from flax rust Melampsora lini (Dodds et al., 2004, 2006),

PiAVR2, Avrblb2 and Avr3a from late blight Phytopthora infestans (Champouret, 2010,

Kamoun et al., 2012; Oliva et al., 2015) have been demonstrated to undergo diversifying

selection, resulting in the evolution of effector variants that could alter recognition specificity by

cognate resistance proteins.

It was proposed in Chapter 2 that G29D09 members possess characteristic of avirulence

proteins. In this chapter, we report that Gr29D09 variants suppress plant immunity with some

level of functional diversification. Many avirulence proteins that elicit effector-triggered

immunity are able to suppress host immunity in compatible interactions to enhance pathogen

virulence (van der Hoorn and Kamoun, 2008; Collier and Moffett, 2009; Hein et al., 2009).

These effectors, maybe in the attempt to manipulate host defense, might set off host immune

responses triggered by resistance proteins. Therefore, it was proposed that those effectors that

suppress host defense might be targets of host immune system (Ali et al., 2015). From a screen

of 40 wild potato accessions the majority of which were reported to have different levels of

70

potato cyst nematode resistance, Gr29D09-V3 and Gr29D09-V4 induced hypersensitive response

in leaves of two wild potato species Solanum berthaultii and S. kurtzianum and appear to

function as avirulence proteins for yet-to-identified R proteins in these potato species. In

addition, Gr29D09-V3 also triggered cell death in potato cultivar ‘Kennebec’ of S. tuberosum

species. Gr29D09-V3 differs other Gr29D09 variants in this study in that it occurs at higher

frequency in RO2 population and often showed stronger suppression of host defense responses.

Notably, Gr29D09-V4 sequence is more similar to V3 than to the sequence of other variants.

Since unambiguous PCN resistance data are not available for these three accessions, nematode

infection assays using different G. rostochiensis populations need to be performed to investigate

whether these potato accessions might harbor nematode resistance genes. Despite of a lack of

information about nematode resistance genes in these accessions, our data suggest that effector

proteins could be exploited to mine natural genetic resources for potato cyst nematode resistance.

In modern resistance breeding, breeders have adopted emerging effector-based strategies and

techniques to accelerate the identification, characterization and deployment of resistance genes,

especially in the potato-P. infestans pathosystem (Vleeshouwers et al., 2014; Vleeshouwers et al.

2011; Hein et al. 2009). Primitive potato cultivars and their wild relatives possess plenty of

unique and diverse genetic variations, which have been used as a major source of disease

resistance for potato breeding (Machida-Hirano, 2015). To date, 14 PCN resistance gene loci

have been mapped to different linkage groups in potato (Finkers-Tomczak et al., 2011) and only

2 of them (Gpa2, Gro1) were cloned (Van der Vossen et al., 2000; Paal et al., 2004). Therefore,

Agrobacterium-mediated expression assay using G. rostochiensis effectors would be a robust

tool to mine natural resistance resources in wild potato species. The obtained hypersensitive

71

response profile would contribute not only to understanding effector functions but also to the

cloning and characterization of novel PCN resistance genes.

There have been only a few reports of host targets of nematode effectors. Based on the

identified host interacting proteins, these effectors were demonstrated to be involved in various

cellular processes such as transcriptional programming (Huang et al., 2006), cell wall

modification (Hewezi et al., 2008), redox regulation (Patel et al., 2010), auxin signaling (Lee et

al., 2012; Hewezi et al., 2015), and plant defense (Rehman et al., 2009b, Lozano-Torres et al.,

2012; Hamamouch et al., 2012). In order to identify Gr29D09-interacting proteins in the potato

host, we did establish a CoIP assay directly on root tissues of potato plants overexpressing

Gr29D09-GFP fusion proteins. GFP tag has been efficiently used to identify putative interacting

proteins in animals and plants (Cristea et al., 2005, Weis et al., 2013). Our assay, aimed at

identifying putative nematode effector-interacting proteins in the hosts, has advantages over the

widely used yeast-2-hybrid method because it utilized nematode-infected host roots, hence the

local enrichment of host proteins involved in nematode parasitism could increase the efficacy

and power of the assay. Using this method, two proteins Hexokinase 1 and heat shock protein 90

were identified as the most likely host targets of Gr29D09-V1 and Gr29D09-V3 with regard to

their potential roles in host defense. Although HSP90 has been shown to be required for

pathogen resistance induced by various resistance genes, this protein appears to have universal

roles in multiple cellular processes as a molecular chaperone. Therefore, its specific role in

nematode parasitism is unclear. Interestingly, HSP90 is also required for Hexokinase II activity

in animals (Chae et al., 2013; Zaromytidou et al., 2012), indicating a possible association

between Hexokinase 1 and HSP90 in plant cells. Therefore, one could predict that HSP90 might

be indirectly immunoprecipitated with Gr29D09 variants via Hexokinase 1. Alternatively,

72

HSP90 might interact with an immune signaling component that Gr29D09 may indirectly impair

via interacting with HSP90. The interactions between Gr29D09-V3 and Gr29D09-V4 and these

putative host interactors need to be further confirmed by CoIP and/or BiFC (Bimolecular

Fluorescence Complementation). In addition, similar approach should be applied to identify the

interacting proteins in potato host of Gr29D09-V2 and Gr29D09-V4 to understand the host target

range of Gr29D09 effector family.

The identification of Hexokinase 1 as a putative Gr29D09 host target is reminiscent of

the importance of sugar metabolism in nematode parasitism. The formation of nematode feeding

sites involves extensive morphological and functional changes in the selected cells in host

tissues. This dramatic cell alterations, coupled with high nutrient and energy demand of the

feeding nematodes, suggest considerable changes in plant primary metabolism pathways in

nematode feeding sites (Hofmann et al., 2010). Indeed, various transcriptomic and metabolomic

studies showed changes in the expression of genes involved in primary metabolism and the

increased accumulation of primary metabolites in nematode-infected roots or syncytia (Puthoff et

al., 2003; Alkharouf et al., 2006; Ithal et al., 2007; Szakasits et al., 2009; Hofmann et al., 2010).

Notably, many key enzymes that involve sugar transportation and metabolism have been found

in abundance in cyst nematode-infected roots or in syncytia. In H. schachtii-induced syncytia in

A. thaliana, 40 out of 90 sugar transporter genes showed differential expression (Hofmann et al.,

2009). Among those, one hexose transporter and two sucrose transporters were strongly

upregulated. Furthermore, elevated expression of sugar-related genes were also found in H.

glycines-infected soybean roots, including glyceraldehyde 3-phosphate dehydrogenase, fructose-

bisphosphate aldolase, sucrose synthase and sucrose transport proteins (Alkharouf et al., 2006).

Moreover, metabolite analyses showed increased accumulation of specific sugars such as 1-

73

ketose, raffinose and ,-trehalose in H. schachtii –induced syncytia in A. thaliana (Betka et al.,

1991, Hofmann et al., 2007; 2009; Hofmann et al., 2010). The mentioned evidence suggests that

active sugar transport and increased sugar metabolism occur in nematode-induced syncytia.

It has been proposed that plants could activate the defense by sensing the shift in sugar

level at pathogen colonization sites and the use of sucrose or sucrose-like compounds have been

reported to trigger resistance responses to pathogens (Solfanelli et al., 2006; Thibaud et al.,

2004; Gómez-Ariza, 2007). Although the molecular mechanisms underlying sugar perception

and signaling in plants are still unclear and so are their roles in plant-nematode interactions,

hexokinase has been identified as a conserved sugar signaling component that controls not only

energy homeostasis but also stress resistance, survival and longevity (Bolouri-Moghaddam et al.,

2010). In plant cells, it was suggested that glucose metabolism and programmed cell death might

be linked via mitochondria membrane-associated hexokinases (Kim et al., 2006). It is very likely

that sugar sensing also activates plant defense responses in the syncytia induced by potato cyst

nematodes and that Gr29D09 variants might interfere with hexokinase to manipulate plant

defense responses.

The third putative Gr29D09-interacting protein is a homologue of the late blight

resistance protein R1A that was coimmunoprecipitated with Gr29D09-V3, but not Gr29D09-V1.

The ability of Gr29D09 effectors to suppress host immunity might make them vulnerable to host

immune system and the diversifying selection found in the Gr29D09 effector family might

indicate that this effector family has undergone rapid change to avoid recognition by host

resistance proteins. There are only few examples of plant resistance proteins that directly

interact with their cognate avirulence effectors from pathogens (Jia et al., 2000; Deslandes et al.,

2003; Ellis et al., 2008; Krasileva et al., 2010; Tasset et al., 2010; Chen et al., 2012). Among

74

those, only three resistance proteins showed a physical interaction with the effector in planta

(Krasileva et al., 2010; Tasset et al., 2010; Chen et al., 2012). G. rostochiensis GrSPRYSEC-19

physically interacts with product of an assumedly inactive resistance gene (SW5F) from a

nematode susceptible tomato cultivar and their association does not activate programmed cell

death or nematode resistance (Postma et al., 2012). It was therefore hypothesized that SW5F

might be a gene duplicate of the paralogous functional resistance protein against G.

rostochiensis. Given that homologue of R1A was also identified in a nematode susceptible potato

cultivar, this similar circumstance might be expected if physical interaction between R1A

homologue and Gr29D09-V3 could be validated. In fact, R1 gene is located on potato

chromosome V and on a resistance hot spot that includes major QTL (Quantitative trait loci) for

resistance to potato cyst nematode G. pallida (Bollvora et al., 2002).

75

Supplementary Figure 3.1 The immunoprecipitation of GFP, GFP-tagged Gr29D09-V1 and

GFP-tagged Gr29D09-V3 using anti-GFP mAb-magnetic beads.

Supplementary Figure 3.2 Subcellular localization of Gr29D09-V1 in N. benthamiana leaves

Gr29D09-V1-Gus-GFP fusion protein was being overexpressed in N. benthamiana leaves

using Agrobacteria and GFP signal was observed in the cytoplasm of the transformed cells.

76

Supplementary Table 3.2 Proteins that co-immunoprecipitated with Gr29D09-V1 and Gr29D09-V3.

Protein description

Accession

Number

No of

repeats

Mascot ion

score

(Average)

Predicted metabolism pathway

V1 and V3

1 Calcium-dependent protein kinase 1::gi|10568116 2 14.5 Tuberization

2 Ripening regulated protein DDTFR10-like 1::gi|78191406 2 19 Tuberization

3 Hexokinase 1 1::gi|3087888 5 79.4 Sugar metabolism

4 Sucrose synthase 1::gi|169572 2 46.5 Sugar metabolism

5 Heat shock protein 90 1::gi|829236 5 71.4 Chaperone

6 Cytochrome c1-2 1::gi|231924 2 48 Oxydation-reduction

7 Putative 40S ribosomal protein S8-like 1::gi|82400150 2 33.5 Translation

8 Putative polyprotein 1::gi|54261821 2 25

9 Unknown protein 1::gi|78191408

V1

1 Urease accessory protein G 1::gi|13161908 2 15 Nitrogen compound metabolism

2 Impaired sucrose induction 1-like protein 1::gi|55956221 1 17 Sugar metabolism

3 Cellulose synthase 1::gi|33186649 1 14 Cellulose metabolism

4 Lipoxygenase 1::gi|1407701 1 18 Lipid metabolism

5 Chloroplast chlorophyll a oxygenase 1::gi|90658396 1 15 Oxydation-reduction

6 1-aminocyclopropane-1-carboxylate oxidase 1::gi|14573463 1 15 Oxydation-reduction

7 Catalase 1::gi|1009704 1 585 Defense

8 Respiratory burst oxidase protein F 1::gi|18389310 1 17 Defense

9 Unnamed protein product 1::gi|62816961 1 15

V3

1 Patatin protein 03 1::gi|84316395 1 15 Tuberization

2 Putative 24 kDa seed maturation protein-like

protein 1::gi|83284001 1 18 Tuberization

77

3 Homolog of the late blight resistance

protein R1A 1::gi|53854474 3 19 Defense

4 Cytokinin oxidase/dehydrogenase 1::gi|227809538 1 16 Defense

5 Annexin p34 1::gi|8247363 1 16 Defense

6 Erg-1 1::gi|31074969 2 50 Defense

7 Hydroxycinnamoyl-CoA quinate-like protein 1::gi|76573303 1 16 Defense

8 Aspartic proteinase inhibitor 1::gi|21413 1 45 Defense

9 Osmotin 81 1::gi|30145493 1 54 Defense

10 Phosphatidylserine decarboxylase 1::gi|224613152 1 21 Lipid metabolism

11 Beta-fructofuranosidase 1::gi|397631 1 41 Sugar transport

12 Hexokinase 2 1::gi|6492118 1 88 Sugar metabolism

13 Glucose-6-phosphate/phosphate-translocator

precursor 1::gi|2997593 2 55.5 Sugar metabolism

14 Cysteine synthase 1::gi|3290020 1 35 Amino acid synthesis

15 Histone deacetylase-like protein-like 1::gi|81074911 1 16 Chromatin modification

16 Histone deacetylase 2a-like 1::gi|81074563 1 36 Chromatin modification

17 Nuclear RNA binding protein 1::gi|257215078 1 18 Post transcriptional control

18 Rieske iron-sulfur protein-like 1::gi|77416965 1 23 Cell respiration (Mitochondria)

19 ATP synthase 6 kDa subunit, mitochondrial 1::gi|1352054 1 20 Cell respiration (Mitochondria)

20 NADH-ubiquinone oxidoreductase 29 kDa

subunit 1::gi|464269 1 40 Cell respiration (Mitochondria)

21 NADH-ubiquinone oxidoreductase 27 kDa

subunit 1::gi|38605724 1 126 Cell respiration (Mitochondria)

22 NADH dehydrogenase 1::gi|505273 1 57 Cell respiration (Mitochondria)

23 Ubiquinol--cytochrome c reductase 1::gi|633685 1 53 Cell respiration (Mitochondria)

24 Ubiquinol--cytochrome c reductase 1::gi|633687 1 62 Cell respiration (Mitochondria)

25 Putative glycine degradation

aminomethyltransferase 1::gi|115260390 1 16 Glycine catabolism (Mitochondria)

26 Pectin methyl esterase 1::gi|6689892 1 47 Cell wall modification

27 Ly200-like protein 1::gi|76161016 2 49.5 Translation/Methyltransferase

78

28 Putative reductase 1::gi|18071341 1 20 Oxidation-Reduction

29 Putative ribosomal protein s19 or s24 1::gi|12322851 1 18 Translation

30 Putative protein 1::gi|5051787 1 14

31 Putative protein 1::gi|5051787 2 29.5

32 Unknown 1::gi|76573355 1 62

33 Unknown 1::gi|77416949 1 71

79

Supplementary Table 3.3 Summary of PTI and ETI suppression phenotypes that are

associated with Gr29D09 variants.

Gr29D09

variants

PTI assays

ETI assays

Host potato assays N. benthamiana

assays

Susceptibility

to G.

rostochiensis

infection

Susceptib

-ility to

S. scabies

infection

Callose

deposition

suppression

ROS

suppression

PTI

markers R3a Gpa2

V1 + + + + + ++ ++

V2 nt nt nt +++ + - +

V3 + + ++ ++++ + ++ ++

V4 nt nt nt ++ + + +

Suppression degrees (+, ++, +++, ++++) were evaluated among variants within the same

assay; (nt): not tested

80

CHAPTER 4

The defense responses activated by PAMPs and nonpathogenic bacteria in potato and

tomato roots and the potential suppression of PTI responses by nematode secreted effectors

4. 1 Abstract

Basal defense responses to pathogen-associated molecular patterns (PAMPs) and root

colonizers have been recently reported in Arabidopsis roots. However, little is known about these

responses in the roots of important solanaceous crops such as potato and tomato. Here, we

provided direct evidence that two flagellin peptides flg22 and flgII-28 as well as two

nonpathogenic bacteria Pseudomonas fluorescens strain 0-1 and P. syringae pv. tomato DC3000

hrcU could trigger the expression of various defense-related genes and/or callose deposition

specifically in the roots of potato and tomato. Results further showed that potato and tomato

exhibited some level of differences in their defense responses to the four kinds of PTI inducers

tested. Meanwhile, flg22-mediated defense responses including defense gene expression and

callose deposition in Arabidopsis roots were also observed in our experimental conditions.

Effectors GrCEP12 and 10A06 produced from G. rostochiesis and H. schachtii, respectively,

have been indicated to be PTI suppressors. Upon treatment with flg22 or the two nonpathogenic

bacteria, we found that the induction of defense gene expression and callose deposition was

suppressed in roots of transgenic lines overexpressing GrCEP12 or 10A06, confirming a role of

these effectors as PTI suppressors. Taken together, our developed PTI assays in potato and

tomato roots represent a valuable tool in the study of a role of nematode-secreted effectors in

defense suppression.

81

4.2 Introduction

Understanding the mechanisms of how plant basal defense is triggered and manipulated by

pathogens is the key for breeding crops with broad-spectrum resistance. In the past decade,

valuable insights into the plant’s two-layered immune system were mostly gained from assays

performed in the leaves of model plants Arabidopsis thaliana, Nicotiana benthamiana, and

occasionally in the leaves of important crop plants (Lloyd et al., 2014). However, basal defense

has been rarely studied in the roots of both model and crop plants. The first layer of plant

immune system (pattern-triggered immunity or PTI) is activated by the early perception of

conserved pathogen-associated molecular patterns (PAMPs) and damage-associated molecular

patterns (DAMPs) by pattern recognition receptors (PRRs) (Jones and Dangl, 2006). The

recognition of these patterns leads to the activation of multiple defense responses including MAP

kinase cascades, the biosynthesis of hormones, the activation of defense-related genes, the

production of reactive oxygen species and the deposition of callose (Boller and Felix, 2009;

Segonzac and Zipfel, 2011). All of these defense responses contribute to the inhibition of the

pathogen growth. To be able to colonize the hosts, successful pathogens have to overcome these

first defense barriers by evolving to minimize PTI and secreting PTI-suppressing effectors (Jones

and Dangl, 2006; Cai et al., 2010).

Plant roots are constantly exposed to diverse soil microflora, either beneficial as in the

case of mycorrhizal fungi, N2-fixing bacteria and plant growth-promoting rhizobacteria; or

detrimental as in case of soil-borne pathogens including bacteria, oomycetes, fungi and

nematodes (Millet et al., 2010). As other plant parts, roots presumably have to selectively defend

against the attacks of the pathogens (Baetz and Martinoia, 2014). In the literature, there are only

a few examples of PAMP-triggered responses in plant roots, possibly because roots are less

82

accessible than other plant parts. Millet et al. (2010) reported that Arabidopsis roots recognized

common PAMPs including flg22, peptidoglycan and chitin and activate defense-related genes

and callose deposition. Likewise, Lakshmana et al. (2012) reported similar root defense

responses upon Arabidopsis shoot treatment by flg22, elf18 and chitin. Another example is the

perception of the fungus Megnaporthe oryzae by the Arabidopsis roots leading to the induction

of basal defense related genes (Marcel et al., 2010). Although potato and tomato are two

economically important crops and are exposed to numerous damaging soil-borne pathogens

including plant parasitic nematodes, little is known about PAMP-triggered defense responses in

the roots of these crops. Flagellar peptides flg22 and flgII-28, P. fluorescens and P. syringae

mutant defective in type III secretion system have been shown to activate PTI responses in

tomato leaves (Veluchamy et al., 2014; Nguyen et al., 2010). P. fluorescens is known as a root

colonizer that is able to promote plant growth and induce systemic resistance. Although P.

syringae is well known as a leaf pathogen, it is also shown to colonize plant roots (Bais et al.,

2004), including tobacco (Nicotiana tabacum) and potato (Solanum tuberosum) (Knoche et al.,

1994; Andreote et al., 2009). Taken together, the findings discussed above suggest the potential

use of flagellar peptides and bacteria in the investigation of basal defense in potato and tomato

roots.

Increasing number of effectors from plant-parasitic nematodes have been demonstrated to

be able to directly or indirectly suppress basal defense responses (Hewezi et al., 2010;

Hamamouch et al., 2012; Lozano Torres et al., 2014; Chronis et al., 2013; Chen et al., 2013;

Jaouannet et al., 2013; Ali et al. 2015ab). However, the roles in host basal defense suppression of

nematode effectors has often been demonstrated using whole Arabidopsis thaliana plants,

Arabidopsis or Nicotiana benthamiana leaves (Table 4.1), whereas nematodes actually penetrate

83

and develop successful parasitism in the host roots. Although PTI appears to be conserved across

plant species, their response spectra might vary across different plant species and plant tissues.

Therefore, there is a need for robust immunity assays in the roots, especially of important host

crops, to study plant-nematode interactions.

Table 4.1 Plant parasitic effectors with roles in suppressing plant basal defense responses

Plant parasitic

nematodes Effectors

Plant parts showed effector

interference with basal defense References

Heterodera schachtii

(Beet cyst nematode) Hs10A06

Whole Arabidopsis plants

-10A06 compromises Arabidopsis

basal defense and suppress defense

gene expression

Hewezi et al., 2010

Meloidogyne

incognita

(Root knot nematode)

Mi-CRT

Whole Arabidopsis plants

-Mi-CRT suppresses elf18-

mediated defense gene expression

and callose deposition

Jaouannet et al.,

2013

Globodera

rostochiensis and H.

schachtii

VAP1

Arabidopsis leaves

VAP1 enhances Arabidopsis

susceptibility to fungal and

oomycete pathogens

Lozano Torres et

al., 2014

G. rostochiensis

GrCEP12

N. benthamiana leaves

GrCEP12 suppresses flg22-induced

ROS production and PTI marker

gene expression

Chronis et al., 2013

Chen et al., 2013

G. rostochiensis

GrEXPB2

GrSKP1

N. benthamiana and N. tabacum

leaves

GrEXPB2 and GrSKP1 suppress P.

sojae elicitor PiNPP-associated cell

death

Ali et al., 2015a

G. rostochiensis

SPRYSEC

gene

members

N. benthamiana and N. tabacum

leaves

GrSPRYSEC family members

suppress P. sojae elicitor PiNPP-

associated cell death

Ali et al., 2015b

In this study, we first investigated the activation of marker genes and callose deposition

in the roots of potato and tomato using two flagellar peptides flg22 and flgII-28, P. fluorescens

strain 0-1 and P. syringae strain DC3000 hrcU. Moreover, we also tested flg22-mediated

84

defense responses in Arabidopsis roots using our immunity assays. Finally, we tested whether

the induced defense responses could be suppressed by two nematode-secreted effectors

GrCEP12 from G. rostochiensis (Chronis et al., 2013) and Hs10A06 from Heterodera schachtii

(Hewezi et al., 2010) with a characterized role in basal defense suppression.

4.3 Materials and Methods

4.3.1 Plant growth conditions

In all cases, plants were grown in the growth chamber at 22oC under 16 h of light and 8-day old

plantlets were used for the root assays. Young shoots of GrCEP12 or GFP overexpression potato

plants in the Desiree cultivar background were cut and cultured in 100mm x 15mm petri dishes

containing propagation media with added selective antibiotics (4.3 g/l Murashige and Skoog

salts, 170 mg/l Na2HPO4.H2O, 100 mg/l inositol, 0.4 mg/l Thiamine HCl, 3% sucrose, 2.5 g/l

gelrite, 50 µg/ml kanamycin, 100 µg/ml timentin, pH 6.0) at a density of 20 shoots per plate.

Tomato seeds of Money Maker cultivar were sterilized in 50% bleach, washed three times with

sterile water, and germinated in petri dishes containing ½ Murashige and Skoog basal medium

(2.15 g/l Murashige and Skoog salts, 0.2% sucrose, 10g/l agar, pH=5.7) at a density of 20-25

seeds/plate. The seeds of the Arabidopsis thaliana ecotype Columbia (Col-0) or homozygous

transgenic Arabidopsis overexpressing nematode effectors were sterilized in 20% bleach, washed

3 times with sterile water and germinated in petri dishes containing solid ½ Murashige and

Skoog basal medium at a density of approximately 100 seedlings per plate.

85

4.3.2 Flg22, flgII-28 peptides and bacterial strains

The flg22 peptide (TRLSSGLKINSAKDDAAGLQIA) and the flgII-28T1 peptide

(ESTNILQRMRELAVQSRNDSNSSTDRD) were synthesized by GenScript (purity 95%).

The peptides were dissolved in sterile water and used at the concentration of 10 µM for potato

and tomato roots, and 1 µM for Arabidopsis roots. Pseudomonas fluorescens strain 0-1 and

Pseudomonas syringae strain DC3000 hrcU were cultured on KB medium supplemented with

100 µg/mL ampicillin and 25 µg/mL rifampicin, respectively. To prepare bacterial inoculum for

the root infection, bacteria were grown for 1 day at 30oC. Bacteria were collected from the media

surface, washed and suspended into MgCl2 10mM to a final OD600 of 1.5.

4.3.3 Root treatment

8-day old plants were removed from media and washed with sterile water. For potato and

tomato, roots were submerged in 5 ml of peptide solutions, bacterial suspensions or mock control

and briefly vacuum infiltrated for 5 minutes. Plants with infiltrated roots were transferred into ½

solid Murashige and Skoog basal medium and placed back in the growth chamber. Root tips

were collected at 6 hpi for mRNA extraction and at 72 hpi for callose deposition assay. For

Arabidopsis, roots were soaked in 5 ml of peptide solution or water control until whole root

systems were collected at 6 hpi for mRNA extraction and at 24 hpi for callose deposition assay.

86

4.3.4 Root mRNA extraction, RT-PCR and qRT-PCR analysis for defense gene expression

mRNA was isolated from snap frozen samples using The Dynabeads mRNA DIRECT

Kit (Life Technologies Corporation) according to the manufacturer’s instruction. One microgram

of DNase-treated mRNA was reverse transcribed using ProtoScript II Reverse Transcriptase

(New England Biolabs Inc). qRT-PCR was performed in 20 µl reaction mixture containing 50ng

of cDNA, 10 pmol of each primer, and 1x SYBR Green Supermix (Bio-rad). Primer sequences

(Table 4.2) were retrieved from Nguyen et al. (2010), Jaouannet et al. (2013) and Manosalva et

al. (2015). Thermal cycling conditions for qRT-PCR were 95oC for 3 min followed by 40 cycles

of 95oC for 20 s and 60oC for 40 s. Each reaction was triplicated. We also analyzed the melting

curves at the end of the PCR to ensure the amplification of the unique products. Ubiquitin was

used as the housekeeping gene for data normalization in tomato and potato. UFP was used for

Arabidopsis. The experiments were repeated in at least three independent experiments.

Table 4.2 Primer sequences used to quantify the expression of defense genes.

Primer Primer sequence (5’-3’)

Potato and tomato

ubiquitin_F GAGGGGAGGAATGCAGAT

StUbi_R TCCATCTTCAAGCTGCTTACC

StPR1-1_F TATGCCAACTCAAGAACTGGTG

StPR1-1_R GACCACAACCTAGTCGAACTGA

SlPti5-F ATTCGCGATTCGGCTAGACATGGT

SlPti5-R AGTAGTGCCTTAGCACCTCGCATT

StGras2-1629F CCCTCGATTTCAAGAAGCTCTA

StGras2-1856R CTCAGAGGATACTGGTGGAACC

SlGras2_F TAATCCAAGGGATGAGCTTCT

SlGras2_R CCACCAACGTGACCACCTT

StLrr22-1313F ACCAAAATCACTCGGAACTTGT

StLrr22-1546R CTCCAAGAAGATATCCCCACAG

SlLrr22 AAGATTGGAGGTTGCCATTGGAGC

SlLrr22 ATCGCGATGAATGATCGGTGGAGT

PDF_29066_3F GGCTAGCAAAATCACTTTCTGTG

PDF_29066_166R CATGATCCTTATTTTTGCACCA

SlWrky28_F ACAGATGCAGCTACCTCATCCTCA

87

SlWrky28_R GTGCTCAAAGCCTCATGGTTCTTG

StFLS2_1359F CAAACCTGGCAAACTTGACATA

StFLS2_1509R CAATTTGTTATGCTCGATGGAA

StTPI-1-1_F CTCATGGCACAAAAAGAAAGTG

StTPI-1-1_R CAGCACCCAAGATGTTATCAAA

Arabidopsis

AtUFP-F CCAGCAGACATGGAGGTTTTGGGG

AtUFP-R TGTTGTCTGTCATTTCTTGGCCAGT

AtFRK1-F CCTATTACGCCAAGAAATACGC

AtFRK1-R AAAGGCGATAATGTCCCTTGTA

AtCYP81F2-F GTGAAAGCACTAGGCGAAGC

AtCYP81F2-R ATCCGTTCCAGCTAGCATCA

AtPHI1-fw TTGGTTTAGACGGGATGGTG

AtPHI1-rv ACTCCAGTACAAGCCGATCC

4.3.5 Callose deposition assay

Callose deposition assays for potato, tomato and Arabidopsis roots were modified from

previously described method (Millet et al., 2010). Following peptide and bacterial treatments,

excised roots were fixed in the solution of 3 to 1 ratio of 95% ethanol: acetic acid overnight to

ensure the thorough fixing and clearing of the tissues. Roots were rehydrated in 70% ethanol for

1 h, 50% ethanol for 1 h and distilled water for 1 h. Roots were treated with 10% NaOH for 1.5

h at 37oC to make the tissues transparent, followed by 2 or 3 washes by distilled water. Finally,

roots were incubated in 1% aniline blue dissolved in 150 mM K2HPO4, pH 9.5 for at least 1 h.

The stained roots were mounted on slides for callose observation on Leica DM5500 microscope

under UV light (excitation: 390 nm; emission: 460 nm) and callose spots in at least 6 roots per

treatment were counted using ImageJ software. The experiments were repeated in three

independent experiments.

88

4.4 Results and Discussion

4.4.1 Activation and suppression of defense gene expression in plant roots

To identify whether PTI responses are activated by PAMPs and nonpathogenic bacteria

in potato and tomato roots, we first examined the expression of eight defense genes (Pti5, Gras2,

Lrr22, WRKY28, FLS2, PR1, PR1 (TPI) and PDF1.2) in the roots upon treatments with flagellar

peptides and bacteria using qRT-PCR. Pti5, Gras2, Lrr22 and WRKY28 are the PTI marker

genes that were reported to be induced in tomato leaves upon inoculation with nonpathogens P.

fluorescens strain 0-1 and DC3000 hrcQU (Nguyen et al., 2010). Tomato FLS2 encodes for the

receptor protein that recognizes and physically interacts with flg22 (Meindl et al., 2000). SA-

(PR1 and PR1 (TPI)) or JA-(PDF1.2) responsive genes associated with the SA- and JA-

mediated signaling pathways were also reported in tomato during pathogen infection (Howe et

al., 1996, Van Loon et al., 1994). Due to the close relationship between the two species, the

homologues of these genes also exist in potato.

In tomato, seven of the examined defense genes (only PR1 (TPI) not detected) were

induced in the roots after all four treatments (flg22, flgII-28, P. fluorescens and DC3000 hrcU),

albeit to different extents (Figure 4.1c). Our study revealed the first time that flg22 and flgII-28

were able to trigger defense response in the tomato roots. More importantly, although flgII-28

induced the expression of Pti5, WRKY28 and PR1, it did not induce flg22 receptor FLS2. This is

consistent with the previous report indicating that flgII-28 is not perceived by FLS2, but by

another receptor FLS3 in tomato (Veluchamy et al., 2014). Furthermore, bacteria generally

triggered stronger defense gene expression than the peptides did, indicating that, besides flagellar

peptides, other bacterial PAMPs might be recognized in the tomato roots.

89

In potato, we used the control potato line (Desiree cultivar) overexpressing neutral GFP

gene to test defense gene expression since transgenic potato plants are commonly used in our lab

to study plant-nematode interactions. Most of the examined defense genes were differently

induced in potato roots upon four treatments except for Lrr22 that was not detected, indicating

that most of homologues of tomato defense genes express in potato (Figure 4.1a). Yet, we did

not observe higher defense gene expression upon bacteria treatments compared with flagellin

peptide treatments in potato roots. It is possible that PAMPs other than flagellin peptides might

be recognized differently in potato roots and hence trigger downstream responses independent of

examined defense genes. An alternate possibility is that an undefined T3SS-independent factor

might partially suppress the induced defense gene expression. Indeed, the suppression of PAMP-

activated responses by P. syringae T3SS-independent phytotoxin coronatine was reported in

Arabidopsis roots (Millet et al., 2010) and therefore induced defense gene expression in potato

roots might be suppressed by a similar mechanism. Interestingly, flgII-28 did not induce the

expression of most of the defense genes that are activated by flg22 in potato roots. Although

flgII-28 was demonstrated to be specifically recognized by a number of Solanaceous species,

including some potato cultivars, the fact that variable flgII-28 alleles can elicit ROS differently

on different potato cultivars indicates that the specific flgII-28 allele in this study might not be

recognized in Desiree cultivar (Clarke et al., 2013). Moreover, we also performed this similar

assay on transgenic potato line overexpressing GrCEP12, a secreted effector from G.

rostochiensis that suppresses flg22-mediated defense responses in N. benthamiana leaves

(Chronis et al., 2013; Chen et al, 2013), and observed the suppression of most induced defense

genes by this effector (Figure 4.1b).

90

In Arabidopsis, using -glucuronidase (GUS) reporters, defense responses (including

defense gene expression and callose deposition) were shown to be activated by PAMPs in the

roots but not by P. fluorescens and P. syringae DC3000 hrcU (Millet et al., 2010). In this study,

we utilized flg22 to reassess the expression of defense genes reported in Millet et al.’s study

(CYP71A12, MYB51, WRKY11, AT5G2526) as well as three other defense genes FRK1, CYP81,

PHI1 which have been also used as PTI marker genes in Arabidopsis (Jaouannet et al., 2013;

Boudsocq et al., 2010). We observed the activation of three marker genes FRK1, CYP81 and

PHI1 upon flg22 treatment (Figure 4.1d) but not the genes in Millet et al.’s study, possibly

because of two reasons: i) these genes were shown to be induced specifically in the root

elongation zones, hence the induced expression of these genes might not be apparent in qRT-

PCR assay using mRNA extracted from the whole roots; 2) these genes were found to be induced

by PAMPs at 30 min after flg22 treatment and their activation by PAMPs might not be the same

at 6 hpi as in our assay.

In conclusion, flagellar peptides flg22 and flgII-28 and two nonpathogenic bacteria P.

fluorescens strain 0-1 and P. syringae strain DC3000 hrcU could induce defense gene

expression in the roots of tomato and potato. The differential responsiveness to PAMPs in

defense gene expression between tomato and potato roots might be explained by the variability

in PAMPs of the pathogens and/or PRRs of the host plants, resulting in different downstream

responses; or by the interference in PTI responses by virulence factors that are T3SS-

independent. We also identified three marker genes that were strongly activated by flg22 in

Arabidopsis roots and could be detected by qRT-PCR using whole root systems. Importantly, the

activation of defense genes in potato roots was suppressed by GrCEP12 which is a nematode

secreted effector with a role in host immunity suppression.

91

92

Figure 4.1 Activation and suppression of defense gene expression in plant roots. Potato

and tomato 8-day old roots were infiltrated with 10 uM of flagellar peptides or nonpathogenic

bacteria at OD600 of 1.5. 8-day old Arabidopsis roots were soaked in solution of 1 uM flg22

peptide for 6 hours. In all cases, treated roots were collected at 6 hpi for mRNA extraction.

Quantitative RT-PCR was performed to determine the expression of all indicated defense

genes in treated roots in relative to mock control. All samples were normalized against the

house-keeping gene Ubiquitin (for potato and tomato) and UFP (for Arabidopsis). Values are

means ± standard errors of at least 3 independent experiments with three technical replicates of

each. Bars annotated with an asterisk indicate the significant fold changes compared to mock

control (P<0.05, according to paired Student t-test analysis).

4.4.2 Induction and suppression of callose deposition in plant roots

PAMP- or microbe-activated callose deposition, one of the PTI responses, has been

widely reported in leaves of N. benthamiana, tomato, and Arabidopsis (Adam and Somerville

1996; Hann and Rathjen, 2007; Hauck et al., 2003; Nguyen et al., 2010) but has been only

studied in Arabidopsis roots (Millet et al., 2010). In this study, we examined the induction of

callose deposition in response to flg22, P. fluorescens and DC3000 hrcU. In potato and tomato

roots, callose deposition was induced upon all three treatments (Figure 4.2ab), indicating that

various PTI responses could be activated by PAMPs and microbes in potato and tomato roots. P.

fluorescens, but not P. syringae DC3000 hrcU, induced more callose deposition in the roots

than flg22 did, possibly because of similar reasons that were discussed in the defense gene

expression section. Moreover, GrCEP12 again suppressed the induced callose deposition upon

all treatments although GrCEP12 peptide itself could trigger some extent of defense-associated

callose deposition.

93

94

Figure 4.2 Induction and suppression of callose deposition in plant roots. 8-day old potato

and tomato roots were infiltrated for 5 min with solutions of 10 uM flagellar peptides or cell

suspensions of bacteria at OD600 of 1.5. Treated roots were collected at 72 hpi for callose

deposition assay. 8-day old Arabidopsis roots were soaked in solution of 1 uM flg22 peptide

until roots were collected at 24 hpi for callose assay. Aniline blue stained root tissues were

observed on Leica DM5500 microscope under UV illumination. Callose spots were counted

using ImageJ software. The bars represent the average numbers (from 12-14 roots) of callose

depositions per image (approximately 5 mm2 root surface at 1 cm from the root tips for tomato

and potato, and root elongation zone for Arabidopsis). Error bars represent standard errors.

Bars annotated with an asterisk indicate a significant difference among samples (P < 0.05,

according to paired Student t-test analysis). Similar results were obtained in 3 independent

experiments.

In Arabidopsis, callose deposition was expectedly induced by flg22 in the roots of wild

type plants (Col-0). We also tested flg22-induced callose deposition in transgenic Arabidopsis

overexpressing two nematode secreted effectors Hs10A06 and Hs19C07 from Hererodera

schachtii. Hs10A06 was demonstrated to indirectly suppress basal defense. Arabidopsis

constitutively overexpressing this effector showed an enhanced susceptibility to unrelated

pathogens and the repression of PR marker genes in the SA pathways (Hewezi et al., 2010). On

the other hand, Hs19C07 interacts with auxin influx transporter LAX3 to control feeding site

development (Lee et al., 2011) and no report has shown the involvement of this effector in the

defense suppression. In our root assay, overexpression of Hs10A06 resulted in the suppression of

flg22-induced callose deposition while this was not the case of Hs19C07, which is consistent

with previously reported results (Figure 4.2c).

Taken together, we provided direct evidence that flagellin-derived PAMPs, P.

fluorescens strain 0-1 and P. syringae strain DC3000 hrcU could be recognized in the roots of

95

two important solanaceous crops and activate defense responses. As in plant leaves, we also

observed the differential responsiveness to these PAMPs and bacteria by potato and tomato

roots, which might reflect the coevolution between plants and pathogens. We also showed that

these activated PTI responses in potato and Arabidopsis roots could be suppressed by two

nematode secreted effectors with a characterized role in plant immunity suppression. Except for

flgII-28 that was shown to be differently recognized by potato and tomato roots, flg22 and two

studied bacteria activate strong defense gene expression and callose deposition in the roots of

these two solanaceous plants, hence should be used in PTI assays to study the interference of

root pathogens in potato and tomato basal defense.

96

CHAPTER 5

General discussion and future direction

The overall objective of this thesis was to clone Gr9D09 sequences from Globodera

rostochiensis and characterize the function of this novel effector in nematode parasitism. We

identified four major variants of Gr29D09 in two G. rostochiensis populations RO1 and RO2

that differ in their virulence effects on potato genotypes harboring nematode resistance gene H1.

The four variants showed high polymorphism in their sequences and bear signatures of positive

selection. Although there may be some functional diversification of these effector proteins, the

evidence presented in this thesis suggests that all four major variants of Gr29D09 family

suppress host innate immunity to promote nematode parasitism. First, Gr29D09 expression in the

dorsal esophageal gland cells is dramatically upregulated during parasitic stages, corresponding

with feeding site establishment and maintenance. Second, overexpression of Gr29D09 variants in

potato host plants resulted in increased susceptibility to not only G. rostochiensis, but also to the

unrelated pathogen Streptomyces scabies, indicating that Gr29D09 overexpression compromised

basal defense of potato host to promote nematode parasitism. This compromised basal defense

was shown to be associated with weakened PTI responses because Gr29D09 variants could

suppress P. fluorescens and flg22-mediated basal defense responses in host potato and N.

benthamiana, respectively. Furthermore, Gr29D09 variants also suppress ETI-associated

hypersensitive response triggered by two potato resistance genes R3a and Gpa2 in N.

benthamiana, suggesting that Gr29D09 might target shared components in the downstream

signaling pathways of PTI and ETI. Lastly, Hexokinase 1 and heat shock protein 90, two

candidate potato host targets of Gr29D09-V1 and Gr29D09-V3, play important roles in plant

defense.

97

An increasing number of plant parasitic nematode effectors have been shown to directly

or indirectly suppress host innate immunity (Postma et al., 2012; Chronis et al., 2013; Chen et

al., 2014; Jaouannet et al., 2012; Lozano-Torres et al., 2014; Chen et al., 2015; Ali et al.,

2015ab). Several of these effectors have been reported to indirectly suppress host defense by

interfering with plant metabolism pathways such as polyamine biosynthesis (Hewezi et al.,

2010), redox regulation (Patel et al., 2010) and salicylic acid biosynthesis (Bekal et al.,

2003; Jones et al., 2003; Doyle and Lambert, 2003; Huang et al., 2005a; Vanholme et al., 2009).

These examples suggest that endoparasitic nematodes might manipulate host defense via feeding

cell metabolism modulation.

Ample transcriptomic and metabolomic evidence showed the significant modifications of

host plant metabolism by plant pathogenic bacteria, fungi and nematodes (Truman et al., 2006,

Rico et al., 2011; Parker et al., 2009; Hofmann et al., 2010), indicating that interference with

plant metabolism may be general features of plant pathogens. Furthermore, cross talks between

plant primary metabolisms, including sugar metabolism in particular, and host defense have been

widely reported (reviewed by Truman et al., 2006; Moghaddam et al., 2012; Rojas et al, 2014).

Hexokinase has been identified as a conserved sugar signaling component that not only plays key

role in sugar metabolism but also controls disease resistance and programmed cell death

(Bolouri-Moghaddam et al., 2010; Kim et al., 2006). Plant hexokinases have many isoforms that

are localized in various subcellular compartments, including the cytoplasm, chloroplasts,

mitochondria, and nucleus, which might indicate the versatile functions of this protein family

(Kim et al., 2006). Notably, the hexokinases associated with outer mitochondrial membrane

appeared to play dual roles in glycolysis and program cell death. Overexpression of

mitochondrial hexokinases in Arabidopsis resulted in increased ROS production and defense

98

gene expression (Sarowar et al., 2008). Hexokinase 1 is one of the most likely host targets of

Gr29D09-V1 and Gr29D09-V3. Based on the characterized dual roles of hexokinase in sugar

metabolism and host defense, Gr29D09 might suppress host defense responses through the

potential interference with mitochondrial Hexokinase 1. Moreover, Hexokinase 1 might be a

moving target, as plant tries to avoid suppression of its immune system by diversifying its

virulence targets. If that is the case, functional diversity in host targets might shape the sequence

diversification of Gr29D09 effector family in which new Gr29D09 effectors evolve to match the

evolution of new host targets. Interestingly, Hexokinase 2 was also co-immunoprecipitated in

one repeat with Gr29D09-V3 but not V1, indicating the involvement of different hexokinase

members with Gr29D09 variants.

Another strong host target candidate of Gr29D09 is heat shock protein 90 (HSP90).

HSP90 is a molecular chaperone with universal roles. Interestingly, HSP90 was demonstrated to

stabilize Hexokinase 2 activity in animals (Chae et al., 2013; Zaromytidou et al., 2012). It is

possible that HSP90 might stabilize plant hexokinase and that HSP90 was co-

immunoprecipitated in a protein complex with Hexokinase 1. The other scenario is that HSP90

might interact with an immune signaling component and Gr29D09 may target HSP90 to

indirectly impair that component. Notably, one of the putative Gr29D09-V3-interacting proteins

in potato host is a homologue of the late blight resistance protein R1A which belongs to a

resistance gene family (Ballvora et al., 2002). Because this homologue of R1A was identified in

a nematode susceptible potato cultivar, this resistance gene might represent an intermediate or

weak resistance allele, or a gene duplicate of a functional resistance protein against G.

rostochiensis (Postma et al., 2012). The identification of a resistance protein as a potential

Gr29D09-V3 host target suggests that potato host plants have evolved resistance proteins to

99

recognize Gr29D09 variants as avirulence proteins. If this is the case, diversifying selection in

Gr29D09 effectors could help them avoid being detected by specific resistance proteins.

In the plant-pathogen interactions, plants protect themselves from pathogens with rapidly

changing effectors by diversifying resistance genes. The coevolution between genomes of

pathogens and plants follows the ‘trench warfare model’ or ‘arms race model’. In the trench

warfare model, high genetic diversity at resistance genes and avirulence genes is maintained in

the gene pools of the pathogens and plants by ‘balancing selection’ (May and Anderson, 1983).

For example, four major forms of Avrblb2 are maintained within P. infestans populations,

suggesting the importance of avirulence genes in pathogen fitness in the diversified host

environment (Oliva et al., 2012). In the arms race model, “selective sweeps” leads to the fixation

of selected beneficial alleles and the decrease of variation in R and Avr genes in the host and

pathogen populations (Brown and Wolfe 1990; Brown, 1994). In nature, coevolution of plants

and pathogens does not always follow any one model absolutely but usually stays between

‘trench warfare’ and ‘arms race’ (Bakker et al., 2006). The occurrence of Gr29D09 variants with

relatively similar frequencies in two studied G. rostochiensis populations may reflect the ‘trench

warfare’ model in which G29D09 polymorphic variants are maintained by balancing selection.

However, given that Gr29D09 variant can suppress ETI-mediated by nematode resistance gene

Gpa2 and the potential avirulence activity of two Gr29D09-V3 and Gr29D09-V4 on several wild

potato species may also reflect a molecular arms race.

In Chapter 2, we reported the increased frequency of Gr29D09-V3 in RO2 population

that overcome H1 gene-mediated resistance. The used RO1 and RO2 populations have been

inbred by mass selection from G. rostochiensis field populations maintained on susceptible and

resistant potato cultivar, respectively. Since G. rostochiensis are outcrossing organisms,

100

individuals in the population are genetically heterogeneous. Therefore, the two studied

populations may not be considered pure avirulent or virulent although they have been maintained

for many generations in the lab. Janssen et al. (1990) developed two near isogenic lines of G.

rostochiensis that are derived from a single mating event and differ only in their virulence on H1

harboring potato genotypes. Nematode individuals in these two lines have 100% H1-virulent or

avirulent rate. We performed additional cloning of Gr29D09 sequences to investigate whether

polymorphism in Gr29D09 sequences exists between these two lines. Interestingly, high

frequencies (40 out of 94 genomic sequences) of putative nonfunctional Gr29D09 effectors was

found to be associated with H1-virulent line. These genomic sequences bear 5 bp frameshift

insertion at the end of exon 2 and 60 bp deletion at exon 3 – intron 3 junction (Figure 5.1). The

fact that Gr29D09-V3 and Gr29D09-V4 could be recognized in wild potato species suggests that

this change in genomic sequences might contribute to avoid host recognition. Addition analysis

of Gr29D09 sequences derived from RT-PCR from parasitic nematodes of these two lines

showed the predominance of Gr29D09-V2 and V2-like variants in H1-avirulent line and the

predominance of Gr29D09-V3-related (94-98% identity with V3) and Gr29D09-V4-related (95-

96% identity with V4) variants in H1-virulent line (Figure 5.2, Supplementary figure 5.1 and

5.2). Unfortunately, the H1 gene has not been cloned and we therefore cannot test whether one or

more Gr29D09 variants could be recognized by H1 resistance protein. Given that Gr29D09-V3

and Gr29D09-V4 were shown to have avirulence activity in several wild potato species, it

remains to be determined whether these wild potato species harbor homologues of H1 gene. In

addition, it would be interesting to test the new Gr29D09 variants (V3-related and V4-related)

identified in H1-virulent lines if they can suppress host immunity and induce hypersensitive

response in wild potato species.

101

Figure 5.1 The structural diagrams of Gr29D09 genomic sequences cloned from the US

populations of G. rostochiensis and the putative nonfunctional genomic sequences that were

found to be associated with H1-virulent line from Netherlands. The black marks indicate

inserted or deleted regions.

Figure 5.2 Frequencies of Gr29D09 variants in G. rostochiensis H1-avirulent and virulent

lines

102

Perspectives

Secreted effectors represent potentially important tools in breeding of durable nematode

resistance. Genome of potato cyst nematode G. pallida is now available and the genome

sequencing of G. rostochiensis will be completed soon. Genome-wide catalogue of G. pallida

effectors revealed important effector families and a large collection of novel effectors. These

effector genes could be exploited to screen wild potato accessions for natural resistance

resources and accelerate the identification of new nematode resistance genes. In addition, the

decision of R gene deployment in specific areas could be based on effector profiling in local

nematode populations. Importantly, the fact that Gr29D09 variants and GrSPRYSEC effectors

could suppress plant immunity triggered by the major nematode resistance gene Gpa2 indicates

the importance of nematode effectors functioning as host immunity suppressors in nematode

resistance breeding. Generally, nematode resistance is determined by the presence of effective

nematode resistance genes in potato host and the existence of avirulence genes in most nematode

individuals in the field populations. However, it is likely that the suppression of R gene-mediated

plant immunity by newly evolved effectors would render the resistant potato cultivars

susceptible, despite a match between resistance genes in the plant hosts and the avirulence genes

in the pathogens. Therefore, to efficiently deploy nematode resistance genes, it would be

necessary to monitor nematode effectors which can suppress host immunity triggered by

nematode resistance genes. High throughput assays based on Agrobacterium-mediated transient

expression would be particularly useful in screening and profiling nematode effectors with

potential roles in host immunity suppression. The newly established immunity assays and co-

immunoprecipitation assays that we developed for potato and/or tomato roots would be robust

assays that could contribute to the functional characterization and the identification of host

103

interactors of nematode effectors, especially those with potential host defense suppression

activities.

Supplementary Figure 5.1 Amino acid alignments of Gr29D09-V3 and Gr29D09-V3-related

sequences identified in H1-virulent line.

Supplementary Figure 5.2 Amino acid alignments of Gr29D09-V4 and Gr29D09-V4-related

sequences identified in H1-virulent line.

104

105

REFERENCES

Abad P, Gouzy J, Aury JM, Castagnone-Sereno P, Danchin EGJ, Deleury E, Perfus-Barbeoch L,

Anthouard V, Artiguenave F, Blok VC, Caillaud MC, Coutinho PM, Dasilva C, De Luca F, Deau

F, Esquibet M, Flutre T, Goldstone JV, Hamamouch N, Hewezi T, Jaillon O, Jubin C, Leonetti

P, Magliano M, Maier TR, Markov GV, McVeigh P, Pesole G, Poulain J, Robinson-Rechavi M,

Sallet E, Ségurens B, Steinbach D, Tytgat T, Ugarte E, van Ghelder C, Veronico P, Baum TJ,

Blaxter M, Bleve-Zacheo T, Davis EL, Ewbank JJ, Favery B, Grenier E, Henrissat B, Jones JT,

Laudet V, Maule AG, Quesneville H, Rosso MN, Schiex T, Smant G, Weissenbach J, Wincker

P. 2008. Genome sequence of the metazoan plant-parasitic nematode Meloidogyne incognita.

Nature Biology 26: 909-915.

Adam L, Somerville SC. 1996. Genetic characterization of five powdery mildew disease resistance

loci in Arabidopsis thaliana. Plant Journal 9: 341-356.

Ali S, Magne M, Chen S, Côté O, Stare BG, Obradovic N, Jamshaid L, Wang X, Bélair G, Moffett

P. 2015a. Analysis of putative apoplastic effectors from the nematode, Globodera rostochiensis,

and identification of an expansin-like protein that can induce and suppress host defenses. PLoS

ONE 10: doi: 10.1371/journal.pone.0115042.

Ali S, Magne M, Chen S, Obradovic N, Jamshaid L, Wang X, Bélair G, Moffett P. 2015b. Analysis

of Globodera rostochiensis effectors reveals conserved functions of SPRYSEC proteins in

suppressing and eliciting plant immune responses. Frontiers in Plant Science: doi:

http://dx.doi.org/10.3389/fpls.2015.00623.

Alkharouf NW, Klink VP, Chouikha IB, Beard HS, MacDonald MH, Meyer S, Knap HT, Khan

R, Matthews BF. 2006. Time course microarray analyses reveal global changes in gene

expression of susceptible Glycine max (soybean) roots during infection by Heterodera glycines

(soybean cyst nematode). Planta 224: 838–852.

Allen RL, Bittner-Eddy PD, Grenville-Briggs LJ, Meitz JC, Rehman AP, Rose LE, Beynon JL.

2004. Host-parasite coevolutionary conflict between Arabidopsis and downy mildew. Science

306: 1957-1960.

106

Allen RL, Meitz JC, Baumber RE, Hall SA, Lee SC, Rose LE, Beynon JL. 2008. Natural variation

reveals key amino acids in a downy mildew effector that alters recognition specificity by an

Arabidopsis resistance gene. Molecular Plant Pathology 9: 511-523.

Anderson JP, Gleason CA, Foley RC, Thrall PH, Burdon JB, Singh KB. 2010. Plants versus

pathogens: an evolutionary arms race. Functional Plant Biology 37: 499–512.

Andreote FD, de Araujo WL, de Azevedo JL, van Elsas JD, da Rocha UN, van Overbeek LS. 2009.

Endophytic colonization of potato (Solanum tuberosum L.) by a novel competent bacterial

endophyte, Pseudomonas putida strain P9, and its effect on associated bacterial communities.

Applied and Environmental Microbiology 75: 3396–3406.

Baetz U, Martinoia E. 2014. Root exudates: the hidden part of plant defense. Trends in Plant Science

19(2): 90–98.

Bais HP, Fall R, Vivanco JM. 2004. Biocontrol of Bacillus subtilis against infection of Arabidois

roots by Pseudomonas syringae is facilitated by biofilm formation and surfactin production.

Plant Physiology 134: 307–319.

Bakker EG, Toomajian C, Kreitman M, Bergelson J. 2006. A genome-wide survey of R gene

polymorphisms in Arabidopsis. Plant Cell 18: 1803-1818.

Ballvora A, Ercolano MR, Weiss J, Meksem K, Bormann CA, Oberhagemann P, Salamini F,

Gebhardt C. 2002. The R1 gene for potato resistance to late blight (Phytophthora infestans)

belongs to the leucine zipper/NBS/LRR class of plant resistance genes. Plant Journal 30: 361–

371.

Bekal S, Niblack TL, Lambert KN. 2003. A chorismate mutase from the soybean cyst nematode

Heterodera glycines shows polymorphisms that correlate with virulence. Molecular Plant

Microbe Interactions 16(5): 439-446.

Bendahmane A, Querci M, Kanyuka K, Baulcombe DC. 2000. Agrobacterium transient expression

system as a tool for the isolation of disease resistance genes: application to the Rx2 locus in

potato. Plant Journal 21(1): 73-81.

107

Betka M, Grundler FMW, Wyss U. 1991. Influence of changes in the nurse cell system (syncytium)

on sex determination and development of the cyst nematode Heterodera schachtii: Single amino

acids. Phytopathology 81: 75–79.

Bhattarai KK, Xie QG, Mantelin S, Bishnoi U, Girke T, Navarre DA, Kaloshian I. 2008. Tomato

susceptibility to root-knot nematodes requires an intact jasmonic acid signaling pathway.

Molecular Plant-Microbe Interactions 21: 1205–1214.

Bhattarai KK, Li Q, Liu Y, Dinesh-Kumar SP, Kaloshian I. 2007. The Mi-1-mediated pest resistance

requires Hsp90 and Sgt11. Plant Physiology 144(1): 312–323.

Bird, DM. 1996. Manipulation of host gene expression by root-knot nematodes. Journal of

Parasitology 82(6): 881–888.

Birnbaum MJ. 2004. On the InterAktion between hexokinase and the mitochondrion. Developmental

Cell 7: 781–782.

Boller T, Felix G. 2009. A renaissance of elicitors: Perception of microbe-associated molecular

patterns and danger signals by pattern-recognition receptors. Annual Review of Plant Biology

60: 379-406.

Boller T, He SY. 2009. Innate immunity in plants: An arms race between pattern recognition

receptors in plants and effectors in microbial pathogens. Science 324, 742-743.

Bolouri-Moghaddam MR, Le Roy K, Xiang L, Rolland F, Van den Ende W. 2010. Sugar signaling

and antioxidant network connections in plant cells. FEBS Journal 277: 2022–2037.

Bos JI, Kanneganti TD, Young C, Cakir C, Huitema E, Win J, Armstrong MR, Birch PR, Kamoun S.

2006. The C-terminal half of Phytophthora infestans RXLR effector AVR3a is sufficient to

trigger R3a-mediated hypersensitivity and suppress INF1-induced cell death in Nicotiana

benthamiana. Plant Journal 48: 165–176.

Brodie BB, Evans K, Franco J. 1993. Nematode parasites of potatoes. In: Evans K, Trudgill DL,

Webster JM. Plant parasitic nematodes in temperate agriculture. CAB International, Wallingford,

UK: 87-132.

108

Brodie BB, Mai WF. 1989. Control of the golden cyst nematode in the United States. Annual

Review of Phytopathology 27: 443-461.

Brown JKM, Wolfe MS. 1990. Structure and evolution of populations of Erysiphe graminis f. sp.

hordei. Plant Patholology 39: 376-390.

Brown JKM. 1994. Chance and selection in the evolution of barley mildew. Trends in Microbiology

2: 470-475.

Cannon, OS. 1941. Heterodera schachtii found in a Long Island potato field. Plant Disease Reporter

25: 408.

Carpentier J, Esquibet M, Fouville D, Manzanares-Dauleux MJ, Kerlan MC, Grenier E. 2012. The

evolution of the Gp-Rbp-1 gene in Globodera pallida includes multiple selective replacements.

Chae YC, Angelin A, Lisanti S, Kossenkov AV, Speicher KD, Wang H, Powers JF, Tischler AS,

Pacak K, Fliedner S, Michalek RD, Karoly ED, Wallace DC, Languino LR, Speicher

DW, Altieri DC. 2013. Landscape of the mitochondrial Hsp90 metabolome in tumours. Nature

Communications 4: 2139.

Champouret N. 2010. Effectors and Solanum resistance genes. In: Visser RGF and Jacobsen E, eds.

Functional genomics of Phytophthora infestans. Department of Plant Breeding. Wageningen

University UR, Wageningen, The Netherlands: 43-90.

Chenna R, Sugawara H, Koike T, Lopez R, Gibson TJ, Higgins DG, Thompson JD. 2003. Multiple

sequence alignment with the Clustal series of programs. Nucleic Acids Research 31: 3497-3500.

Chen C , Liu S, Liu Q , Niu J , Liu P, Zhao J, Jian H. 2015. An ANNEXIN-like protein from the

cereal cyst nematode Heterodera avenae suppresses plant defense. PLoS ONE 10(4): doi:

10.1371/journal.pone.0122256.

Chen S, Chronis D, Wang X. 2013. The novel GrCEP12 peptide from the plant-parasitic nematode

Globodera rostochiensis suppresses flg22-mediated PTI. Plant Signal Behavior 8(9).

109

Chen Y, Liu Z, Halterman DA. 2012. Molecular determinants of resistance activation and

suppression by Phytophthora infestans effector IPI-O. PLoS Pathogens 8: doi:

10.1371/journal.ppat.1002595.

Chisholm ST, Coaker G, Day B, Staskawicz BJ. 2006. Host–microbe interactions: shaping the

evolution of the plant immune response. Cell 124: 803-814.

Chitwood DJ. 2003. Research on plant-parasitic nematode biology conducted by the United States

Department of Agriculture - Agricultural Research Service. Pest Management Science 59: 748-

753.

Chronis D, Chen S, Lang P, Tran T, Thurston D, Wang X. 2014a. In vitro nematode infection on

potato plant. Bio-protocol 4(1).

Chronis D, Chen S, Lang P, Tran T, Thurston D, Wang X. 2014b. Potato transformation. Bio-

protocol 4(1).

Chronis D, Chen S, Lu S, Hewezi T, Carpenter SC, Loria R, Baum TJ, Wang X. 2013. A ubiquitin

carboxyl extension protein secreted from a plant-parasitic nematode Globodera rostochiensis is

cleaved in planta to promote plant parasitism. Plant Journal 74(2): 185-196.

Clarke CR, Chinchilla D, Hind SR, Taguchi F, Miki R, Ichinose Y, Martin GB, Leman S, Felix

G, Vinatzer BA. 2013. Allelic variation in two distinct Pseudomonas syringae flagellin epitopes

modulates the strength of plant immune responses but not bacterial motility. New Phytolologist

200: 847–860.

Collier SM, Moffett P. 2009. NB-LRRs work a “bait and switch” on pathogens. Trends Plant

Science 14: 521–529.

Cotton JA, Lilley CJ, Jones LM, Kikuchi T, Reid AJ, Thorpe P, Tsai IJ, Beasley H, Blok V, Cock

PJ, Eves-van den Akker S, Holroyd N, Hunt M, Mantelin S, Naghra H, Pain A, Palomares-Rius

JE, Zarowiecki M, Berriman M, Jones JT, Urwin PE. 2014. The genome and life-stage specific

transcriptomes of Globodera pallida elucidate key aspects of plant parasitism by a cyst

nematode. Genome Biology 15(3): R43.

110

Cristea IM, Williams R, Chait BT, Rout MP. 2005. Fluorescent proteins as proteomic probes.

Molecular and Cellular Proteomics 4(12): 1933-1941.

Davis EL, Husse RS, Mitchum MG, Baum TJ. 2008. Parasitism proteins in nematode-plant

interactions. Current Opinion in Plant Biology 11: 360-366.

Davis EL, Hussey RS, Baum TJ, Bakker J, Schots A, Rosso MN, Abad P. 2000. Nematode

parasitism genes. Annual Review of Phytopathology 38: 365–396.

Davis EL, Hussey RS, Baum TJ. 2004. Getting to the roots of parasitism by nematodes. Trends in

Parasitology 20: 134-141.

De Boer JM, McDermott JP, Davis EL, Hussey RS, Popeijus H, Smant G, Baum TJ. 2002. Cloning

of a putative pectate lyase gene expressed in the subventral esophageal glands of Heterodera

glycines. Journal of Nematology 34: 9-11.

De Boer JM, Yan Y, Bakker J, Davis EL, Baum TJ. 1998. In situ hybridization to messenger RNA

of Heterodera glycines. Journal of Nematology 30: 309-312.

Decraemer W, Geraert E. 2006. Ectoparasitic nematodes. In: Perry RN, Moens M, eds. Plant

Nematology. CAB International, Wallingford, UK: 153–184.

Deslandes L, Olivier J, Peeters N, Feng DX, Khounlotham M, Boucher C, Somssich I, Genin S,

Marco Y. 2003. Physical interaction between RRS1-R, a protein conferring resistance to

bacterial wilt, and PopP2, a type III effector targeted to the plant nucleus. Proceedings of the

National Academy of Science 100: 8024-8029.

Ding X, Shields J, Allen R, Hussey RS. 2000. Molecular cloning and characterization of a venom

allergen AG5-like cDNA from Meloidogyne incognita. International Journal for Parasitology 30:

77-81.

Ding X, Shields J, Allen R, Hussey RS. 1998. A secretory cellulose-binding protein cDNA cloned

from the root-knot nematode (Meloidogyne incognita). Molecular Plant-Microbe Interactions

11(10): 952-959.

111

Dodds PN, Lawrence GJ, Catanzariti AM, Ayliffe MA, Ellis JG. 2004. The Melampsora lini

AvrL567 avirulence genes are expressed in haustoria and their products are recognized inside

plant cells. Plant Cell 16: 755–768

Dodds PN, Lawrence GJ, Catanzariti AM, The T, Wang CI, Ayliffe MA, Kobe B, Ellis JG. 2006.

Direct protein interaction underlies gene-for-gene specificity and coevolution of the flax

resistance genes and flax rust avirulence genes. Proceedings of the National Academy of Science

103: 8888-8893.

Dodds PN, Rathjen JP. 2010. Plant immunity: towards an integrated view of plant-pathogen

interactions. Nature Review Genetics 11: 539–548

Dou D, Kale SD, Wang X, Chen Y, Wang Q, Wang X, Jiang RH, Arredondo FD, Anderson RG,

Thakur PB, McDowell JM, Wang Y, Tyler BM. 2008. Conserved C-terminal motifs required for

avirulence and suppression of cell death by Phytophthora sojae effector Avr1b. Plant Cell 20:

1118-1133.

Downward J. 2003. Metabolism meets death. Nature 424: 896–897.

Doyle EA, Lambert KN. 2003. Meloidogyne javanica chorismate mutase 1 alters plant cell

development. Molecular Plant-Microbe Interactions 162: 123-131.

Dropkin VH. 1969. Cellular responses of plant cells to nematode infections. Annual Review of

Phytopatholology 7: 101-122.

Dubreuil G, Deleury E, Magliano M, Jaouannet M, Abad P, Rosso MN. 2011. Peroxiredoxins from

the plant parasitic root-knot nematode Meloidogyne incognita are required for successful

development within the host. International Journal of Parasitology 41: 385–396.

Edgar RC. 2004. MUSCLE: a multiple sequence alignment method with reduced time and space

complexity. BMC Bioinformatics 5: 113.

Ellenby C. 1952. Resistance to the potato root eelworm, Heterodera rostochiensis Wollenweber.

Nature 170: 1016.

112

Ellis JG, Dodds PN, Lawrence GJ. 2008. Flax rust resistance gene specificity is based on direct

resistance avirulence protein interactions. Annual Review of Phytopathology 45: 289-306.

Emanuelsson O, Brunak S, von Heijne G, Nielsen H. 2007. Locating proteins in the cell using

TargetP, SignalP and related tools. Nature Protocols 2: 953-971.

Ernst K, Kumar A, Kriseleit D, Kloos DU, Phillips MS, Ganal MW. 2002. The broad-spectrum

potato cyst nematode resistance gene (Hero) from tomato is the only member of a large gene

family of NBS-LRR genes with an unusual amino acid repeat in the LRR region. Plant Journal

31: 127–136.

Fabro G, Steinbrenner J, Coates M, Ishaque N, Baxter L, Studholme DJ, Körner E, Allen RL,

Piquerez SJM, Rougon-Cardoso A, Greenshields D, Lei R, Badel JL, Jones JDG. 2011. Multiple

candidate effectors from the oomycete pathogen Hyaloperonospora arabidopsidis suppress host

plant immunity. PLOS Pathogens: doi: 10.1371/journal.ppat.1002348.

Finkers-Tomczak A, Bakker E, de Boer J, van der Vossen E, Achenbach U, Golas T, Suryaningrat

S, Smant G, Bakker J, Goverse A. 2011. Comparative sequence analysis of the potato cyst

nematode resistance locus H1 reveals a major lack of co-linearity between three haplotypes in

potato (Solanum tuberosum ssp.). Theoretical and Applied Genetics 122(3): 595-608.

Fraley C, Meng SX, Osterbauer NK. 2009. Detection of a new Globodera species during surveys of

Oregon seed potato fields for potato cyst nematodes. Poster presented at the 2nd National Plant

Diagnostic Network Meeting, Miami, Florida.

Franco J, Oros R, Main G, Ortuno N, 1998. Potato cyst nematodes (Globodera species) in South

America. In: Marks RJ, Brodie BB, eds. Potato cyst nematodes biology, distribution and control.

CAB International, Wallingford, UK: 239-270.

Gao B, Allen R, Maier T, Davis EL, Baum TJ, Hussey RS. 2001a. Identification of putative

parasitism genes expressed in the esophageal gland cells of the soybean cyst nematode

Heterodera glycines. Molecular Plant-Microbe Interactions 14: 1247-1254.

113

Gao B, Allen R, Maier T, Davis EL, Baum TJ, Hussey RS. 2001b. Molecular characterisation and

expression of two venom allergen-like protein genes in Heterodera glycines. International

Journal for Parasitology 31: 1617-1625.

Maier B, Allen R, Maier T, Davis EL, Baum TJ, Hussey RS. 2003. The parasitome of the

phytonematode Heterodera glycines. Molecular Plant-Microbe Interactions 16(8): 720-726.

Gleason CA, Liu QL, Williamson WM. 2008. Silencing a candidate nematode effector gene

corresponding to the tomato resistance gene Mi-1 leads to acquisition of virulence. Molecular

Plant-Microbe Interactions 21: 576-585.

Gómez-Ariza J, Campo S, Rufat M, Estopà M, Messeguer J, San Segundo B, Coca M.

2007. Sucrose-mediated priming of plant defence responses and broad-spectrum disease

resistance by overexpression of the maize pathogenesis-related PRms protein in rice

plants. Molecular Plant-Microbe Interactions 20: 832-842.

Goto DB, Miyazawa H, Mar JC, Sato M. 2013. Not to be suppressed? Rethinking the host response

at a root-parasite interface. Plant Science 213: 9–17.

Goverse A, Smant G. 2014. The activation and suppression of plant innate immunity by parasitic

nematodes. Annual Review Phytopathology 52: 243-265.

Grundler FMW, Hofmann J. 2011. Water and nutrient transport in nematodes feeding sites. In: Jones

J, Gheysen G, Fenoll C. Genomics and molecular genetics of plant –nematode interactions.

Springer, Netherlands: 423-439.

Guo M, Tian F, Wamboldt Y, Alfano JA. 2009. The majority of the type III effector inventory of

Pseudomonas syringae pv. tomato DC3000 can suppress plant immunity. Molecular Plant-

Microbe Interactions 22: 1069–1080.

Haas BJ, Kamoun S, Zody MC, Jiang RHY, Handsaker RE, Cano LM, Grabherr M, Kodira CD,

Raffaele S, Torto-Alalibo T, Bozkurt TO, Ah-Fong AM, Alvarado L, Anderson VL, Armstrong

MR, Avrova A, Baxter L, Beynon J, Boevink PC, Bollmann SR, Bos JI, Bulone V, Cai G, Cakir

C, Carrington JC, Chawner M, Conti L, Costanzo S, Ewan R, Fahlgren N, Fischbach MA,

Fugelstad J, Gilroy EM, Gnerre S, Green PJ, Grenville-Briggs LJ, Griffith J, Grünwald NJ, Horn

114

K, Horner NR, Hu CH, Huitema E, Jeong DH, Jones AM, Jones JD, Jones RW, Karlsson EK,

Kunjeti SG, Lamour K, Liu Z, Ma L, Maclean D, Chibucos MC, McDonald H, McWalters J,

Meijer HJ, Morgan W, Morris PF, Munro CA, O'Neill K, Ospina-Giraldo M, Pinzón A, Pritchard

L, Ramsahoye B, Ren Q, Restrepo S, Roy S, Sadanandom A, Savidor A, Schornack S, Schwartz

DC, Schumann UD, Schwessinger B, Seyer L, Sharpe T, Silvar C, Song J, Studholme DJ, Sykes

S, Thines M, van de Vondervoort PJ, Phuntumart V, Wawra S, Weide R, Win J, Young C, Zhou

S, Fry W, Meyers BC, van West P, Ristaino J, Govers F, Birch PR, Whisson SC, Judelson HS,

Nusbaum C. 2009. Genome sequence and analysis of the Irish potato famine

pathogen Phytophthora infestans. Nature 461: 393-398.

Hall, SA, Allen RL, Baumber RE, Baxter LA, Fisher K, Bittner-Eddy PD, Rose LE, Holub EB,

Bnon JL. 2009. Maintenance of genetic variation in plants and pathogens involves complex

networks of gene-for-gene interactions. Molecular Plant Pathology 10: 449-457.

Hamamouch N, Li C, Hewezi T, Baum TJ, Mitchum MG, Hussey RS, Vodkin LO, Davis EL. 2012.

The interaction of the novel 30C02 cyst nematode effector protein with a plant β-1,3-

endoglucanase may suppress host defence to promote parasitism. Journal of Experimental

Botany: doi: 10.1093/jxb/ers058.

Handoo ZA, Carta LK, Skantar AM, Chitwood DJ. 2012. Description of Globodera ellingtonae n.

sp. (Nematoda: Heteroderidae) from Oregon. Journal of Nematology 44(1): 40–57.

Hang Y, Chronis D, Lu S, Wang S. 2011. Chorismate mutase: an alternatively spliced parasitism

gene and a diagnostic marker for three important Globodera nematode species. European Journal

of Plant Pathology 129(1): 89-102.

Hann DR, Rathjen JP. 2007. Early events in the pathogenicity of Pseudomonas syringae on

Nicotiana benthamiana. Plant Journal 49: 607-618.

Hauck P, Thilmony R, He SY. 2003. A Pseudomonas syringae type III effector suppresses cell wall-

based extracellular defense in susceptible Arabidopsis plants. Proceedings of the National

Academy of Sciences 100: 8577-8582.

Hawkes JG. 1990. The potato, evolution, biodiversity and genetic resources. Belhaven, London.

115

Hawkes JG. 1958. Significance of wild species and primitive forms for potato breeding. Euphytica

7: 257–270.

Heath MC. 2000. Hypersensitive response-related death. Plant Molecular Biology 44: 321-334.

Hein I, Gilroy EM, Armstrong MR, Birch PRJ. 2009. The zig-zag-zig in oomycete-plant

interactions. Molecular Plant Pathology 10: 547-562.

Henkle-Duhrsen K, Kampkotter A. 2001. Antioxidant enzyme families in parasitic nematodes.

Molecular and Biochemical Parasitology 114: 129–142.

Hewezi T, Howe P, Maier TR, Hussey RS, Mitchum MG, Davis EL, Baum TJ. 2008. Cellulose

binding protein from the parasitic nematode Heterodera schachtii interacts with Arabidopsis

pectin methylesterase: cooperative cell wall modification during parasitism. Plant Cell 20(11):

3080-3093.

Hewezi T, Howe PJ, Maier TR, Hussey RS, Mitchum MG, Davis EL, Baum TJ. 2010. Arabidopsis

spermidine synthase is targeted by an effector protein of the cyst nematode Heterodera schachtii.

Plant Physiology 152(2): 968–984.

Hockland S, Niere B, Grenier E, Blok V, Phillips M, Den Nijs L, Anthoine G, Pickup J, Viane N.

2012. An evaluation of the implications of virulence in non-European populations of Globodera

pallida and G. rostochiensis for potato cultivation in Europe. Nematology 14: 1–13.

Hofmann J, El Ashry AEN, Anwar S, Erban A, Kopka J, Grundler FMW. 2010. Metabolic profiling

reveals local and systemic responses of host plants to nematode parasitism. Plant Journal 62:

1058–1071.

Hofmann J, Hess PH, Szakasits D, Blöchl A, Wieczorek K, Daxböck-Horvath S, Bohlmann H, van

Bel AJE, Grundler FMW. 2009. Diversity and activity of sugar transporters in nematode induced

root syncytia. Journal of Experimental Botany 60: 3065–3095.

Hofmann J, Wieczorek K, Blöchl A, Grundler FMW. 2007. Sucrose supply to nematode-induced

syncytia depends on the apoplasmic and the symplasmic pathway. Journal of Experimental

Botany 58: 1591–1601.

116

Howe GA, Lightner J, Browse J, Ryan CA: An octadecanoid pathway mutant (JL5) of tomato is

compromised in signaling for defense against insect attack. 1996. Plant Cell 8: 2067-2077.

Huang G, Dong R, Allen R, Davis EL, Baum TJ, Hussey RS. 2005a. Two chorismate mutase genes

from the root-knot nematode Meloidogyne incognita. Molecular Plant Pathology 6(1): 23-30.

Huang G, Dong R, Allen R, Davis EL, Baum TJ, Hussey RS. 2006. A root-knot nematode secretory

peptide functions as a ligand for a plant transcription factor. Molecular Plant-Microbe

Interactions 19: 463–470.

Huang GZ, Gao BL, Maier T, Allen R, Davis EL, Baum TJ, Hussey RS. 2003. A profile of putative

parasitism genes expressed in the esophageal gland cells of the root-knot nematode Meloidogyne

incognita. Molecular Plant-Microbe Interactions 16: 376–381.

Huang S, Van Der Vossen EAG, Kuang H, Vleeshouwers VGAA, Zhang N, Borm TJA, Van Eck

HJ, Baker B, Jacobsen E, Visser RGF. 2005b. Comparative genomics enabled the isolation of

the R3a late blight resistance gene in potato. Plant Journal 42: 251–261.

Hubert DA, Tornero P, Belkhadir Y, Krishna P, Takahashi A, Shirasu K, Dangl JL. 2003. Cytosolic

HSP90 associates with and modulates the Arabidopsis RPM1 disease resistance protein. EMBO

Journal 22(21): 5679-5689.

Hussey RS, Mimms CW. 1990. Ultrastructure of esophogeal glands and their secretory granules in

the root-knot nematode Meloidogyne incognita. Protoplasma 162: 99–107.

Hussey, RS. 1989. Disease-inducing secretions of plan-parasitic nematodes. Annual Review of

Phytopathology 27: 123-41.

Ithal N, Recknor J, Nettleton D, Maier T, Baum TJ, Melissa MG. 2007. Developmental transcript

profiling of cyst nematode feeding cells in soybean roots. Molecular Plant-Microbe Interactions

20: 510–525.

Janssen R, Bakker J, Gommers FJ. 1991. Mendelian proof for a gene-for-gene relationship between

virulence of Globodera rostochiensis and the H1 resistance gene in Solanum tuberosum ssp.

andigena CPC 1673. Revue de Nematologie 14: 213-219.

117

Jaouannet M, Magliano M, Arguel MJ, Gourgues M, Evangelisti E, Abad P, Rosso MN. 2013. The

root-knot nematode calreticulin Mi–CRT is a key effector in plant defense suppression.

Molecular Plant-Microbe Interactions 26: 97-105.

Jaubert S, Laffaire JB, Abad P, Rosso MN. 2002. A polygalacturonase of animal origin isolated from

the root-knot nematode Meloidogyne incognita. FEBS Letters 522: 109–112.

Jia Y, McAdams SA, Bryan GT, Hershey HP, Valent B. 2000. Direct interaction of resistance gene

and avirulence gene products confers rice blast resistance. EMBO Journal 19: 4004-4014

Jiang RHY, Tripathy S, Govers F, Tyler BM. 2008. RXLR effector reservoir in two Phytophthora

species is dominated by a single rapidly evolving superfamily with more than 700 members.

Proceedings of the National Academy of Sciences USA 105: 4874-4879.

Jones JD, Dangl JL. 2006. The plant immune system. Nature 444 (7117): 323-329.

Jones JT, Furlanetto C, Bakker E, Banks B, Blok V, Chen Q, Phillips M, Prior A. 2003.

Characterization of a chorismate mutase from the potato cyst nematode Globodera pallida.

Molecular Plant Pathology 4(1): 43-50.

Jones JT, Haegeman A, Danchin EGJ, Gaur HS, Helder J, Jones MGK, Kikuchi T, Manzanilla-lópez

R, Palomares-Rius JE, Wesemaeland WML, Perry RN. 2013. Top 10 plant-parasitic nematodes

in molecular plant pathology. Molecular Plant Pathology 14(9): 946–961.

Jones JT, Kumar A, Pylypenko LA, Thirugnanasambandam A, Castelli L, Chapman S, Cock PJA,

Grenier E, Lilley CJ, Phillips MS, Blok VC. 2009. Identification and functional characterization

of effectors in expressed sequence tags from various life cycle stages of the potato cyst nematode

Globodera pallida. Molecular Plant Pathology 10: 815-828.

Jones MGK, Dropkin VH. 1975. Cellular alterations induced in soybean by three endoparasitic

nematodes. Physiological Plant Pathology 5: 119-124.

Jones MGK, Northcote DH. 1972. Nematode induced syncytium - a multinucleate transfer cell.

Journal of Cell Science 10: 789-809.

118

Jones MGK. 1981. Host cell responses to endoparasitic nematode attack: Structure and function of

giant cells and syncytia. Annual Applied Biology 97: 353-372.

Jones, FGW. 1970. The control of the potato cyst-nematode. Journal of Royal Society of Arts 118:

179-99

Kaloshian I, Desmond OJ, Atamian HS. 2011. Disease resistance-genes and defense responses

during incompatible interactions. In: Jones J, Gheysen G, Fenoll C. Genomics and

molecular genetics of plant –nematode interactions. Springer, Netherlands: 309-324.

Kamoun S, Segretin ME, Schornack S. 2012. Late blight resistance genes. Patent number WO

2013/009935 A2.

Kandoth PK, Mitchum MG. 2013. War of the worms: how plants fight underground attacks. Current

Opinion in Plant Biology 16: 457–463.

Kikuchi T, Cotton JA, Dalzell JJ, Hasegawa K, Kanzaki N, McVeigh P, Takanashi T, Tsai IJ, Assefa

SA, Cock PJA, Otto TD, Hunt M, Reid AJ, Sanchez-Flores A, Tsuchihara K, Yokoi T, Larsson

MC, Miwa J, Maule AG, Sahashi N, Jones JT, Berriman M. 2011. Genomic insights into the

origin of parasitism in the emerging plant pathogen Bursaphelenchus xylophilus. PLOS

Pathogens 7(9): doi: 10.1371/journal.ppat.1002219.

Kim M, Lim JH, Ahn CS, Park K, Kim GT, Kim WT, Pai HS. 2006. Mitochondria-associated

hexokinases play a role in the control of programmed cell death in Nicotiana benthamiana. Plant

Cell 18(9): 2341–2355.

Knoche K, Parke J, Durbin R. 1994. Relationship of Pseudomonas syringae pv. tabaci races to the

rhizosphere of Wisconsin-grown tobacco. Plant and Soil 158(1): 91-97.

Krasileva KV, Dahlbeck D, Staskawicz BJ. 2010. Activation of an Arabidopsis resistance protein is

specified by the in planta association of its leucine-rich repeat domain with the cognate oomycete

effector. Plant Cell 22: 2444-2458.

119

Krogh A, Larsson B, Von Heijne G, Sonnhammer ELL. 2001. Predicting transmembrane protein

topology with a hidden Markov model: Application to complete genomes. Journal of Molecular

Biology 305: 567-580.

Kudla U, Milac AL, Qin L, Overmar H, Roze E, Holterman M, Petrescu AJ, Goverse A, Bakker J,

Helder J, Smant G. 2007. Structural and functional characterization of a novel, host penetration-

related pectate lyase from the potato cyst nematode Globodera rostochiensis. Molecular Plant

Pathology 8: 293-305.

Kyndt T, Vieira P, Gheysen G, de Almeida-Engler J. 2013. Nematode feeding sites: unique organs in

plant roots. Planta 238: 807–18.

Lakshmanan V, Kitto SL, Caplan JL, Hsueh Y, Kearns DB, Wu Y, Bais HP. 2012. Microbe-

associated molecular patterns – triggered root responses mediate beneficial recruitment in

Arabidopsis. Plant Physiology 160: 1642-1661.

Lambert KN, Bekal S, Domier LL, Niblack TL, Noel GR, Smyth CA. 2005. Selection of Heterodera

glycines chorismate mutase-1 alleles on nematode-resistant soybean. Molecular Plant Microbe

Interactions 18(6): 593-601.

Lambert KN, Ferrie BJ, Nombela G, Brenner ED, Williamson VM. 1999a. Identification of genes

whose transcripts accumulate rapidly in tomato after root-knot nematode infection. Physiological

and Molecular Plant Pathology 55: 341–348.

Lambert KN, Allen KD, Sussex IM. 1999b. Cloning and characterization of an esophageal-gland-

specific chorismate mutase from the phytoparasitic nematode Meloidogyne javanica. Molecular

Plant-Microbe Interactions 12(4): 328-336.

Lee C, Chronis D, Kenning C, Peret B, Hewezi T, Davis EL, Baum TJ, Hussey R, Bennett M,

Mitchum MG. 2011. The novel cyst nematode effector protein 19C07 interacts with the

Arabidopsis auxin influx transporter LAX3 to control feeding site development. Plant

Physiology 155(2): 866–880.

120

Li Z, Liu X, Chu Y, Wang Y, Zhang Q, Zhou X. 2011. Cloning and characterization of a 2-Cys

peroxiredoxin in the pine wood nematode Bursaphelenchus xylophilus, a putative genetic factor

facilitating the infestation. International Journal of Biological Sciences 7: 823–836.

Liu Y, Burch-Smith T, Schiff M, Feng S, Dinesh-Kumar SP. 2004. Molecular chaperone Hsp90

associates with resistance protein N and its signaling proteins SGT1 and Rar1 to modulate an

innate immune response in plants. Journal of Biological Chemistry 279(3): 2101-2108.

Liu Z, Bos JIB, Armstrong M, Whisson SC, da Cunha L, Torto-Alalibo T, Win J, Avrova AO,

Wright F, Birch PRJ, Kamoun S. 2005. Patterns of diversifying selection in the phytotoxin-like

scr74 gene family of Phytophthora infestans. Molecular Biology Evolution 22 (3): 659-672.

Lloyd SR, Schoonbeek HJ, Trick M, Zipfel C, Ridout CJ. 2014. Methods to study PAMP-triggered

immunity in Brassica species. Molecular Plant-Microbe Interactions 27(3): 286-295

Lozano-Torres JL, Wilbers RHP, Warmerdam S, Finkers-Tomczak A, Diaz-Granados A, van Schaik

CC, Helder J, Bakker J, Goverse A, Schots A, Smant G. 2014. Apoplastic venom allergen-like

proteins of cyst nematodes modulate the activation of basal plant innate immunity by cell surface

receptors. PLOS Pathogens 10(12).

Lozano-Torres JL, Wilbers RHP, Gawronski P, Boshoven JC, Finkers-Tomczak , Cordewener

JHG, America AHP, Overmars HA, Klooster JWV, Baranowski L, Sobczak M, Ilyas M, van der

Hoorn RAL, Schots A, de Wit PJGM , Bakker J, Goverse A , Smant G. 2012. Dual disease

resistance mediated by the immune receptor Cf-2 in tomato requires a common virulence target

of a fungus and a nematode. Proceedings of the National Academy of Science 109(25): 10119–

10124.

Lu SW, Chen S, Wang J, Yu H, Chronis D, Mitchum MG, Wang X. 2009. Structural and functional

diversity of CLAVATA3/ESR(CLE)-like genes from the potato cyst nematode Globodera

rostochiensis. Molecular Plant-Microbe Interactions 22: 1128-1142.

Lu SW, Tian D, Borchardt-Wier HB, Wang X. 2008. Alternative splicing: a novel mechanism of

regulation identified in the chorismate mutase gene of the potato cyst nematode Globodera

rostochiensis. Molecular and Biochemical Parasitology 162: 1–15.

121

Ma W, Guttman DS. 2008. Evolution of prokaryotic and eukaryotic virulence effectors. Current

Opininion in Plant Biology 11: 412–419.

Machida-Hirano. 2015. Diversity of potato genetic resources. Breeding Science 65: 24-40.

Mai WF, Lownsbery BF. 1948. Crop rotation in relation to the golden nematode population of the

soil. Phytopathology 42: 345-347.

Mai, WF. 1977. Worldwide distribution of potato cyst nematodes and their importance in crop

production. Journal of Nematology 9(1): 30-34.

Majewski N, Noqueira V, Bhaskar P, Coy PE, Skeen JE, Gottlob K, Chandel NS, Thompson CB,

Robey RB, Hay N. 2004. Hexokinase-mitochondria interaction mediated by Akt is required to

inhibit apoptosis in the presence or absence of Bax and Bak. Molecular Cell 16: 819–830.

Manosalva P, Manohar M, von Reuss SH, Chen S, Koch A, Kaplan F, Choe A, Micikas RJ, Wang

X, Kogel KH, Sternberg PW, Williamson VM, Schroeder FC, Klessig DF. 2015. Conserved

nematode signalling molecules elicit plant defenses and pathogen resistance. Nature

Communications 6: 7795.

Marcel S, Sawers R, Oakeley E, Angliker H, Paszkowski U. 2010. Tissue-adapted invasion

strategies of the rice blast fungus Magnaporthe oryzae. The Plant Cell 22(9): 3177-3187.

Meindl T, Boller T, Felix G. 2000. The bacterial elicitor flagellin activates its receptor in tomato

cells according to the address-message concept. Plant Cell 12: 1783–1794.

Mendoza HA. 1987. Advances in population breeding and its potential impact on the efficiency of

breeding potatoes for the developing countries. The Production of New Potato Varieties -

Technological Advances, 235-246.

Millet YA, Danna CH, Clay NK, Songnuan W, Simon MD, Daniele Werck-Reichart D, and Ausubel

FM. 2010. Innate Immune responses activated in Arabidopsis roots by microbe-associated

molecular patterns. Plant Cell 22: 973-990.

122

Moghaddam MRB, Van den Ende W. 2012. Sugars and plant innate immunity. Journal of

Experimental Botany: 1-10.

Nguyen HP, Chakravarthy S, Velásquez AC, McLane HL, Zeng L, Nakayashiki H, Park

DH, Collmer A, Martin GB. 2010. Methods to study PAMP-triggered immunity using tomato

and Nicotiana benthamiana. Molecular Plant-Microbe Interactions 23(8): 991-999.

Nicol JM, Turner SJ, Coyne DL, den Nijs L, Hockland S, Tahna Maafi Z. 2011. Current nematode

threats to world agriculture. In: Jones J, Gheysen G, Fenoll C. Genomics and

molecular genetics of plant –nematode interactions. Springer, Netherlands: 21–43.

Oliva RF, Cano LM, Raffaele S, Win J, Bozkurt TO, Belhaj K, Oh SK, Thines M, Kamoun S. 2015.

A recent expansion of the RXLR effector gene Avrblb2 is maintained in global populations of

Phytophthora infestans indicating different contributions to virulence. Molecular Plant-Microbe

Interactions 28(8): 901-912.

Opperman CH, Bird DM, Williamson VM, Rokhsar DS, Burke M, Cohn J, Cromer J, Diener S,

Gajan J, Graham S, Houfek TD, Liu Q, Mitros T, Schaff J, Schaffer R, Scholl E, Sosinski BR,

Thomas VP, Windham E. 2008. Sequence and genetic map of Meloidogyne hapla: A compact

nematode genome for plant parasitism.

Paal J, Henselewski H, Muth J, Meksem K, Menéndez CM, Salamini F, Ballvora A, Gebhardt C.

2004. Molecular cloning of the potato Gro1-4 gene conferring resistance to pathotype RO1 of

the root nematode Globodera rostochiensis, based on a candidate gene approach. Plant Journal

38: 285-297.

Parker D, Bechmann M, Zubair H, Enot DP, Caracuel-Rios Z, Overy DP, Snowdon S, Talbot NJ,

Draper J. 2009. Metabolic analysis reveals a common pattern of metabolic re-programming

during invasion of three host plant species by Magnaporthe grisea. Plant Journal 59: 723-737.

Pastorino JG, Shulga N, Hoek JB. 2002. Mitochondrial binding of hexokinase II inhibits Bax-

induced cytochrome c release and apoptosis. Journal of Biological Chemistry 1: 7610-7618.

123

Patel N, Hamamouch N, Li C, Hewezi T, Hussey RS, Baum TJ, Mitchum MG, Davis EL. 2010. A

nematode effector protein similar to annexins in host plants. Journal of Experimental Botany 61:

235-248.

Popeijus H, Overmars H, Jones J, Blok V, Goverse A, Helder J, Schots A, Bakker J, Smant G. 2000.

Enzymology: Degradation of plant cell walls by a nematode. Nature 406: 36-37.

Postma WJ, Slootweg EJ, Rehman S , Finkers-Tomczak A, Tytgat TOG , van Gelderen K, Lozano-

Torres JL, Roosien J, Pomp R, van Schaik C, Bakker J, Goverse A, Smant G. 2012. The effector

SPRYSEC-19 of Globodera rostochiensis suppresses CC-NB-LRR-mediated disease resistance

in plants. Plant Physiology 160: 944–954.

Puthoff DP, Nettleton D, Rodermel SR, Baum TJ. 2003. Arabidopsis gene expression changes

during cyst nematode parasitism revealed by statistical analyses of microarray expression

profiles. Plant Journal 33: 911–921.

Qin L, Kudla U, Roze EHA, Goverse A, Popeijust H, Nieuwland J, Overmars H, Jones JT, Schots A,

Smant G, Bakker J, Helder J. 2004. A nematode expansin acting on plants. Nature 427: 30.

Qin L, Overmars B, Helder J, Popeijus H, van der Voort JR, Groenink W, van Koert P, Schots A,

Bakker J, Smant G. 2000. An efficient cDNA-AFLP-based strategy for the identification of

putative pathogenicity factors from the potato cyst nematode Globodera rostochiensis.

Molecular Plant-Microbe Interactions 13(8): 830-836.

Raffaele S, Farrer RA, Cano LM, Studholme DJ, MacLean D, Thines M, Jiang RHY, Zody MC,

Kunjeti SG, Donofrio NM, Meyers BC, Nusbaum C, Kamoun S. 2010. Genome evolution

following host jumps in the Irish potato famine pathogen lineage. Science 330(6010): 1540-

1543.

Rawsthorne D, Brodie BB. 1987. Movement of potato root diffusate through soil. Journal of

Nematololgy 19(1): 119-122.

Rawsthorne D, Brodie BB. 1986. Root growth of susceptible and resistant potato cultivars and

population dynamics of Globodera rostochiens is in the field. Journal of Nematology 18: 501-

504.

124

Rehman S, Butterbach P, Popeijus H, Overmars H, Davis EL, Jones JT, Goverse A, Bakker J, Smant

G. 2009. Identification and characterization of the most abundant cellulases in stylet secretions

from Globodera rostochiensis. Phytopathology 99: 194-202.

Rehman S, Postma W, Tytgat T, Prins P, Qin L, Overmars H, Vossen J, Spiridon LN, Petrescu AJ,

Goverse A, Bakker J, Smant G. 2009. A secreted SPRY domain-containing protein (SPRYSEC)

from the plant-parasitic nematode Globodera rostochiensis interacts with a CC-NBLRR protein

from a susceptible tomato. Molecular Plant-Microbe Interactions 22: 330-340.

Replogle AJ, Wang J, Paolillo V, Smeda J, Kinoshita A, Durbak A, Tax FE, Wang X, Sawa

S, Mitchum MG. 2012. Synergistic interaction of Clavata1, Clavata2, and receptor-like protein

kinase 2 in cyst nematode parasitism of Arabidopsis. Molecular Plant-Microbe Interactions

26(1): 87-96.

Rico A, McCraw SL, Preston GM. 2011. The metabolic interface between Pseudomonas syringae

and plant cells. Current Opinion in Microbiology 14: 31–38.

Robertson L, Robertson WM, Sobczak M, Helder J, Tetaud E Ariyanayagam MR, Ferguson MA,

Fairlamb A, Jones JT. 2000. Cloning, expression and functional characterisation of a

peroxiredoxin from the potato cyst nematode Globodera rostochiensis. Molecular and

Biochemical Parasitology 111: 41–49.

Rohmer L, Guttman DS, Dangl JL. 2004. Diverse evolutionary mechanisms shape the type III

effector virulence factor repertoire in plant pathogenic Pseudomonas syringae. Genetics 167:

1341-1360.

Rojas CM, Senthil-Kumar M, Tzin V, Mysore KS. 2014. Regulation of primary plant metabolism

during plant-pathogen interactions and its contribution to plant defense. Frontiers in Plant

Science 5: doi: 10.3389/fpls.2014.00017.

Rolland F, Sheen J, 2005. Sugar sensing and signaling networks in plants. Biochemical Society

Transaction 33: 269–271.

125

Rutter WB, Hewezi T, Abubucker S, Maier TR, Huang G, Mitreva M, Hussey RS, Baum TJ. 2014.

Mining novel effector proteins from the esophageal gland cells of Meloidogyne incognita.

Molecular Plant-Microbe Interactions 27(9): 965-974.

Sacco MA, Koropacka K, Grenier E, Jaubert MJ, Blanchard A, Goverse A, Smant G, Moffett P.

2009. The cyst nematode SPRYSEC protein RBP-1 elicits Gpa2- and RanGAP2-dependent plant

cell death. PLoS Pathogens 5: doi: 10.1371/journal.ppat.1000564.

Sarkar SF, Gordon JS, Martin GB, Guttman DS. 2006. Comparative genomics of host-specific

virulence in Pseudomonas syringae. Genetics 174: 1041-1056.

Sarowar S, Lee JY, Ahn ER, Pai HS. 2008. A role of hexokinases in plant resistance to oxidative

stress and pathogen infection. Journal of Plant Biology 51(5): 341-346.

Schulze-Lefert P. 2004. Plant Immunity: the origami of receptor activation. Current Biology 14:

R22-R24.

Scofield SR, Tobias CM, Rathjen JP, Chang JH, Lavelle DT, Michelmore RW, Staskawicz BJ. 1996.

Molecular basis of gene-for-gene specificity in bacterial speck disease of tomato. Science 274:

2063-2065.

Segonzac C, Feike D, Gimenez-Ibanez S, Hann DR, Zipfel C, Rathjen JP. 2011. Hierarchy and roles

of pathogen-associated molecular pattern-induced responses in Nicotiana benthamiana. Plant

Physiology 156: 687-699.

Skantar AM, Handoo ZA, Carta LK, Chitwood DJ. 2007. Morphological identification of Globodera

pallida associated with potato in Idaho. Journal of Nematology 27: 493-494.

Skantar AM, Handoo ZA, Zasada IA, Ingham RE, Carta LK, Chitwood DJ. 2011. Morphological

and molecular characterization of Globodera populations from Oregon and Idaho.

Phytopathology 101(4): 480-491.

Smant G, Stokkermans JPWG, Yan Y, De Boer JM, Baum TJ, Wang X, Hussey RS, Gommers FJ,

Henrissat B, Davis EL, Helder J, Schots A, Bakker J. 1998. Endogenous cellulases in animals:

Isolation of β-1,4-endoglucanase genes from two species of plant-parasitic cyst nematodes.

126

Proceedings of the National Academy of Sciences of the United States of America 95: 4906-

4911.

Solfanelli C, Poggi A, Loreti E, Alpi A, Perata P. 2006. Sucrose-specific induction of the

anthocyanin biosynthetic pathway in Arabidopsis. Plant Physiology 140: 637-646.

Spears JF, Mai WF, Betz DO. 1956. A case history of the persistence of Heterodera rostochiensis

Wollenweber in a treated field. Plant Disease Reporter 40: 632-634.

Spears JF. 1968. The golden nematode handbook: survey, laboratory, control and quarantine

procedures. Agriculture Handbook, USDA-ARS: 353.

Sperschneider J, Ying H, Dodds PN, Gardiner DM, Upadhyaya NM, Singh KB, Manners JM, Taylor

JM. 2014. Diversifying selection in the wheat stem rust fungus acts predominantly on pathogen-

associated gene families and reveals candidate effectors. Frontiers in Plant Science 5: 372.

Stergiopoulos I, De Kock MJ, Lindhout P, De Wit PJ. 2007. Allelic variation in the effector genes of

the tomato pathogen Cladosporium fulvum reveals different modes of adaptive evolution.

Molecular Plant-Microbe Interactions 20(10): 1271-1283.

Stukenbrock EH, McDonald BA. 2007. Geographical variation and positive diversifying selection in

the host-specific toxin SnToxA. Molecular Plant Pathology 8(3): 321-332.

Sun F, Miller S, Wood S, Cote MJ. 2007. Occurrence of potato cyst nematode, Globodera

rostochiensis, on potato in the Saint-Amable region, Quebec, Canada. Plant Disease 91: 108.

Szakasits D, Heinen P, Wieczorek K, Hofmann J, Wagner F, Kreil DP, Sykacek P, Grundler FM,

Bohlmann H. 2009. The transcriptome of syncytia induced by the cyst nematode Heterodera

schachtiiin Arabidopsis roots. Plant Journal 57: 771–784.

Tasset C, Bernoux M, Jauneau A, Pouzet C, Briére C, Kieffer-Jacquinod S, Rivas S, Marco Y,

Deslandes L. 2010. Autoacetylation of the Ralstonia solanacearum effector PopP2 targets a

lysine residue essential for RRS1-R-mediated immunity in Arabidopsis. PLoS Pathogens 6.

127

Thibaud MC, Gineste S, Nussaume L, Robaglia C. 2004. Sucrose increases pathogenesis-related PR-

2 gene expression in Arabidopsis thaliana through an SA-dependent but NPR1-independent

signaling pathway. Plant Physiology and Biochemistry 42: 81-88.

Thorpe P, Mantelin S, Cock PJ, Blok VC, Coke MC, Eves-van den Akker S, Guzeeva E, Lilley

CJ, Smant G, Reid AJ, Wright KM, Urwin PE, Jones JT. 2014. Genomic characterization of the

effector complement of the potato cyst nematode Globodera pallida. BMC Genomics 23: 15-923.

Tomczak A, Koropacka K, Smant G, Goverse A, Bakker E. 2009. Resistant plant responses. In: Berg

RH, Taylor CG, eds. Plant cell monographs. Springer, Berlin: 83–113.

Truman W, de Zabala MT, Grant M. 2006. Type III effectors orchestrate a complex interplay

between transcriptional networks to modify basal defence responses during pathogenesis and

resistance. Plant Journal 46: 14–33.

Tsuda K, Katagiri F. 2010. Comparing signaling mechanisms engaged in pattern-triggered and

effector-triggered immunity. Current Opinions in Plant Biology13(4): 459-465.

Turner SJ, Rowe JA. 2006. Cyst nematodes. In: Perry RN, Moens M, eds. Plant Nematology. CAB

International, Wallingford, UK: 90–122.

van der Hoorn RA, Kamoun S. 2008. From guard to decoy: a new model for perception of plant

pathogen effectors. Plant Cell 20: 2009–2017.

van der Vossen EAG, van der Voort JNAM, Kanyuka K, Bendahmane A, Sandbrink H, Baulcombe

DC, Bakker J, Stiekema, Klein-Lankhorst RM. 2000. Homologues of a single resistance-gene

cluster in potato confer resistance to distinct pathogens: a virus and a nematode. Plant Journal 23:

567–576.

Vanholme B, Kast P, Haegeman A, Jacob J, Grunewald W, Gheysen G. 2009. Structural and

functional investigation of a secreted chorismate mutase from the plant-parasitic nematode

Heterodera schachtii in the context of related enzymes from diverse origins. Molecular Plant

Pathology 10(2): 189-200.

128

Vanholme B, Van Thuyne W, Vanhouteghem K, De Meutter JAN, Cannoot B, Gheysen G. 2007.

Molecular characterization and functional importance of pectate lyase secreted by the cyst

nematode Heterodera schachtii. Molecular Plant Pathology 8: 267-278.

Van Loon LC, Pierpoint WS, Boller T, ConejeroV. 1994. Recommendations for naming plant

pathogenesis-related proteins. Plant Molecular Biology Reporter 12: 245.

Veluchamy S, Hind SR, Dunham DM, Martin GB, Panthee DR. 2014. Natural variation for

responsiveness to flg22, flgII-28,and csp22 and Pseudomonas syringae pv. tomato in Heirloom

Tomatoes. PLOS ONE 9: e106119.

Vleeshouwers VGAA, Oliver RP. 2014. Effectors as tools in disease resistance breeding against

biotrophic, hemibiotrophic, and necrotrophic plant pathogens. Molecular Plant-Microbe

Interactions 27(3): 196–206.

Wang Q, Han C, Ferreira AO, Yu X, Ye W, Tripathy S, Kaleb SD, Gub B, Shenga Y, Suia

Y, Wanga X, Zhanga Z, Chenga B, Donga S, Shanc W, Zhenga X, Dou D, Tylerb BM, Wang Y.

2011. Transcriptional programming and functional interactions within the Phytophthora sojae

RXLR effector repertoire. Plant Cell 23: 2064–2086.

Wang X, Allen R, Ding X, Goellner M, Maier T, de Boer JM, Baum TJ, Hussey RS, Davis EL.

2001. Signal peptide-selection of cDNA cloned directly from the esophageal gland cells of the

soybean cyst nematode Heterodera glycines. Molecular Plant–Microbe Interactions 14: 536–544.

Wang X, Mitchum MG, Gao B, Li C, Diab H, Baum TJ, Hussey RS, Davis EL. 2005. A parasitism

gene from a plant-parasitic nematode with function similar to CLAVATA3/ESR (CLE) of

Arabidopsis thaliana. Molecular Plant Pathology 6(2): 187-191.

Weis C, Pfeilmeier S, Glawischnig E, Isono E, Pachl F, Hahne H, Kuster B, Eichmann

R, Hückelhoven R. 2013. Co-immunoprecipitation-based identification of putative BAX

INHIBITOR-1-interacting proteins involved in cell death regulation and plant-powdery mildew

interactions. Molecular Plant Pathology 14(8): 791-802.

Whisson SC, Boevink PC, Moleleki L, Avrova AO, Morales JG, Gilroy EM, Armstrong MR,

Grouffaud S, van West P, Chapman S, Hein I, Toth IK, Pritchard L, Birch PR. 2007. A

129

translocation signal for delivery of oomycete effector proteins into host plant cells. Nature 450:

115-118..

Win J, Kamoun S. 2008. Adaptive evolution has targeted the C-terminal domain of the RXLR

effectors of plant pathogenic oomycetes. Plant Signaling & Behavior 3(4): 251-253.

Win J, Morgan W, Bos J, Krasileva KV, Cano LM, Chaparro-Garcia A, Ammar R, Staskawicz BJ,

Kamoun S. 2007. Adaptive evolution has targeted the C-terminal domain of the RXLR effectors

of plant pathogenic oomycetes. Plant Cell 19: 2349-2369.

Wyss U, Grundler FMW, Munch A. 1992. The parasitic behavior of second-stage juveniles of

Meloidogyne incognita in roots of Arabidopsis thaliana. Nematologica 38: 98–111.

Wyss U, Zunke U. 1986. Observations on the behaviour of second stage juveniles of Heterodera

schachtii inside host roots. Revue de Nematologie 9(2): 153-165.

Yang Z, Nielsen R. 2000. Estimating synonymous and nonsynonymous substitution rates under

realistic evolutionary models. Molecular Biology and Evolution 17: 32-43.

Yang, Z., Wong, W.S.W., and Nielsen, R.(2005). Bayes empirical Bayes inference of amino acid

sites under positive selection. Molecular Biology and Evolution 22, 1107-1118.

Zaromytidou AI. 2012. Chaperoning tumour bioenergetics. Nature Cell Biology 14 (11): 1129.

Zipfel C, Robatzek S, Navarro L, Oakeley EJ, Jones JDG, Felix G, Boller T. 2004. Bacterial disease

resistance in Arabidopsis through flagellin perception. Nature 428(6984): 764-767.

Zipfel C. 2008. Pattern-recognition receptors in plant innate immunity. Current Opinions in

Immunology 20(1): 10-16.